A molecular marker related to malic acid content of apple fruit and application thereof

By detecting the SNP sites in the promoter region of the MdNAC029 gene in apple fruits, the problem of malic acid content being difficult to control in breeding was solved, enabling accurate judgment and efficient screening of malic acid content, and improving the efficiency of apple variety breeding.

CN122279096APending Publication Date: 2026-06-26SHENZHEN RESEARCH INSTITUTE OF NORTHWEST A & F UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHENZHEN RESEARCH INSTITUTE OF NORTHWEST A & F UNIVERSITY
Filing Date
2026-05-28
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

The lack of upstream core transcription factors and key mutation sites that regulate malic acid content in apple fruits under the background of the Ma1 gene in current technology makes it difficult to accurately control malic acid content in breeding.

Method used

A molecular marker related to the malic acid content of apple fruit is provided, specifically a single nucleotide polymorphism (SNP) site in the promoter region of the MdNAC029 gene. This site is located at the 2693rd base from the 5' end of the nucleotide sequence, and the polymorphism is T or C. The malic acid content can be determined by detecting the genotype of this SNP site, and primer pairs can be designed to amplify the fragment containing this site.

Benefits of technology

By detecting SNP sites in the promoter region of the MdNAC029 gene, the malic acid content of apple fruits can be accurately determined, improving the efficiency of breeding high-quality apple varieties, reducing environmental impact, and offering low cost and rapid detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122279096A_ABST
    Figure CN122279096A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant molecular biology and genetic breeding technology, specifically relating to a molecular marker related to the malic acid content of apple fruit and its application. The molecular marker is... MdNAC029 The single nucleotide polymorphism site in the gene promoter region, this site is located MdNAC029 The nucleotide sequence of the gene promoter region, starting from the 2693rd base at the 5' end, corresponds to... MdNAC029 At a position 442 bp upstream of the transcription start codon, the polymorphism is either T or C, with the C / C genotype indicating high malic acid content and the T / T genotype indicating low malic acid content. This invention, through molecular biology experiments, confirms that the T allele is the binding site for the transcriptional repressor MdMYC2, and the C allele eliminates the binding of MdMYC2, thereby relieving transcriptional repression and promoting malic acid accumulation. This provides a new molecular marker for the genetic improvement of apple fruit acidity traits, accelerating the breeding process of superior varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology and genetic breeding technology, specifically relating to a molecular marker related to the malic acid content of apple fruit and its application. Background Technology

[0002] The flavor of apple (Malus domestica Borkh.) is mainly determined by the types and amounts of soluble sugars and organic acids, among which malic acid is the most abundant organic acid in apples, and its content directly affects the fruit's taste and processing suitability. Therefore, elucidating the genetic regulatory mechanisms of malic acid accumulation and identifying key functional genes and their variation sites is of great significance for apple molecular breeding.

[0003] Current research indicates that the Ma locus on chromosome 16 of apples... Ma1 The gene (encoding aluminum-activated malate transporter) is a key gene that determines the acidity of fruit. Ma1 A premature stop codon mutation in a gene leads to truncation of the malate transporter, resulting in a significant reduction in the efficiency of malate transport to the vacuolar membrane and a low-acidity phenotype. However, breeding and production practices have found that even when carrying homozygous nonfunctional malates... ma1 Among cultivars with the (ma1 / ma1) allele, significant differences remain in malic acid content in fruit, with some varieties even maintaining high malic acid levels. This phenomenon indicates the existence of malic acid content in apples that is independent of [the specific gene]. Ma1 Compensatory or alternative regulatory networks of the main effect pathway.

[0004] In recent years, although some proton pumps (such as...) have been reported... MdMa10 ) and metabolic enzyme genes (such as MdMDH5 )participate Ma1 While malic acidity is a gene-independent pathway, the upstream core transcription factors regulating this pathway remain unclear. Furthermore, existing functional gene studies largely focus on coding regions, with limited research on the impact of natural variations in promoter regions, particularly single nucleotide polymorphisms (SNPs), on gene expression and their subsequent regulation of malic acid accumulation. Fruit acidity, as a complex quantitative trait, is regulated by multiple gene interactions and is associated with traits such as fruit development.

