Chicken embryo fibroblast cell line, culture medium, domestication method and application thereof

By using the chicken embryo fibroblast suspension cell line CEF-P17 3D and its domestication method, employing carrier-free and serum-free suspension culture medium and progressive environmental stress passage, the problems of long culture cycle and cumbersome operation of chicken embryo fibroblast cell lines were solved, achieving efficient and stable large-scale culture, reducing production costs and pollution risks.

CN122256239APending Publication Date: 2026-06-23NANJING JOES FUTURE FOOD TECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610724212.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-25
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing chicken embryo fibroblast cell lines have long culture cycles and complicated operations, making them unsuitable for large-scale culture. They also pose risks of batch-to-batch serum variability and viral contamination.

Method used

We provide the chicken embryo fibroblast suspension cell line CEF-P17 3D and its acclimatization method. It adopts carrier-free and serum-free suspension culture medium and gradual environmental stress passage, and directly realizes the combination of suspension culture and immortalization in shake flasks, which simplifies the operation and shortens the acclimatization cycle.

Benefits of technology

It achieves efficient suspension growth under serum-free and carrier-free conditions, with stable cell function and phenotype, reduces batch instability and contamination risk caused by serum, is suitable for large-scale culture, and reduces production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256239A_ABST
    Figure CN122256239A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of animal cell culture technology, specifically relating to chicken embryo fibroblast cell lines, their culture media, acclimatization methods, and applications. This application provides a chicken embryo fibroblast cell line derived from… Gallus gallus The chicken embryo fibroblast suspension cell line CEF-P17 3D is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: C202661 and deposit date of March 31, 2026. This application also provides a culture medium for culturing the chicken embryo fibroblast cell line and a method for acclimatizing the chicken embryo fibroblast cell line, which shortens the acclimatization period, simplifies the operation, and is suitable for large-scale culture. This application also provides the application of the culture medium for the chicken embryo fibroblast cell line. Furthermore, this application also provides the application of the chicken embryo fibroblast cell line in the preparation of cultured meat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal cell culture technology, specifically relating to chicken embryo fibroblast cell lines, their culture media, domestication methods, and applications. Background Technology

[0002] In the large-scale production of cell-cultured meat, to achieve low cost, high efficiency, and simplified downstream processes, the ideal culture mode must meet two core conditions: first, serum-free culture to avoid quality fluctuations caused by batch-to-batch serum differences, reduce production costs, and meet food-grade production requirements; second, suspension culture, enabling cells to proliferate at high density in bioreactors, overcoming the limitation of adherent surface area, thus supporting the needs of industrial-scale production. Chicken embryo fibroblasts, due to their good proliferation potential and wide availability, have become ideal seed cells for chicken meat culture research; however, their natural adhesion dependence and serum requirement make them difficult to directly apply to the aforementioned ideal culture system.

[0003] In recent years, an Israeli research team has made groundbreaking progress in this field, with related findings published in *Nature Food*. The paper [Pasitka L, Cohen M, Ehrlich A, Spontaneous immortalization of chicken fibroblasts generates stable, high-yield cell lines for serum-free production of cultured meat[J]. *Nature Food*, 2023, 4: 35-50.] discloses the team's technical approach: first, through spontaneous immortalization, chicken embryo fibroblasts are allowed to overcome senescence and gain unlimited proliferative capacity; then, they are gradually domesticated into cell lines adapted to serum-free suspension culture, ultimately achieving high-density suspension growth. This research provides important technical validation for cell-cultured meat, demonstrating that chicken embryo fibroblasts have the potential to become suspension-domesticated cells. However, this step-by-step strategy of "first immortalization, then suspension domestication" has inherent limitations: the spontaneous immortalization process requires a long culture period, and the cells need to go through the senescence period in the adherent state before they can break through; on this basis, suspension domestication is carried out, which further prolongs the overall establishment time; and the immortalization steps are complicated to operate, requiring multiple steps such as preparing fibroblast spheres, dissociating the spheres, and mechanical perturbation, which is not suitable for large-scale culture and domestication.

[0004] Therefore, there is an urgent need to provide a chicken embryo fibroblast cell line and a domestication method that can adapt to carrier-free and serum-free suspension culture, shorten the domestication cycle, and has a simple operation process suitable for large-scale culture. Summary of the Invention

[0005] 1. The problem to be solved To address the technical problems of existing chicken embryo fibroblast cell lines, which employ a step-by-step strategy of first spontaneous immortalization and then suspension domestication, resulting in long culture cycles, cumbersome operations, and unsuitability for large-scale culture, this application provides a chicken embryo fibroblast cell line.

[0006] Furthermore, this application provides a culture medium for culturing the chicken embryo fibroblast cell line.

[0007] Furthermore, this application provides a method for domesticating chicken embryo fibroblast cell lines.

[0008] Furthermore, this application also provides the application of the culture medium for the chicken embryo fibroblast cell line.

[0009] This application also provides the application of the chicken embryo fibroblast cell line.

[0010] 2. Technical Solution To achieve the above objectives, the provided technical solution is as follows: The first aspect of this invention provides a chicken embryo fibroblast cell line, said chicken embryo fibroblast cell line being derived from... Gallus gallus The chicken embryo fibroblast suspension cell line CEF-P17 3D was deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:C202661 on March 31, 2026.

