Use of an hmox1 inhibitor for the preparation of a medicament for the treatment of senile vaginitis

Abstract

This invention belongs to the field of biomedicine and discloses the application of HMOX1 inhibitors in the preparation of drugs for treating senile vaginitis. This invention is the first to discover that the content of the metabolite MESV1 (Guggulsterone) is significantly elevated in the vaginal secretions of patients with senile vaginitis. MESV1 induces ferroptosis in vaginal epithelial cells by upregulating HMOX1 protein expression, thereby driving the disease. Based on this, this invention proposes a novel therapeutic strategy targeting HMOX1. The inhibitors include shRNAs targeting HMOX1 (such as SEQ ID NO: 1-3), which can be prepared into vaginal gels, creams, and other dosage forms. Simultaneously, MESV1 can also be used to prepare auxiliary diagnostic kits. This invention provides a novel target and precise treatment approach for non-hormonal treatment of senile vaginitis.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to intervention in MESV1 / HMOX1 / Fe 2+ Strategies and drugs for treating senile vaginitis by using signaling pathway-mediated ferroptosis. Background Technology

[0002] With the accelerating aging of the global population, more than half of postmenopausal women experience discomfort due to vulvar and vaginal atrophy caused by estrogen deficiency. Currently, clinical management protocols for senile vaginitis mainly include systemic estrogen therapy, local estrogen therapy, and non-estrogenous therapies. Long-term use of systemic estrogen therapy increases the risk of venous thromboembolism and the incidence of breast and endometrial cancer. Local estrogen therapy is characterized by a relatively slow onset of action and minimal systemic absorption; however, it is contraindicated in patients with active thromboembolic diseases, unexplained abnormal uterine bleeding, and those with known or suspected estrogen-dependent tumors (such as breast cancer and endometrial cancer). Non-hormonal replacement therapies such as hyaluronic acid products cannot fundamentally change the body's endogenous hormone levels; they primarily alleviate symptoms through physical moisturizing and tissue repair. Due to metabolic clearance, the effects of these therapies typically diminish over several days to weeks, requiring regular and repeated use to maintain efficacy. Furthermore, non-hormonal therapies cannot improve systemic menopausal symptoms, but are limited to relieving local vulvar and vaginal symptoms such as vaginal dryness and pain, and cannot reverse the underlying cause of atrophy.

[0003] The rising prevalence of senile vaginitis places a heavy economic burden and medical pressure on families and society. Therefore, elucidating the pathogenesis of this disease and developing new, effective, and safe treatment options and novel intervention methods are of significant clinical importance.

[0004] In recent years, the effects of ferroptosis on the physiological processes of gynecological diseases have been widely confirmed in numerous studies [1-3]. HMOX1 is a protein with dynamic properties, capable of regulating its function through post-translational modifications and structural changes. We found that changes in HMOX1 protein expression are often associated with ferroptosis. [4, 5] There are no studies on ferroptosis in senile vaginitis. Summary of the Invention

[0005] To address the aforementioned problems, this invention discloses the application of HMOX1 inhibitors in the preparation of drugs for treating senile vaginitis. It reveals for the first time the existence of ferroptosis regulated by the MESV1 / HMOX1 axis in senile vaginitis and proposes a novel therapeutic strategy for senile vaginitis by intervening in the target protein HMOX1 using shRNA-HMOX1 nucleotide sequences.

[0006] This invention is the first to discover that the active metabolite MESV1 is highly expressed in the vaginal secretions of patients with senile vaginitis, and that MESV1 can promote ferroptosis of vaginal epithelial cells by upregulating the expression level of HMOX1 protein, thereby exacerbating the inflammatory response and tissue damage.

[0007] Specifically:

[0008] The expression level of MESV1 in senile vaginitis is closely related to the occurrence, development and prognosis of the disease, and may serve as a potential biomarker for disease progression in the future.

[0009] The HMOX1 gene is a key target in the MESV1-induced ferroptosis process. By inhibiting the expression of the HMOX1 gene or reducing its protein activity, the MESV1-mediated ferroptosis pathway can be effectively blocked, thereby reducing vaginal mucosal damage and inflammatory response.

[0010] Based on the above findings, this invention discloses the application of the shRNA-HMOX1 nucleotide sequence as an HMOX1 target protein in the preparation of a drug for treating senile vaginitis. The drug intervenes in the MESV1-induced ferroptosis process by inhibiting HMOX1 gene expression or protein activity.