[0005] Therefore, excavation in ma1 Identifying the core genes driving malic acid accumulation in the genetic context and their natural variation sites, screening upstream transcription factors that regulate malic acid accumulation, and identifying key SNP sites in their promoter regions will not only help to elucidate the complex regulatory network of malic acid accumulation, but also provide new molecular markers for developing acidity marker-assisted selection technology for apple fruits. Summary of the Invention

[0006] To address the lack of existing technologies in ma1This invention addresses the technical challenges of upstream core transcription factors and key mutation sites that regulate malic acid content in apple fruits under a genetic background. It provides a molecular marker related to malic acid content in apple fruits and its application.

[0007] On the one hand, the present invention provides a molecular marker related to the malic acid content of apple fruit, wherein the molecular marker is... MdNAC029 Single nucleotide polymorphism sites in the gene promoter region;

[0008] The single nucleotide polymorphism site is located at MdNAC029 The nucleotide sequence of the gene promoter region, starting from the 2693rd base at the 5' end, corresponds to... MdNAC029 442bp upstream of the gene transcription start codon Place Its polymorphism is T or C; Among them, the C / C genotype indicates high malic acid content, while the T / T genotype indicates low malic acid content.

[0009] Furthermore, in the molecular marker, the single nucleotide polymorphism site is located within the MYC-binding cis-acting element; the T allele is the binding site for the transcriptional repressor MdMYC2, and the C allele eliminates the binding of MdMYC2.

[0010] A method for detecting the molecular markers described in this invention is also provided, the method comprising: detecting in the apple genome MdNAC029 Does a T / C single nucleotide polymorphism exist at the 2693rd base from the 5' end of the gene promoter region?

[0011] The invention also provides the application of the molecular markers described herein in identifying the malic acid content of apple fruits. The malic acid content of apple fruits is determined by detecting the genotype of the molecular markers: the C / C genotype indicates high malic acid content, and the T / T genotype indicates low malic acid content.

[0012] The invention also provides the application of the molecular markers described herein in marker-assisted breeding of apples, which involves screening apple germplasm resources with target malic acid content by detecting the genotype of the molecular markers.

[0013] It also provides a method for screening apple germplasm resources with high or low malic acid content, comprising the following steps: Genomic DNA was extracted from apple germplasm resources; Detecting the genotype of the molecular markers described in this invention; Select C / C genotype germplasm resources as high malic acid content germplasm resources, or select T / T genotype germplasm resources as low malic acid content germplasm resources.

[0014] Also provided is a primer pair for detecting the molecular marker described in this invention, the primer pair being used to amplify molecules containing... MdNAC029 The segment from the 2693rd base at the 5' end of the gene promoter region.

[0015] Furthermore, the upstream primer nucleotide sequence of the primer pair is shown in SEQ ID NO:11, and the downstream primer nucleotide sequence of the primer pair is shown in SEQ ID NO:12.

[0016] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: (1) This invention discovers and confirms that in Ma1 In gene-independent pathways, MdNAC029 Natural variations (SNPs T / C) in gene promoter regions are key genetic loci regulating malic acid accumulation in apple fruits. Through systematic molecular biology experiments (Y1H, CUT&RUN, LUC, GUS, etc.), this study elucidated... MdMYC2 Transcription factors inhibit the specific binding of the T allele of this SNP. MdNAC029 Gene expression, and the molecular mechanism by which C allele mutations relieve inhibition and promote malic acid accumulation, provides a new theoretical basis for the regulatory network of malic acid metabolism.

[0017] (2) This SNP site can be used as a functional molecular marker for early screening and prediction of germplasm with different malic acid contents. This method is not affected by the environment, is accurate, rapid and low in cost, and can significantly improve the breeding efficiency of high-quality apple varieties, and has broad application prospects. Attached Figure Description

[0018] Figure 1 for MdNAC029 A diagram illustrating gene expression patterns in different tissues of an apple.

