Use of cald1 protein in the preparation of a medicament for treating bladder cancer

Through in vivo tumor models and proteomics analysis, it was found that CALD1 protein is highly expressed in cisplatin-resistant bladder cancer. Inhibiting CALD1 protein expression or activity can improve the sensitivity of bladder cancer cells to cisplatin chemotherapy, solving the problem of chemotherapy resistance in bladder cancer and providing a new treatment approach.

CN122321145APending Publication Date: 2026-07-03THE AFFILIATED HOSPITAL OF QINGDAO UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610567510.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-27
Publication Date
2026-07-03

Smart Images

  • Figure CN122321145A_ABST
    Figure CN122321145A_ABST
Patent Text Reader

Abstract

This invention discloses the application of CALD1 protein in the preparation of drugs for treating bladder cancer, belonging to the field of biomedical technology. The application of CALD1 protein in the preparation of drugs for treating bladder cancer: This invention, through the construction of drug-resistant cell lines using in vivo animal models and combined with clinical sample analysis, first discovered that CALD1 is highly expressed in cisplatin-resistant bladder cancer cells and is associated with poor patient prognosis, demonstrating that CALD1 is a potential novel target for treating cisplatin resistance in bladder cancer, which is beneficial for further research on the mechanism of tumor chemotherapy resistance caused by abnormal activation of CALD1.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of a CALD1 protein in the preparation of a drug for treating bladder cancer. Background Technology

[0002] Bladder cancer is one of the most common malignant tumors of the urinary system. Statistics show that approximately 90,000 new cases of bladder cancer are diagnosed in my country each year, making it the 11th most common malignant tumor in the country (see HAN B, ZHENG R, ZENGH, et al. Cancer incidence and mortality in China, 2022 [J]. J Natl CancerCent, 2024, 4(1): 47-53.). Clinically, cisplatin-based chemotherapy remains the standard first-line treatment for muscle-invasive and advanced metastatic bladder cancer. Although 60-70% of patients respond well to initial cisplatin treatment, most develop resistance within a short period, leading to treatment failure and difficulty in controlling disease progression (see JIANG DM, GUPTA S, KITCHLU A, et al. Defining cisplatin eligibility in patients with muscle-invasive bladder cancer [J]. Nat Rev Urol, 2021, 18(2): 104-14.). In recent years, immune checkpoint inhibitors have been approved for bladder cancer patients who are intolerant or resistant to cisplatin; however, the overall response rate is only 15-25% when not used in combination with cisplatin (see SCHNEIDER AK, CHEVALIER MF, DERRé L. The multifaceted immune regulation of bladder cancer [J]. Nat Rev Urol, 2019, 16(10): 613-30.). In other words, some bladder cancer patients are not sensitive to cisplatin-based chemotherapy, and may even develop resistance and toxic side effects, highlighting the urgent need to find new targets to improve the efficacy of bladder cancer treatment.

[0003] However, cisplatin-based chemotherapy resistance in bladder cancer remains a major clinical challenge, with complex mechanisms involving multiple levels such as epigenetic transcriptional regulation, metabolic reprogramming, and cell death escape. These mechanisms are insufficient to fully explain the complex resistance phenomena observed clinically, suggesting the existence of undiscovered molecular drivers. Therefore, it is necessary to systematically elucidate the important mechanisms of cisplatin-based chemotherapy resistance in bladder cancer and identify key regulatory targets based on this, aiming to provide new strategies for reversing resistance and achieving precision medicine, ultimately providing important scientific evidence for improving patient prognosis and quality of life.

