Primers pair, target and application of PCR detection of alternaria porri

By designing primer pairs and targets specific to Alternaria marinum for PCR detection, the problem of long detection time in existing technologies for Alternaria marinum has been solved, realizing a rapid and sensitive detection method that supports the early prevention and control of marigold leaf spot disease.

CN122168789APending Publication Date: 2026-06-09CHENGUANG BIOTECH GRP CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610440492.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-03
Publication Date
2026-06-09

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to the technical field of biology, and in particular discloses a PCR detection primer pair of Alternaria porri, a target and application thereof.The present application provides a PCR detection primer pair of Alternaria porri, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1-2.After PCR amplification of DNA of a to-be-tested sample is carried out by using the primer pair of the present application, and then whether specific bands appear or not is observed by combining with gel electrophoresis, it can be determined whether Alternaria porri is contained in the to-be-tested sample or not.The primer has high specificity and good sensitivity, can rapidly detect the presence of Alternaria porri in a sample, and can provide a reference for early inspection and quarantine and early prevention and treatment of Alternaria porri leaf spot.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to primer pairs, targets, and applications for the PCR detection of Alternaria marigold. Background Technology

[0002] Marigolds are annual herbaceous plants belonging to the genus *Mallotus* in the family Asteraceae. They can be divided into ornamental varieties and pigment varieties. Ornamental marigolds are mainly used for horticultural landscaping and gardening. Lutein extracted from pigment marigold flowers has uses such as protecting eyesight, anti-oxidation, and as a feed additive. Since lutein cannot be synthesized by the human body, it needs to be supplemented exogenously. Pigment marigolds are widely cultivated.

[0003] Marigold leaf spot disease, also known as marigold black spot or marigold brown spot, is caused by Alternaria rubra (a type of spore). Alternaria tagetica This fungal disease is caused by [unspecified pathogen]. Initially, dark brown spots about 3 mm in diameter appear on older leaves. Under suitable conditions, these spots merge and gradually spread upwards, eventually leading to the death of the entire plant. This severely impacts marigold yield, reducing it by up to 40% in severe cases. The disease spreads rapidly in actual production, making control difficult. Conidia produced by the pathogen on diseased tissues can be spread by rainwater and human activity, while long-distance transmission mainly occurs through infected seeds, diseased plant debris, and infected soil.

[0004] Existing research mainly focuses on the isolation of Alternaria marigold and molecular identification based on ITS sequences (Gao Shan, Wang Mengfei, Hu Ping, Feng Xiaojun. Molecular identification of the pathogen of marigold leaf spot based on ITS sequence. Hubei Agricultural Sciences, May 2013, Vol. 52, No. 9; Cheng X, Lu Y, Chen D, et al. Pathogen and disease characteristics of marigold black spot in Beijing and surrounding areas. Plant Pathology, 2019, 68: 689-699), which is often time-consuming and not conducive to practical application. Therefore, it is necessary to establish a method for rapid detection of Alternaria marigold in seed, soil and other samples. Summary of the Invention

[0005] One of the objectives of this invention is to provide a method for the rapid, simple, and timely detection of Alternaria micrantha (a type of spore). Alternaria tagetica The method of existence.

[0006] Currently, there is no rapid and effective PCR detection method for *Alternaria alternata*, the pathogen causing marigold leaf spot. *Alternaria alternata* is an important pathogen on marigolds, and its complete genome information is not yet publicly available. Therefore, it is impossible to obtain a rapid detection method for *Alternaria alternata* using conventional specific primer design methods based on existing information. This invention, during its research, targeted ITS and... Alt Multiple primer pairs were designed for conventional molecular identification of *Alternaria* species, but none were found to specifically amplify *Alternaria marigold*, thus failing to achieve rapid detection. Therefore, this invention first sequenced the genome framework of *Alternaria marigold* and, through intragenus comparative genomic analysis, obtained several *Alternaria marigold*-specific gene sequences. Next, targeting these specific genes, this invention further eliminated gene sequences with poor specificity by expanding the screening range of fungal species, finally obtaining an effective detection target gene (as shown in SEQ ID No. 3). Based on this, primers were designed to develop a method capable of specifically amplifying *Alternaria marigold*.

[0007] This invention provides primer pairs for PCR detection of Alternaria marigold, the nucleotide sequences of which are shown in SEQ ID No. 1-2.

[0008] The present invention also provides a target for detecting Alternaria marigold, the nucleotide sequence of which is shown in SEQ ID No. 3.

[0009] The present invention also provides the application of the above primer pairs or targets in the detection of Alternaria marigold.

