A method for regulating the catalytic behavior of a 3'->5' exonuclease based on deoxyribose configuration regulation and application thereof
By altering the deoxyribose conformation at the AP site and using hydrazine compounds and reducing agents to convert it into an open-chain conformation, precise control of nuclease catalytic behavior can be achieved. This solves the problems of poor positional accuracy and unpredictable effects in existing technologies and is applicable to DNA damage localization, controllable DNA assembly, and DNA oxidative damage detection.
Patent Information
- Application Number
- CN202610340515.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-19
- Publication Date
- 2026-06-23
AI Technical Summary
Existing technologies lack positional precision and predictability in regulating the catalytic behavior of DNA polymerases or related nucleases, and do not utilize deoxyribose conformational changes to regulate nuclease catalytic behavior.
By regulating the deoxyribose configuration at the AP site, hydrazine compounds with the -NH-NH2 functional group are condensed with deoxyribose to form hydrazone intermediates, which are then converted to open-chain configuration in the presence of a reducing agent, causing nucleases to either catalytically stop or pass through at specific sites.
It enables precise regulation of nuclease catalytic behavior, with single nucleotide resolution and predictable regulation effects, and is suitable for DNA damage localization, controllable DNA assembly, and DNA oxidative damage detection.
Smart Images

Figure CN122255203A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of nucleic acid chemistry, biocatalysis regulation and molecular engineering, specifically to methods for regulating the conformation of DNA abase sites, methods for influencing the catalytic behavior of nucleases based on changes in deoxyribose conformation, and modifications to nucleic acid molecules and their applications in DNA damage localization, molecular diagnostics and DNA nanoengineering. Background Technology
[0002] Depurine / depyrimidine (AP) sites are among the most common types of DNA damage. They can arise from spontaneous base hydrolysis or as intermediates in base excision repair processes. The C1 aldehyde group at these sites exhibits strong electrophilic reactivity, specifically binding to nucleophiles such as hydrazine and hydroxylamine. Therefore, AP sites have long been used as chemical reaction sites for DNA damage detection or selective labeling.
[0003] In nucleic acid metabolism, DNA polymerases or related nucleases with 3'→5' exonuclease activity participate in DNA degradation and proofreading. Their catalysis depends on the precise geometric coordination between the substrate phosphate backbone and the metal ion at the active site. Existing regulatory methods often involve introducing large-volume substituents or altering charge properties to affect enzyme-substrate interactions. However, these methods often lack positional precision, and the regulatory effects are difficult to predict.
[0004] On the other hand, although chemical modifications of the AP site have been extensively studied, current techniques still treat it as a passive biomarker or a complex factor in the repair process, without addressing the regulation of nuclease catalytic behavior by altering the conformational state of the deoxyribose at the AP site. A dynamic equilibrium exists between open-chain and closed-loop configurations of deoxyribose, and whether this conformational change can serve as a structural factor influencing the geometrical matching of exonuclease catalysis has not been systematically investigated. Given the modifiability of the AP site, different chemical modifications could potentially produce predictable exonuclease passage or repression behaviors by regulating the deoxyribose conformational state. Therefore, it is necessary to provide a method for regulating the catalytic behavior of exonucleases based on deoxyribose conformational regulation, addressing the technical problems of poor positional precision and unpredictable effects in existing methods. Summary of the Invention
[0005] This invention aims to provide a method for controllably regulating the catalytic behavior of nucleases with 3'→5' exonuclease activity by adjusting the deoxyribose conformation at the AP site. This method does not rely on steric hindrance of modifying groups or changes in the nuclease molecular structure, but rather affects the catalytic geometry by altering the local conformation of the substrate, thereby achieving controllable arrest or passage of the enzyme at a predetermined site.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A method for regulating the catalytic behavior of nuclease 3'→5' exonucleases based on deoxyribose conformation includes the following steps:
[0008] (1) Provide a DNA molecule containing at least one depurinating / depyrimidine site (AP site);
[0009] (2) Modify the deoxyribose configuration of the AP site: make the DNA molecule undergo a condensation reaction with a hydrazine compound containing a -NH-NH2 functional group to form a hydrazone intermediate, and reduce the hydrazone intermediate in the presence of a reducing agent to change the deoxyribose at the AP site from a closed-loop configuration to a stable open-chain configuration.
[0010] (3) The modified DNA molecule obtained in step (2) is co-incubated with a nuclease having 3'→5' exonuclease activity under suitable reaction conditions. The nuclease undergoes stable catalytic stagnation one nucleotide downstream of the AP site where deoxyribose is converted to the open-chain conformation, thereby achieving controllable regulation of the catalytic behavior of the nuclease.
[0011] Furthermore, the DNA molecule containing at least one AP site described in step (1) above can be obtained by treating a DNA molecule containing deoxyuridine (dU) with uracil-DNA glycosidase (UDG).
