Snps molecular marker, primer pair, kit and application closely linked with beef drip loss trait
By providing SNP molecular markers and their primer pairs that are closely related to the drip loss trait in beef, the problem of low efficiency in traditional breeding methods has been solved, enabling early genotyping and efficient breeding, and selecting beef cattle with low drip loss, thereby improving the quality of beef cattle.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ANHUI SCI & TECH UNIV
- Filing Date
- 2026-04-30
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies are insufficient for efficiently selecting and breeding beef cattle with low drip loss. Traditional breeding methods are inefficient and inaccurate, and lack molecular markers closely linked to the drip loss trait in beef, which limits the large-scale application of molecular breeding for beef quality.
This invention provides an SNP molecular marker and its primer pair that are closely related to the drip loss trait in beef. Genotypes are detected by PCR amplification and sequencing to screen individuals with low drip loss rates for precise selection and breeding.
Early genotyping identification has been achieved, significantly improving the efficiency and accuracy of breeding selection, enabling the efficient breeding of beef cattle with low drip loss and improving meat quality.
Smart Images

Figure CN122279052A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of animal breeding technology, specifically relating to an SNP molecular marker, primer pair, kit, and application that is closely linked to the drip loss trait in beef. Background Technology
[0002] Beef is rich in protein, iron, zinc, B vitamins, and essential unsaturated fatty acids, making it a high-quality source of nutrition for humans. With the rapid growth of per capita beef consumption in China, the domestic consumption gap is widening. This trend has spurred a growing demand for different cattle breeds and for high-quality and premium beef.
[0003] Drip loss is a key indicator of meat's water-holding capacity, directly reflecting the degree of liquid loss from the muscle protein system under gravity. It is an important technical parameter for evaluating beef freshness, appearance quality, and eating quality. Drip loss not only affects the sensory appearance, shelf life, and commercial value of beef, but also significantly alters the juiciness, tenderness, and flavor of cooked and cured products, directly influencing consumers' purchasing intentions and eating experience. Therefore, reducing drip loss and improving water-holding capacity in beef is one of the important goals of beef cattle quality breeding.
[0004] Meat quality traits such as drip loss in beef animals are regulated by multiple factors including genetics, feed nutrition, pre-slaughter stress, and post-slaughter processing. Among these, genetic factors are the core internal factors determining meat quality. Drip loss is a typical quantitative trait, controlled by a synergistic effect of multiple genes with minor effects. Traditional phenotype-based breeding selection has limitations such as long cycles, low efficiency, poor accuracy, and susceptibility to environmental interference, making it difficult to achieve efficient and precise breeding for the desirable trait of low drip loss. Candidate gene methods and molecular marker-assisted selection provide an efficient technical pathway for the genetic improvement of beef quality. By screening functional genes and molecular markers closely linked to meat quality traits, genotyping can be conducted early in the individual, significantly improving the efficiency and accuracy of breeding selection. Currently, a number of candidate genes related to beef meat quality have been identified, but most genes have insufficient linkage to the target trait and unstable genetic effects, resulting in poor operability and selection effects in practical breeding applications. The lack of molecular markers closely linked to the beef drip loss trait and efficiently applicable to breeding practice severely restricts the large-scale application of molecular breeding for beef quality. Therefore, the present invention aims to provide a molecular marker closely related to the drip loss trait of beef, providing technical support for the breeding of beef cattle with low drip loss traits, the improvement of meat quality, and efficient breeding. Summary of the Invention
[0005] In view of the above technical problems, the present invention provides an SNP molecular marker that is closely related to the drip loss trait of beef, which can be used to select and breed beef cattle with low drip loss rate.
[0006] The specific technical solution provided by this invention is as follows: In a first aspect, the present invention provides an SNP molecular marker closely related to the drip loss trait of beef, the nucleotide sequence of which is shown in SEQ ID NO.1, and the sequence shown in SEQ ID NO.1 has a C / T polymorphism at 76 bp.
[0007] As a preferred embodiment of the present invention, the drip loss of individuals with the CC genotype at the polymorphic site is higher than that of individuals with the CT genotype.
[0008] In a second aspect, the present invention provides a primer pair for amplifying the molecular marker, comprising a forward primer and a reverse primer, wherein the sequences of the forward primer and the reverse primer are as follows: Forward primer: 5'-AAGAAGCCCATTCCCAGATAC-3'; Reverse primer: 5'-ACCTTCCTAGTGCCATCCAG-3'.
