Novel mutations in ankrin repeat domain containing 11 associated with KBG syndrome and uses thereof

By detecting ANKRD11 gene mutants and constructing cell models, the unresolved molecular pathogenesis mechanism of KBG syndrome has been addressed, enabling early gene diagnosis and personalized intervention, supporting the development of targeted therapy, and improving the accuracy of screening and diagnosis of KBG syndrome.

CN122256365APending Publication Date: 2026-06-23QINGDAO WOMEN & CHILDREN HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
QINGDAO WOMEN & CHILDREN HOSPITAL
Filing Date
2026-04-01
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively explain the molecular pathogenesis of KBG syndrome, and there is a lack of early genetic diagnosis and personalized intervention methods. Furthermore, the development of targeted therapy strategies has not been fully studied.

Method used

We provide ANKRD11 gene mutants and their detection methods. Through the design of nucleic acids and peptides, we can screen individuals at risk for KBG syndrome and construct cell models with low p53 protein expression for research and clinical diagnosis.

Benefits of technology

This study broadened the pathogenic gene spectrum of KBG syndrome, provided a scientific basis for early gene diagnosis and personalized intervention, supported the development of targeted therapy strategies, and improved the accuracy of screening and diagnosis of KBG syndrome.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure REF-OBJ-1774933280378-000002
    Figure REF-OBJ-1774933280378-000002
  • Figure REF-OBJ-1774933280378-000003
    Figure REF-OBJ-1774933280378-000003
  • Figure REF-OBJ-1774933280378-000004
    Figure REF-OBJ-1774933280378-000004
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and specifically discloses a new mutation of ANKRD11 related to KBG syndrome and application thereof. The ANKRD11 gene mutation is any one of the following: a nucleic acid, the nucleic acid has a target fragment, and the target fragment is compared with a wild-type ANKRD11 gene with a sequence of SEQ ID NO. 1, nucleotides from No. 6281 to No. 6282 are deleted; a polypeptide, compared with a protein encoded by a wild-type ANKRD11 gene with a sequence of SEQ ID NO. 2, has a p.L2095Gfs*6 mutation. The application also relates to application of a reagent for detecting the aforementioned ANKRD11 gene mutation in screening of a KBG syndrome risk population. In the disclosure, the pathogenic gene spectrum of KBG syndrome is widened, the understanding of the disease is strengthened, experience is provided for clinical screening and diagnosis of the disease, and a basis is provided for prenatal diagnosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to novel mutations of ANKRD11 associated with KBG syndrome and their applications. Background Technology

[0002] KBG syndrome (KBGS) is a rare autosomal dominant multisystemic developmental disorder whose pathogenesis is closely related to the loss of function of the ANKRD11 gene (encoding ankyrin repeat domain protein 11, OMIM 611192). Studies such as "The chromatin regulator Ankrd11 controls cardiac neuralcrest cell-mediated outflow tract remodeling and heart function," "Insights into the ANKRD11 variants and short-stature phenotype through literature review and ClinVar database search," and "ANKRD11 binding to cohesin suggests a connection between KBG syndrome and Cornelia de Lange syndrome" have all confirmed that abnormal ANKRD11 protein function can induce KBG syndrome. Various mutation types of this gene, such as frameshift mutations, nonsense mutations, missense mutations, splice site mutations, and microdeletions in the 16q24.3 region of chromosome 16, can all lead to abnormal ANKRD11 protein function, resulting in highly heterogeneous clinical manifestations. Its main clinical features include short stature, distinctive facial features, macrodontia, delayed neurodevelopment, skeletal abnormalities, and epilepsy.

