Antisense oligonucleotides targeting long noncoding RNA Lnc01876 and their applications

Abstract

This application discloses an antisense oligonucleotide targeting the long non-coding RNA Lnc01876 and its applications. The antisense oligonucleotide has the sequence shown in SEQ ID NO:2 or SEQ ID NO:3 and efficiently knocks down Lnc01876 expression at a concentration of 50 nM. This antisense oligonucleotide can be used to prepare anti-CRC metastasis drugs, significantly inhibiting CRC cell proliferation, migration, and invasion, and suppressing tumor growth and lung metastasis in vivo.

Description

Technical Field

[0001] This application relates to an antisense oligonucleotide targeting the long non-coding RNA Lnc01876 and its applications, belonging to the field of biomedical technology. Background Technology

[0002] Colorectal cancer (CRC) is a malignant tumor of the digestive tract with high incidence and mortality rates. Currently, clinical treatments for metastatic colorectal cancer (mCRC) mainly include chemotherapy, targeted therapy, immunotherapy, and combination therapy. However, these methods have problems such as weak targeting, limited efficiency in inhibiting tumor metastasis, easy development of drug resistance, and toxic side effects. Existing treatment methods for mCRC still lack highly specific and durable treatment options.

[0003] Long non-coding RNAs (lncRNAs) are a class of RNA molecules longer than 200 nt that do not encode proteins. They participate in the proliferation, invasion, and metastasis of tumor cells through epigenetic regulation, transcription, and post-transcriptional regulation, and are characterized by high tissue specificity and strong expression stability. Research on tumor-targeted therapy based on lncRNAs has become one of the research directions in the biomedical field. Among them, antisense oligonucleotides (ASOs) are a commonly used technique for targeting and regulating lncRNA expression. By artificially synthesizing short-chain nucleic acids complementary to the target lncRNA, the expression of the target lncRNA is specifically inhibited, thereby blocking the malignant biological behavior of tumors.

[0004] Several studies on tumor therapy using ASOs targeting non-coding RNAs have been published. Patent application CN201910726294.9 discloses an ASO targeting lncRNA DDX11-AS1, which can inhibit the proliferation, migration, and invasion of liver cancer cells. Patent application CN202110692817.X discloses an ASO targeting circITGB6 that can enhance the sensitivity of ovarian cancer cells to platinum-based chemotherapy drugs. In the CRC field, existing ASOs mostly focus on inhibiting the in vitro proliferation of tumor cells, such as targeting CCAT1. Development of specific targets and ASOs for distant metastasis of CRC remains lacking. Due to the complexity of the CRC metastasis molecular network and the large number of lncRNAs with unknown functions in the human transcriptome, screening for targets highly correlated with metastasis and possessing drug potential presents technical challenges. Therefore, the field still needs to explore new key targets and develop corresponding ASO drugs. Summary of the Invention

[0005] The purpose of this application is to overcome the shortcomings of the prior art and provide an antisense oligonucleotide targeting the long non-coding RNA Lnc01876 and its application, so as to solve the problem of the lack of specific targeted intervention methods for CRC transfer in the prior art.

[0006] To achieve the above objectives, this application employs the following technical solution:

[0007] In a first aspect, this application provides an antisense oligonucleotide targeting the long non-coding RNA Lnc01876, the sequence of which is shown in SEQ ID NO: 2 or SEQ ID NO: 3.

[0008] Furthermore, the antisense oligonucleotide is an oligonucleotide modified with locked nucleic acid (LNA). The unique bridging conformation of LNA not only endows the probe with extremely high targeting affinity to break through the folding structure of lncRNA, but also significantly enhances its stability against nucleases.

[0009] The use of the antisense oligonucleotides described in the first aspect in the preparation of medicaments for inhibiting the proliferation, invasion and / or migration of colorectal cancer cells.

[0010] The use of the antisense oligonucleotides described in the first aspect in the preparation of medicaments for inhibiting the growth of colorectal tumors and / or lung metastases.

[0011] In a second aspect, this application provides a pharmaceutical composition comprising an effective dose of the antisense oligonucleotide described in the first aspect, and a pharmaceutically acceptable carrier or excipient.

[0012] Furthermore, the effective concentration of the antisense oligonucleotide is 50 nM to 100 nM.