[0009] In a third aspect, the present invention provides a detection reagent or kit comprising the primer pair.
[0010] As a preferred embodiment of the present invention, the kit includes at least one of dNTPs, DNA polymerase, PCR reaction buffer, and standard positive template.
[0011] In a fourth aspect, the present invention provides an use of the molecular marker or the primer pair, having any of the following characteristics: (1) Used to detect whether there is significant water loss from dripping beef; (2) Used for predicting drip loss characteristics in beef; (3) Select cattle with low drip loss rate for breeding; (4) Used for molecular marker-assisted breeding or variety improvement related to drip loss traits in beef.
[0012] In a fifth aspect, the present invention provides a method for detecting drip loss characteristics of beef, comprising the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair; After sequencing the amplified products, genotyping was performed. Individuals with the CC genotype at the polymorphic site had a higher droplet loss than individuals with the CT genotype.
[0013] In a sixth aspect, the present invention provides a method for breeding beef cattle with low drip loss rate, comprising the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair; Analyze the amplification products.
[0014] In a preferred embodiment of the present invention, the genotype at the 76th bp of the amplified product sequence is detected, and the drip loss rate of individuals with the CT genotype is lower than that of individuals with the CC genotype.
[0015] As a preferred embodiment of the present invention, the PCR reaction program is as follows: pre-denaturation at 94~95℃ for 5 min~5 min 30 s; denaturation at 94℃ for 30 s; annealing at 58~59℃ for 30~45 s; extension at 70~75℃ for 30~45 s; 30~40 cycles; and holding at 70~75℃ for 10 min.
[0016] More preferably, the PCR reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58.7℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ total extension for 10 min.
[0017] As a preferred embodiment of the present invention, the PCR amplification system is 25 μL: 12.5 μL of 2×Taq PCR Master mix, 2 μL of DNA template, 1 μL each of upstream and downstream primers (100 ng / μL), and 8.5 μL of deionized water.
[0018] In a preferred embodiment of the present invention, the beef is derived from Dabie Mountain cattle, eastern Anhui cattle, southern Anhui cattle, Jianghuai water buffalo, or Dongliu water buffalo.
[0019] More preferably, the beef is sourced from Dabie Mountain cattle.
[0020] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention utilizes DNA sequencing technology to analyze the DNA of five local cattle breeds in Anhui Province. PPARG Polymorphic analysis of genes revealed that: PPARG The SNP site g.19054C>T was screened at the first intron of the gene. Further analysis using a least-squares linear model was conducted on the Dabie Mountain cattle. PPARG Association analysis between gene polymorphism sites and meat quality traits showed that: PPAR The G gene g.19054C>T site was significantly associated with drip loss. P <0.05), and at the g.19054C>T site, the drip loss of individuals with the CC genotype was significantly higher than that of individuals with the CT genotype. Attached Figure Description
[0021] Figure 1 These are the results of genomic DNA extraction; Figures 2 - 5 They are PPARG Results of PCR amplification products of the gene using 8 primer pairs, as measured by 1.5% agarose gel electrophoresis; Figure 6 yes PPARG Gene sequencing analysis results. Detailed Implementation
[0022] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.
[0023] Meat quality evaluation indicators include meat color, pH value, water-holding capacity, drip loss, and marbling. Among these, drip loss affects the appearance and technical properties of fresh meat, as well as the juices in cooked or marinated products, thus influencing consumers' purchasing experience and choices. Therefore, drip loss is an important indicator for judging meat quality.
[0024] This invention provides a molecular marker closely related to the drip loss trait in beef, the nucleotide sequence of which is shown in SEQ ID NO.1. The sequence shown in SEQ ID NO.1 exhibits a C / T polymorphism at position 76 bp. Individuals with the CC genotype at the polymorphic site show higher drip loss than individuals with the CT genotype. This molecular marker can be used to breed beef cattle with low drip loss.
[0025] Example 1 Anhui local breed cattle PPARG Genetic diversity analysis 1. Test materials 1.1 Experimental Animals Using a random typical sampling method, a total of 286 individuals from five local cattle breeds in Anhui Province (Eastern Anhui cattle, Southern Anhui cattle, Dabie Mountain cattle, Dongliushui cattle, and Jianghuai water buffalo) were collected. Detailed information is shown in Table 1.