[0019] Figure 2 The images show the subcellular localization results of the MdNAC029 protein, where a is a cell field of view under bright field; b is the nucleus-specific fluorescence signal stained with DAPI; c is the green fluorescence signal of the MdNAC029-GFP fusion protein; and d is an overlay of bright field, DAPI fluorescence, and GFP fluorescence.

[0020] Figure 3 for MdNAC029 A graph illustrating the transcriptional autoactivation activity of genes.

[0021] Figure 4 for MdNAC029 Identification of functional T / C SNPs in gene promoters and MdMYC2 Figure showing the verification results of allele-specific regulation. Where A represents... MdNAC029Schematic diagram of gene promoter SNP sites; B represents the malic acid content of different genotypes; C represents the verification results of cut & run experiments. MdMYC2 direct combination MdNAC029 Gene promoters; D~F are yeast one-hybrid, LUC, and GUS experiments verifying that MdMYC2 can bind to the T-type MdNAC029 promoter to downregulate its expression; G~H are yeast one-hybrid and GUS experiments verifying that MdMYC2 cannot bind to the C-type MdNAC029 promoter. Detailed Implementation

[0022] The technical solution of the present invention will be described below with reference to the embodiments. However, the present invention is not limited to the following embodiments.

[0023] To enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings, but the embodiments described are not intended to limit the present invention.

[0024] Unless otherwise specified, the experimental and detection methods described in the following embodiments are conventional methods; unless otherwise specified, the reagents and materials are commercially available.

[0025] Example 1 This embodiment establishes a method for the extraction and determination of organic acids in apples.

[0026] 1.1 Extraction of organic acids from malic acid Plant tissue was ground into a fine powder in liquid nitrogen. Approximately 0.1–0.2 g of the powder was suspended in 1 mL of ultrapure water, homogenized, and then sonicated at 500 Hz for 30 minutes, with one inversion during the process. The mixture was centrifuged at 6000 rpm for 15 minutes. The supernatant was filtered through a 0.22 μm aqueous filter membrane, and the filtrate was collected in a clean centrifuge tube, which yielded malic organic acids.

[0027] 1.2 Determination of malic acid content The malic acid content in apple organic acids was determined by high-performance liquid chromatography (HPLC) using an Agilent 1260 Infinity HPLC system. The column used was an Athena C18 (100 Å, 4.6 mm × 250 mm, 5 μm). The mobile phase was 0.02 M KH₂PO₄ solution (pH = 2.4), the flow rate was 0.8 mL / min, and the column temperature was 40 °C. The detection wavelength was 210 nm, the injection volume was 20 μL, isocratic elution was performed, and the elution time was 20 min.

[0028] Example 2 MdNAC029 It is a transcription factor of the NAC family in apples. MdNAC029The nucleotide sequence of the gene coding region is shown in SEQ ID NO:1. MdNAC029 The gene is located on chromosome 13 of the apple. This example is for determination. MdNAC029 Gene expression patterns and subcellular localization.

[0029] 2.1 MdNAC029 Gene expression patterns Previous studies have found that MdNAC029 Genes showed significant differential expression during apple fruit development, in order to clarify... MdNAC029 To investigate the tissue expression characteristics of genes, RT-qPCR expression patterns were analyzed using root, stem, leaf, flower, and fruit samples from different developmental stages of Fuji apples. RNA was extracted from these samples and reverse transcribed into cDNA. Using cDNA as a template, the target gene was amplified using primers MdNAC029-BD-F and MdNAC029-BD-R. Simultaneously, actin-F and actin-R primers were used for internal control amplification. The primer sequences are as follows: MdNAC029-BD-F (SEQ ID NO:2): AGGCAATTTACAGCGAGTCC; MdNAC029-BD-R (SEQ ID NO:3): AGGTGCTTGTTGGGTTGTTG.

[0030] actin-F (SEQ ID NO:4): CTCCGTGTGGGTTTTTAAG; actin-R (SEQ ID NO:5):GGAGGCAGAAACAGTACCAT.