[0003] In current global reports of KBG syndrome cases, single-base mutations or small insertions / deletions in the ANKRD11 gene cause approximately 78.0% of cases, while 16q24.3 microdeletions are associated with the remaining 22.0%. De novo mutations account for a large proportion, approximately 81.9% of single-gene mutations and 75.0% of chromosomal deletions. In terms of mutation type distribution, frameshift mutations are the most common (approximately 65.2%), followed by nonsense mutations (approximately 27.3%), with other types of mutations being less frequent. In-depth analysis of ANKRD11 gene mutants not only helps elucidate the molecular pathogenesis of KBG syndrome but also provides important scientific evidence for early genetic diagnosis, genetic counseling, and personalized intervention. Furthermore, functional studies based on ANKRD11 mutants can provide a crucial molecular basis for the development of targeted therapy strategies and the screening of specific drugs, demonstrating significant translational medicine value and clinical application prospects. Summary of the Invention

[0004] To solve the above problems, the present invention adopts the following technical solution: The first aspect of the present invention provides an ANKRD11 gene mutant, wherein the ANKRD11 gene mutant is any one of the following: Nucleic acid having a target fragment, wherein the target fragment has a CT deletion of nucleotides 6281 to 6282 compared to the wild-type ANKRD11 gene with the sequence SEQ ID NO.1; The polypeptide has the p.L2095Gfs*6 mutation compared to the protein encoded by the wild-type ANKRD11 gene, which has the sequence SEQ ID NO.2.

[0005] Furthermore, the protein encoded by the wild-type ANKRD11 gene is the wild-type ANKRD11 protein. In some cases, the mutant has a fragment with the amino acid sequence shown in SEQ ID NO.3. This fragment with the amino acid sequence shown in SEQ ID NO.3 is mainly for illustrating the changes in the mutation site after mutation. Any mutant with the same mutation site should be within the scope of this invention.

[0006] It should be noted that the aforementioned comparison uses a specific site as an example, mainly to show the location of the newly mutated site. It emphasizes the presence of the mutation and does not require other sites to be consistent with the wild type. Simply put, any site that has the newly mutated mutation of this invention compared to the aforementioned wild type sequence should be considered within the scope of this invention, without considering the issue of other sites.

[0007] Regarding the effects of ANKRD11 gene mutants on organisms or organs: As a key nuclear transcriptional co-regulator, the dysfunction of the ANKRD11 protein (usually caused by haploinadequacy due to gene mutation or inactivation of key functional domains) is sufficient to induce disease phenotypes. Specifically, loss of ANKRD11 function first weakens its interactions with chromatin regulatory complexes (such as cohesin) and histone deacetylases (such as HDAC3), thereby disrupting chromatin structure stability and the coordination of target gene transcription programs. This molecular-level disorder further leads to reduced expression levels of downstream key regulatory genes (such as SETD5), impairing ribosome biosynthesis and global protein translation efficiency, thus affecting cell growth and metabolic homeostasis. At the developmental level, the aforementioned molecular and cellular cascade abnormalities specifically affect cell populations highly dependent on ANKRD11 function: the proliferation, differentiation, and migration of neural progenitor cells are hindered, leading to abnormal brain structure, agenesis of the corpus callosum, and intellectual disability; the developmental program of craniofacial neural crest cells is disrupted, resulting in typical facial features (including prominent brow ridges and a wide nasal bridge); and the differentiation and growth of skeletal and dental progenitor cells are impaired, manifesting as delayed skeletal development, oblique fifth finger, and macrodontia. Therefore, ANKRD11 dysfunction, by disrupting the chromatin regulatory network and causing dysregulation of key developmental gene expression, impairs the normal developmental processes of multiple cell lineages, including neural, craniofacial, and skeletal cells, ultimately leading to the comprehensive clinical manifestations of KBG syndrome, including intellectual disability, distinctive facial features, skeletal abnormalities, and dental malformations.

[0008] A second aspect of this invention provides the application of reagents for detecting the aforementioned ANKRD11 gene mutation in the preparation of products for screening individuals at risk of KBG syndrome. The form of the product is not particularly limited, as long as it is suitable for assisting in the screening of at-risk individuals.

[0009] Regarding the understanding of the risk population for KBG syndrome: The risk population for KBG syndrome refers to patients with KBG syndrome or those at risk of developing KBG syndrome.