[0011] To achieve the objectives of this invention, the invention includes the following technical solutions:

[0012] This invention discloses for the first time the application of HMOX1 inhibitors in the preparation of drugs for treating senile vaginitis.

[0013] Furthermore, in the above applications, the HMOX1 inhibitor is a substance capable of reducing or silencing HMOX1 gene expression and / or inhibiting HMOX1 protein activity.

[0014] Furthermore, in the above applications, the HMOX1 inhibitor is a shRNA, siRNA, or antisense oligonucleotide that targets the HMOX1 gene.

[0015] Furthermore, in the above applications, the shRNA sequence is selected from SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, wherein:

[0016] SEQ ID NO: 1 is TGCCAGTGCCACCAAGTTCAA;

[0017] SEQ ID NO: 2 is ATGGGTCCTTACACTCAGCTT;

[0018] SEQ ID NO: 3 is AGGCAGAGAATGCTGAGTTCA.

[0019] The present invention also discloses a pharmaceutical composition for the prevention and / or treatment of senile vaginitis, comprising a therapeutically effective amount of an HMOX1 inhibitor as defined in any one of claims 1-4 and a pharmaceutically acceptable carrier.

[0020] Furthermore, the above-mentioned pharmaceutical composition is in the dosage form of a vaginal preparation, including gel, cream, suppository, or vaginal tablet.

[0021] The present invention also discloses the use of the metabolite MESV1 in the preparation of reagents or kits for the auxiliary diagnosis of senile vaginitis.

[0022] This invention also discloses a kit for the auxiliary diagnosis of senile vaginitis, comprising reagents for detecting the metabolite MESV1.

[0023] Furthermore, in the above-mentioned kit, the reagents are antibodies against MESV1 or mass spectrometry detection standards.

[0024] This invention also discloses a product comprising an HMOX1 inhibitor and a ferroptosis inhibitor, said product being used to prepare a medicament for the prevention and / or treatment of senile vaginitis.

[0025] Compared with the prior art, the present invention has the following outstanding advantages:

[0026] 1. This invention reveals for the first time the mechanism of action of the MESV1-HMOX1-ferroptosis pathway in senile vaginitis, providing a new theoretical basis for the pathological study of the disease;

[0027] 2. Intervention strategies targeting the HMOX1 gene are characterized by high specificity and strong targeting, which can avoid the side effects of traditional hormone therapy and improve the safety of treatment;

[0028] 3. This strategy provides new targets and drug development directions for the precision treatment of senile vaginitis, and has broad prospects for clinical application. Attached Figure Description

[0029] Figure 1For example, after treating VK2 / E6E7 cells with 40 μmol MESV1 for 48 hours, (A) lipid peroxidation levels were assessed by flow cytometry after staining with BODIPY-C11 reagent; (B) lipid peroxidation levels were detected using the BODIPY-C11 kit (expressed as the fluorescence ratio of oxidized to non-oxidized BODIPY-C11) and quantitatively analyzed using ImageJ software, scale bar = 25 μm; (C) intracellular lipid peroxidation levels were detected using malondialdehyde (MDA) assay; (D) fluorescence images were acquired after FerroOrange staining, and the average fluorescence intensity was calculated using ImageJ software, scale bar = 25 μm; (E) intracellular Fe was measured using a ferrous ion colorimetric assay kit. 2+ Levels (n=3 per group); (F) HMOX1 protein expression levels were analyzed by Western blotting; data represent at least three independent experiments with consistent results. Student's t-test was used for intergroup comparisons, ×p<0.05, ××p<0.01, ×××p<0.001, ××××p<0.0001.

[0030] Figure 2 For VK2 / E6E7 cells treated with 40 μmol MESV1 for 48 hours, (A) fluorescence images were acquired using a reactive oxygen species (ROS) detection kit, and the average fluorescence intensity was calculated using ImageJ software (scale bar = 25 μm); (B) ROS levels were assessed by flow cytometry; a stable VK2 / E6E7 cell line with low HMOX1 expression was successfully constructed via lentiviral transfection; (C) Intracellular lipid peroxidation levels were assessed using MDA assay (n = 3 per group); (D) FerroOrange-stained cells were fluorescence-imagined, and the average fluorescence intensity was calculated using ImageJ software (scale bar = 25 μm); (E) FerroOrange-stained VK2 / E6E7 cells were analyzed by flow cytometry; (F) Intracellular Fe was measured using a ferrous ion colorimetric assay kit. 2+ Levels (n=3 per group); (G) Cells were stained using a reactive oxygen species detection kit (DHE) and analyzed by flow cytometry; (H) HMOX1 protein expression in VK2 / E6E7 cells was detected by Western blotting. Student's t-test was used for intergroup comparisons, with ×p<0.05 and ××××p<0.0001.