[0013] This application provides the use of the pharmaceutical composition described in the second aspect in the preparation of a medicament for inhibiting the proliferation, invasion, and / or migration of colorectal cancer cells.

[0014] This application provides the use of the antisense oligonucleotides described in the first aspect in the preparation of a kit for screening candidate molecules that inhibit colorectal cancer metastasis.

[0015] Thirdly, this application provides a kit for inhibiting colorectal cancer metastasis, comprising the antisense oligonucleotides described in the first aspect.

[0016] Compared with the prior art, the beneficial effects achieved by this application are as follows:

[0017] This application provides an antisense oligonucleotide targeting the long non-coding RNA Lnc01876 and its application. Based on the Lnc01876 target, two antisense oligonucleotide sequences were designed. After modification with locked nucleic acids, the knockdown efficiency of the target gene reached more than 90% at a concentration of 50 nM. The proliferation, migration and invasion ability of HT29 cells decreased, and the volume of subcutaneous tumors and the number of lung metastases in vivo were reduced. Attached Figure Description

[0018] Figure 1 The results of single-cell transcriptome analysis revealing the positive correlation between Lnc01876 expression upregulation and colorectal cancer metastasis are shown in the figure. A is the flowchart of the overall experimental design and sequencing analysis of snRandom-seq; B is the single-cell UMAP dimensionality reduction feature map of epithelial cell adhesion molecules, a classic epithelial marker; C is the single-cell UMAP dimensionality reduction feature map of Lnc01876; D is a violin diagram of Lnc01876 expression level in the whole cell community in multiple organ microenvironments; E is a violin diagram comparing the quantitative abundance of Lnc01876 expression in malignant tumor cell subsets.

[0019] Figure 2 The figure shows the expression characteristics of Lnc01876 in colorectal cancer cell lines and the validation results of antisense oligonucleotide targeted knockdown. In the figure, A is a bar chart of the relative expression level of Lnc01876 in five colorectal cancer cell lines; B is a subcellular localization analysis of Lnc01876 in HT29 cells; and C is a validation chart of the knockdown efficiency after transfection with antisense oligonucleotides targeting Lnc01876.

[0020] Figure 3 To demonstrate that the antisense oligonucleotide knockdown of Lnc01876 significantly inhibited the in vitro migration and invasion of colorectal cancer cells, the figure shows: A is a representative microscopic image of cell migration and invasion experiments; B is a bar chart of quantitative migration rate; and C is a bar chart of quantitative invasive cell number.

[0021] Figure 4 To verify the in vitro ability of antisense oligonucleotide knockdown of Lnc01876 to significantly inhibit the proliferation of colorectal cancer cells, the figure shows: A is a representative image and quantitative statistical bar chart of cell colony formation assay; B is a cell proliferation kinetics curve detected by real-time label-free cell analysis system.

[0022] Figure 5 To demonstrate that targeted knockdown of Lnc01876 significantly inhibits the in vivo tumorigenicity of colorectal cancer cells, the figure shows: A is a gross image of the subcutaneous xenograft tumor in nude mice; B is a dynamic monitoring curve of tumor volume growth; and C is a scatter plot of the final tumor weight.

[0023] Figure 6To demonstrate that targeted knockdown of Lnc01876 significantly inhibits the in vivo lung metastasis ability of colorectal cancer cells, the figure shows: A is a gross lung specimen image from a nude mouse tail vein lung metastasis model; B is a histopathological image of the lung metastasis lesions stained with hematoxylin and eosin and Ki-67 immunohistochemical staining. Detailed Implementation

[0024] The technical solution of this application will be described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the embodiments and specific features in the embodiments are detailed descriptions of the technical solution of this application, rather than limitations thereof.

[0025] In the following embodiments, unless otherwise specified, the experimental methods used in this application are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0026] The specific parameters of the experimental materials and instruments used in this application are as follows:

[0027] Cell line: Cell culture incubator conditions are 37℃ and 5% CO2.

[0028] The specific formulations of the culture media are as follows: human embryonic kidney cells 293T (293T), human colon cancer cells RKO (RKO), and human colon cancer cells 480 (SW480) were cultured in Dulbecco-modified Eagle medium (DMEM); human colon tumor cells 8 (HCT8) and human colon tumor cells 116 (HCT116) were cultured in RPMI 1640 medium; and human tumor cells 29 (HT29) were cultured in McCoy's 5A-modified medium. All media were supplemented with fetal bovine serum (FBS) to a final concentration of 5%.