[0012] Furthermore, the hydrazine compound mentioned in step (2) above can be selected from one of the following: hydrazine-s-triazine derivatives, acylhydrazine compounds, and monosubstituted hydrazine compounds. These reagents have -NH-NH2 functional groups, can react with the aldehyde group at the C1 position of the AP site to generate an hydrazone intermediate, and induce deoxyribose to form a stable open-chain configuration in the presence of a reducing agent, achieving precise cessation of nucleases with 3'→5' exonuclease activity one nucleotide downstream of the modification site without relying on steric hindrance.
[0013] The general structural formula of the hydrazine-s-triazine derivative is shown in Formula I:
[0014]
[0015] In Formula I, R represents a substituted amino or alkoxy group, wherein the substituted amino group is preferably a monoalkyl or dialkyl-substituted amino group. Further, the alkoxy group is preferably a C1-C6 alkoxy group; the substituted alkyl group on the amino group is preferably a C1-C6 alkyl group.
[0016] For example, the hydrazyl-s-triazine derivatives include, but are not limited to: 2-hydrazyl-4,6-bis(dimethylamino)triazine, 2-hydrazyl-4,6-bis(diethylamino)triazine, 2-hydrazyl-4,6-bis(diisopropylamino)triazine, 2-hydrazyl-4,6-bis(di-n-propylamino)triazine, 2-hydrazyl-4,6-di(methoxy)triazine, 2-hydrazyl-4,6-di(ethoxy)triazine, 2-hydrazyl-4,6-di(methylamino)triazine, 2-hydrazyl-4,6-di(ethylamino)triazine, 2-hydrazyl-4,6-di(n-butylamino)triazine, etc.
[0017] The monosubstituted hydrazine compounds include, but are not limited to, monoalkyl-substituted hydrazines, monoaryl-substituted hydrazines, monoarylalkyl-substituted hydrazines, monoheteroarylalkyl-substituted hydrazines, monounsaturated aliphatic hydrocarbon-substituted hydrazines, etc. Specifically, the alkyl group in the monoalkyl-substituted hydrazine is preferably a C1-C12 alkyl group, more preferably a C1-C6 alkyl group, such as propylhydrazine, isopropylhydrazine, etc.; the aryl group in the monoarylalkyl-substituted hydrazine is preferably a phenyl group, a C1-C6 alkyl group, or an alkoxy-substituted phenyl group, such as phenylhydrazine, 3,5-dimethoxyphenylhydrazine, etc.; the aryl group in the monoarylalkyl-substituted hydrazine is preferably a C7-C12 aryl alkyl group, such as benzylhydrazine, phenethylhydrazine, etc.; the heteroaryl group in the monoheteroarylalkyl-substituted hydrazine is preferably a C5-C12 heteroaryl alkyl group containing N, O, and / or S atoms, such as pyridin-3-methylenehydrazine, etc.; the monounsaturated aliphatic hydrocarbon group is preferably a C2-C12 unsaturated hydrocarbon group, more preferably a C2-C6 hydrocarbon group, such as 2-propynylhydrazine, etc.
[0018] The acylhydrazide compounds refer to compounds with the -CO-NH-NH2 acylhydrazide structure, such as acetylhydrazide, benzoylhydrazide, biotinylate hydrazide and their derivatives.
[0019] The reducing agent mentioned in step (2) above is a mild reducing agent capable of stabilizing hydrazone intermediates, including but not limited to pyridineborane reducing agents (such as 2-methylpyridineborane), sodium cyanoborohydride, or other reduction systems that specifically reduce hydrazone bonds. Figure 1 As shown, the hydrazine compound undergoes a condensation reaction with the aldehyde group at the C1 position of the AP site to form a hydrazone intermediate containing a C=N double bond. The reducing agent reduces the hydrazone intermediate, reducing the double bond to a CN single bond, which can no longer be attacked and added by the -OH at the C4 position after the deoxyribose ring opens, thereby maintaining the stable open-chain configuration of the deoxyribose at the AP site.
[0020] Furthermore, the nucleases mentioned in step (3) above include, but are not limited to, DNA polymerases or exonucleases with 3'→5' exonuclease activity, such as T4 DNA polymerase.
[0021] This invention relates to a method for regulating the catalytic behavior of nucleases from 3' to 5' exonucleases based on deoxyribose conformation. This method can be applied to high-resolution DNA damage localization, controlled DNA assembly in nanotechnology, and detection of DNA oxidative damage levels. In DNA damage localization, the location of AP sites within the DNA molecule is precisely determined by detecting the length and sequence of the remaining fragment after T4 DNA polymerase digestion stalls. In controlled DNA assembly, the method utilizes the controlled stalling effect of nuclease catalytic degradation to introduce AP sites with deoxyribose conformation regulation at predetermined sites on the DNA fragment. This regulates the degree of DNA fragment degradation by the nuclease, resulting in sticky ends of predetermined lengths, thereby achieving directional splicing of the DNA fragments. In the detection of DNA oxidative damage levels, DNA glycosylation enzymes first remove various damaging bases such as dU and OG, converting them into AP sites. Then, deoxyribose conformation regulation is applied to these AP sites. Nuclease stalls at the modified AP sites, generating characteristic remaining fragments. Probes are then designed based on the sequences of these remaining fragments to construct a detection system based on nuclease stall signals, enabling the detection of damage levels at specific sites in DNA.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] 1. This invention regulates the catalytic behavior of 3'→5' exonucleases of nucleases by controlling the deoxyribose conformation at the AP site, rather than relying on steric hindrance caused by large-volume modification groups or changes in the molecular structure of nucleases. It achieves precise regulation of enzyme catalytic behavior at the local conformation level of the substrate.