[0004] Furthermore, previous studies on establishing cisplatin-resistant cell models for bladder cancer have primarily focused on the in vitro cellular level, constructing models by continuously exposing bladder cancer cells to cisplatin. However, this method has certain limitations: firstly, it lacks the interaction between tumor cells and immune cells, stromal cells, and the vascular system, making it difficult to simulate the complex tumor microenvironment in vivo; secondly, long-term continuous in vitro administration may lead to non-physiological adaptive changes in cells, which may differ from the drug resistance mechanisms induced by intermittent chemotherapy regimens in clinical practice. Summary of the Invention

[0005] To address the technical problems existing in the prior art, this invention provides an application of CALD1 protein in the preparation of a drug for treating bladder cancer. The technical solution is as follows:

[0006] Application of CALD1 protein in the preparation of drugs for treating bladder cancer.

[0007] Alternatively, bladder cancer can be treated by inhibiting the expression or activity of the CALD1 protein to increase the sensitivity of bladder cancer cells to cisplatin chemotherapy.

[0008] Application of reagents that inhibit the expression or activity of CALD1 protein in the preparation of drugs for treating bladder cancer.

[0009] Optionally, the agent that inhibits the expression or activity of the CALD1 protein can treat bladder cancer by increasing the sensitivity of bladder cancer cells to cisplatin chemotherapy.

[0010] A pharmaceutical composition for treating bladder cancer, the pharmaceutical composition comprising: an agent that inhibits the expression or activity of CALD1 protein and cisplatin.

[0011] Optionally, the reagent for inhibiting the expression or activity of CALD1 protein includes shRNA, the sequence of which is shown in SEQ ID No. 1.

[0012] A shRNA that inhibits the expression or activity of CALD1 protein, the sequence of which is shown in SEQ ID No. 1.

[0013] The beneficial effects of the technical solutions provided in the embodiments of the present invention include at least the following:

[0014] This invention, through the construction of drug-resistant cell lines using in vivo animal models and combined with clinical sample analysis, has pioneered the discovery that CALD1 is highly expressed in cisplatin-resistant bladder cancer cells and is associated with poor patient prognosis. This demonstrates that CALD1 is a potential novel target for treating cisplatin resistance in bladder cancer, which is beneficial for further research into the mechanism of tumor chemotherapy resistance caused by abnormal activation of CALD1.

[0015] Specifically, to overcome the limitations of in vitro cell models in simulating the tumor microenvironment and accurately representing drug resistance mechanisms, this invention utilizes an in vivo xenograft tumor model to construct a cisplatin-resistant bladder cancer cell line (UMUC3-R) after multiple cycles of intermittent cisplatin treatment. This model better simulates the dynamic development of clinical chemotherapy resistance. Subsequently, proteomics sequencing revealed that CALD1 (Caldesmon 1, calmodulin-binding protein 1) protein is highly expressed in cisplatin-resistant bladder cancer cells (UMUC3-R) compared to parental UMUC3 cells. Clinical sample analysis further confirmed that CALD1 is highly expressed in drug-resistant bladder cancer tissues and is associated with poor patient prognosis; knockdown of CALD1 enhances the sensitivity of cisplatin-resistant bladder cancer cells to cisplatin; animal experiments also confirmed that knockdown of CALD1 can improve the chemosensitivity of bladder tumors to cisplatin, providing a new approach to bladder cancer treatment. Future development may involve small molecule inhibitors or combination therapies targeting this molecule, providing a promising treatment strategy for cisplatin-resistant bladder cancer, with significant theoretical guidance and clinical translational value. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1A This is a flowchart of the in vivo screening of the cisplatin-resistant cell line UMUC3-R provided in Example 1 of the present invention;

[0018] Figure 1B This is a graph showing the changes in subcutaneous tumor volume during four cycles of in vivo screening provided in Embodiment 1 of the present invention.

[0019] Figure 1C This is a graph showing the IC50 of UMUC3-R and UMUC3 cells in response to cisplatin treatment as determined by the MTT assay provided in Embodiment 1 of the present invention;

[0020] Figure 1D This is a graph from Example 1 of the present invention, showing the effect of cisplatin treatment on the survival rate of two groups of mice in a subcutaneous tumor-bearing model constructed using UMUC3-R and UMUC3 cells.