[0010] The present invention also provides the application of the above primer pairs or targets in the preparation of reagents or kits for detecting Alternaria marigold.

[0011] The present invention also provides reagents or kits for detecting Alternaria marigold, which include the above-described primer pairs or targets.

[0012] The present invention also provides a method for detecting Alternaria marigold, which uses the DNA of the sample to be tested as a template, performs PCR amplification using the above primer pair, and then performs gel electrophoresis detection on the amplification product; if a specific band (which can specifically amplify a 150bp product) is present, it is determined that the sample to be tested contains Alternaria marigold.

[0013] In the method of the present invention, each 10 μL of the PCR amplification reaction system comprises: 5 μL PCR mix, 0.5 μL primer shown in SEQ ID No. 1, 0.5 μL primer shown in SEQ ID No. 2, 1 μL DNA template, and 3 μL sterile ddH2O.

[0014] In the reaction system of the method of the present invention, the concentration of the primer is 10 μM.

[0015] In the method of the present invention, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 4 min, 94℃ denaturation for 30 s, 54~58℃ annealing for 30 s, 72℃ extension for 30 s, 36 cycles, and 72℃ final extension for 10 min.

[0016] In the method of the present invention, the conditions for gel electrophoresis are: 2% agarose gel, 90V electrophoresis for 40-60 min.

[0017] The beneficial effects of this invention are at least as follows: This invention provides a novel and rapid method for detecting Alternaria alternata, the pathogen of marigold leaf spot disease. The method has high detection sensitivity and specificity, and can provide a reference for early inspection, quarantine and prevention of marigold leaf spot disease. Attached Figure Description

[0018] Figure 1 The results are from the agarose gel electrophoresis in Example 1.

[0019] Figure 2 The results are from the agarose gel electrophoresis in the specific detection experiment in Example 2.

[0020] Figure 3 The results are from the agarose gel electrophoresis in the sensitivity detection experiment of Example 3. Detailed Implementation

[0021] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art.

[0023] In this invention, marigold plants infected with Alternaria leaf spot disease were identified using methods known in the art.

[0024] The *Alternaria mariscina* strains described in the specific embodiments of this invention were all collected from diseased plants in marigold planting bases in Yunnan Province, and underwent complete Koch's postulates isolation, identification, and multi-gene phylogenetic analysis, ultimately being identified as *Alternaria mariscina*.

[0025] The positive controls used in Specific Example 2 (three strains of *Alternaria rubra* isolated and identified from diseased marigold plants in Baoshan and Wenshan, Yunnan), *Alternaria spp.*, and *Anthracnose spp.* were obtained from Chenguang Biotech Group Co., Ltd.; *Pyrrosia lingua* and *Rhizoctonia solani* were obtained from Guizhou University; *Alternaria stalkata* was obtained from the China General Microbiological Culture Collection Center, CGMCC 3.20931; *Sphaerocera cucumberensis* was obtained from the China Agricultural Microbiological Culture Collection Center, ACCC 39734; *Botrytis cinerea* was obtained from the China General Microbiological Culture Collection Center, CGMCC 3.20932; and *Dioscorea opposita* was obtained from the China General Microbiological Culture Collection Center, CGMCC 3.20151.

[0026] Example 1 This embodiment provides a method for detecting Alternaria alternata, the pathogen of marigold leaf spot disease, including the following steps: DNA was extracted from the sample to be tested, and PCR amplification was performed using upstream primer YH24-2F and downstream primer YH24-2R (the target sequence is shown in SEQ ID No. 3). The PCR amplification product was then detected by agarose gel electrophoresis. If a DNA band with a molecular weight of approximately 150 bp was present (specifically amplifying a 150 bp product), it indicates that the sample contained Alternaria marigold.

[0027] The primer sequences for upstream primer YH24-2F and downstream primer YH24-2R are: YH24-2F (SEQ ID No. 1): 5'-CGACATGCGCTGCTACAAAA-3'; YH24-2R (SEQ ID No. 2): 5'-CGAACCTCCACCGTCTCTTC-3'.

[0028] The target sequence for amplification is (SEQ ID No. 3): CGACATGCGCTGCTACAAAACCGCTGCGCTTGCCAACTTTCCGCGCAACAAATGGTACTATCGATGCAAAGCCGAGTATGCTTGCACGCGACAACAGCGCCAGATCCGCCGCACGCTCATATCGATCAATGAAGAGACGGTGGAGGTTCG.

[0029] The reaction system for the above PCR amplification is as follows: 5 μL PCR mix (2×), 0.5 μL primer YH24-2F (10 μM), 0.5 μL primer YH24-2R (10 μM), 1 μL DNA template, 3 μL sterile ddH2O.