[0031] Figure 3The results are as follows: (A) Schematic diagram of mouse model establishment. OVX mice were administered the drug three times consecutively for subsequent experiments and were divided into OVX group, OVX-MESV1 intervention group, and OVX-MESV1-Fer-1 group. (B) Mouse vaginal irrigation fluid was diluted 100-fold and spread on LB medium; (C) Appearance of the mouse vaginal opening; (D) HE-stained section of mouse vaginal tissue, with blue arrows indicating inflammatory cells and neutrophils, and black boxes marking mucosal damage areas. The scale bar is 0.1 mm at 40x magnification and 0.05 mm at 60x magnification; (EH) Expression levels of inflammatory factors IL-6, IL-13, TGF-β, and TNF-α in isolated mouse vaginal tissue were detected by qPCR; (I) Expression of HMOX1 protein in mouse vaginal tissue was detected by Western blot. Data are expressed as mean ± standard deviation (n ≥ 3); ×p < 0.05, ××××p < 0.0001. Detailed Implementation

[0032] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] Unless otherwise specified, all reagents or instruments used in the embodiments of this invention are commercially available conventional reagent products.

[0034] To address the current research gaps in senile vaginitis, we identified three previously uncharacterized metabolites from patient secretions: Guggulsterone, Umbelliprenin, and Inosinic acid, which we named vaginal environment-derived metabolites 1-3 (MESV1-3). To explore the role of these metabolites in atrophic vaginitis and uncover their clinical potential, we selected MESV1 as the research subject based on the multiplicity of metabolite variability and the within-group coefficient of variation. A search of the HMDB Human Metabolites Database (https: / / hmdb.ca / ) revealed that Guggulsterone, also known as MESV1 (CAS registry number 95975-55-6), has the molecular formula C1. 21 H 28 O2 has a molecular weight of 312.45 Da.

[0035] Experimental materials:

[0036] Sample source: Vaginal secretion samples were collected from senile vaginitis patients and healthy postmenopausal women;

[0037] Cell line: Human vaginal epithelial cell line VK2 / E6E7;

[0038] Reagents: MESV1 standard was purchased from Medchemexpress, catalog number: 95975-55-6; the sequence numbers of the three shRNA-HMOX1 fragments are as follows:

[0039] LV-HMOX1-RNAi(PSC85773-1):TGCCAGTGCCACCAAGTTCAA= SEQ ID NO: 1;

[0040] LV-HMOX1-RNAi(PSC85774-1):ATGGGTCCTTACACTCAGCTT =SEQ ID NO: 2;

[0041] LV-HMOX1-RNAi(PSC85775-2): AGGCAGAGAATGCTGAGTTCA=SEQ ID NO: 3.

[0042] Co-shRNA-HMOX1:TTCTCCGAACGTGTCACGT=SEQ ID NO: 4.

[0043] Ferric death test kits were purchased from Elabscience to detect malondialdehyde and Fe. 2+ Concentrations: BODIPY 581 / 591 C11 was purchased from Medchemexpress; HO-1 / HMOX1 polyclonal antibody was purchased from Proteintech, diluted 1:1000; Goat Anti-Rabbit IgG (H+L) was purchased from Yamei, diluted 1:5000.

[0044] The samples were sent to the relevant company for testing. The content of MESV1 in vaginal secretions was detected by high performance liquid chromatography. The content of MESV1 in vaginal secretions of patients with senile vaginitis was significantly higher than that in the healthy control group, and the expression level of HMOX1 protein was positively correlated with the content of MESV1.

[0045] Example 1

[0046] The mechanism by which MESV1 induces upregulation of HMOX1 expression in VK2 / E6E7 cells and ferroptosis;

[0047] Cell model establishment: MESV1 was dissolved in DMSO, and 40 μM MESV1 was used to continuously induce VK2 / E6E7 cells for 48 h for comparison with VK2 / E6E7 cells that had not been treated with MESV1.

[0048] Detection of ferroptosis biomarkers: Detection of lipid peroxides (e.g., using flow cytometry and confocal imaging) Figure 1 As shown in AB), the kit was used to detect malondialdehyde (MDA) in cell homogenates (as shown in AB). Figure 1 (as shown in C) and ferrous ions (Fe) 2+ ) level (e.g.) Figure 1 As shown in E), intracellular FerroOrange expression was detected using confocal microscopy (e.g., as shown in E). Figure 1 As shown in Figure D), the results revealed that MDA and Fe were present in the MESV1-treated cell group (model group). 2+ The content increased significantly.