[0026] Table 1. Sample information of five local cattle breeds in Anhui Province 1.2 Preparation of main reagents and solutions (1) Main reagents Chloroform, isoamyl alcohol, double-distilled water (ddH2O), anhydrous ethanol, and ultrapure water (DI) were all provided by the university laboratory. DNA Marker (DL2000), 6x Loading Buffer, and 2×Taq PCR Master mix were purchased from Sangon Biotech (Shanghai) Co., Ltd.; agarose was purchased from Mona Biotechnology Co., Ltd.; nucleic acid staining agents were purchased from Savill Biotechnology Co., Ltd.; and the blood genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.
[0027] (2) Preparation of reagents A: PBS buffer: NaCl 8g, KCl 0.2g, Na2HPO4•12H2O 3.58g, KH2PO4 0.27g, add ddH2O to bring the volume to 1L, adjust the pH to 7.4, autoclave, and store at 4℃.
[0028] B: 50×TAE: Take 242g of Tris and 100mL of 0.5mol / L EDTA and place them in a 1L beaker. Add 800mL of ddH2O to the beaker and stir well. Then add 57.1mL of glacial acetic acid solution and continue stirring. Finally, add enough deionized water until the total volume reaches 1L.
[0029] C: 1×TAE electrode buffer: 20mL 50×TAE, 980mL distilled water to a final volume of 1L.
[0030] D: 1.5% agarose gel electrophoresis: Add 1.5g agarose to 100mL of 1×TAE, heat in a micro furnace until melted, and let cool to a temperature that can be touched by hand. Then add 5µL of nucleic acid dye and mix well.
[0031] 1.3 Main Instruments The main instruments and equipment required for this invention are shown in Table 2 below.
[0032] Table 2 Main Instruments and Equipment 2. Test methods 2.1 Blood Sample Collection Blood was collected from the jugular veins of five local cattle breeds in Anhui Province and placed in EDTA anticoagulant tubes. The tubes were then brought back to the laboratory with crushed ice in an insulated box and stored at -20°C for later use.
[0033] 2.2 Extraction of Genomic DNA Genomic DNA was extracted from the blood of 286 cattle using an animal blood genomic DNA extraction kit. The specific procedures were performed according to the kit's instructions.
[0034] 2.3 Genomic DNA Concentration and Purity Detection DNA concentration was detected using a Nanodrop One micro-volume spectrophotometer; the A concentration of pure DNA was... 260 A 280The range is 1.7–1.9, and then its integrity is further verified. 2 μL of DNA template is mixed with 3 μL of 6× Loading Buffer, and the mixture is detected by 1.5% agarose gel electrophoresis. If it passes the test, it is stored at -20℃ for later use.
[0035] 2.4 Primer Design and Synthesis According to the cattle data published in the NCBI database PPARG The gene sequence (ID: 281993) was used to design primers for the exon and some intron regions of the gene using Primerpremier 5.0 software. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and details are shown in Table 3.
[0036] Table 3 Anhui Local Cattle Breeds PPARG Gene primer information Note: E: Exon; i: Intron 2.5 PCR Amplification and Sequencing The PCR amplification system consisted of 25 μL: 12.5 μL of 2×Taq PCR Master mix, 2 μL of DNA template, 1 μL each of forward and reverse primers (100 ng / μL), and 8.5 μL of deionized water. The amplification conditions were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing for 30 s (annealing temperatures see Table 3), 72℃ extension for 30 s, for 35 cycles; and a final extension at 72℃ for 10 min. The product was stored at 4℃ for later use. PCR products were detected by 1.5% agarose gel electrophoresis. Products that passed the electrophoresis were sent to General Biosystems (Anhui) Co., Ltd. for sequencing.
[0037] 3. Data Analysis 3.1 Genotype frequency and allele frequency Genotype frequency = Number of individuals with a genotype / Total number of individuals in the population being tested Allele frequency = (a specific allele in a population) / (all alleles) Pi=[2(ii)+(ij1)+(ij2)+…+(ijn)] / 2N Pi: Frequency of the i-th allele; i: Homozygous multiple allele i1, j2, ..., jn: the first to nth alleles co-occurring with i 3.2 Hardy-Weinberg equilibrium test Hardy-Weinberg equilibrium is the state of genotype frequencies of two alleles from two autosomal loci after random mating in an infinitely large population.
[0038] x 2 = ∑ Where: Ei represents the theoretical value, Oi represents the actual observed value, and n represents the number of alleles.