[0011] The second aspect of the present invention provides a culture medium for culturing the chicken embryo fibroblast cell line described in the first aspect of the present invention, comprising an amino acid component, a vitamin component, an inorganic salt component, and a cell supplementation factor; The amino acid composition includes glycine, alanine, arginine, asparagine, aspartic acid, cysteine, cystine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. The vitamin components include biotin, choline chloride, pantothenic acid, folic acid, nicotinamide, pyridoxine, riboflavin, thiamine, vitamin B12, and inositol. The inorganic salt components include calcium salts, copper salts, iron salts, magnesium salts, potassium salts, phosphates, and zinc salts; The cell-supplementing factors include hypoxanthine, linoleic acid, thymine, basic fibroblast growth factor, bovine serum albumin, insulin-like growth factor-1, leukemia inhibitory factor, vitamin C, L-ascorbic acid-2-phosphate trisodium salt, glucose, alpha-lipoic acid, sodium pyruvate, epidermal growth factor, cortisol, hepatocyte growth factor, N-acetylcysteine, shear protectant, anti-caking agent, and yeast extract.

[0012] The culture medium used to culture the chicken embryo fibroblast cell line is an iterative serum-free medium.

[0013] Preferably, the amino acid component comprises glycine, L-alanine, L-arginine monohydrochloride, L-asparagine, L-aspartic acid, L-cysteine ​​hydrochloride monohydrate, L-cysteine ​​dihydrochloride, L-glutamic acid, L-glutamine, L-histidine monohydrochloride monohydrate, L-isoleucine, L-leucine, L-lysine monohydrochloride, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine disodium hydrate, and L-valine. The vitamin components include biotin, choline chloride, D-pantothenic acid hemicalcium salt, folic acid, nicotinamide, pyridoxine hydrochloride, and ( )- Riboflavin, thiamine hydrochloride, vitamin B12 and inositol; Furthermore, the total concentration of the amino acid component is 1900 mg / L to 3800 mg / L; The total concentration of the vitamin components is 45 mg / L to 85 mg / L; The total concentration of the inorganic salt components is 500 mg / L to 1000 mg / L; In the cell supplement factor, the concentration range of glucose is 4200 mg / L to 7800 mg / L, the concentration range of yeast extract is 350 mg / L to 650 mg / L, and the concentration range of bovine serum albumin is 0.35 g / 100mL to 0.65 g / 100mL.

[0014] Preferably, the concentration of the shear protectant is 1× the working concentration, the concentration of the anti-clumping agent is 1× the working concentration, and the total concentration of the remaining cell supplementation factors, excluding glucose, yeast extract, bovine serum albumin, shear protectant and anti-clumping agent, ranges from 190 mg / L to 360 mg / L.

[0015] Preferably, the concentration range of any of the amino acid components is 10 mg / L to 700 mg / L; The concentration range of any of the vitamin components is 0.1 mg / L to 34 mg / L; The concentration range of any of the inorganic salt components is 0.003 mg / L to 400 mg / L; The concentration range of any of the remaining cell-supplementing factors is 0.007 mg / L to 85 mg / L.

[0016] Furthermore, the inorganic salt component comprises calcium chloride, copper sulfate, ferric nitrate, ferric sulfate, magnesium chloride, magnesium sulfate, potassium chloride, disodium hydrogen phosphate, sodium dihydrogen phosphate, and zinc sulfate; The shear protectant is poloxamer.

[0017] A third aspect of this invention provides a method for domesticating the chicken embryo fibroblast cell line described in the first aspect of this invention, comprising the following steps: Primary cell isolation: Chicken embryos were taken, cut into small pieces, digested with trypsin, and cultured in an adherent culture to obtain primary chicken embryo fibroblasts; Primary cell expansion culture: Primary chicken embryo fibroblasts were added to complete culture medium and expanded to generation P3-P5; Suspension culture acclimatization: Cells expanded to P3-P5 generation are digested and collected, placed in shake flasks, and serum-free medium is added for carrier-free suspension culture, so that the cell number goes through a process of decreasing, slow proliferation and then continuous proliferation. Long-term suspension culture: The serum-free culture medium is replaced with the culture medium of the chicken embryo fibroblast cell line described in the second aspect of the present invention. After the cell doubling time is shortened and the cell can proliferate stably and continuously, the chicken embryo fibroblast suspension cell line CEF-P17 3D is obtained.

[0018] Preferably, the serum-free culture medium includes a first serum-free culture medium and a second serum-free culture medium; the first serum-free culture medium is used for the first 346 days of suspension culture acclimatization; the second serum-free culture medium is used for the third 347 days to the fourth 444 days; and an iterative serum-free culture medium is used from the fourth 445 day onwards.

[0019] Furthermore, during the suspension culture acclimatization, the cell seeding density is 0.5 × 10⁻⁶. 6 Cells / mL ~ 1×10 6 Cells / mL; during long-term suspension culture, the cell seeding density is 2 × 10⁶ cells / mL. 5 Cells / mL ~3×10 5 per mL.

[0020] Furthermore, during the suspension culture acclimatization period from day 0 to day 60, cell counting and passage are performed every 3 to 4 days; from day 60 to day 385, cell counting and passage are performed every 6 to 7 days; and during the long-term suspension culture, cell counting and passage are performed every 3 to 4 days starting from day 385 of cell culture.

[0021] Furthermore, before day 260 of the suspension culture acclimatization, the shaking speed of the flask was 90 rpm; from day 260 onwards, the shaking speed of the flask was 120 rpm.

[0022] The shaking speed was initially low and then increased. The low fluid shear force generated at 90 rpm prevented the cells from dying in large numbers due to mechanical damage in the early stages. The low speed also facilitated cell aggregation into small clumps, maintaining intercellular signal communication. The later speed of 120 rpm generated stronger turbulence and shear force, which further screened out high-quality single cells that could maintain a high proliferation rate under strong shear conditions.