[0049] HMOX1 protein expression levels were detected by Western blotting. The results showed that HMOX1 expression in the model group was significantly higher than that in the control group (e.g., ...). Figure 1 As shown in F).

[0050] Intracellular ROS levels were detected using flow cytometry and confocal microscopy (e.g., ...). Figure 2 As shown in AB), the results showed that the significantly increased ROS content in the model group indicated that ferroptosis was activated.

[0051] Example 2

[0052] shRNA-HMOX1 significantly reduced MESV1-induced upregulation of HMOX1 expression and ferroptosis in VK2 / E6E7 cells;

[0053] Cell Model Establishment: Lentiviral viruses carrying shRNA sequences targeting the HMOX1 gene were packaged by Jikai Gene Company. The shRNA sequences were selected from SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. All three sequences have equivalent effects in inhibiting HMOX1 expression; this example uses SEQ ID NO: 1 as an example. A lentivirus carrying an unrelated sequence (Co-shRNA-HMOX1, SEQ ID NO: 4) was also constructed as a control. The virus was transduced into VK2 / E6E7 cells according to the product instructions to construct a stable HMOX1 knockdown cell model (shRNA-HMOX1 group) and a control cell model (Co-shRNA-HMOX1 group). Subsequently, both groups of cells were treated with 40 μM MESV1 for 48 hours, and comparative analysis was performed.

[0054] Detection of ferroptosis biomarkers: Malondialdehyde (MDA) in cell homogenates was detected using a kit (e.g., Figure 2 (as shown in C) and intracellular ferrous iron (Fe) 2+ )(like Figure 2The results showed that the Fe levels in the shRNA-HMOX1-VK2 / E6E7 cell group were significantly higher than those in the Co-shRNA-HMOX1-VK2 / E6E7 cell group. 2+ The content was significantly reduced, and intracellular ROS levels were detected using flow cytometry (e.g., Figure 2 As shown in G), the results showed that the ROS content in the shRNA-HMOX1-VK2 / E6E7 cell group was significantly lower than that in the Co-shRNA-HMOX1-VK2 / E6E7 cell group, indicating that MESV1-induced ferroptosis was significantly inhibited after knocking down HMOX1 protein.

[0055] HMOX1 protein expression levels were detected by Western blotting. The results showed that HMOX1 expression was significantly lower in the shRNA-HMOX1-VK2 / E6E7 cell group compared to the Co-shRNA-HMOX1-VK2 / E6E7 cell group (e.g., ...). Figure 2 (as shown in H).

[0056] Example 3

[0057] In a senile vaginitis model, MESV1 induced upregulation of HMOX1 expression and exacerbated inflammation in mouse vaginal tissue;

[0058] Animal model establishment: The model establishment process is as follows Figure 3 As shown in Figure A, bilateral ovaries were surgically removed from 5-8 week old BALB / cJGpt mice. A senile vaginitis model was established by vaginal administration of the following drugs: OVX group, OVX-MESV1 group (adding 9.373 mg / kg MESV1), and OVX-MESV1-Fer-1 group (adding 9.373 mg / kg MESV1 and 0.655 mg / kg Ferrostatin-1 (Fer-1)). Administration was repeated three times, with a three-day interval between doses. Observations were then performed. Figure 3 As shown in BC;

[0059] Tissue analysis: vaginal tissues from the OVX group, OVX-MESV1 group, and OVX-MESV1-Fer-1 group.

[0060] HE staining experiments revealed that MESV1 induced severe thinning and tissue damage of the vaginal mucosa in mice. However, Fer-1 could partially improve the MESV1-induced mucosal damage in mice, significantly thickening the mucosa (e.g., Figure 3 (As shown in D). Detection of MESV1-induced inflammation in OVX mice: The levels of inflammatory factors IL-6, IL-13, TGF-β, and TNF-α were detected by real-time quantitative PCR (qRT-PCR). Figure 3 As shown in EH, the results showed that the expression of inflammatory factors in the OVX-MESV1 group was significantly higher than that in the OVX group, indicating that MESV1 induces inflammation in the vaginal tissue of OVX mice. The use of Fer-1 rescue can significantly reduce the release of MESV1-induced vaginal epithelial cell inflammatory factors.