[0039] 3.3. Genetic homozygosity Ho ) Ho This indicates the homozygosity of a specific allele in a population. The formula for calculation is:
[0040] H0 = ∑ 1 (pi)2 Where Pi is the frequency of the i-th allele, and n is the number of alleles at a certain locus.
[0041] 3.4. Heterozygosity He ) He The proportion of a group that is heterozygous at a particular seat is used to measure the information content of the labeling method. The calculation formula is:
[0042] He = 1 − ∑ 1 (pi)2 Where Pi is the frequency of the i-th allele, and n is the number of alleles at a certain locus.
[0043] 3.5 Effective number of alleles Ne ) Ne It is also an indicator reflecting the magnitude of genetic variation in a population, expressed as the reciprocal of homozygosity. If alleles are more evenly distributed in a population, the effective number of alleles will be closer to the actual number of alleles detected.
[0044] In the formula: i is the i-th allele; pi is the frequency of the i-th allele; n is the number of alleles.
[0045] 3.6. Polymorphic information content ( PIC ) Polymorphism Information Content PICThe value is calculated based on the frequency of its allele in a population, indicating the level of polymorphism at the locus.
[0046] PIC = 1 − ∑ 1 pi2 − ∑ ∑=i+1 2pi2 pj2 In the formula: pi and pj are the frequencies of the i-th and j-th alleles, respectively; n is the number of alleles. Generally, when PIC When the value is >0.5, it indicates high polymorphism; when it is <0.25, it indicates high polymorphism. PIC When the value is less than 0.5, it indicates moderate polymorphism. PIC When the value is less than 0.25, it indicates low-degree polymorphism.
[0047] 3.7 Data Analysis Software Sequencing results were compared with reference sequences using DNAman software to screen for SNP sites. The peak plots of the sequencing results were then analyzed using Chromas software to further validate the screened SNP sites.
[0048] 4. Results and Analysis 4.1 Genomic DNA Quality Testing The quality of the extracted genomic DNA was measured using a NanoDrop One ultra-micro spectrophotometer, and its ratio A was determined. 260 / A 280 The values were within the range of 1.7 to 1.9. Further analysis was performed using 1.5% agarose gel electrophoresis. The electrophoresis results are shown in Figure 1. The bands were bright and clear, without tailing, and the band integrity was good. These results indicate that the extracted DNA quality meets the requirements for subsequent experiments.
[0049] 4.2 Anhui Local Cattle Breeds PPARG Genetic diversity analysis 4.2.1 PPARG Quality detection of gene PCR amplification products PPARG The results of PCR amplification of the gene products by 1.5% agarose gel electrophoresis are shown in Figures 2-5. Amplification PPARG The eight primer pairs for the gene showed good specificity, no dimers, and the amplified bands were bright, clear, and uniform. The fragment size met expectations, and sequencing could be performed directly afterward.
[0050] 4.2.2、 PPARG Gene sequencing results analysis The expanded population of five local Anhui cattle breeds PPARG All exons and the first intron of the gene were sequenced, and the sequencing results were consistent with those published by NCBI for bovine genomes.PPARG Comparative analysis was performed using gene reference sequences. As shown in Figure 6, the results revealed that: PPARG The SNP site screened in the gene is g.19054C>T on intron 1.
[0051] The nucleotide sequence of the molecular marker containing the above SNP sites is shown in SEQ ID NO.1: AAGAAGCCCATTCCCAGATACCCTTAGGAGAGTCATCCCACTGTAAGGAG AACAGGGCTGTCTGTAGGACGTTGGSGTGGGTCCGCTGTACAGGCTGACACTGCTAGAGGGTCCTCGACATGACGTCCAGGTAATGGGTGACTTCCCTC AGTTACTTCAGCAACCTGGATGGCACTAGGAAGGT, where S is C or T.
[0052] 4.2.3 Anhui Local Cattle Breeds PPARG Population genetic structure analysis of genes (0) Analysis of genetic polymorphism in the first intron of the PPARG gene Five local cattle breeds in Anhui PPARG Gene and genotype frequency analysis was performed on the SNP loci of the first intron of the gene (Table 4). At the g.19054C>T locus, three genotypes were detected: CC, TC, and TT. The TT genotype was not detected in Wandong cattle; the CC genotype was not detected in Jianghuai water buffalo; and only the TT genotype was detected in Dongliu water buffalo. Furthermore, the distribution of dominant genotypes differed among breeds. In the three common cattle populations, the CC genotype frequency was higher than the TC and TT genotype frequencies, indicating it was the dominant genotype. The CC genotype frequency was the same in Dabieshan cattle and Wandong cattle (0.60). The C allele frequency was higher than the T allele frequency, indicating it was the dominant allele. In the two water buffalo breed populations, the TC genotype frequency was higher than the TT genotype frequency in Jianghuai water buffalo, indicating it was the dominant genotype, with T being the dominant allele. In Dongliu water buffalo, the TT genotype was the dominant genotype, and T was the dominant allele.