[0010] The reagent for detecting the aforementioned ANKRD11 gene mutation can be any one of a gene chip, primers, or probes. By detecting the presence of the aforementioned ANKRD11 gene mutant in a sample (e.g., peripheral blood), it can be determined whether the sample originates from a patient with KBG syndrome or a high-risk group (formed and unformed fetuses are temporarily categorized as patients or high-risk groups). This is because the presence of the aforementioned ANKRD11 gene mutant necessarily indicates that the tested individual has KBG syndrome or is at risk. More specifically, the reagent for detecting the aforementioned ANKRD11 gene mutant is at least one of a probe or primer specifically targeting the aforementioned ANKRD11 gene mutant, and may also be other methods such as Sanger sequencing, NGS sequencing, etc. (all within the scope of the claims of this invention). The primers are generally primer pairs: forward primer: 5'TCCACAGAGATTCCCCGAGT3', reverse primer: 5'TTCACCATCTGCGGCATCTT3'.

[0011] The test reagent is used to analyze whether the aforementioned ANKRD11 gene mutation is detected in peripheral blood samples. It can be directly analyzed by analyzing whether the aforementioned specific mutation is present in the peripheral blood samples of the tested population.

[0012] A third aspect of this invention provides a method for constructing a cell model with low p53 protein expression; the method involves transfecting a plasmid overexpressing the c.6281_6282delCT mutant ANKRD11 into a tool cell line. This method provides a novel cell model that can obtain low p53 protein expression, which can be used as a research model for scientific research purposes.

[0013] Regarding the tool cell line: the tool cell line is HEK293 cells; transfection was performed using the Lipofectamine™ 3000 transfection kit. Specifically, regarding plasmid construction and transfection methods, existing techniques can be directly employed.

[0014] This publication successfully broadened the pathogenic gene spectrum of KBG syndrome, further clarifying the specific association between the ANKRD11 gene, especially the ANKRD11 c.6281_6282delCT mutation, and the syndrome, thereby deepening clinicians' understanding of the genetic mechanisms and phenotypic characteristics of this type of disease. This discovery not only provides important reference and practical experience for screening and differential diagnosis of related diseases in clinical practice, but also lays a solid theoretical foundation for future precise prenatal genetic diagnosis and counseling. Attached Figure Description

[0015] Figure 1 A schematic diagram of the pedigree of KBG patients; Figure 2Sanger sequencing validation peak diagram of the c.6281_6282delCT mutation site in the ANKRD11 gene of the KBG proband and his parents; Figure 3 This image shows the expression of the c.6281_6282delCT mutant of the ANKRD11 gene and related p53 protein. Detailed Implementation

[0016] The present invention will be further described in detail below with reference to specific research examples. However, this should not be construed as limiting the scope of the present invention to the following embodiments.

[0017] I. Research on pathogenic genes and mutation sites 1. Sample collection: The inventor collected a family history of KBG syndrome, such as Figure 1 As shown, □ represents a normal male, ○ represents a normal female, ● represents a female with the disease, and ↗ represents a proband. All family members involved in this invention research signed informed consent forms. The inventors collected peripheral blood samples from patients and normal individuals within the aforementioned KBG syndrome families.

[0018] The proband was a 29-year-old female patient with KBG syndrome who had hearing impairment, speech impairment, intellectual disability, and average cognitive level since birth.

[0019] 2. Whole exome sequencing The inventors used the Roche KAPA HyperExome in conjunction with the MGI-DNB-T7 sequencing platform to perform whole-exome sequencing on the proband in this family. The target region coverage was >99.80%, the proportion of sites with a depth greater than 20× in the target region was >99.32%, and the average sequencing depth was approximately 157×.

[0020] 2.1 Sample Preparation Peripheral blood was collected from the proband and their parents in the aforementioned families, and peripheral blood DNA was extracted using the Qiagen Blood DNA minikit 1.2.1 kit (Qiagen, Germany). Quantification was performed using Qubit, ensuring that at least 2 μg of each DNA sample was used for whole-exome sequencing. 2.2 Library construction and sequencing DNA samples were randomly fragmented into 150-200 bp fragments using an E220 Covaris instrument. Following the manufacturer's instructions, fragment sizes were selected using AMPure XP Beads, followed by end repair, phosphorylation, and α-tailing. BGISEQ-500 platform-specific adapters were ligated to the α-tail fragments, the ligated fragments were purified, and amplified by PCR. Finally, the fragments were cycled to generate single-stranded DNA circulars. After quantitative identification, the library was sequenced.