[0024] 2. The catalytic stagnation occurs one nucleotide downstream of the modification site, with single nucleotide resolution;
[0025] 3. Different types of modifying reagents have different effects on the deoxyribose conformation, resulting in different 3'→5' exonuclease catalytic behaviors of nucleases through / blocking. The correspondence between the deoxyribose conformation state and the nuclease catalytic behavior was established, making the regulatory effect predictable.
[0026] 4. This method is applicable to applications such as high-resolution localization of DNA damage, controllable DNA assembly, and detection of DNA oxidative damage levels. Attached Figure Description
[0027] Figure 1 A schematic diagram illustrating the differences in the regulation of T4 DNA polymerase catalytic behavior by hydrazine and hydroxylamine-modified AP sites in Example 1 of this invention.
[0028] Figure 2The agarose and urea-polyacrylamide gel electrophoresis images show the differences in the regulation of T4 DNA polymerase catalytic behavior by hydrazine and hydroxylamine modified AP sites in Example 1 of this invention. The numbers above the lanes represent the numbers of the modifying reagents, where numbers 1-16 are hydrazine modifying reagents and numbers 17-20 are hydroxylamine modifying reagents.
[0029] Figure 3 Example 2 of this invention describes the conformational state of the deoxyribose at the AP site modified by hydroxylamine under reducing and non-reducing conditions and its effect on the catalytic behavior of T4 DNA polymerase. In this example: A is the MS spectrum of the OBHA-modified product under reducing (right) / non-reducing (left) conditions; B is the electrophoretic detection image of the OBHA-modified product after hydrolysis catalyzed by T4 DNA polymerase under reducing (with the addition of Pic-BH3) / non-reducing conditions.
[0030] Figure 4 The interaction between natural DNA and PMH-modified DNA and T4 DNA polymerase and the detection of enzymatic digestion efficiency in Example 3 of this invention are shown in the figure. In this figure: A is the fluorescence polarization experiment curve, with the horizontal axis representing the T4 DNA polymerase concentration (nM) and the vertical axis representing the polarization value; B is the real-time fluorescence enzymatic digestion experiment curve, with the horizontal axis representing the reaction time (min) and the vertical axis representing the fluorescence intensity.
[0031] Figure 5 The molecular dynamics simulation diagrams of the binding of the natural substrate and the PMH-modified open-chain substrate to the T4 DNA polymerase exonuclease domain in Example 3 of this invention are shown, where: A is the binding model of the natural substrate; B is the binding model of the PMH-modified open-chain substrate.
[0032] Figure 6 The HPLC-MS chromatogram of the product of i-Pr2N modified AP-DNA after hydrolysis by T4 DNA polymerase in Example 4 of this invention is shown in Figure 4. In Figure 4, A is the HPLC-UV detection result of the reaction substrate and the enzymatic hydrolysis product; B is the MS detection result of the reaction substrate and the enzymatic hydrolysis product.
[0033] Figure 7 The high-resolution localization Sanger sequencing results of the AP site based on the deoxyribose conformation regulation method of the present invention in Example 5 of this invention. Detailed Implementation
[0034] This invention relates to a method for regulating the catalytic behavior of nuclease 3'→5' exonucleases based on deoxyribose conformation and its application, such as... Figure 1As shown, hydrazine-based reagents with -NH-NH2 functional groups are used to modify the AP site. Under the action of a reducing agent (such as 2-methylpyridineborane, i.e., Pic-BH3), the deoxyribose at the AP site is induced to form a stable open-chain conformation, thereby inhibiting the catalytic hydrolysis behavior of nucleases with 3′-5′ exonuclease activity (such as T4 DNA polymerase). Moreover, the enzymatic cessation occurs precisely one nucleotide downstream of the modified site. In contrast, hydroxylamine-based reagents mostly keep the deoxyribose at the AP site in a closed-loop conformation. Under this conformation, nucleases can smoothly pass through the modified site to complete the catalytic hydrolysis.
[0035] This invention achieves a controllable switching between "restriction" and "normal passage" of exonuclease catalytic behavior by regulating the state of deoxyribose at the AP site between open-chain and closed-loop configurations.
[0036] The technical solution of the present invention will be described in detail below with reference to specific embodiments and accompanying drawings. These embodiments are only for explaining the present invention and are not intended to limit the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are all conventional methods; reagents and instruments used, unless otherwise specified, are all commercially available products.
[0037] Example 1: Verification of the difference in regulation of T4 DNA polymerase catalytic behavior by hydrazine and hydroxylamine modifications
[0038] In this embodiment, hydrazine-based reagents as defined in this invention and hydroxylamine-based reagents as a control were used to modify the AP site to verify the differences in the regulation of T4 DNA polymerase exonuclease catalytic behavior by different modifications.