[0023] The fourth aspect of the present invention provides the application of the culture medium for the chicken embryo fibroblast cell line described in the second aspect of the present invention, wherein the culture medium is applied to the serum-free and carrier-free suspension proliferation culture of the chicken embryo fibroblast cell line.

[0024] The fifth aspect of the present invention provides the application of the chicken embryo fibroblast cell line described in the first aspect of the present invention, wherein the chicken embryo fibroblast cell line is applied to the preparation of cell-cultured meat.

[0025] Information on the preservation of biological materials: Preservation Name: Chicken Embryo Fibroblast Suspension Cell Line CEF-P17 3D Gallus gallus In accordance with the relevant provisions of the Patent Law, the biological material is deposited at the China Center for Type Culture Collection (CCTCC) on March 31, 2026, with accession number CCTCC NO:C202661, and the deposit address is Wuhan University, Wuhan, Hubei Province, China.

[0026] 3. Beneficial effects Compared with existing known technologies, the technical solution provided by this invention has the following beneficial effects: (1) The chicken embryo fibroblast cell line of the present invention is derived from Gallus gallus The chicken embryo fibroblast suspension cell line CEF-P17 3D, deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: C202661 and deposit date of March 31, 2026, is described in this invention. This chicken embryo fibroblast suspension cell line CEF-P17 3D can achieve suspension growth completely without serum and without relying on any microcarriers or adherent interfaces, thus eliminating batch instability, viral contamination risks, and the additional costs associated with introducing carriers. After suspension culture, it maintains its collagen-differentiating ability, effectively adheres to scaffold materials, maintains high cell viability, and exhibits excellent cell characteristics, functional and phenotypic stability.

[0027] (2) The culture medium for culturing chicken embryo fibroblast cell lines of the present invention, namely, the iterative serum-free culture medium, contains amino acid components, vitamin components, inorganic salt components, and cell supplementation factors. The amino acid components include glycine, alanine, arginine, asparagine, aspartic acid, cysteine, cystine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. The vitamin components include biotin, choline chloride, pantothenic acid, folic acid, nicotinamide, and pyridoxine. The formula contains pyridoxine, riboflavin, thiamine, vitamin B12, and inositol; inorganic salt components include calcium, copper, iron, magnesium, potassium, phosphate, and zinc salts; cell-supplementing factors include hypoxanthine, linoleic acid, thymine, basic fibroblast growth factor, bovine serum albumin, insulin-like growth factor-1, leukemia inhibitory factor, vitamin C, L-ascorbic acid-2-phosphate trisodium salt, glucose, alpha-lipoic acid, sodium pyruvate, epidermal growth factor, cortisol, hepatocyte growth factor, N-acetylcysteine, shear protectant, anti-caking agent, and yeast extract. The formula is entirely proprietary, reducing external dependence and costs. The process is highly integrated, facilitating large-scale scaling; achieving a complete technological closed loop from cell domestication to large-scale expansion culture. Compared to existing serum-free culture media (Comparative Example 1), the iterative serum-free culture medium of this application results in a higher fold increase in cell proliferation. This iterative serum-free culture medium is designed based on the metabolic characteristics of domesticated cells, with clearly defined component concentrations. It contains no serum, reducing the uncertainty caused by batch-to-batch variations in serum and improving the consistency of the culture system. It supports stable cell proliferation in bioreactors, exhibiting excellent batch stability and overcoming the drawbacks of traditional serum-containing culture media, such as large batch-to-batch variations and potential safety hazards.

[0028] (3) The method for domesticating the chicken embryo fibroblast cell line of the present invention includes: primary cell isolation: chicken embryos are taken, cut into pieces, digested with trypsin, and cultured on the wall to obtain primary chicken embryo fibroblasts; primary cell expansion culture: primary chicken embryo fibroblasts are added to complete culture medium for expansion culture to P3~P5 generation; suspension culture domestication: cells expanded to P3~P5 generation are digested and collected, placed in shake flasks, and serum-free culture medium is added for carrier-free suspension culture, so that the cell number experiences a decrease, slow proliferation to a continuous proliferation state; long-term suspension culture: the serum-free culture medium is replaced with the iterative serum-free culture medium developed in this application, and the cell doubling time is shortened and continuous stable proliferation is achieved to obtain the chicken embryo fibroblast suspension cell line CEF-P17 3D. This invention offers a radically different technical approach, unlike the "step-by-step" strategy employed by the Israeli team. Firstly, it integrates suspension culture and immortalization processes, directly subjecting chicken embryo fibroblasts to gradual environmental stress and adaptive passage in a shake-flask suspension culture system. During this process, cells naturally undergo senescence (a decrease in cell number) in suspension and then overcome senescence to achieve immortalization characteristics in a dynamic culture environment; thus, suspension culture and immortalization are completed simultaneously. Secondly, this invention directly uses early-generation primary chicken embryo fibroblasts for carrier-free and serum-free suspension culture. Through continuous passage culture, it eliminates dependence on serum and solid-phase microcarriers. The culture process is simple, effectively reduces the risk of exogenous factor contamination, shortens the culture cycle, and is suitable for large-scale culture.

[0029] (4) Application of the culture medium of the chicken embryo fibroblast cell line of the present invention: This culture medium is applied to the serum-free and carrier-free suspension proliferation culture of the chicken embryo fibroblast cell line. By using an iterative serum-free culture medium with relatively well-defined components prepared in-house, the high cost of commercial culture media is avoided. The components of the iterative serum-free culture medium are designed based on the cell metabolic characteristics to achieve a higher expansion fold. Using this culture medium, the cell density reaches 6.95 × 10⁻⁶ after 3 days of culture in a bioreactor. 5 The cell density increased by 3.58 times to 1.44 × 10⁹ / mL, reaching its peak on day 5. 6 / mL, cell proliferation 7.42-fold; ensuring safety and consistency, achieving efficient, stable, low-cost, and scalable expansion of domesticated cell lines in bioreactors, laying a solid foundation for industrial applications.