[0031] RT-qPCR test results are as follows Figure 1 As shown, MdNAC029 The gene was expressed in all tested apple tissues, indicating its involvement in multiple biological processes of apple growth and development. The highest expression level was observed in apple fruit tissues, with a highly significant difference compared to other tissues (P<0.05, labeled a). Its relative expression level was significantly higher than other tissues, suggesting… MdNAC029 This gene likely plays a crucial role in fruit development and ripening. The root tissue showed the second highest expression level, significantly higher than the shoot tip, flower, leaf, and stem (P<0.05, labeled b), suggesting that this gene may also be involved in root growth and development or stress response. The shoot tip, flower, and leaf showed lower expression levels, with the stem tissue exhibiting the lowest expression (labeled f). MdNAC029 The high expression pattern of the gene in the fruit suggests that it may be involved in regulating fruit development and fruit quality formation.

[0032] 2.2 MdNAC029 Gene subcellular localization With MdNAC029 Using the cDNA of the gene as a template, the gene was amplified by PCR using primers MdNAC029-OE-F and MdNAC029-OE-R. MdNAC029 The full-length coding sequence of the gene was obtained. After double digestion of the amplification product and the pCAMBIA2300 vector, the target gene fragment and the vector fragment were ligated. The ligation product was transformed into competent E. coli cells, and positive clones were screened and sent to a sequencing company for sequencing. The sequencing results were correct, indicating that the MdNAC029-pCAMBIA2300 overexpression vector was successfully constructed.

[0033] The sequences of the primers MdNAC029-OE-F and MdNAC029-OE-R are as follows: MdNAC029-OE-F (SEQ ID NO:6): ACACGGGGGACGAGCTCGATGGAGGCAAAACGAAGCTCT; MdNAC029-OE-R (SEQ ID NO:7): TGGTGTCGACTCTAGAGGATCCCGGTCCAAACCACGGTTGG.

[0034] The 35S::MdNAC029::GFP fusion expression vector was constructed using conventional methods. Agrobacterium-mediated transformation was performed on the 35S::MdNAC029::GFP in the leaf epidermal cells of *N. benthamiana*. Subcellular localization was observed using confocal microscopy after DAPI staining. The results are as follows: Figure 2 As shown, the MdNAC029-GFP fluorescence signal specifically overlaps with the DAPI nuclear staining signal, indicating that... MdNAC029 Genes are located in the cell nucleus.

[0035] Example 3 This example demonstrates the verification through a yeast two-hybrid experiment. MdNAC029 Gene transcriptional autoactivation activity.

[0036] A full-length pGBKT7-MdNAC029 decoy vector was constructed using conventional methods, and the N-terminal fragment (MdNAC029) was further constructed. N (1~450bp) and C-terminal fragment (MdNAC029) CThe pGBKT7-MdNAC029 series bait vectors (451~855bp) were co-transformed with the empty pGADT7(AD) vector into yeast strain Y2HGold. The transformation products were plated on SD / -Leu / -Trp / -His / -Ade quadruple-deficient medium and incubated upside down at 30℃ for 3~5 days. The activation of the reporter gene was detected by X-α-Gal colorimetric assay.

[0037] The results are as follows Figure 3 As shown, yeast strains co-transformed with pGBKT7-MdNAC029 (full-length) and pGADT7 were able to grow normally on SD / -Leu / -Trp / -His / -Ade quadruple-deficient medium, and X-α-Gal staining showed a deep blue color, indicating that the full-length MdNAC029 protein has strong transcriptional autoactivation activity.

[0038] Yeast strains co-transformed with pGBKT7-MdNAC029^N (1~450bp) and pGADT7 were able to grow normally on quadruple-deficient medium, and the color development results were consistent with the full-length strain, appearing as a deep blue color, indicating that... MdNAC029 The transcriptional autoactivation activity of genes is mainly located in the N-terminal 1~450bp region.

[0039] Yeast strains co-transformed with pGBKT7-MdNAC029^C (451~855bp) and pGADT7 were able to grow on quadruple-deficient medium, but the X-α-Gal color was significantly lighter, indicating that the self-activation activity of the C-terminal 451~855bp segment was weak.