[0039] The specific steps are as follows:
[0040] 1. Preparation of DNA containing AP sites: 0.5 nmol of oligonucleotides containing dU (SEQ ID NO: 1 in the sequence listing) was dissolved in 1×UDG reaction buffer, 25 U of uracil-DNA glycosylase was added and incubated at 37°C for 2 h, and purified using the AidQuick oligonucleotide purification kit to obtain DNA molecules containing AP sites (AP-DNA).
[0041] 2. Modification of AP-DNA with hydrazine / hydroxylamine reagents: (1) Hydrazine modification: In a 40 μL reaction system, 0.5 nmol AP-DNA was reacted with 0.5-2 mg / mL hydrazine modification reagent and 0.25 M 2-methylpyridineborane. After incubation at 45℃ for 3 h, the AP-DNA was purified by AidQuick oligonucleotide purification kit to obtain hydrazine-modified AP-DNA; (2) Hydroxylamine modification: In a 40 μL reaction system, 0.5 nmol AP-DNA was reacted with 2 mg / mL hydroxylamine reagent. After incubation at 45℃ for 3 h, the AP-DNA was purified by AidQuick oligonucleotide purification kit to obtain hydroxylamine-modified AP-DNA.
[0042] 3. Take 20 pmol of each of the above-mentioned modified products and mix them with 1.5 U T4 DNA polymerase and 1×NE Buffer. TM Mix 10 μL of the r2.1 buffer solution into the reaction mixture, incubate at 37°C for 1 h, and then add 2 μL of 0.5 M EDTA to terminate the reaction.
[0043] 4. Product detection and analysis: The reaction products of each group were subjected to 3% agarose gel electrophoresis or 15% urea (7M)-polyacrylamide gel electrophoresis. After electrophoresis, the products were stained with YeaRed nucleic acid dye and photographed and analyzed using a 3500 gel imaging system.
[0044] The DNA nucleic acid sequence used in this embodiment is as follows (dU is deoxyuridine):
[0045] TCTCTGACCACAGTAGACATTCGCACGATA (dU)CGAGGTCTATAGATCAGTAATGGT (SEQ ID NO: 1).
[0046] The hydrazine-modifying reagents used in this embodiment include hydrazine-S-triazine derivatives, monosubstituted hydrazine compounds, and acylhydrazine compounds, whose structures are as follows:
[0047] Hydrazine-S-triazine derivatives:
[0048]
[0049] Monosubstituted hydrazine compounds:
[0050]
[0051] Acylhydrazide compounds:
[0052]
[0053] The hydrazine-s-triazine derivative was synthesized independently, and the synthesis method was based on the Chinese invention patent "A class of sugar labeling reagents based on triazine structure and their synthesis method and application" (patent number: ZL 201110423326.1).
[0054] The hydroxylamine-based modifying agent used in this embodiment has the following structure:
[0055]
[0056] Experimental results:
[0057] All AP-DNA modified with hydrazine and acylhydrazine reagents showed stable and consistent specific stop bands after digestion with T4 DNA polymerase, while AP-DNA modified with hydroxylamine reagents was completely degraded (see...). Figure 2 The aforementioned hydrazine reagents showed significant differences in substituent volume, charge, and skeletal structure, but all induced enzymatic retardation at the same location. This indicates that the catalytic retardation effect did not originate from steric hindrance of the modified groups or differences in the chemical skeleton, but rather from changes in the structural state of the deoxyribose at the AP site. Combined with subsequent conformational analysis results (see Example 2), it can be confirmed that the difference in the conformation of the deoxyribose at the AP site is the core factor leading to the different catalytic behaviors of exonucleases.
[0058] Example 2: Verification of deoxyribose conformation as a core factor regulating the catalytic behavior of T4 DNA polymerase
[0059] This embodiment artificially modulates the configuration state of deoxyribose at the AP site by adding or not adding a reducing agent to the hydroxylamine-modified system, and verifies the direct correspondence between the configuration state of deoxyribose and the catalytic behavior of nucleases by combining density functional theory calculations.
[0060] The specific steps are as follows:
[0061] 1. Preparation and detection of hydroxylamine-modified AP-DNA under reducing / non-reducing conditions: Oligonucleotide (SEQ ID NO: 1) was treated according to step 1 of Example 1 to prepare AP-DNA; AP-DNA was modified with different hydroxylamine reagents according to step 2 of Example 1 with or without the addition of 0.25 M 2-methylpyridineborane. After purification, the molecular weight changes of each modified product were detected by ThermoScientific Dionex Ultimate 3000 high performance liquid chromatography-Q Exactive Mass Spectrometer (HPLC-MS), and the deoxyribose configuration was analyzed.