[0030] (5) The application of the chicken embryo fibroblast cell line of the present invention is to apply the chicken embryo fibroblast cell line to the preparation of cell cultured meat, which provides a seed cell resource and core technology solution with simpler process, shorter cycle, better cost and more complete supporting facilities for the industrial production of cell cultured meat; the application of this cell line to the production of cell cultured meat significantly improves the production safety, scalability and economy, and provides a high-performance seed cell that can be industrially cultured for the industrialization of cell cultured meat, which has important industrial application value and broad market prospects. Attached Figure Description

[0031] Figure 1 This is a diagram showing the growth status of primary chicken embryo fibroblasts CEF-P17 2D expanded to the P2 generation. Figure 2 This is a diagram showing the long-term suspension culture cell proliferation of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention. Figure 3 The cell morphology of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention was obtained on day 550. Figure 4 This image shows the cell proliferation of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention in iterative serum-free medium during suspension culture. Figure 5 This is a comparison of cell proliferation of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention in suspension culture in iterative serum-free medium and existing serum-free medium. Figure 6 The collagen differentiation of the chicken embryo fibroblast suspension cell line CEF-P17 3D after culturing in iterative serum-free medium according to the present invention is shown. Figure 7 The proliferation of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention in a bioreactor was observed using iterative serum-free medium. Figure 8 This image shows a comparison between the attachment of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention on the scaffold and a blank scaffold; wherein... Figure 8 In the diagram, 'a' represents a blank scaffold diagram. Figure 8 In the image, b is the CEF-P17 3D mounting image on the bracket; Figure 9 The survival of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention on a scaffold after being cultured in iterative serum-free medium; wherein... Figure 9 In the image, 'a' represents a live-cell staining pattern with calcein AM. Figure 9 In the image, b represents a staining pattern of dead cells with propidium iodide. Figure 9 In the image, 'c' represents a superimposed image of staining live and dead cells. Detailed Implementation

[0032] To further understand the content of this invention, the invention will be described in detail with reference to the embodiments.

[0033] The present application will be further described below with reference to specific embodiments.

[0034] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0035] As used herein, the term “about” is used to provide for the flexibility and imprecision associated with a given term, measure, or value. Those skilled in the art can readily determine the degree of flexibility for a particular variable. As used herein, the term “at least one of…” is intended to be synonymous with “one or more of…”. For example, “at least one of A, B, and C” explicitly includes only A, only B, only C, and combinations thereof.

[0036] Concentration, amount, and other numerical data may be presented in range format herein. It should be understood that such range format is used solely for convenience and brevity and should be flexibly interpreted to include not only the values ​​explicitly stated as the limits of the range, but also all individual values ​​or subranges encompassed within the range, as if each value and subrange were explicitly stated. For example, a range of values ​​from about 1 to about 4.5 should be interpreted to include not only the explicitly stated limits of 1 to 4.5, but also individual numbers (such as 2, 3, 4) and subranges (such as 1 to 3, 2 to 4, etc.). The same principle applies to ranges that describe only a single value, such as "less than about 4.5," which should be interpreted to include all the values ​​and ranges described above. Furthermore, this interpretation should apply regardless of the breadth of the range or characteristic described.

[0037] The full English names and Chinese names of some abbreviations used in this application are shown in Table 1.

[0038] Table 1. Full English Names and Chinese Names of Abbreviations

[0039] Example 1 This embodiment provides a method for domesticating a chicken embryo fibroblast cell line, using primary chicken embryo fibroblasts as the original cell line, and includes the following steps: S1. Primary cell isolation: Take 10-day-old vigorous chicken embryos, remove the limbs, internal organs, and head of the embryo, wash the remaining embryo with PBS, and then cut the embryo into small pieces (1 mm). 3Add 4-5 times the volume of 0.25% trypsin to small pieces of embryonic tissue, mix thoroughly, and incubate at 37°C for 30 minutes, shaking every 10 minutes. After 30 minutes, the chopped embryonic tissue will appear as a very viscous flocculent mass. At this point, terminate the trypsin reaction with DMEM containing 10% fetal bovine serum. Repeatedly pipette until no tissue fragments are visible, and filter through a 40 μm cell sieve. Centrifuge and resuspend, and stain a small amount of cell suspension with 0.4% trypan blue for cell counting. Equilibrate 10 cm culture dishes containing 8 mL of complete culture medium at 39°C for 5-10 minutes beforehand, then add 1.5 × 10⁻⁶ cells / cm². 6 Dispense the cells into culture dishes containing complete culture medium, seed them in a zigzag pattern, and shake to mix. Incubate at 39°C, 5% CO2 for 4-6 hours. After the cells adhere, remove the unattached cells from the supernatant, replace with fresh complete culture medium, and continue culturing to obtain primary chicken embryo fibroblasts.

[0040] Complete culture medium: DMEM medium containing 2.5 ng / mL Basic Fibroblast Growth Factor (bFGF) and 10% fetal bovine serum.

[0041] S2. Primary cell expansion culture: After isolation, cells are cultured until confluence reaches 80-85%, then digested and passaged. Cells are then cultured at a rate of 3 × 10⁶ cells / year. 5 / cells were seeded into 10 cm culture dishes (containing 8 mL of complete culture medium) and incubated at 39 °C in a 5% CO2 incubator. The remaining cells were cryopreserved as P0 generation cells. The medium was changed after 2 days, and the cells were passaged after 3 days. Cells showed good growth. Figure 1 This image shows the growth status of primary chicken embryo fibroblasts CEF-P17 2D expanded to the P2 generation; subsequently, the cells were expanded to the P4 generation for subsequent shake-flask acclimation.