[0040] Example 4 Malic acid content is a key factor affecting apple fruit quality, and a deeper understanding of the molecular mechanisms regulating malic acid accumulation is crucial for apple variety improvement. Single nucleotide polymorphisms (SNPs) in promoter regions may influence gene transcriptional regulation, thereby affecting the accumulation of related metabolites in the fruit. This embodiment aims to discover and verify... MdNAC029 Functional SNPs in gene promoters that are associated with malic acid content.

[0041] Genome-wide association analysis revealed MdNAC029 A T / C single nucleotide polymorphism (SNP) site located 442 bp upstream of the start codon of a gene. 38 samples with this SNP were selected. ma1 / ma1 Apple germplasm resources with homozygous genotypes were used as test materials to verify this SNP locus.

[0042] Genomic DNA was extracted from leaves of 38 test materials using conventional methods. MdNAC029The nucleotide sequence of the gene promoter region (SEQ ID NO:8) was obtained by PCR amplification using specific primer pairs MdNAC029-pro-F and MdNAC029-pro-R. MdNAC029 Full-length gene promoter. MdNAC029 The nucleotide sequence of the gene promoter region is as follows:

[0043] The sequences of the MdNAC029-pro-F and MdNAC029-pro-R primers are as follows: MdNAC029-pro-F (SEQ ID NO:9): CACCTGGCACCTACTACTCCCT; MdNAC029-pro-R (SEQ ID NO: 10):TCTAGGGTTACAGGAGTAGAAAGG.

[0044] Based on the nucleotide sequence of the promoter region of the MdNAC029 gene (SEQ ID NO:8), SNP site-specific amplification primers were designed to amplify gene fragments containing the SNP site, thereby enabling specific detection of SNP sites in germplasm materials.

[0045] The sequences of the primers for SNP site-specific amplification are as follows: MdNAC029-SNP-F (SEQ ID NO:11): CTAGCAACTTCCCTCTTTCATGT; MdNAC029-SNP-R (SEQ ID NO:12): TCTGCCTTCCATCCCTTCCTGT.

[0046] After sequencing the PCR amplification products, the sequencing peak diagrams were analyzed using DNAMAN bioinformatics software in conjunction with Chromas software to determine the composition of each sample. MdNAC029 The single nucleotide polymorphism (SNP) sites in the promoter region of the gene were identified, and based on the base type of the SNP sites, the 38 apple germplasms were divided into three genotypes: homozygous C / C, homozygous T / T, and heterozygous C / T.

[0047] Single nucleotide polymorphism (SNP) sites were identified in each sample, and the genotype distribution of 38 apple germplasm resources was statistically analyzed based on the SNPs. The results are shown in Table 1.

[0048] Table 1. Among 38 apple germplasm accessions MdNAC029 Genotype distribution of SNP sites in gene promoter regions

[0049] Note: This SNP site is located at MdNAC029 The core regulatory region of the gene promoter region, where C represents the reference sequence allele and T represents the variant allele.

[0050] As shown in Table 1, among the 38 apple germplasm resources, the proportion of C / C homozygous genotype was 21%, the proportion of T / T homozygous genotype was 37%, and the proportion of C / T heterozygous genotype was 42%.

[0051] During the apple fruit ripening period, 3-5 fruits were randomly selected from each apple germplasm resource, and pulp tissue was collected. Organic acids were extracted from the apple using the method described in Example 1, and the malic acid content was determined. Based on the genotype (C / C, T / T, or C / T) of each apple germplasm resource determined by sequencing results, the malic acid content of different genotypes was statistically analyzed, and the correlation between genotype and malic acid content was examined.

[0052] 4.1 Correlation analysis between malic acid content and promoter variation in apple germplasm resources High-performance liquid chromatography (HPLC) was used to determine the absolute quantitative content of malic acid in mature fruits from natural populations (containing apple germplasms of different genotypes). Simultaneously, genomic DNA was extracted from these germplasms and cloned using specific primers. MdNAC029 The promoter sequence of the gene was obtained and Sanger sequencing was performed. Cis-regulatory elements in the promoter sequence were compared and predicted using polymorphism analysis software and the PlantCARE online database.