[0029] Laboratory animals: The thymus-deficient nude mice used in the live modeling stage were bred, genotyped, and supplied by commercial vendors. All animals were housed within a barrier system at an SPF-grade animal center. Strict aseptic procedures were followed in this area, with comprehensive sterilization control implemented for all personnel, animals, and supplies such as feed, water, and bedding. Constant temperature and humidity were maintained in the animal rooms, and an automatic lighting system simulated a 12-hour light-dark cycle. The indoor air cleanliness was maintained at Class 10,000. All husbandry and experimental procedures complied with relevant regulations on laboratory animal ethics and welfare and were strictly implemented according to standard operating procedures.

[0030] Main reagents: RNAiMAX transfection reagent, 8 µm invasive chamber, matrix gel, SYBR Green real-time quantitative polymerase chain reaction (qPCR) kit, negative control oligonucleotide, cell lysis buffer, BCA protein concentration assay kit, specific primary antibody, HRP-labeled secondary antibody, ultrasensitive chemiluminescent solution, 4% paraformaldehyde and CRC tissue immunohistochemistry (IHC) related reagents.

[0031] Main instruments: vernier calipers, vertical gel electrophoresis apparatus and transfer system, fully automated chemiluminescence imaging analysis system, inverted fluorescence microscope, laser scanning confocal microscope, CO2 constant temperature cell culture incubator, biosafety cabinet, benchtop high-speed refrigerated centrifuge / real-time label-free cell analysis (RTCA) instrument, qPCR instrument and Nanodrop 2000 nucleic acid and protein quantification instrument, etc.

[0032] Example 1:

[0033] This embodiment uses single-cell transcriptomics analysis based on single-cell nuclear whole transcriptome sequencing technology to analyze the positive correlation between the expression level of Lnc01876 and the malignant progression of CRC.

[0034] like Figure 1 As shown in Figure A, this application uses single-nucleus full-field transcriptome sequencing (snRandom-seq) technology to sequence and analyze 24 FFPE samples, including four primary tumor lesions and four paired lung metastases, liver metastases, or peritoneal metastases from 12 untreated mCRC patients. The aim is to systematically analyze the cellular composition of their tumor microenvironment.

[0035] All tissue samples underwent standard dewaxing and rehydration procedures, followed by cell nuclear separation and permeabilization. Library construction was then performed according to the snRandom-seq protocol. The experimental cohort included four samples each of the primary lesion and its paired lung, liver, and peritoneal metastases, which were then divided into six control groups.

[0036] Using single-cell UMAP dimensionality reduction and unsupervised clustering analysis of whole transcriptome sequencing data, a total of 13 major cell subpopulations were identified, such as... Figure 1 As shown in Figure B, the distribution of highly concentrated expression of epithelial cell adhesion molecules in specific cell subpopulations is illustrated. The redder the color, the higher the expression abundance, which lays the foundation for subsequent precise dissection of malignant epithelial tumor clones.

[0037] After accurately identifying malignant clones, this application discovered and identified lncRNA Lnc01876 through differential expression analysis of various subpopulations. Figure 1As shown in Figure C, the red area where the Lnc01876 high expression signal is located highly overlaps with the epithelial cell population, indicating that it is specifically located in malignant epithelial clones.

[0038] like Figure 1 As shown in Figure D, by comparing the whole-cell communities of various primary colorectal cancer lesions and their corresponding distant metastases, the distribution density and abundance of Lnc01876 in 6 different clinicopathological states (primary lesions of liver / lung / peritoneal metastases and their corresponding metastases) showed that its expression level was generally upregulated with the occurrence of tumor organ metastasis.

[0039] like Figure 1 As shown in Figure E, the study specifically focused on a subset of malignant tumor cells and further quantified and compared the expression levels of Lnc01876 in malignant cells of primary lesions and paired metastatic lesions, confirming that the expression abundance of Lnc01876 in malignant cells significantly and synergistically increased with the metastatic progression of colorectal cancer.

[0040] Example 2:

[0041] This embodiment performs HT29 target cell selection and Lnc01876 subcellular localization analysis and verifies the antisense oligonucleotide knockdown efficiency.