[0021] 3. Variant detection, annotation, and database comparison; sequencing results and analysis. Whole-genome sequencing was performed on the proband and their parents. Sequencing data were matched against the SPAST genome reference using the Burrows-Wheeler alignment tool and annotated using snpEff 3 and the dbSNP database. First, all identified variants were screened using the dbSNP database, ExAC, HapMap database, 1000 genomes, and a local database of 100 healthy Chinese adults. Variants with a MAF > 0.01 in healthy individuals were removed. Then, all filtered variants were compared with the OMIM and CGD databases to identify gene variants associated with the disease phenotype.

[0022] Whole-exome sequencing analysis of the proband revealed a heterozygous variant, c.6281_6282delCT, in exon 9 of the ANKRD11 gene. This frameshift mutation involved the deletion of nucleotides 6281 and 6282 (CT), resulting in a change from leucine to glycine at amino acid position 2095 of the encoded protein. This altered the entire amino acid sequence from position 2095 onwards, and prematurely introduced a stop codon around position 2101, causing premature termination of protein synthesis and affecting normal translation (p.L2095Gfs*6) (PVS1). This variant had no reported frequency in the normal reference population gene database (allele frequency gnomAD:.) (PM2_PP). This variant was de novo in this family (PS2_PP). Based on the aforementioned evidence, and in accordance with the ACMG (The American College of Medical Genetics and Genomics) variant classification guidelines, this variant has been further identified as a pathogenic variant (ACMG: PVS+2PP).

[0023] 4. Sanger sequencing verification The ANKRD11 gene was sequenced in patients and their parents (normal individuals) within the family. Based on the sequence determination results, whether the mutation was wild-type or mutant, the correlation between the c.6281_6282delCT heterozygous mutation of the ANKRD11 gene and KBG syndrome was verified. The specific methodological steps are as follows: 1) DNA extraction Genomic DNA was extracted from the peripheral blood of the proband and his / her parents for later use.

[0024] 2) Primer design and PCR reaction Referring to the human genome sequence database GRCh37.1 / ANKRD11, specific primers targeting the c.6281_6282delCT mutation site with the nucleotide sequence shown below were designed, as detailed in the table below.

[0025] The extracted DNA was used as a template to perform a PCR reaction with the above-mentioned specific primers according to conventional methods in the art, and the purified PCR product was sequenced.

[0026] The PCR amplification products obtained from the patient and their parents were sequenced for DNA. Based on the sequencing results, the ANKRD11 gene coding sequence of the above samples was compared. The results showed that the proband carried the c.6281_6282delCT heterozygous mutation, while the parents of the proband who showed normal behavior did not carry this mutation. Therefore, it was preliminarily determined that this mutation is the pathogenic site of KBG syndrome.

[0027] 3) Test kit Prepare a detection kit containing primers suitable for ANKRD11 gene mutants (compared to SEQ ID NO.1, the ANKRD11 gene mutants have the c.6281_6282delCT mutation) for screening biological samples susceptible to KBG syndrome, wherein these primers include the aforementioned ANKRD11 gene-specific primers.

[0028] The specific steps for screening biological samples susceptible to KBG syndrome using the above kit are as follows: extract DNA from the subject, use the extracted DNA as a template to perform PCR reaction with the above-mentioned specific primers, purify the PCR product according to conventional methods in the field, sequence the purified product, and then observe whether the sequenced product has the c.6281_6282delCT mutation to effectively detect whether the subject is susceptible to KBG syndrome.

[0029] 5. In vitro experiments to verify protein expression levels: 1) Plasmid construction: Overexpression plasmids for wild-type and c.6281_6282delCT mutant ANKRD11 were constructed and provided by Sangon Biotech (Shanghai) Co., Ltd.