[0042] S3. Acclimation of Chicken Embryo Fibroblasts to Carrier-Free and Serum-Free Suspension Culture: The P4 generation cells expanded in step S2 were digested and collected. The cells were placed in a 125 mL shake flask, and 20 mL of serum-free culture medium was added. The total number of cells inoculated was 2 × 10⁶. 7 The cell density is 1×10 6Cells were cultured at 90 rpm with a cell density of 10 cells / mL for suspension culture. From day 0 to 60 after culture, cells were counted and passaged every 3-4 days. The cell suspension was collected in 50 mL centrifuge tubes, centrifuged at 330 g for 5 min, the supernatant was removed, and 5-10 mL of culture medium was added for resuspending. Cells were counted again. If cell proliferation was not observed, 20 mL of fresh serum-free medium was added to reconnect all cells to the shake flask for continued culture. By day 30, no significant cell proliferation was observed, and the cell count began to decline. After day 60, cells were passaged every 6-7 days. Cultured until day 260, the culture was maintained at 120 rpm, and long-term passage was continued, recording cell proliferation. By day 335, the cell doubling time gradually shortened. By day 347, the serum-free medium was replaced with serum-free medium, and cells began to exhibit continuous proliferation.

[0043] First serum-free culture medium: Culture medium ZZ07 (manufacturer: Jianshun Biotechnology (Nantong) Co., Ltd.; item number: IMB25020): EX-CELL® CHO cloning medium (manufacturer: Sigma-Aldrich Co. LLC; item number: C6366) = 1:1 mixed to form a mixed culture medium. Cell culture supplement factor is added to the mixed culture medium. The supplement factor refers to the cell culture supplement factor in Example 2 of Chinese Invention Patent CN114574433A.

[0044] Second serum-free culture medium: Acgro serum-free culture medium (manufacturer: Shanghai Beianji Biotechnology Co., Ltd.; product number: TP0112904), with added cell culture supplement factor, the supplement factor refers to the cell culture supplement factor in Example 2 of Chinese Invention Patent CN114574433A.

[0045] S4. Long-term suspension culture of chicken embryo fibroblasts without carrier or serum: Starting from day 385, cells were passaged and counted every 3-4 days, and the seeding density was adjusted to 2.5 × 10⁻⁶ cells / day. 5 Cells / mL. On day 445, the second serum-free medium was replaced with an iterative serum-free medium. On day 505, the doubling time was further shortened to 33.58 h, and the cells were able to proliferate stably (e.g., ...). Figure 2 As shown in the figure, a chicken embryo fibroblast cell line adapted for carrier-free and serum-free suspension culture was obtained, and its preservation name is Chicken Embryo Fibroblast Suspension Cell Line CEF-P17 3D. Gallus gallus It is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:C202661 and deposit date of March 31, 2026.

[0046] During the suspension culture acclimation process of chicken embryo fibroblasts, cell death occurs, leading to a decrease in overall cell density. To maintain cell state and normal diameter at low density, a more complex serum-free medium is used from day 0 to 346. After cells overcome senescence, a second serum-free medium that promotes cell proliferation is used from day 347 to 444, which helps cell proliferation. Once cell proliferation stabilizes, the iterative serum-free medium described in this application is used for long-term suspension culture from day 445, allowing for sustained and stable cell proliferation.

[0047] Figure 2 This image shows the long-term suspension culture cell proliferation of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention.

[0048] Figure 2 A cell doubling time graph was plotted with days on the x-axis and doubling time (h) on the y-axis. In the early suspension adaptation phase, the total cell count initially decreased and then slowly increased. The cell doubling time fluctuated significantly and lasted for a long time. From day 335 to 388, the cell doubling time shortened from 900 h to 100 h. Further passage to day 391 resulted in a doubling time of less than 100 hours, eventually stabilizing at 30-50 h. This indicates that through long-term acclimatization, cell proliferation efficiency was significantly improved, ultimately reaching a stable state and adapting to long-term carrier-free and serum-free suspension culture.

[0049] Example 2 This embodiment provides a method for preparing a culture medium (iterative serum-free medium) for chicken embryo fibroblast cell lines, including the following steps: Taking the preparation of 1L of culture medium as an example, take 800 mL of purified water, weigh the amino acid components, vitamin components and inorganic salt components according to the concentrations in Table 2 and add them to the water. Stir for 10 minutes to mix well. Adjust the pH of the culture medium to 9.05 with 5 mol / L sodium hydroxide solution and stir thoroughly for 30 minutes. Then adjust the pH back to 7.0 with 6 mol / L dilute hydrochloric acid. Then add 1.9 g of sodium bicarbonate powder, dissolve it and adjust the pH to 7.0. Adjust the volume of the solution to 1 L with purified water. Finally, adjust the osmotic pressure of the solution with sodium chloride powder to control it at 300 mOsmol / kg. Stir for 5 minutes. Finally, add cell supplementation factor according to the concentration in Table 2. Finally, filter to obtain the culture medium.

[0050] Table 2. Components and concentrations of iterative serum-free culture medium

[0051] (1) Detection of proliferation characteristics in suspension culture with iterative serum-free medium: Chicken embryo fibroblast suspension cell line CEF-P173D cells were cultured to day 445 and then cultured in iterative serum-free medium. Cells were passaged and counted every 3 days, and the seeding density was 2.5 × 10⁻⁶ cells / day. 5 per mL.