[0053] Depend on Figure 4 As can be seen from A, in MdNAC029 There is a critical T / C single nucleotide polymorphism (SNP) located 442 bp upstream of the transcription start codon (ATG), which is located within a core cis element (TCTCTTA) that is a putative transcription repressor MYC binding element.

[0054] Depend on Figure 4 As shown in Figure B, this SNP locus is significantly correlated with the malic acid content of the fruit. Apple germplasm with the C / C homozygous genotype has a significantly higher malic acid content in its fruit (mean approximately 2.74 mg / g FW) than germplasm with the T / T genotype (mean approximately 2.36 mg / g FW). Therefore, detecting the genotype of this SNP locus can serve as a molecular marker for determining malic acid content.

[0055] The association analysis results show that MdNAC029 The T / C variation at -442bp in the gene promoter region is a key genetic site that determines the difference in malic acid content. This mutation may regulate the expression of downstream genes and malic acid accumulation by changing the binding affinity of MYC family transcription factors.

[0056] 4.2 In vivo binding assay (CUT & RUN) to verify protein-protein interaction Constructing an overexpression vector 35S:: with a GFP tag MdMYC2::GFP was synthesized by Agrobacterium-mediated transformation of T / T genotype apple callus to obtain stably expressed transgenic material. Callus tissue in the logarithmic growth phase was collected, and in vivo DNA-protein interaction analysis was performed using a CUT&RUN kit. Chromatin fragments binding to MdMYC2 protein were specifically enriched using an anti-GFP monoclonal antibody, with a homologous IgG antibody used as a negative control. The enriched DNA was extracted, purified, and detected by real-time quantitative PCR (RT-qPCR) using primer pairs MdNAC029-SNP-F and MdNAC029-SNP-R.

[0057] Depend on Figure 4 As shown in C, the target DNA fragment enriched by the anti-GFP antibody (labeled as...) MdNAC029 The relative enrichment level of the promoter fragment was significantly higher than that of the IgG negative control group (the enrichment factor was approximately 3 times that of IgG).

[0058] 4.3 Yeast one-hybrid (Y1H) experiment to verify in vitro specific binding Amplify the T allele and C allele separately. MdNAC029 The gene promoter core fragment was ligated into the bait vector pAbAi (constructed as pAbAi-ProMdNAC029-T and pAbAi-ProMdNAC029-C). After linearization, it was transformed into Y1HGold yeast competent cells, screened on SD / -Ura medium lacking uracil, and the self-activation concentration was determined using different concentrations of amoeboidin A (AbA). The full-length gene promoter core fragment was then ligated into the bait vector pAbAi (constructed as pAbAi-ProMdNAC029-T and pAbAi-ProMdNAC029-C). MdMYC2 The gene was cloned into the prey vector pGADT7 and transformed into a yeast strain that had already been transformed into the bait vector. Positive clones were screened by plating on SD / -Leu medium, and single clones were picked and serially diluted (10⁻⁶ m² / L). 0 10 -1 10 -2 10 -3 The samples were seeded on SD / -Leu deficient medium supplemented with 500 ng / mL AbA and incubated upside down at 28°C for 3-5 days to observe their growth.

[0059] Depend on Figure 4 As shown in the study, yeast strains co-transformed with pGADT7-MdMYC2 and the promoter T allele bait vector were able to grow normally on selective medium containing a high concentration of AbA (500 ng / mL), while the control group was severely inhibited.

[0060] Depend on Figure 4 As can be seen from G, yeast strains co-transformed with pGADT7-MdMYC2 and promoter C allele bait vectors could not grow on AbA-containing media and exhibited a lethal phenotype consistent with the negative control.

[0061] The results of the yeast one-hybrid experiment showed that MdMYC2 Able to directly bind to the T allele MdNAC029 The gene promoter, but when a T mutation to C occurs at a key site, the recognition and binding ability of MYC2 is completely destroyed.