[0021] Figure 2A This is a heatmap of proteomics sequencing of UMUC3-R and UMUC3 cells provided in Embodiment 2 of the present invention;

[0022] Figure 2B This is a volcano diagram showing the significant high expression of CALD1 in drug-resistant cells, provided in Example 2 of the present invention;

[0023] Figure 2C This is a graph showing the expression level of CALD1 protein in cisplatin-sensitive and drug-resistant bladder cancer tissues detected by immunohistochemical experiments provided in Example 2 of this invention.

[0024] Figure 2D This is a graph showing the expression score of CALD1 protein in cisplatin-sensitive and cisplatin-resistant bladder cancer tissues provided in Example 2 of the present invention, illustrating the high expression of CALD1 protein in cisplatin-resistant bladder cancer specimens;

[0025] Figure 2E This is a graph from Embodiment 2 of the present invention, which uses the Kaplan-Meier method to analyze the relationship between CALD1 expression level and patient overall survival, illustrating the correlation between high CALD1 expression and poor patient prognosis.

[0026] Figure 3A This is a graph provided in Example 3 of the present invention, showing the apoptosis rate detected by flow cytometry in UMUC3-R cells with CALD1 knockdown treated with PBS or cisplatin, respectively.

[0027] Figure 3B This is a gross photograph of a subcutaneous tumor provided in Embodiment 3 of the present invention;

[0028] Figure 3C This is a diagram showing the volume of the subcutaneous tumor provided in Embodiment 3 of the present invention;

[0029] Figure 3D This is a graph showing the weight of a subcutaneous tumor as provided in Embodiment 3 of the present invention;

[0030] Figure 3E This is a diagram showing the apoptosis of tumor tissue in the control group and the treatment group in the TUNEL experiment provided in Embodiment 3 of the present invention. Detailed Implementation

[0031] The technical solution of the present invention will now be described with reference to the accompanying drawings.

[0032] In embodiments of the present invention, words such as "exemplarily," "for example," etc., are used to indicate that something is an example, illustration, or description. Any embodiment or design described as "exemplary" in the present invention should not be construed as being more preferred or advantageous than other embodiments or designs. Specifically, the use of the word "exemplary" is intended to present the concept in a concrete manner. Furthermore, in embodiments of the present invention, the meaning expressed by "and / or" can be both, or either one.

[0033] In this invention, CALD1 refers to calmodulin-binding protein 1, PBS refers to phosphate buffer solution, and TUNEL refers to terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling.

[0034] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0035] Unless otherwise specified, the experimental methods described in the following embodiments are conventional experimental methods well known to those skilled in the art, and are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Where specific conditions are not specified in the experimental methods, they are generally operated under conventional conditions.

[0036] Unless otherwise specified, all materials and reagents described in the following examples are commercially available.

[0037] Example 1

[0038] 1. Cell inoculation: 5 × 10⁵ cells were subcutaneously injected into the right back of 5-week-old male BALB / c nude mice (purchased from Vital Rivers). 6 One UMUC3 cell (purchased from ATCC);

[0039] 2. Initial cisplatin therapy: When the tumor volume reaches 100-200 mm 3 Start administering medication at the appropriate time;

[0040] 3. Dosage regimen: Cisplatin 1 mg / kg, intraperitoneal injection, 3 times a week;

[0041] 4. Tumor regression and regrowth: Continue treatment for 2 cycles or more until the transplanted tumor has shrunk to almost undetectable size, and wait for the tumor to regrow to 100-200 mm. 3 ;

[0042] 5. Tumor tissue dissociation and cell separation: The transplanted tumor tissue was dissociated into a single-cell suspension by collagenase digestion, and the cells were collected and passaged for culture.

[0043] 6. Re-inoculation and repeated treatment: The isolated and cultured cells were re-inoculated into new BALB / c nude mice, and cisplatin treatment was repeated (steps 2-4).

[0044] 7. Drug resistance determination: The above cycle is repeated continuously. The determination criterion is that the tumor volume no longer shrinks after cisplatin treatment, which is considered acquired chemotherapy resistance.