[0042] First, targeted intervention was performed using an in vitro cell model. The basal expression level of Lnc01876 in five conventional CRC cell lines (HT29, RKO, HCT116, HCT8, and SW480) was detected by qPCR. Figure 2 As shown in Figure A, Lnc01876 expression varied significantly across different cell lines, with the highest expression in HT29 cells and the lowest in RKO cells. Its expression trend was positively correlated with the malignant phenotype of each cell line, indicating that Lnc01876 plays a crucial role in promoting the malignant progression of CRC. Based on this, HT29 cells with high expression were selected for knockdown intervention, and its full-length sequence is shown in SEQ ID NO:1.

[0043] 5' -gcagtttgat ctcagactgc tgtgctagca atcagcgaga ctccctgtga gtaggaccctccgagccagg tgcggcttat aatctcgtgg tgcgccgttt tttaagccgg tcggaaaagc gcagtattcgggtgggagtg acccgatttt ccagggatgg aagaagatac ttggaaaaat cagggaagag tgaagaagatacttcaaa atcgggaag attttcatca taaggtccaa gcaagattc ctgagcctga gtctactgacaaatatacca catccccaga gtaagttgga gtctcttaaa attgtcttgc tggcatctag cggagattgtccccacaagc atgttcctta tgacggatgc ctgggtcaga acacataata cattcctttt tataagcacaaaagattctga gaagcactgc ccctccacg tgtcacactc tgggagaga ttattggaat gcctcttggatcaggtatct ttggtgatca ttccacctag ttaagatgaa gctggtgata gcctttggct tgtttcaggtaatgtaacca gattttccag tgacttgtga attaacaggc taaaaactag tttcagttt ctggagaagggttcccaatc tcatttgagg ctattggagg aaaaatccct tcagaaaata aagcatgaca gtaagagattttagtatgcagg aagtaaaattc agttccttt gagatcagca tgcctctat caatcctctc cttaatcccttgagtcag atctagtaga gggttggacc aggaaattga gtgtagggtt ataggtgata agatgaggagaggcactccc ctcaggagtt aagatgcagg aaatttggtt tgcactttag ccagtacaag gcatttcaccaggatggagaatatgtgctc tcttgcacag aaatccgtgc cagcagtaag tgatgtggaa ggatttagtgaaattttgcc aataacccca ggcttactgc ttaatgaaca gaacattctc ctgggacttg aagaggtcctatgaaataag ggacataaat gatgtacttt cttttctgtt aggcttaaga aattctgttc tgagtgcaaatagagggaat gatttccgac tttcctatta gatagcagat atctttgcat cttggataca tttagaaagaatagaaatgt gaatgattga aacctagtca gtcaattgat ttattagaat tcctggaaga agtctgagtaaacacaatct cattctcttt ctttttctct ctgtcagttc ttcttcttgg gttcctatac tatgggatataaatgaaaca gtgcaatgta aaactagtat aatgatggtc gagagtaggt ccccaataaa tcttggttattactgttatt ggagagaatg atgaaattta aagctagtgg gggaaaaaga atcgtacaaa ctggaaatgaattggaatga gtgttgcttc aggttgccct caatttggta tcagtaccct cagtaaatca gagttgctgtgacctgggct ttgatgtaag ggtagcagaa tgatttagaa aaaacagcat tagattaaaa gccagagacatattatagtc ctagttcttt cgcttactag agatttgacc ttgaaaagct taatttgttt aaatcccgtttcctcatctg aaaaatgaag actgatgata tctgtcctaa ctccatcttg tgatgatcca atggaataaagtgctgtcaa aatgtgaa-3’.

[0044] such as Figure 2As shown in Figure B, the nucleocytoplasmic separation experiment combined with qPCR analysis showed that, with GAPDH as the cytoplasmic internal control (shown in red bars) and NEAT1 as the nuclear internal control (shown in blue bars), Lnc01876 was uniformly distributed in the nucleus and cytoplasm of HT29 cells in approximately equal proportions. This indicates that it can have both nuclear and cytoplasmic regulatory functions, and also constitutes the direct basis for selecting antisense oligonucleotides that can penetrate both the nuclear membrane and the cell membrane as intervention methods.