[0053] Calculated based on gene frequency and genotype frequency N e, H e, H o, PIC The results of the Hardy-Weinberg equilibrium are shown in Table 5. Only the TT genotype was present in the Middle Eastern flowing buffalo population at the g. 19054C>T locus; therefore... NeFor 1. g. 19054C>T site, Jianghuai water buffalo N e was the highest at 1.937. g. The 19054C>T site was in Hardy-Weinberg equilibrium in all three normal cattle populations. P >0.05), the Jianghuai water buffalo population is in a state of extreme Hardy-Weinberg imbalance ( P <0.01).
[0054] Table 4. Frequency of the first intron gene and genotype of the PPARG gene in local Anhui cattle breeds. Table 5. Genetic variation parameters of the first intron of the PPARG gene in Anhui local breed cattle. Example 2 Dabie Mountain cattle PPARG Correlation analysis between gene polymorphism and meat quality 1. Experimental Materials and Methods 1.1 Sample Collection Fifty-six healthy, disease-free Dabie Mountain cattle aged 24-30 months and of similar weight (from Jiuhong Agricultural Comprehensive Development Co., Ltd., Taihu County, Anqing City) were selected for fattening. Feeding was prohibited for 24 hours prior to slaughter, and a sanitary inspection was conducted, with 10 mL of blood collected. After slaughter, 500 g of the longissimus dorsi muscle from the 12th-13th thoracic vertebrae was removed, washed with physiological saline to remove blood, and stored at -20℃ for later use.
[0055] 1.2 Determination of Beef Quality (1) Crude fat: The fat content of the longissimus dorsi muscle of Dabie Mountain cattle was determined by Soxhlet extraction according to GB / T5009.6-2003 "Determination of fat in food".
[0056] (2) Flesh color: After the collected longissimus dorsi muscle sections were exposed to air for oxygenation for 40 minutes, the color difference was measured using a Canon CR-S400w handheld colorimeter. The brightness (L*), redness (a*), and yellowness (b*) of the longissimus dorsi muscle were measured. Each sample was measured 3 times, and the average value of the data was taken.
[0057] (3) Drip loss: Remove the surrounding muscle membrane from the meat sample and cut it into pieces approximately 5cm × 3cm × 2cm along the muscle fiber direction. Take 3 pieces of each meat sample and record the weight (m1). Bend a wire into a hook shape, hook one end, and place it in an air-filled plastic bag to prevent it from falling and to avoid contact with the plastic bag. Hang the meat sample in a refrigerator at 4°C for 24 hours. After that, remove the plastic bag, gently wipe the juice off the surface of the meat sample with filter paper, and weigh it again (m2). Drip loss is expressed as the percentage reduction in the initial weight of the meat sample. Calculate using the following formula:
[0058] Drip loss (%) = (m1 - m2) / m1 × 100% (4) Cooking Loss: After removing the connective tissue and fat from the surface of the muscle, cut it into slices approximately 2 cm thick and weigh them (recorded as W1). Place the meat slices in a heat-resistant vacuum bag and insert a thermometer to the center of the muscle. Seal the bag tightly to prevent contact with the outside environment. Then, place the heat-resistant vacuum bag in a constant temperature water bath at 80°C and heat until the core temperature of the meat sample reaches 70°C. Then remove the meat sample from the water bath and allow it to cool naturally at room temperature. Afterward, gently absorb the moisture from the surface of the meat sample with absorbent paper and weigh it (recorded as W2). Calculation formula:
[0059] Cooking loss (%) = (W1 - W2) / W1 × 100% (5) Shear force: The meat sample was placed in a water bath preheated to 80°C and heated until the temperature at the center of the meat sample reached 70°C. After that, the meat sample was removed and allowed to cool to room temperature. Ten cylindrical samples with a diameter of 1.27 cm were taken from the meat sample along the muscle fiber direction. Shear force was tested on these samples using a tenderness tester, and the average value of the obtained shear force was calculated.