[0045] Experimental results:

[0046] See the experimental results. Figures 1A to 1D This is for establishing and validating a cisplatin-resistant cell model of bladder cancer.

[0047] in, Figure 1A This is a flowchart of the in vivo screening process for the cisplatin-resistant cell line UMUC3-R. From... Figure 1A The process can be seen in the use of UMUC3 cells to carry tumors subcutaneously in nude mice and construct the cisplatin-resistant bladder cancer cell line UMUC3-R.

[0048] Figure 1B This is a graph showing the changes in subcutaneous tumor volume during four cycles of in vivo screening. From... Figure 1B The curves showing the changes in subcutaneous tumor volume in nude mice during the four screening cycles can be observed.

[0049] Figure 1C This is a graph showing the IC50 of UMUC3-R and UMUC3 cells in response to cisplatin treatment, obtained using the MTT assay. From... Figure 1C It can be seen that the IC50 of resistant cells UMUC3-R against cisplatin is higher than that of parental cells UMUC3.

[0050] Figure 1D This figure shows the effect of cisplatin treatment on the survival rate of two groups of mice, using a subcutaneous tumor-bearing model constructed with UMUC3-R and UMUC3 cells. Figure 1D As can be seen, the survival rate of subcutaneous tumor-bearing mice constructed from UMUC3-R cells after cisplatin treatment was much lower than that of mice modeled with UMUC3 cells.

[0051] Example 2

[0052] 1. The parental UMUC3 cells and the drug-resistant UMUC3-R cells screened in Example 1 were compared using proteomics sequencing. The specific steps are as follows:

[0053] ①Proteomics sequencing and analysis:

[0054] Sample preparation: Total protein was extracted from parental cells and drug-resistant cells, respectively;

[0055] Protein isolation and enzymatic digestion: The extracted protein is enzymatically digested and cut into peptides;

[0056] Mass spectrometry detection: Peptides were analyzed using liquid chromatography-tandem mass spectrometry (LC-MS / MS).

[0057] ② Differentially regulated proteins: Set a threshold (expression difference > 2-fold) to screen for proteins that are significantly upregulated or downregulated in drug-resistant cells.

[0058] Experimental results:

[0059] Proteomics sequencing revealed that CALD1 protein expression was significantly upregulated in drug-resistant UMUC3-R cells compared to parental UMUC3 cells.

[0060] See the experimental results. Figures 2A to 2B .in,

[0061] Figure 2A This is a heatmap of proteomics sequencing of UMUC3-R and UMUC3 cells. From Figure 2A The protein clustering can be observed.

[0062] Figure 2B The volcano map was created based on proteomics sequencing data. Figure 2B As can be seen, CALD1 is significantly overexpressed in drug-resistant cells.

[0063] 2. Immunohistochemistry was performed on 25 cisplatin-sensitive bladder cancer specimens and 13 cisplatin-resistant bladder cancer specimens to detect the expression level of CALD1 in cisplatin-sensitive and drug-resistant bladder cancer specimens.

[0064] The inclusion criteria for 25 cisplatin-sensitive bladder cancer specimens were: ① Patients receiving neoadjuvant therapy with pathological complete response (pCR), where no surviving cancer cells were found in the resected tumor tissue and dissected lymph nodes postoperatively (pathology reports often state ypT0N0). ② Patients receiving neoadjuvant therapy with pathological downstaging (pDS), where the postoperative pathological stage was lower than the pre-treatment clinical stage. This is usually defined as tumor downgrading to ypT1 or lower (i.e., the tumor is confined to the submucosa or superficial layers) and no lymph node metastasis (N0). ③ For unresectable advanced or metastatic patients, after 2-3 cycles of chemotherapy, achieving complete response (CR, complete disappearance of all visible tumor lesions, no new lesions) or partial response (PR, a reduction of ≥30% in the total diameter of all target lesions compared to pre-treatment levels).