[0045] Given that conventional small interfering RNA (siRNA) is difficult to efficiently knock down nuclear RNA, and antisense oligonucleotides can target RNA in the cell nucleus and cytoplasm, this application transiently transfected negative control (NC) and two specific antisense oligonucleotides (ASO-1 and ASO-2) targeting Lnc01876 in HT29 cells with high background expression.

[0046] Validation of antisense oligonucleotide transfection efficiency in the 50-100 nM range showed that, Figure 2 As shown in Figure C, both specific antisense oligonucleotides can achieve efficient gene silencing at a transfection concentration of 50 nM, significantly downregulating their expression levels by more than 90%, providing a reliable in vitro model basis for subsequent targeted intervention functional experiments.

[0047] The nucleotide sequences of ASO-1 and ASO-2 are as follows:

[0048] ASO-1: 5'-UUAUGUGUUCUGACCCAGGC-3' (SEQ ID NO: 2).

[0049] ASO-2: 5'-GAUUGAAUAGAGGCAUGCUG-3' (SEQ ID NO: 3).

[0050] Note: The ASO sequence consists of 20 bases, each linked by a phosphate thioester bond. The structure consists of 10 DNA bases in the middle and 5 RNA bases at both ends. The 1st, 3rd, 5th, 16th, 18th and 20th RNA bases are modified with 2'-O-methyl (2'OMe), and the 2nd, 4th, 17th and 19th RNA bases are modified with locked nucleic acid.

[0051] Example 3:

[0052] This embodiment investigates the effect of antisense oligonucleotide targeting Lnc01876 on the migration and invasion abilities of CRC cells, further confirming the effectiveness of antisense oligonucleotides targeting Lnc01876.

[0053] 1. Cell migration detection:

[0054] (1) Cell seeding: Use tweezers to take the scratch insert, stick the adhesive side tightly to the bottom of the 12-well plate, add 50 µL of complete culture medium containing 10% FBS to each well of the insert, then add 50 µL of cell suspension at a uniform rate, and put it into an incubator for culture.

[0055] (2) Mitomycin C treatment of cells: After 24 h of cell seeding, observe under a microscope whether the cell density meets the expected density. Add 800 µL of 1% FBS complete medium containing 10 µg / mL mitomycin C to the plug, remove the medium from the plug, remove the plug, treat the cells with mitomycin C for 1 h, and finally add 1% FBS complete medium. This time is recorded as 0 h and a picture is taken.

[0056] (3) Take photos and observe: Take photos regularly to record.

[0057] (4) Data analysis: ImageJ software was used to calculate the migration area.

[0058] 2. Cell invasion test

[0059] (1) Coating with matrix gel: Dilute the matrix gel with serum-free culture medium at a ratio of 1:9 and operate on ice. Add 100 µL to the upper chamber of the chamber. Incubate in an incubator for 2 to 3 hours until the matrix liquid phase transforms into a solid gel film, at which point the coating is complete.

[0060] (2) Hydration: Aspirate the liquid from the upper chamber and add 100 µL of serum-free culture medium for 30 min.

[0061] (3) Cell seeding: Prepare a uniform single-cell suspension using serum-free culture medium. After aspirating the hydration solution from the upper chamber, add 100 µL of cell suspension and 600 µL of culture medium containing 30% FBS to the lower chamber.

[0062] (4) Incubation: Incubate in a constant temperature incubator for 24 to 48 hours.

[0063] (5) Fixation and staining: Discard the culture medium, wash the chamber with PBS, fix with 4% paraformaldehyde at room temperature for 30 min, discard the fixative, and then stain with crystal violet at room temperature for 30 min. Wash 3 times with PBS and wipe away the cells in the upper chamber with a cotton swab.

[0064] (6) Observation and counting: Complete the shooting of representative fields of view under the microscope, and use ImageJ to identify and automatically count the stained cells in the obtained images.

[0065] like Figure 3The migration shown in Figure A illustrates the dynamic process of HT29 cells transfected with negative controls (NC) and antisense oligonucleotides (ASO-1 and ASO-2) specifically targeting Lnc01876 migrating towards the center of the scratch wound at three time points: 0 hours, 16 hours, and 24 hours. The solid yellow lines in the figure delineate the boundaries of the cell-free areas. Figure 3 As shown in Figure A, after 48 hours of cell culture, representative fields of view obtained by passing through a microporous filter membrane coated with matrix gel and staining with crystal violet show that the number of invasive cells in the antisense oligonucleotide treatment group was significantly reduced.