[0062] 4.4 Validation of transcriptional repression activity using dual-luciferase and GUS reporter gene system Containing T and C alleles MdNAC029 Gene promoters were cloned into reporter vectors to drive the LUC or GUS reporter genes (constructed as ProMdNAC029-T-LUC / GUS and ProMdNAC029-C-GUS). MdMYC2 Construct the effector vector. Transform the plasmids into Agrobacterium GV3101 cells and adjust the OD of the bacterial culture. 600 The concentration was adjusted to approximately 0.8, and after mixing in the appropriate ratio, it was injected into tobacco leaves. After incubation in the dark for 48–72 hours, the fluorescence intensity of LUC was observed using an in vivo imaging system and the LUC / REN ratio was measured; or histochemical staining was performed using GUS staining solution, and the protein was extracted and the relative GUS enzyme activity was quantitatively determined using the MUG substrate method.

[0063] Depend on Figure 4 As can be seen from E, compared with the control, co-expression MdMYC2 This leads to a significant weakening of the LUC fluorescence signal driven by the T allele promoter, resulting in a significant reduction in relative LUC activity.

[0064] Depend on Figure 4 As can be seen from F, for the T allele promoter, injection MdMYC2 The blue staining of the half tobacco leaf was significantly lighter, and the GUS enzyme activity was significantly lower than that of the control group.

[0065] Depend on Figure 4 As can be seen from H, when the promoter is mutated to the C allele, the injection... MdMYC2 There were no significant differences (ns) in GUS staining depth and relative GUS activity between the tobacco leaves and the control group.

[0066] The results of the dual-luciferase and GUS experiments further proved in plants that MdMYC2 As a transcriptional repressor, it can effectively suppress the T allele. MdNAC029 The transcriptional activity of the gene promoter; however, the T-to-C mutation allows the promoter to escape. MdMYC2 Transcriptional repression.

[0067] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.

Claims

1. A molecular marker related to the malic acid content of apple fruit, characterized in that, The molecular marker is MdNAC029 Single nucleotide polymorphism sites in the gene promoter region; The single nucleotide polymorphism site is located at MdNAC029 The nucleotide sequence of the gene promoter region, starting from the 2693rd base at the 5' end, corresponds to... MdNAC029 442bp upstream of the gene transcription start codon Place Its polymorphism is T or C; Among them, the C / C genotype indicates high malic acid content, while the T / T genotype indicates low malic acid content.

2. The molecular marker according to claim 1, characterized in that, The single nucleotide polymorphism site is located within the MYC-binding cis-acting element; the T allele is the binding site for the transcriptional repressor MdMYC2, and the C allele eliminates the binding of MdMYC2.

3. A method for detecting the molecular marker of claim 1, characterized in that, include: Detecting apple genome MdNAC029 Does a T / C single nucleotide polymorphism exist at the 2693rd base from the 5' end of the gene promoter region? 4. The application of the molecular marker according to claim 1 in identifying the malic acid content of apple fruit, characterized in that, The malic acid content of apple fruits is determined by detecting the genotype of the molecular marker: the C / C genotype indicates high malic acid content, and the T / T genotype indicates low malic acid content.

5. The application of the molecular marker as described in claim 1 in marker-assisted breeding of apples, characterized in that, Apple germplasm resources with target malic acid content are screened by detecting the genotype of the molecular markers.

6. A method for screening apple germplasm resources with high or low malic acid content, characterized in that, Includes the following steps: Genomic DNA was extracted from apple germplasm resources; Detecting the genotype of the molecular marker described in claim 1; Select C / C genotype germplasm resources as high malic acid content germplasm resources, or select T / T genotype germplasm resources as low malic acid content germplasm resources.

7. A primer pair for detecting the molecular marker of claim 1, characterized in that, The primer pair is used to amplify the contents of MdNAC029 The segment from the 2693rd base at the 5' end of the gene promoter region.

8. The primer pair according to claim 7, characterized in that, The upstream primer nucleotide sequence of the primer pair is shown in SEQ ID NO:11, and the downstream primer nucleotide sequence of the primer pair is shown in SEQ ID NO:12.