[0062] HPLC analysis was performed using a Zorbax Eclipse Plus C18 column (2.1 mm × 150 mm, 1.8 μm) at 55 °C. Mobile phase A was 20 mM NH4Ac (pH 9.0), and mobile phase B was acetonitrile. The flow rate was 0.3 mL / min, with gradient elution: 0.0–13.0 min, 0.0–5.0% mobile phase B; 13.0–20.0 min, 5.0–22.0% mobile phase B; 20.0–21.0 min, 15.0–100.0% mobile phase B; 21.0–25.0 min, 100.0% mobile phase B; 25.0–26.0 min, 100.0–0.0% mobile phase B. UV detection was performed at 260 nm, and the data acquisition rate was 2.5 Hz.
[0063] MS detection was performed in negative ion ESI mode, with a scan range of m / z 350.0-4000.0, ion transmission capillary temperature of 350℃, mass resolution of 70000, and AGC target set to 5×10⁻⁶. 5 The maximum injection time is 100 ms, the spray voltage is 3.20 kV, and the flow rates of sheath gas, auxiliary gas, and scavenging gas are 35, 15, and 2 units, respectively.
[0064] 2. Enzymatic verification of O-butylhydroxylamine (OBHA) modified products: OBHA modified products with and without reducing agent were co-incubated with T4 DNA polymerase according to step 3 of Example 1, and the enzyme digestion products were detected by 15% urea (7M)-polyacrylamide gel electrophoresis.
[0065] 3. DFT calculation to verify configurational stability: Molecular models of the open-chain and closed-ring configurations of the pyridine-3-methylenehydrazine (PMH) modified product and the O-[(pyridine-3-yl)methyl]hydroxylamine (PMOA) modified product were constructed using Gabedit software. After conformational search using the Molclus program, constrained structure optimization and energy ranking were performed at the GFN2-XTB level to screen for dominant conformations. Subsequently, high-order structure optimization was performed at the B3LYP / 6-31G (d) theoretical level using Gaussian 16 software. High-precision single-point energy calculations were performed using ORCA 6 software at the RI-PWPB95 / def2-QZVPP theoretical level combined with the SMD implicit solvation model (simulating the physiological buffer environment). Finally, the thermodynamic stability of each configuration was determined by comparing the energy differences between the open-chain and closed-ring configurations of the two types of modified products based on the single-point energy results.
[0066] Experimental results:
[0067] 1. HPLC-MS and enzyme digestion detection results (see...) Figure 3The results showed that under reducing conditions, the molecular weight of the OBHA-modified product increased by 2 Da compared to the non-reducing conditions. Figure 3 (A) indicates that the deoxyribose changed from a closed-ring configuration to a stable open-ring configuration, while the AP sites modified by the remaining hydroxylamine reagents retained their closed-ring configuration. Correspondingly, the non-reduced closed-ring OBHA-modified product was completely degraded, while the reduced open-ring product showed a distinct stagnation band (A). Figure 3 (B) indicates that the difference in the catalytic behavior of exonucleases originates from the deoxyribose configuration at the AP site, rather than from the modifying reagent itself.
[0068] 2. DFT calculations show that the closed-ring configuration of the hydroxylamine-modified product has 2.2 kcal / mol lower energy than the open-ring configuration, and the closed-ring configuration is thermodynamically stable; while the open-ring configuration of the hydrazine-modified PMH product has similar energy to the closed-ring configuration, so the reducing agent can stabilize it into the open-ring configuration.
[0069] The above results collectively clarify and establish a direct correspondence between the deoxyribose conformation state and the catalytic behavior of exonucleases, proving that the enzyme behavior regulation mechanism of the present invention is based on deoxyribose conformation regulation.
[0070] Example 3: Molecular mechanism by which deoxyribose open-chain conformation represses the catalytic behavior of T4 DNA polymerase
[0071] This embodiment delves into the mechanism of action of the technical solution of the present invention at the molecular level. Through fluorescence polarization experiments, real-time fluorescence experiments and molecular dynamics simulations, it systematically reveals the molecular mechanism by which the deoxyribose open-chain configuration inhibits the catalytic behavior of T4 DNA polymerase.
[0072] The specific experimental steps are as follows:
[0073] 1. Preparation of PMH-modified AP-DNA: Following steps 1-2 of Example 1, the oligonucleotides shown in SEQ ID NO: 3 and SEQ ID NO: 5 were treated to prepare PMH-modified AP-DNA.
[0074] 2. Fluorescence polarization assay for substrate binding affinity: Binding buffer (10 mM Tris-HCl pH 7.9, 50 mM NaCl, 1 mM DTT, 10 mM EDTA) was prepared. 5 nM FAM-labeled native DNA (SEQ ID NO: 2) and PMH-modified DNA (SEQ ID NO: 3) were mixed with gradient concentrations of T4 DNA polymerase, incubated at 37°C for 30 min, and then placed in a BioTek Synergy H1 microplate reader. Fluorescence polarization values were detected at 485 nm excitation wavelength and 528 nm emission wavelength. A graph was plotted with polarization values on the ordinate and enzyme concentration on the abscissa. A nonlinear regression model was used to fit the graph to obtain the apparent binding dissociation constant (K0). d The binding affinity of the two DNAs to T4 DNA polymerase was compared.