[0066] like Figure 3 As shown in Figure B, quantitative analysis of the relative migration rate of cells in each group at 16 and 24 hours showed that, compared with the NC group, the migration ability of HT29 cells was significantly inhibited after transfection with ASO-1 and ASO-2.

[0067] The statistical results of the absolute number of cells that successfully invaded in each group are as follows: Figure 3 As shown in Figure C, antisense oligonucleotide-mediated Lnc01876 knockdown significantly reduced the number of HT29 cells capable of penetrating MATCH.

[0068] The above results indicate that specific antisense oligonucleotides (ASO-1 and ASO-2) at a concentration of 50 nM can effectively block the migration and invasive malignant phenotype of colorectal cancer cells.

[0069] Example 4:

[0070] This embodiment investigates the effect of antisense oligonucleotide targeting Lnc01876 on the proliferation of colorectal cancer cells. The results of in vitro cell functional experiments further confirm the effect of antisense oligonucleotides targeting Lnc01876.

[0071] 1. Cloning experiment:

[0072] (1) Cell seeding: Digested and collected HT29 cells were seeded into 6-well culture plates, with 600 cells seeded in each well. Six biological parallel replicates were set up for each group.

[0073] (2) Cloning amplification culture: Add 500 µL of fresh culture medium to the culture plate every 3 days and maintain incubation in the incubator until the 14th day.

[0074] (3) Fixation and color development identification: Discard the old culture medium, wash once with phosphate buffer (PBS), add 1 mL of 4% paraformaldehyde to each well for 30 min at room temperature, wash with water, add 1 mL of crystal violet staining solution to each well for 30 min at room temperature, wash thoroughly with PBS and air dry.

[0075] (4) Clone counting: Collect, record and quantify stained cell colonies.

[0076] like Figure 4 As shown in the left image of image A, HT29 cells transfected with negative controls (NC) and antisense oligonucleotides (ASO-1 and ASO-2) specifically targeting Lnc01876, after 14 days of culture, were stained with crystal violet. The results showed a significant reduction in clonal colony numbers in the antisense oligonucleotide treatment group. Quantitative statistical results of the clonal number are as follows: Figure 4 As shown in the right bar chart of A, after the antisense oligonucleotide targeted knockdown of Lnc01876, the monoclonal formation ability of HT29 cells was significantly inhibited, and the number of clonal colonies was greatly reduced.

[0077] 2. Cell proliferation detection:

[0078] (1) Preparation of cell suspension: Digest, collect cells and count them.

[0079] (2) Baseline calibration: 50 µL of basic culture medium was pre-placed in the wells of the E-Plate 96 micro-detection plate, and then pushed into the RTCA detection chamber to complete the baseline scanning measurement.

[0080] (3) Sample inoculation and sedimentation: After the base signal is collected, the well plate is removed and 100 µL of calibrated cell suspension is added to each well. At least 6 biological replicates are set up for each group and the plate is left to stand at room temperature for 30 min.

[0081] (4) Real-time dynamic monitoring: The E-Plate 96 with the loaded sample is put back into the analyzer detection platform to trigger the system to automatically scan continuously and start real-time non-invasive tracking of cell proliferation behavior.

[0082] (5) Dynamic data analysis: Export the proliferation dynamic curves generated by the system after the operation is completed.

[0083] like Figure 4 As shown in Figure B, the proliferation activity of HT29 cells in each group was continuously and dynamically monitored using the RTCA system. The vertical axis represents the cell index reflecting the cell proliferation status. Compared with the red curve of the NC group, the proliferation curves of the ASO-1 (green curve) and ASO-2 (blue curve) treatment groups were significantly lower, indicating that knockdown of Lnc01876 can significantly weaken the sustained proliferation momentum of colorectal cancer cells.