[0052] Figure 3 The cell morphology of the chicken embryo fibroblast suspension cell line CEF-P17 3D passed on to day 550 of this application.

[0053] Depend on Figure 3 It can be seen that using an iterative serum-free culture medium to culture cells can maintain a good cell viability, and the cells exhibit a regular, translucent spherical shape and are in good condition.

[0054] Figure 4 This image shows the cell proliferation of the chicken embryo fibroblast suspension cell line CEF-P17 3D of this application in iterative serum-free culture medium.

[0055] Depend on Figure 4 It can be seen that the cell line can proliferate continuously and stably, with a maximum proliferation fold of 5.08 after 3 days of cell culture and a doubling time of 30.71 h.

[0056] (2) Detection of collagen differentiation capacity after suspension culture in iterative serum-free medium: Chicken embryo fibroblast suspension cell line CEF-P17 3D cells were cultured in iterative serum-free medium for 565 days, and the cells were harvested at 1×10⁻⁶. 6 Cells were seeded at a density of [number] cells / well and seeded into 6-well plates. They were cultured for 2-3 days in serum-containing complete medium (DMEM containing 2.5 ng / mL bFGF and 10% fetal bovine serum) to ensure complete cell adhesion and confluence. After confluence, differentiation was induced using serum-free medium to induce in vitro matrix protein production (refer to Example 1 of Chinese Invention Patent Publication No. CN116769702A). The medium was changed every 2 days. On differentiation days 0 and 5 (D0 and D5), the cultured cells were washed with PBS and collected for qPCR detection of collagen-related genes to identify the cells' extracellular matrix secretion potential. Collagen differentiation-related genes include type I collagen α1 chain (Collagen I α1), type IV collagen α1 chain (Collagen IV α1), and the internal control gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

[0057] The nucleotide sequence (5'→ 3') of the Collagen I α1 forward primer is shown in SEQ ID NO:1.

[0058] SEQ ID NO:1: agagagaggtgagcagggtc The nucleotide sequence (5'→3') of the Collagen I α1 Reverse primer is shown in SEQ ID NO:2.

[0059] SEQ ID NO:2: cccttagcaccgtcgtttc The nucleotide sequence (5'→3') of the Collagen IV α1 forward primer is shown in SEQ ID NO:3.

[0060] SEQ ID NO:3: ctgactggaagcataggacc The nucleotide sequence (5'→3') of the Collagen IV α1 Reverse primer is shown in SEQ ID NO:4.

[0061] SEQ ID NO:4: aagcccatgtagcccttc The nucleotide sequence (5'→3') of the glyceraldehyde-3-phosphate dehydrogenase forward primer (GAPDH Forward) is shown in SEQ ID NO:5.

[0062] SEQ ID NO:5: gagggtagtgaaggctgtatc The nucleotide sequence (5'→3') of the glyceraldehyde-3-phosphate dehydrogenase reverse primer (GAPDH Reverse) is shown in SEQ ID NO:6.

[0063] SEQ ID NO:6: cacaacacggttgctgtatc Primer sequences SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 are referenced in [Du Hongting. Study on the expression regulation of COL4A1 collagen gene by FOXL2 in chicken granular cells [D]. Wuhan: Huazhong Agricultural University, 2020.] Figure 6This paper presents the collagen differentiation of the chicken embryo fibroblast suspension cell line CEF-P17 3D after iterative serum-free culture medium. After collagen-induced differentiation, the expression of Collagen I α1 and Collagen IV α1 genes was significantly upregulated compared with the undifferentiated group, with Collagen IV α1 showing the most significant upregulation, approximately 5.5 times that of the undifferentiated group. This indicates that chicken embryo fibroblast suspension cells still possess collagen differentiation ability after long-term passage culture.

[0064] The iterative serum-free culture medium of this embodiment is adapted to the carrier-free and serum-free suspension culture of chicken embryo fibroblast suspension cell line CEF-P17 3D. The iterative serum-free culture medium of this embodiment can be used for long-term passage culture in shake flasks.

[0065] Comparative Example 1 This comparative example provides an existing serum-free culture medium. The chicken embryo fibroblast suspension cell line CEF-P173D of the present invention is cultured in suspension using an existing serum-free culture medium. The operation steps are as follows: Chicken embryo fibroblast suspension cell line CEF-P17 3D was cultured to day 445, and then cultured using existing serum-free medium. Cells were passaged and counted every 3 days at a seeding density of 2.5 × 10⁶ cells / day. 5 per mL.

[0066] Existing serum-free culture medium: Refer to the culture medium in Example 2 of Chinese Patent CN120249193B.

[0067] Figure 5 This is a comparison of cell proliferation of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention in suspension culture in iterative serum-free medium and existing serum-free medium.

[0068] Depend on Figure 5 It can be seen that the iterative serum-free culture medium maintained a stable cell proliferation rate of 3-4 times throughout the entire observation period (457-484 days), demonstrating good batch stability. In contrast, the existing serum-free culture medium only maintained a proliferation rate of around 1 time, and even fell below 1 time in the later stages, indicating that cell death exceeded proliferation and it could not sustain long-term culture. Therefore, the iterative serum-free culture medium of Example 2 was significantly superior to the existing serum-free culture medium of Comparative Example 1 during long-term culture, greatly improving the cell proliferation capacity.