[0060] (6) Water Loss Rate: Cut the meat sample into 2cm pieces and use a circular sampler to extract a portion of the meat sample from the center of each piece. Weigh this portion of the meat sample and record it as W1. Then wrap it in gauze. Next, place the wrapped meat sample between two layers of filter paper (36 layers in total), place the meat sample on a pressure gauge, apply a pressure of 25kg for 5 minutes, and then remove the pressure. Then weigh the meat sample again and record it as W2. The difference between the weight before pressure (W1) and the weight after pressure (W2) is the water loss weight of the meat sample. Calculation formula:
[0061] Water loss rate (%) = (W1 - W2) / W1 × 100% (7) pH: Insert the electrode of the pH meter into the meat sample and perform three repeated measurements on each meat sample. Then calculate the average of the three measurements as the pH value of the meat sample.
[0062] 2. Data Analysis 2.1 Statistical Analysis Model First, the data was initially organized in Excel. Then, the GLM (General Linear Model) procedure in SAS software, combined with the least squares analysis of variance model, was used to compare the differences in meat quality traits among different genotypes. Finally, significance tests and multiple comparisons were performed on the meat quality traits among different genotypes, and the results are presented in the form of mean ± standard deviation.
[0063] The statistical model is as follows: Yij=μ+GENi+GROj+eij Yij represents the phenotypic value of an individual for a certain trait; μ represents the population mean; GENi represents the genotype effect; GROj represents the group effect; and eij represents the random error.
[0064] 3. Results and Analysis Using SAS software to analyze the cattle of the Dabie Mountains PPARG Association analysis was performed between genotypes at gene polymorphism sites and nine meat quality traits in Dabie Mountain cattle, including intramuscular fat, shear force, and drip loss (Table 6). The g.19054C>T site was significantly associated with drip loss rate; at the g.19054C>T site, individuals with the CC genotype had significantly higher rates than those with the CT genotype. P <0.05).
[0065] Table 6 PPARG Association analysis of gene SNPs and the quality of beef from Dabie Mountain Note: For comparisons of different genotypes at the same locus, different lowercase letters in the data headings indicate significant differences. P <0.05, different capital letters indicate highly significant differences ( P <0.01).
[0066] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A SNP molecular marker associated with drip loss traits in beef, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
1. The sequence shown in SEQ ID NO.1 has a C / T polymorphism at 76 bp. Individuals with the CC genotype at the polymorphic site have a higher drop loss than individuals with the CT genotype.
2. A primer pair for amplifying the molecular marker of claim 1, characterized in that, It includes a forward primer and a reverse primer, the sequences of which are as follows: Forward primer: 5'-AAGAAGCCCATTCCCAGATAC-3'; Reverse primer: 5'-ACCTTCCTAGTGCCATCCAG-3'.
3. A detection reagent or kit comprising the primer pair of claim 2.
4. The detection reagent or kit according to claim 3, characterized in that, The kit includes at least one of dNTPs, DNA polymerase, PCR reaction buffer, and standard positive template.
5. A molecular marker according to claim 1, a primer pair according to claim 2, or a detection reagent or kit according to claim 3 has any of the following uses: (1) Used to detect whether there is significant water loss from dripping beef; (2) Used for predicting drip loss characteristics in beef; (3) Select cattle with low drip loss rate for breeding; (4) Used for molecular marker-assisted breeding or variety improvement related to drip loss traits in beef.
6. A method for detecting drip loss characteristics of beef, characterized in that, Includes the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2; After sequencing the amplified products, genotyping was performed. Individuals with the CC genotype at the polymorphic site had a higher droplet loss than individuals with the CT genotype.
7. The method according to claim 6, characterized in that, The PCR reaction program was as follows: 94~95℃ pre-denaturation for 5 min~5 min 30 s; 94℃ denaturation for 30 s; 58~59℃ annealing for 30~45 s; 70~75℃ extension for 30~45 s; 30~40 cycles; 70~75℃ hold for 10 min.
8. A method for breeding beef cattle with low drip loss rate, characterized in that, Includes the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2; Analyze the amplification products.
9. The method according to claim 8, characterized in that, Genotypes at the 76th bp of the amplified product sequence were detected. Individuals with the CT genotype had a lower droplet loss rate than individuals with the CC genotype.
10. The method according to claim 8, characterized in that, The beef cattle mentioned are Anhui East cattle, Anhui South cattle, Dabie Mountain cattle, Dongliu River cattle, or Jianghuai water cattle.