[0065] The inclusion criteria for 13 cisplatin-resistant bladder cancer specimens were: ① Patients who received neoadjuvant therapy did not achieve pCR or pDS. ② For unresectable advanced or metastatic patients, after 2-3 cycles of chemotherapy, the disease was stable (SD, lesion shrinkage did not meet the PR criteria, and lesion enlargement did not meet the PD criteria) or the disease progressed (PD, the total diameter of the target lesions increased by ≥20% compared to the minimum diameter during treatment, or new lesions appeared).

[0066] The specific steps for detecting CALD1 expression levels are as follows:

[0067] 1. Sample preparation and slicing

[0068] ① Sample acquisition and fixation: Surgical resection specimens from bladder cancer patients were collected. The tissues were immediately placed in 10% neutral formalin buffer for fixation for 24 hours after ex vivo.

[0069] ② Dehydration, clearing and embedding: The fixed tissue is dehydrated with a gradient of alcohol (concentrations from 50%, 70%, 95% to 100%), then cleared with xylene, and finally embedded in paraffin to make a wax block.

[0070] ③ Slicing, scooping, and baking: Use a microtome to slice the wax block into thin slices 2-4 micrometers thick. Flatten the slices in warm water and scoop them out with a slide treated to prevent detachment. Then, bake the slides in an oven at 50-60℃ for at least 15-30 minutes to ensure the tissue adheres firmly to the slide.

[0071] 2. Dewaxing, hydration, and antigen retrieval

[0072] ① Dewaxing and hydration: Soak the baked sections in xylene twice for 10 minutes each time to completely remove the paraffin. Then soak the sections in a series of ethanol solutions (100%, 95%, 70%, 50%) for 3-5 minutes each. Finally, soak the sections in PBS buffer for 5 minutes to rehydrate the tissue.

[0073] ② Antigen retrieval: Place the tissue section in citrate buffer, heat it in a microwave oven until small bubbles appear, cool it for 5 minutes, repeat the cycle three times, and finally let it cool naturally to room temperature.

[0074] 3. Blocking and antibody incubation

[0075] ① Blocking endogenous peroxidase: The subsequent detection system uses horseradish peroxidase (HRP). The slides are incubated with 3% hydrogen peroxide (H2O2) at room temperature for 30 minutes to inactivate endogenous peroxidase in the tissue and avoid background staining.

[0076] ② Blocking non-specific sites: Add 5% bovine serum albumin (BSA) or normal serum homologous to the secondary antibody, incubate at 37°C for 30 minutes to block sites on the tissue that can non-specifically bind to the antibody. Do not wash after blocking; proceed directly to the next step.

[0077] ③ Primary antibody incubation: Add CALD1 specific antibody, place the slide in a humidified chamber, and incubate overnight at 4°C.

[0078] ④ Secondary antibody incubation: After thoroughly washing the sections with PBS buffer, add the enzyme-labeled secondary antibody (HRP-labeled goat anti-rabbit IgG) corresponding to the primary antibody and incubate at room temperature for 60 minutes.

[0079] 4. Development, Restaining and Mounting

[0080] ① Color development: After washing, add freshly prepared DAB (diaminobenzidine) color development solution. DAB will form a brownish-yellow or brownish-red precipitate under the action of HRP. Once the target protein turns a clear brownish-yellow color and the background has not yet turned yellow, immediately stop the reaction with distilled water.

[0081] ② Counterstaining: To reveal the outline of the cell nucleus and facilitate the localization of the target protein (CALD1 is located in the cytoplasm), hematoxylin was used for counterstaining, staining the cell nucleus for about 5 minutes. Then, the stain was thoroughly rinsed with tap water to allow the stain to return to blue (about 5 minutes).

[0082] ③ Dehydration, clearing, and mounting: The slides are dehydrated and cleared sequentially by passing them through a gradient of ethanol (50%, 70%, 95%, 100%) and xylene. Finally, a drop of neutral resin is added, and the slide is covered with a coverslip. After the resin dries, the slides can be observed under a microscope and photographed for preservation.