[0061] The protein expression level of HMOX1 was detected by Western blotting. The results showed that the expression of HMOX1 in the OVX-MESV1 group was significantly higher than that in the OVX group (e.g., ...). Figure 3 As shown in Figure I).

[0062] As can be seen from the above examples, we first discovered MESV1, which is highly expressed in vaginal secretions, in a population with senile vaginitis. Through VK2 / E6E7 cell experiments, we found that it can induce ferroptosis. Then, we focused on the HMOX1 protein, and by silencing the HMOX1 protein, we found that the ferroptosis induced by MESV1 was significantly improved. Our experiments showed that MESV1 induces ferroptosis in vaginal epithelial cells through the HMOX1 protein, thereby causing inflammation. This target can precisely locate the HMOX1 gene for use in the preparation of drugs for the treatment of senile vaginitis. These drugs can intervene in the MESV1-induced ferroptosis process by inhibiting HMOX1 gene expression or protein activity, thereby providing precise treatment for senile vaginitis and reducing adverse drug reactions.

[0063] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.

[0064] Appendix: References.

[0065] 1.Hu H, Zhang J, Xin X, Jin Y, Zhu Y, Zhang H, Fan R, Ye Y, Jiang Y,Li D: Bushen Jianpi Tiaoxue Decoction (BJTD) inhibits the LIF-mTOR signalingaxis to regulate mitochondrial function and alleviate cyclophosphamide-induced diminished ovarian reserve. Apoptosis 2025, 30:1331-1350.

[0066] 2.Lu C, Zhu W, Han X, Du X, Zhang H, Yao Q, Liu T, Zhang C:Clinicopathological characteristics of invasive stratified mucinous carcinomaof the cervix and the expression and clinical significance of SLC7A11, SLC3A2and PD-L1. Frontiers in Oncology 2024, 14.

[0067] 3.Shen C, Jiang Y, Lin J, Guo Q, Fang D: METTL3 silencing inhibitsferroptosis to suppress ovarian fibrosis in PCOS by upregulating m6Amodification of GPX4. Journal of Molecular Histology 2024, 55:1163-1175.

[0068] 4.Peng X, Sun B, Tang C, Shi C, Xie X, Wang X, Jiang D, Li S, Jia Y,Wang Y, et al: HMOX1-LDHB interaction promotes ferroptosis by inducingmitochondrial dysfunction in foamy macrophages during advancedatherosclerosis. Developmental Cell 2025, 60:1070-1086.e1078.

[0069] 5.Zhou Y, Zeng L, Cai L, Zheng W, Liu X, Xiao Y, Jin X, Bai Y, Lai M,Li H, et al: Cellular senescence-associated gene IFI16 promotes HMOX1-dependent evasion of ferroptosis and radioresistance in glioblastoma. NatureCommunications 2025, 16。

Claims

1. Application of HMOX1 inhibitors in the preparation of drugs for treating senile vaginitis.

2. The application according to claim 1, characterized in that, The HMOX1 inhibitor is a substance that can reduce or silence HMOX1 gene expression and / or inhibit HMOX1 protein activity.

3. The application according to claim 2, characterized in that, The HMOX1 inhibitor is a shRNA, siRNA, or antisense oligonucleotide that targets the HMOX1 gene.

4. The application according to claim 3, characterized in that, The shRNA sequence is selected from SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, wherein: SEQ ID NO: 1 is TGCCAGTGCCACCAAGTTCAA; SEQ ID NO: 2 is ATGGGTCCTTACACTCAGCTT; SEQ ID NO: 3 is AGGCAGAGAATGCTGAGTTCA.

5. A pharmaceutical composition for the prevention and / or treatment of senile vaginitis, characterized in that, Contains a therapeutically effective amount of an HMOX1 inhibitor as defined in any one of claims 1-4 and a pharmaceutically acceptable carrier.

6. The pharmaceutical composition according to claim 5, characterized in that, Its dosage form is a vaginal preparation, including gel, cream, suppository or vaginal tablet.

7. Application of metabolite MESV1 in the preparation of reagents or kits for the auxiliary diagnosis of senile vaginitis.

8. A kit for assisting in the diagnosis of senile vaginitis, characterized in that, It contains reagents for detecting the metabolite MESV1.

9. The reagent kit according to claim 8, characterized in that, The reagents are antibodies or mass spectrometry detection standards targeting MESV1.

10. A product comprising an HMOX1 inhibitor and a ferroptosis inhibitor, characterized in that, The product is used to prepare a medicine for the prevention and / or treatment of senile vaginitis.

Images