[0030] 2) Cell transfection: HEK293 cells were cultured in 1×DMEM basic solution with 10% fetal bovine serum and 1% ampicillin-streptomycin added. Transfection was performed using the Lipofectamine™ 3000 transfection kit according to the manufacturer's instructions.

[0031] 3) Protein extraction and Western blot: Cells were washed with PBS buffer and lysed using RIPA lysis buffer on ice for 5 minutes. The samples were sonicated and centrifuged at 10,000 × g for 10 minutes at 4°C, and the supernatant was collected. The samples were diluted with 5× loading buffer and heated at 98°C for 10 minutes. Protein samples were separated using a 4%–12% SDS-PAGE gel and protein electrophoresis system according to the manufacturer's instructions.

[0032] Experimental results are as follows Figure 3 As shown, this mutation results in the production of a truncated protein, impairing its function and leading to abnormal function of the protein encoded by ANKRD11, further confirming its pathogenicity. Furthermore, this truncated protein causes a decrease in p53 protein expression levels. Previous studies have shown that ANKRD11 can activate the p53 signaling pathway, while the loss-of-function mutation in this study leads to the loss of ANKRD11 activity, thereby weakening its regulatory effect on p53 and ultimately causing downregulation of p53 expression. This molecular mechanism provides direct evidence for explaining the pathological process of KBG syndrome caused by this mutation.

[0033] II. Introduction and Application Cases of Mutants Here is a brief introduction to the clinical applications of this type of product. It can be used to analyze the obtained samples for testing. By analyzing whether the sample has specific mutations, it can determine whether the sample source has a certain disease or is a high-risk group, thus providing a reference for clinical diagnosis and treatment. In particular, it provides better guidance in preconception screening, and can screen for potential serious diseases in the fetus during pregnancy to provide accurate advice.

[0034] When conducting clinical applications, the general steps are as follows: 1. Extract nucleic acid samples from biological samples (samples in this step can also be provided directly by the testing party). There are no special restrictions on the type of biological sample, as long as a nucleic acid sample that can be extracted from it to indicate whether the biological sample has an ANKRD11 mutation. Biological samples can be selected from at least one of human blood, skin, and subcutaneous tissue, with peripheral blood being preferred. This facilitates sampling and testing, thereby improving the efficiency of screening biological samples susceptible to KBG syndrome. It should be noted that the term "nucleic acid sample" used in this section should be interpreted broadly. It can be any sample that can reflect whether the biological sample has an ANKRD11 mutation, such as whole-genome DNA extracted directly from the biological sample, or a portion of the whole genome containing the ANKRD11 coding sequence; it can be total RNA extracted from the biological sample, or mRNA extracted from the biological sample. This broadens the range of biological sample sources and determines multiple information from the biological sample, thereby improving the efficiency of screening biological samples susceptible to KBG syndrome. Furthermore, if RNA is used as the nucleic acid sample, the extraction of nucleic acid samples from biological samples also involves: extracting RNA samples from biological samples, with mRNA being preferred; and obtaining cDNA samples through reverse transcription based on the obtained RNA samples, with the resulting cDNA samples constituting the nucleic acid samples. This can further improve the efficiency of using RNA as the nucleic acid sample to screen biological samples susceptible to KBG syndrome.

[0035] 2. After obtaining nucleic acid samples, they are analyzed to determine their nucleic acid sequences. There are no special restrictions on the methods and equipment used to determine the nucleic acid sequences of nucleic acid samples. Sequencing can be used to determine the nucleic acid sequences of nucleic acid samples. Sequencing methods and equipment are not particularly limited; second-generation sequencing technology, as well as third-generation, fourth-generation, or more advanced sequencing technologies, can be used. At least one of the following sequencing devices—HISEQ2000, SOLID, 454, ABI3730, and single-molecule sequencing devices—can be used to sequence the nucleic acid sequences. Combining the latest sequencing technologies allows for higher sequencing depths at single sites, significantly improving detection sensitivity and accuracy. Therefore, the high-throughput and deep sequencing capabilities of these sequencing devices can be utilized to further improve the efficiency of nucleic acid sample detection and analysis, thereby enhancing the precision and accuracy of subsequent sequencing data analysis. Determining the nucleic acid sequences of nucleic acid samples may further include: first, constructing a nucleic acid sequencing library from the obtained nucleic acid samples; and then sequencing the obtained nucleic acid sequence library to obtain data results composed of multiple sequencing data. It should be noted that the term "nucleic acid sequence" used in this section should be interpreted broadly. It can refer to the complete nucleic acid sequence information obtained after assembling the sequencing data obtained from sequencing nucleic acid samples, or it can refer to the sequencing data (reads) obtained from sequencing nucleic acid samples directly as nucleic acid sequences, as long as these nucleic acid sequences contain the coding sequence corresponding to ANKRD11.