[0075] 3. Real-time fluorescence assay to detect catalytic hydrolysis activity: 100 nM of native DNA (SEQ ID NO: 4) and PMH-modified DNA (SEQ ID NO: 5) were reacted with 1×SYBR Gold and 1×NEBuffer, respectively. TM Mix with R2.1 buffer, add 1.5 U T4 DNA polymerase to start the reaction, place in a BioTek Synergy H1 microplate reader and detect at 37°C. Use 495 nm as the excitation wavelength and 537 nm as the emission wavelength, record the fluorescence intensity every 15 s, and continue detection for 10 min. Plot a real-time hydrolysis curve with fluorescence intensity as the ordinate and time as the abscissa to compare the enzymatic hydrolysis efficiency of the two DNA substrates.
[0076] 4. Molecular Dynamics Simulations: Based on the 1NOY crystal structure, complex models of the natural substrate (dT-dT-dT) and the PMH-modified substrate (dT-PMH-AP-dT) with the T4 DNA polymerase exonuclease domain were constructed, respectively. The complexes were solvated using the CHARMM36 force field and the TIP3P water model, and catalytic metal ions (Zn) were added. 2+ Mn 2+ ) and Na + Neutralize the system charge; perform a 100 ns equilibrium molecular dynamics simulation at 298.15 K, extract representative snapshots of the simulated trajectory, and analyze the hydrogen bond interactions between the enzyme active site and the substrate, as well as the spatial arrangement changes of the catalytic groups.
[0077] The DNA nucleic acid sequence used in this embodiment (FAM represents 5' end labeled with carboxyfluorescein) is as follows:
[0078] FAM-GAAGTTTCTGAGAATGCTTC (SEQ ID NO: 2);
[0079] FAM-GAAGTTTCTGAGAATGCT(dU)C (SEQ ID NO: 3);
[0080] GAAGTTTCTGAGAATGCTTC (SEQ ID NO: 4);
[0081] GAAGTTTCTGAGAATGCT(dU)C (SEQ ID NO: 5).
[0082] Experimental results
[0083] 1. Results of fluorescence polarization experiment ( Figure 4 (A) shows: K of natural DNA and T4 DNA polymerase d The value is 796 nM, indicating the K+ of PMH-modified DNA and T4 DNA polymerase. d The value was 1097 nM, indicating that the open-chain configuration of deoxyribose significantly reduced the binding affinity between the substrate and the enzyme.
[0084] 2. Results of real-time fluorescence experiments ( Figure 4 Figure B shows that the fluorescence intensity of natural DNA decreased rapidly over time, almost dropping to baseline within 2 minutes, indicating that it was rapidly enzymatically digested; the fluorescence intensity of PMH-modified DNA did not change significantly throughout the detection time, indicating that it could not be hydrolyzed by T4 DNA polymerase at all, and the exonuclease behavior was completely inhibited.
[0085] 3. Molecular dynamics simulation results ( Figure 5 The results show that when the natural substrate binds to the enzyme's active site, the 4'O of the deoxyribose forms a stable hydrogen bond with the conserved residue Asn-214 in the active site, and the easily cleavable phosphate group is precisely aligned with the catalytic metal ion, satisfying the spatial structure requirements of the hydrolysis reaction. The PMH-modified open-chain substrate disrupts these conserved hydrogen bond interactions, causing the DNA backbone to become distorted, and the oxygen atom of the easily cleavable phosphate group aligns precisely with the catalytic Mn ion. 2+ Ion misalignment disrupts the precise geometry required for catalytic hydrolysis, ultimately leading to the loss of catalytic activity of exonucleases.
[0086] The above results demonstrate, from three aspects—substrate binding capacity, catalytic hydrolysis efficiency, and enzyme-substrate spatial structure matching—that the stable open-chain conformation of deoxyribose disrupts the precise geometric arrangement required for the active site of exonucleases, leading to catalytic stagnation. Conversely, the closed-ring conformation maintains the normal catalytic geometry, allowing the enzyme to successfully complete the hydrolysis reaction.
[0087] Therefore, the regulation of exonuclease catalytic behavior achieved by this invention originates from local conformational changes in the substrate, rather than changes in enzyme structure or simple steric hindrance effects.
[0088] Example 4: Validation of the Precision of T4 DNA Polymerase Stationary Sites Achieved Through Deoxyribose Conformation Regulation
[0089] In this embodiment, AP-DNA was modified with 2-hydrazino-4,6-bis(diisopropylamino)triazine (i-Pr2N), a hydrazine reagent specified in this invention. After incubation with T4 DNA polymerase, the enzymatic digestion products were detected and analyzed by HPLC-MS.
[0090] The specific steps are as follows:
[0091] 1. Preparation and enzymatic digestion of i-Pr2N modified AP-DNA: Following steps 1-3 of Example 1, the oligonucleotide shown in SEQ ID NO: 1 was treated to prepare i-Pr2N modified AP-DNA, and then subjected to T4 DNA polymerase digestion to obtain the enzyme digestion product.