[0083] 5. Result Interpretation and Quantitative Analysis

[0084] The expression level of CALD1 was assessed by comparing the staining differences between drug-resistant and drug-sensitive tissues.

[0085] Experimental results:

[0086] See the experimental results. Figures 2C to 2D .in,

[0087] Figure 2C This is a graph showing the expression levels of CALD1 protein in cisplatin-sensitive and cisplatin-resistant bladder cancer tissues as determined by immunohistochemical assays. From... Figure 2C It can be seen that the expression level of CALD1 in drug-resistant bladder cancer tissues is higher than that in cisplatin-sensitive bladder cancer tissues.

[0088] Figure 2D This is a graph showing the immunohistochemical scores of CALD1 protein in cisplatin-sensitive and cisplatin-resistant bladder cancer tissues. From... Figure 2D It can be seen that CALD1 protein is highly expressed in cisplatin-resistant bladder cancer specimens.

[0089] The above experimental results show that CALD1 is highly expressed in cisplatin-resistant bladder cancer specimens.

[0090] 3. The CALD1 expression levels detected in 80 bladder cancer specimens were divided into two groups (high and low expression). Based on the relevant clinical follow-up data, survival curves were obtained by plotting the survival time of each patient (defined as from the date of surgery to the date of death or the last follow-up date of the survivor).

[0091] The inclusion criteria for 80 bladder cancer specimens were: ① pathologically confirmed muscle-invasive bladder cancer; ② age ≥18 years and ≤80 years; ③ life expectancy exceeding 3 months; ④ provision of archived tumor tissue samples; ⑤ ECOG score ≤2; ⑥ good hematopoietic function, defined as an absolute neutrophil count ≥1.5×10⁻⁶. 9 / L, platelet count ≥100×10 9 / L, hemoglobin ≥90g / L (no blood transfusion or erythropoietin (EPO) dependence within 7 days); ⑦ Good liver function, defined as total bilirubin level ≤1.5 times the upper limit of normal (ULN); for patients without liver metastases, aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels ≤2.5 times ULN, and for patients with recorded liver metastases, AST and ALT levels ≤5 times ULN; ⑧ Good renal function, defined as serum creatinine ≤1.5 times ULN or calculated creatinine clearance ≥60ml / min (Cockcroft-Gault formula); urinalysis shows less than 2+ proteinuria. Exclusion criteria were: ① Comorbid malignancies, excluding patients with other active malignancies within the past 5 years (except for cured non-melanoma skin cancer, cervical carcinoma in situ, etc.) to avoid confusion in prognostic assessment; ② Severe comorbidities or organ dysfunction, renal insufficiency: creatinine clearance <60 mL / min; cardiac disease: New York Heart Association class III / IV heart failure or left ventricular ejection fraction <50%; ③ Active infection: active infection requiring systemic treatment (including confirmed urinary tract infection); ④ Mental illness or substance abuse; ⑤ Loss to follow-up; ⑥ Unqualified specimen quality.

[0092] Experimental results:

[0093] See the experimental results. Figure 2E .

[0094] Figure 2E This is a graph analyzing the relationship between CALD1 expression levels and overall patient survival using the Kaplan-Meier method. From... Figure 2E The results show that high CALD1 expression is associated with poor patient prognosis.

[0095] Example 3

[0096] (a) The cisplatin-resistant bladder cancer cells UMUC3-R obtained in Example 1 were transfected with shCALD1 to knock down CALD1 molecules and inhibit the expression of CALD1 protein.

[0097] UMUC3-R cells were seeded in 6-well plates. The next day, when the cell density was about 60%-80%, shCALD1 was transfected to knock down the CALD1 molecule. The sequence of shCALD1 is as follows: GAGGAATGACGATGATGAAGATTCAAGAGATCTTCATCATCGTCATTCCTCTTTTTTG (SEQ ID No. 1).