[0036] 3. After determining the nucleic acid sequence of the nucleic acid sample, the obtained nucleic acid sequence is compared with the sequence of SEQ ID NO.1. If the c.6281_6282delCT mutation is present in the obtained nucleic acid sequence, it indicates that the biological sample is susceptible to KBG syndrome (it also indicates that the method uses "a kit for screening biological samples with KBG syndrome" and "the application of reagents for detecting nucleic acids and / or peptides in the preparation of kits or devices"). Therefore, the method for screening biological samples susceptible to KBG syndrome according to the embodiments of the present invention can effectively screen biological samples susceptible to KBG syndrome. There are no special limitations on the method and equipment for comparing the nucleic acid sequence with SEQ ID NO.1; any conventional software can be used.

[0037] Unless otherwise specified, the techniques used in the embodiments are conventional methods familiar to those skilled in the art, and can be performed with reference to the third edition of Molecular Cloning: A Laboratory Manual or related products. All reagents and products used are commercially available. Various processes and methods not described in detail are conventional methods known in the art. The source, trade name, and components of any reagents used, if necessary, are indicated upon their first appearance. Subsequent use of the same reagents, unless otherwise specified, will be identical to the initial indication.

[0038] Those skilled in the art will appreciate that various modifications can be made to the above embodiments without departing from the overall spirit and concept of the present invention. For any aspects not detailed herein, reference can be made to the prior art. All such modifications fall within the protection scope of the present invention. The protection scheme of the present invention is defined by the appended claims.

Claims

1. An ANKRD11 gene mutant, characterized in that, The ANKRD11 gene mutant is any of the following: Nucleic acid having a target fragment, wherein the target fragment has a CT deletion of nucleotides 6281 to 6282 compared to the wild-type ANKRD11 gene with the sequence SEQ ID NO.1; The polypeptide has the p.L2095Gfs*6 mutation compared to the protein encoded by the wild-type ANKRD11 gene, which has the sequence SEQ ID NO.

2.

2. The ANKRD11 gene mutant according to claim 1, characterized in that, The protein encoded by the wild-type ANKRD11 gene is the wild-type ANKRD11 protein.

3. The use of the reagent for detecting the ANKRD11 gene mutation in claim 1 in the preparation of products for screening individuals at risk of KBG syndrome.

4. The application according to claim 3; wherein, The reagent for detecting the ANKRD11 gene mutant in claim 1 is any one of a gene chip, primers, or probes.

5. The application according to claim 4; wherein, The primers are primer pairs: forward primer: 5'TCCACAGAGATTCCCCGAGT3', reverse primer: 5'TTCACCATCTGCGGCATCTT3'.

6. The application according to claim 4; wherein, The reagent is used to analyze the presence of the ANKRD11 gene mutant in peripheral blood samples as described in claim 1.

7. The application according to claim 3; wherein, The at-risk population for KBG syndrome refers to patients with KBG syndrome or those at risk of developing KBG syndrome.

8. A method for constructing a cell model with low p53 protein expression; characterized in that, The overexpression plasmid of c.6281_6282delCT mutant ANKRD11 was transfected into the tool cell line.

9. The method for constructing a cell model with low p53 protein expression according to claim 8; characterized in that, The cell line used was HEK293; transfection was performed using the Lipofectamine™ 3000 transfection kit.