[0069] Example 3 This embodiment provides the application of culture medium for chicken embryo fibroblast cell lines. The chicken embryo fibroblast suspension cell line CEF-P17 3D is cultured in a bioreactor using iterative serum-free culture medium for suspension scale-up. The specific steps include the following: (1) Chicken embryo fibroblasts that were successfully suspended and passaged to day 562 were transferred to a 3 L bioreactor for scale-up culture. 2.33 × 10 8 One cell was added to 1.2 L of iterative serum-free culture medium, with a cell density of 1.94 × 10⁶ cells / mL. 5 The sample size was 100 cells / mL, and the rotation speed was 120 rpm.

[0070] (2) 10 mL of cell suspension was drawn every day to detect cell growth and metabolic indicators.

[0071] (3) After 3 days of culture in a 3 L bioreactor, the cell density reached 6.95 × 10⁻⁶. 5 At 1.44 × 10⁶ / mL, the cell density increased 3.58-fold, reaching a peak of 1.44 × 10⁶ / mL on day 5, representing a 7.42-fold increase. However, the viability decreased to 61.5%, at which point the culture was terminated (see Table 3). In contrast, after 3 days of shake-flask culture, the cells increased 3.01-fold, and by day 5, they had increased 3.67-fold (see Table 4). Therefore, under the 3-day passage culture condition, the chicken embryo fibroblast cell line can proliferate well in a bioreactor, enabling suspension-scale culture, such as... Figure 7 The proliferation of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention in a bioreactor using iterative serum-free medium.

[0072] Table 3. Scale-up results of CEF-P17 3D suspension culture in a bioreactor

[0073] Table 4. Cultivation results of CEF-P17 3D in shake flasks

[0074] Example 4 This embodiment provides the application of chicken embryo fibroblast cell lines in the preparation of cultured meat, focusing on evaluating their attachment and survival ability on plant polysaccharide-protein gel scaffolds, specifically including the following steps: (1) Sterilization of plant polysaccharide protein gel scaffold: Immerse the plant polysaccharide protein gel scaffold in ultrapure water at room temperature until it is fully expanded. Then, take out the scaffold, put it in an Erlenmeyer flask and seal it. Sterilize it at 121 °C for 30 min. Immerse the sterilized scaffold in iterative serum-free culture medium and place it in a 39 °C incubator for later use.

[0075] (2) Cell seeding: Using tweezers, insert the plant polysaccharide-protein gel scaffold soaked in iterative serum-free medium into a 24-well plate, and gently squeeze to remove excess medium; take 100 μL of cell suspension, with a total cell count of 1×10⁻⁶. 6The cells were evenly seeded onto a plant polysaccharide-protein gel scaffold. After seeding, the cells were transferred to a 39 ℃ incubator and allowed to stand for 4 h. Once the cells had migrated to the scaffold, 1 mL of the iterative serum-free culture medium of this application was added to the culture dish, and the dish was placed in a 39 ℃ incubator for further culture.

[0076] (3) Microscopic observation of cell adhesion: After 24 hours of culture, the adhesion of chicken embryo fibroblast suspension cell lines to the plant polysaccharide-protein gel scaffold was observed and recorded under a microscope, such as... Figure 8 As shown, cells can adhere to the scaffold.

[0077] Figure 8 This image shows a comparison between the attachment of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention on the scaffold and a blank scaffold; wherein... Figure 8 In the diagram, 'a' represents a blank scaffold diagram. Figure 8 In the diagram, b is the CEF-P17 3D attachment on the bracket.

[0078] (4) Observation of cell attachment and survival through cell viability staining: To further confirm the cell attachment and survival on the scaffold, the cells were stained using a cell viability (live and dead cell staining) assay kit. ① Preparation of working solution: Take out the Calcein AM and PI reagent stock solutions and equilibrate at room temperature for 30 min. Add 5 µL of PI reagent stock solution to 10 mL of PBS / culture medium, vortex to mix, and obtain 8 µM PI working solution. Add 5 µL of Calcein AM reagent stock solution to 10 mL of PI working solution, vortex to mix, and obtain 2 µM Calcein AM working solution. The obtained working solution (2 µM Calcein AM and 8 µM PI) can be directly used to stain cells. ② Cell staining and fluorescence microscopy detection: Remove the culture medium supernatant from the 24-well plate, gently add 1 mL of the above-prepared working solution along the wall to ensure complete immersion of the scaffold and attached cells, and incubate at room temperature in the dark for 30 min to 45 min. After incubation, the labeled cells were observed under a fluorescence microscope. Calcein AM (Ex / Em: 495 nm / 520 nm) emitted green fluorescence, and PI (Ex / Em: 530 nm / 620 nm) emitted red fluorescence.

[0079] Figure 9 The survival of the chicken embryo fibroblast suspension cell line CEF-P17 3D of the present invention on a scaffold after being cultured in iterative serum-free medium; wherein... Figure 9 In the image, 'a' represents a live-cell staining pattern with calcein AM. Figure 9 In the image, b represents a staining pattern of dead cells with propidium iodide. Figure 9 In the image, 'c' represents a superimposed image of staining live and dead cells.

[0080] Viability staining results showed that the cells exhibited a relaxed spindle-shaped morphology on the plant polysaccharide-protein gel scaffold, with good cell adhesion and almost no cell death, resulting in good cell viability after adhesion. This indicates that the chicken embryo fibroblast suspension cell line CEF-P17 3D, adapted to carrier-free and serum-free suspension culture, can adhere well to the surface of the plant polysaccharide-protein gel scaffold and survive well, making it suitable for preparing cell-cultured meat.