[0098] PBS and cisplatin were added to the control group and treatment group cells respectively at a concentration of 10 µM. Flow cytometry was used to detect apoptosis 24 h later. The apoptosis kit used was the Annexin V-FITC / PI Cell Apoptosis Detection Kit (servicebio), and the flow cytometer was a CytoFLEX LX (Beckman Coulter, Inc.).

[0099] Experimental results:

[0100] See the experimental results. Figure 3A .from Figure 3A As can be seen, transfection with shCALD1 can inhibit the expression of CALD1 protein, and knockdown of CALD1 can promote apoptosis in cisplatin-induced drug-resistant bladder cancer cells.

[0101] (II) Effects of CALD1 knockdown on subcutaneous tumors in nude mice

[0102] Animal experimental procedures:

[0103] 1. Purchase 24 five-week-old male BLAB / c-nu mice (purchased from Vital Rivers) and randomly divide them into 4 groups of 6 mice each.

[0104] 2. Expand the stable cell lines of UMUC3 control and CALD1 knockdown. Collect cells, wash them once with PBS, centrifuge, and count the cells. Resuspend the cells in PBS so that 200 µl of PBS contains 5 × 10⁶ cells / mL. 6 One tumor cell.

[0105] 3. Modeling: Mice were anesthetized with isoflurane, and the right axillary region was disinfected with povidone-iodine. 200 µl of tumor cell suspension was injected subcutaneously into the right upper limb of the mouse using an insulin needle.

[0106] 4. Feeding mice: After modeling, measure the length of the subcutaneous tumor with calipers every 2-3 days. Continue feeding until the tumor volume reaches 50mm.3 Treatment involved intraperitoneal injection of PBS or cisplatin (3 times a week at a dose of 1 mg / kg), with the volume of subcutaneous tumors recorded.

[0107] 5. Sample collection: The mice were euthanized 30 days later. Subcutaneous tumors were collected, photographed, and weighed.

[0108] Experimental results:

[0109] See the experimental results. Figures 3B to 3E .in,

[0110] Figure 3B This is a gross photograph of the subcutaneous tumor shown. Figure 3B The results show that knocking down CALD1 can improve the sensitivity of bladder tumors to cisplatin chemotherapy.

[0111] Figure 3C This is a diagram showing the volume of the subcutaneous tumor, from... Figure 3C As can be seen, the tumor volume was smaller in the CALD1 knockdown group.

[0112] Figure 3D This is a graph showing the weight of the subcutaneous tumor, from... Figure 3D As can be seen, the tumors in the CALD knockdown group were lighter.

[0113] Figure 3E This is a diagram from the TUNEL assay showing tumor tissue apoptosis in the control and treatment groups. From... Figure 3E It can be seen that more apoptosis occurred in the tumor tissue of the CALD1 knockdown group.

[0114] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. Application of CALD1 protein in the preparation of drugs for treating bladder cancer.

2. The application according to claim 1, characterized in that, Bladder cancer can be treated by inhibiting the expression or activity of the CALD1 protein to increase the sensitivity of bladder cancer cells to cisplatin chemotherapy.

3. Application of reagents that inhibit the expression or activity of CALD1 protein in the preparation of drugs for treating bladder cancer.

4. The application according to claim 1, characterized in that, The reagent that inhibits the expression or activity of the CALD1 protein treats bladder cancer by increasing the sensitivity of bladder cancer cells to cisplatin chemotherapy.

5. A pharmaceutical composition for treating bladder cancer, characterized in that, The pharmaceutical composition comprises: an agent that inhibits the expression or activity of CALD1 protein and cisplatin.

6. The pharmaceutical composition according to claim 5, characterized in that, The reagent for inhibiting the expression or activity of CALD1 protein includes shRNA, the sequence of which is shown in SEQ ID No.

1.

7. A shRNA that inhibits the expression or activity of CALD1 protein, characterized in that, The sequence of the shRNA is shown in SEQ ID No. 1.