[0092] 2. The digestion products were detected by HPLC-MS according to the parameter settings in step 1 of Example 2.
[0093] 3. Calculation and verification of the stall site: Based on the molecular weight of the digestion product obtained by HPLC-MS, the corresponding fragment length is calculated to determine the specific nucleotide site where the exonuclease stalls.
[0094] Experimental results:
[0095] HPLC-MS results are as follows Figure 6 The reaction substrate is 55 nt in length and has a molecular weight of 17117 Da. A specific halting fragment with a molecular weight of 9913 Da was detected in the enzyme digestion product. This molecular weight corresponds to a DNA fragment of 32 nt in length, indicating that the 3'→5' exonuclease hydrolysis behavior of T4 DNA polymerase stops precisely one nucleotide downstream of the modified AP site in this invention, with single nucleotide resolution.
[0096] Example 5: Application of the method of the present invention in high-resolution DNA damage localization
[0097] This embodiment uses Sanger sequencing as an example to fully implement the deoxyribose conformation regulation method of the present invention. By modifying the AP site, inducing precise cessation of T4 DNA polymerase, ligating the 3' end adapter, PCR amplification and sequencing analysis, the method is verified to achieve high-resolution and precise localization of the AP site, demonstrating its practical application value in the field of DNA damage detection.
[0098] The specific steps are as follows:
[0099] 1. Preparation and enzymatic digestion of i-Pr2N-modified AP-DNA: The model strands (SEQ ID NO: 1 and SEQ ID NO: 6) were treated according to steps 1-3 of Example 1 to prepare i-Pr2N-modified AP-DNA, and then subjected to T4 DNA polymerase digestion. After the reaction, the nuclease was inactivated by heating at 80°C for 30 min.
[0100] 2. Prepare the dual ligands: Dissolve 10 pmol oligonucleotides (SEQ ID NO: 7 and SEQ ID NO: 8) in 10 μL of 1× T4 DNA ligase reaction buffer and place them in a Bio-Rad C1000 Touch Thermo Cycler PCR instrument for annealing. The reaction program is set as follows: denature at 95℃ for 5 min, then decrease the temperature by 1℃ every 30 s until it reaches 20℃.
[0101] 3. Add 3' adapter: Add 10 μL of the above enzymatic hydrolysis product to a mixture containing 400 nM double-linker, 1 M betaine, and 400 U Hi-T4. TM A reaction system with a total volume of 25 μL was prepared in a solution of thermostable DNA ligase and 1× T4 DNA ligase reaction buffer. After reacting at 50 °C for 12 h, the enzyme was inactivated by heat by incubation at 75 °C for 20 min.
[0102] 4. Amplification and Sanger Sequencing Analysis: All the above reaction products were added to a buffer containing 1 μM forward primer (SEQ ID NO: 9 or SEQ ID NO: 10), 1 μM reverse primer (SEQ ID NO: 11), 250 μM dNTP, 5U TaKaRa Ex Taq hot-start PCR polymerase, and 1×Ex Taq PCR polymerase buffer (with added Mg). 2+ A PCR system with a total volume of 50 μL was prepared in a solution containing [missing information]. The PCR reaction program was set as follows: denaturation at 95℃ for 3 min, followed by 40 cycles, each cycle consisting of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 1 min. After the reaction, the PCR products were analyzed by Sanger sequencing.
[0103] The DNA nucleic acid sequence used in this embodiment is as follows (P represents a phosphate terminus at the 5' end, and other sequences are assumed to have a hydroxyl terminus at the 5' end; SpC3 represents the 3' end being blocked by the C3 spacer blocking group; N represents any one of the A, T, C, and G bases):
[0104] TAATCTGCCGGTGGTGTTGCTGTATCTCGGCTCTCTGACCACAGTAGACATTCGCACGATAACGAGGTCTATAGATCAGTAATGCA (dU)GGCTGTGAACCACGTGAGTCCTGAAA GACGGCATTCGGAGCAT (SEQ ID NO: 6);
[0105] P-GTGAACAGACATATGGACGTACGACGAGATCGGAAGCTCAAGATGACGACATTC GTAGTC-SpC3 (SEQ ID NO: 7);
[0106] GACTACGAATGTCGTCATCTTGAGCTTCCGATCTCGTCGTACGTCCATATGTCTGTTCACNNNNNN-SpC3 (SEQ ID NO: 8);
[0107] TCTCTGACCACAGTAGAC (SEQ ID NO: 9);
[0108] TAATCTGCCGGTGGTGTTGC (SEQ ID NO: 10);
[0109] GACTACGAATGTCGTCATCTTGAG (SEQ ID NO: 11).
[0110] Experimental results:
[0111] Sanger sequencing results as follows Figure 7 As shown, after removing the adapter sequence, the penultimate base from the 3' end is the AP site, which matches the sequence of the model strand. This localization result accurately corresponds to the AP site location under different lengths and sequence backgrounds, indicating that the method of this invention has good universality and reproducibility, and can meet the practical application requirements for high-resolution DNA damage localization.