[0081] In summary, this invention successfully constructed a chicken embryo fibroblast cell line and its supporting culture system adapted to carrier-free and serum-free suspension culture by combining a simultaneous domestication strategy that integrates suspension domestication and immortalization processes with a self-developed iterative serum-free suspension culture medium. Compared with existing technologies, this invention not only significantly shortens the overall domestication cycle and avoids the cumbersome steps of first achieving adherence immortalization and then suspension adaptation, but also achieves efficient expansion of the chicken embryo fibroblast suspension cell line CEF-P17 3D through a customized iterative serum-free culture medium. This provides a simpler, shorter, more cost-effective, and more complete seed cell resource and core technology solution for the industrial production of cell-cultured meat, possessing significant industrial application value and broad market prospects.

[0082] The embodiments described above merely illustrate preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications, improvements, and substitutions without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A chicken embryo fibroblast cell line, characterized in that: The chicken embryo fibroblast cell line is derived from Gallus gallus The chicken embryo fibroblast suspension cell line CEF-P17 3D was deposited at the China Center for Type Culture Collection (CCTCCNO:C202661) on March 31, 2026.

2. A culture medium for culturing the chicken embryo fibroblast cell line of claim 1, characterized in that: It contains amino acid components, vitamin components, inorganic salt components, and cell-replenishing factors; The amino acid composition includes glycine, alanine, arginine, asparagine, aspartic acid, cysteine, cystine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. The vitamin components include biotin, choline chloride, pantothenic acid, folic acid, nicotinamide, pyridoxine, riboflavin, thiamine, vitamin B12, and inositol. The inorganic salt components include calcium salts, copper salts, iron salts, magnesium salts, potassium salts, phosphates, and zinc salts; The cell-supplementing factors include hypoxanthine, linoleic acid, thymine, basic fibroblast growth factor, bovine serum albumin, insulin-like growth factor-1, leukemia inhibitory factor, vitamin C, L-ascorbic acid-2-phosphate trisodium salt, glucose, alpha-lipoic acid, sodium pyruvate, epidermal growth factor, cortisol, hepatocyte growth factor, N-acetylcysteine, shear protectant, anti-caking agent, and yeast extract.

3. The culture medium for culturing chicken embryo fibroblast lines according to claim 2, characterized in that: The total concentration of the amino acid components is 1900 mg / L to 3800 mg / L; The total concentration of the vitamin components is 45 mg / L to 85 mg / L; The total concentration of the inorganic salt components is 500 mg / L to 1000 mg / L; In the cell supplement factor, the concentration range of glucose is 4200 mg / L to 7800 mg / L, the concentration range of yeast extract is 350 mg / L to 650 mg / L, and the concentration range of bovine serum albumin is 0.35 g / 100mL to 0.65 g / 100mL.

4. The culture medium for culturing chicken embryo fibroblast lines according to claim 2, characterized in that: The inorganic salt components include calcium chloride, copper sulfate, ferric nitrate, ferric sulfate, magnesium chloride, magnesium sulfate, potassium chloride, disodium hydrogen phosphate, sodium dihydrogen phosphate, and zinc sulfate. The shear protectant is poloxamer.

5. The method for domesticating the chicken embryo fibroblast cell line according to claim 1, characterized in that: Includes the following steps: Primary cell isolation: Chicken embryos were taken, cut into small pieces, digested with trypsin, and cultured in an adherent culture to obtain primary chicken embryo fibroblasts; Primary cell expansion culture: Primary chicken embryo fibroblasts were added to complete culture medium and expanded to generation P3-P5; Suspension culture acclimatization: Cells expanded to P3-P5 generation are digested and collected, placed in shake flasks, and serum-free medium is added for carrier-free suspension culture, so that the cell number goes through a process of decreasing, slow proliferation and then continuous proliferation. Long-term suspension culture: Replace the serum-free culture medium with the culture medium according to any one of claims 2-4, and obtain the chicken embryo fibroblast suspension cell line CEF-P17 3D after the cell doubling time is shortened and it can proliferate continuously and stably.

6. The method for domesticating chicken embryo fibroblast cell lines according to claim 5, characterized in that: During the suspension culture acclimatization, the cell seeding density was 0.5 × 10⁻⁶. 6 Cells / mL ~ 1×10 6 Cells / mL; during long-term suspension culture, the cell seeding density is 2.0 × 10⁶ cells / mL. 5 cells / mL ~3.0×10 5 per mL.

7. The method for domesticating chicken embryo fibroblast cell lines according to claim 5, characterized in that: During the suspension culture acclimatization period from day 0 to day 60, cells are counted and passaged every 3 to 4 days; from day 60 to day 385, cells are counted and passaged every 6 to 7 days; during the long-term suspension culture, cells are counted and passaged every 3 to 4 days starting from day 385.

8. The method for domesticating chicken embryo fibroblast cell lines according to claim 5, characterized in that: Before day 260 of the suspension culture acclimatization, the shaking speed was 90 rpm; from day 260 onwards, the shaking speed was 120 rpm.

9. The application of the culture medium for the chicken embryo fibroblast cell line according to any one of claims 2-4, characterized in that: The culture medium was applied to serum-free and carrier-free suspension proliferation culture of chicken embryo fibroblasts.

10. The application of the chicken embryo fibroblast cell line according to claim 1, characterized in that: The chicken embryo fibroblast cell line was used in the preparation of cultured meat.

Citation Information

Patent Citations

  • A serum-free culture medium for in vitro suspension culture of porcine muscle stem cells and its application

    CN120249193B

  • Systems and methods for growing cells in vitro

    CN109714962A

  • Preparation method of avian infectious bursal disease virus live vaccine

    CN109913404A

  • Culture medium with definite chemical components for in-vitro proliferation of muscle-derived cells

    CN114574433A

  • Improved culture medium with definite chemical components for inducing generation of in-vitro matrix protein and application of improved culture medium

    CN116769702A