[0030] The above PCR amplification procedure is as follows: Pre-denaturation at 94℃ for 4 min, denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, 36 cycles, final extension at 72℃ for 10 min.

[0031] The above agarose gel electrophoresis was performed using a 2% agarose gel at 90V for 50 minutes.

[0032] This embodiment further uses the above method to detect Alternaria rubra var. marigolds, as detailed below: Four marigold leaves infected with Alternaria leaf spot and eight healthy marigold leaves were collected. DNA was extracted from the lesions and normal leaves using a commercial kit. Using this DNA as a template, PCR amplification was performed with primer pairs YH24-2F / YH24-2R, followed by agarose gel electrophoresis and observation using a gel imaging system. The results are shown below. Figure 1 As shown, lanes 1-4 are all lesion samples, with a specific band at 150bp. The DNA from healthy leaves in lanes 5-12 did not show a specific band.

[0033] Example 2 Take long-stalked Alternaria ( Alternaria longipes Alternaria spp. ( ) A. tenuissima ), Cucumber spores ( Plectosphaerella cucumerina ), Dioscorea opposita ( ), fruit anthracnose ( ), Botrytis cinerea ( Botrytis cinerea ), griseorrhizosporium ( ) and Rhizoctonia solani ( Specificity tests were conducted, with three different Alternaria marigold strains serving as positive controls.

[0034] After extracting DNA from the above-mentioned fungi, PCR amplification and agarose gel electrophoresis were performed as described in Example 1. The results are as follows: Figure 2 As shown, the leftmost lane is the DNA marker. Lanes 1-3 contain three positive controls. Lanes 4-11 contain Alternaria longstalk, Corynebacterium cucumberense, Botrytis cinerea, Botrytis cinerea, Rhizoctonia solani, Alternaria microphylla, Anthracnose spp., and Diplosporium cocovenenans, respectively. The results showed that only three Alternaria marigold strains amplified a specific 150 bp band; the other species did not amplify any bands.

[0035] Example 3 Genomic DNA of Alternaria marigold was diluted to 7.0 ng / μL and 7.0 × 10⁻⁶ μL. -1 ng / μL, 7.0 ×10 -2 ng / μL, 7.0 ×10 -3 ng / μL, 7.0 ×10 -4 ng / μL, 7.0 ×10 -5 ng / μL, 7.0 ×10 -6 ng / μL was added as a template to the PCR reaction system, and PCR amplification was performed according to Example 1, followed by agarose gel electrophoresis. Results Figure 3 As shown, 7.0 ng / μL (lane 1), 7.0 × 10 -1 ng / μL (lane 2), 7.0 ×10 -2 ng / μL (lane 3), 7.0 ×10 -3 DNA templates at concentrations of ng / μL (lane 4) all amplified to a 150bp band, while the others showed no bands, indicating that the detection limit of the method of this invention is 7.0 × 10⁻⁶. - 3 ng / μL.

[0036] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A primer pair for PCR detection of Alternaria marigold, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID No. 1-2.

2. A detection target for Alternaria rubra purpurea, characterized in that, The nucleotide sequence of the target is shown in SEQ ID No.

3.

3. The application of the primer pair of claim 1 or the target of claim 2 in the detection of Alternaria marigold.

4. The use of the primer pair of claim 1 or the target of claim 2 in the preparation of reagents or kits for detecting Alternaria marigold.

5. A reagent or kit for detecting Alternaria truncatula, characterized in that, Includes the primer pair as described in claim 1 or the target as described in claim 2.

6. A method for detecting Alternaria micrantha, characterized in that, Using the DNA of the sample to be tested as a template, PCR amplification was performed using the primer pair described in claim 1, and then the amplification product was detected by gel electrophoresis; if a specific band was present, it was determined that the sample to be tested contained Alternaria marigold.

7. The method according to claim 6, characterized in that, Each 10 μL PCR amplification reaction system comprises: 5 μL PCR mix, 0.5 μL primers shown in SEQ ID No. 1, 0.5 μL primers shown in SEQ ID No. 2, 1 μL DNA template, and 3 μL sterile ddH2O.

8. The method according to claim 7, characterized in that, The concentration of the primers was 10 μM.

9. The method according to any one of claims 6-8, characterized in that, The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 4 min, 94℃ denaturation for 30 s, 54~58℃ annealing for 30 s, 72℃ extension for 30 s, 36 cycles, and 72℃ final extension for 10 min.

10. The method according to any one of claims 7-8, characterized in that, The conditions for gel electrophoresis were: 2% agarose gel, 90V electrophoresis for 40-60 minutes.