Claims
1. A method for modifying the deoxyribose conformation of the AP site in a DNA molecule, characterized in that, A DNA molecule containing at least one AP site undergoes a condensation reaction with a hydrazine compound containing a -NH-NH2 functional group to form a hydrazone intermediate. The hydrazone intermediate is then reduced in the presence of a reducing agent, causing the deoxyribose at the AP site to change from a closed-loop configuration to a stable open-chain configuration.
2. The method as described in claim 1, characterized in that, The hydrazine compound is selected from one of the following: hydrazine-s-triazine derivatives, acylhydrazine compounds, and monosubstituted hydrazine compounds; the reducing agent is a pyridineborane reducing agent or sodium cyanoborohydride.
3. The method as described in claim 2, characterized in that, The structure of the hydrazine-s-triazine derivative is shown in Formula I: In Formula I, R represents an alkoxy, a monoalkyl-substituted amino, or a dialkyl-substituted amino. The monosubstituted hydrazine compound is a monoalkyl-substituted hydrazine, a monoaryl-substituted hydrazine, a monoarylalkyl-substituted hydrazine, a monoheteroarylalkyl-substituted hydrazine, or a monounsaturated aliphatic hydrocarbon-substituted hydrazine. The acylhydrazide compounds refer to compounds having the -CO-NH-NH2 acylhydrazide structure; The pyridineborane reducing agent is 2-methylpyridineborane.
4. The method as described in claim 3, characterized in that, The hydrazine compounds are selected from one of the following compounds: 2-hydrazyl-4,6-bis(dimethylamino)triazine, 2-hydrazyl-4,6-bis(diethylamino)triazine, 2-hydrazyl-4,6-bis(diisopropylamino)triazine, 2-hydrazyl-4,6-bis(di-n-propylamino)triazine, 2-hydrazyl-4,6-di(methoxy)triazine, 2-hydrazyl-4,6-di(ethoxy)triazine, 2-hydrazyl-4,6-di(methylamino)triazine, 2-hydrazyl-4,6-di(ethylamino)triazine, 2-hydrazyl-4,6-di(n-butylamino)triazine, propylhydrazine, isopropylhydrazine, phenylhydrazine, 3,5-dimethoxyphenylhydrazine, benzylhydrazine, phenethylhydrazine, pyridin-3-methylenehydrazine, 2-propynylhydrazine, acetylhydrazine, and biotinylhydrazine.
5. A method for regulating the catalytic behavior of nuclease 3'→5' exonucleases based on deoxyribose conformation, comprising the following steps: 1) Provide a DNA molecule containing at least one AP site; 2) The method according to any one of claims 1 to 4 modifies the deoxyribose conformation of the AP site in the DNA molecule; 3) The DNA molecule obtained in step 2) is co-incubated with a nuclease having 3'→5' exonuclease activity under suitable reaction conditions. The nuclease experiences stable catalytic stagnation one nucleotide downstream of the AP site where deoxyribose is converted to the open-chain conformation, thereby achieving controllable regulation of the nuclease's catalytic behavior.
6. The control method as described in claim 5, characterized in that, Step 1) The DNA molecule containing deoxyuridine is treated with uracil-DNA glycosidase to obtain a DNA molecule containing the AP site.
7. The control method as described in claim 5, characterized in that, The nuclease is a DNA polymerase or exonuclease with 3'→5' exonuclease activity.
8. The method for regulating the catalytic behavior of nuclease 3'→5' exonuclease as described in any one of claims 5 to 7 is used in high-resolution DNA damage localization, controllable DNA assembly, or detection of DNA oxidative damage levels.
9. The application as described in claim 8, characterized in that, In high-resolution DNA damage localization, the deoxyribose conformation of AP sites in DNA is first modified to achieve precise catalytic cessation of nucleases at a nucleotide downstream of the modified AP site. Then, by detecting the length and sequence of the remaining fragments after the T4 DNA polymerase digestion and modification of DNA stalls, the precise location of the AP site in the DNA molecule can be achieved.
10. The application as described in claim 8, characterized in that, In controlled DNA assembly, AP sites are first introduced at predetermined sites on the DNA fragment. Then, by modifying the deoxyribose conformation of the AP sites, a controllable stagnation effect on the catalytic degradation of nucleases is achieved, thereby regulating the degree of degradation of the DNA fragment by the nucleases and causing the DNA fragment to form sticky ends of predetermined length, thus realizing the directional splicing of the DNA fragment.
11. The application as described in claim 8, characterized in that, In the detection of DNA oxidative damage levels, multiple damaged bases are first removed by DNA glycosylation enzymes and converted into AP sites. Then, the AP sites are modified by deoxyribose conformation regulation. Nucleases stop at the modified AP sites to generate characteristic residual fragments. Probes are then designed based on the sequence of the residual fragments to construct a detection system based on nuclease stop signals, thereby realizing the detection of damage levels at specific sites in DNA.
Citation Information
Patent Citations
Sugar label reagent based on triazine structure as well as synthesis method and application thereof
CN102584728B