[0084] Example 5:

[0085] To verify the inhibitory effect of antisense oligonucleotides on CRC growth in vivo, a subcutaneous tumor model was constructed to test tumorigenicity. Since antisense oligonucleotides need to exert their effects continuously in vivo, this experiment used guide RNA designed based on the antisense oligonucleotide sequence. Stable knockdown cell lines of HT29 CRISPRi (guide-Lnc01876-1 and guide-Lnc01876-2) were constructed using CRISPR interference technology, with the lactose operon Z gene (guide-lacZ) as a control. qPCR analysis confirmed that Lnc01876 expression was continuously reduced in the stable transfected lines, with a knockdown efficiency >90%.

[0086] Subcutaneous tumor model: HT29 CRISPRi stable cells in logarithmic growth phase were collected (experimental groups: guide-Lnc01876-1 and guide-Lnc01876-2; control group: guide-lacZ), and resuspended in PBS to a concentration of 2×10⁻⁶. 7 cells / mL. Take 100 μL of cell suspension (containing 2 × 10⁶ cells / mL). 6 (5 cells) were subcutaneously injected into the right axilla of nude mice, with 5 mice per group. Every 2 days after inoculation, the long diameter (L) and short diameter (W) of the tumor were measured using calipers, and the result was calculated using the formula V = 0.5 × L × W. 2 Calculate tumor volume. Approximately two weeks after inoculation, sacrifice the mice, remove the tumors, and weigh them.

[0087] like Figure 5 Figure A shows a gross image of the subcutaneous xenograft in nude mice, illustrating the complete removal of the subcutaneous tumor from each group of nude mice (n=5 per group) on day 17 post-inoculation. In the nude mouse subcutaneous xenograft model, compared with the negative control group (Guide-lacZ), the tumor volume of the two groups with specific Lnc01876 knockdown (Guide-Lnc01876-1 and Guide-Lnc01876-2) was visibly significantly reduced.

[0088] Tumor volume growth dynamic monitoring curve as shown Figure 5 As shown in Figure B, tumor volume (cubic millimeters) was measured and calculated periodically using vernier calipers. The monitoring period was 17 days. The results showed that after targeted knockdown of Lnc01876, the in vivo growth rate of the tumor was greatly slowed down, and the growth curve was significantly lower than that of the control group.

[0089] The endpoint tumor weight quantitative statistical scatter plot is shown below. Figure 5 As shown in Figure C, the endpoint wet weight (mg) of solid tumors stripped on day 17 is displayed. The tumor weight of both groups of targeted knockdown strains decreased significantly.

[0090] The above in vivo experiments confirm that the guide-Lnc01876, designed based on the antisense oligonucleotide targeting sequence, has demonstrated drug efficacy targeting this region in vivo.

[0091] Example 6:

[0092] To verify the inhibitory effect of antisense oligonucleotides on CRC metastasis in vivo, this embodiment constructed a tail vein lung metastasis model to detect metastasis capacity.

[0093] Tail vein lung metastasis model: Stable cells were collected and resuspended in PBS to a concentration of 2×10⁻⁶. 7 cells / mL, injected into nude mice via tail vein (2×10⁻⁶ cells / mL). 6 (cells / 100μL / mouse), 5 mice per group. 50 days after injection, the mice were sacrificed, lung tissue was removed, and the number of metastatic nodules on the surface was observed with the naked eye and photographed for recording.

[0094] like Figure 6 As shown in Figure A, on day 50 after tail vein injection of stable cells from each group, lung specimens completely dissected from nude mice showed that, compared with the negative control group (Guide-lacZ) which was covered with large metastatic nodules, the number and volume of lung metastatic nodules in the two experimental groups (Guide-Lnc01876-1 and Guide-Lnc01876-2) specifically targeting and knocking down Lnc01876 were significantly inhibited. The right-hand red box magnified four times shows in detail the distribution characteristics of metastatic lesions on the lung surface, with red arrows indicating the typical white raised metastatic nodules visible to the naked eye.

[0095] The lung tissue was then fixed in 10% formalin, embedded in paraffin, sectioned, and subjected to hematoxylin-eosin (HE) staining and Ki-67 immunohistochemical analysis.

[0096] like Figure 6 As shown in the top row of images in section B, the dark purple areas in the representative fields of HE staining of lung tissue sections represent metastatic lesions formed by colorectal cancer cell colonization. The control group showed large-area invasive metastatic lesions that disrupted alveolar structure, while the knockdown group showed only sporadic micrometastatic lesions.

[0097] like Figure 6 As shown in the lower row of images in section B, in Ki-67 immunohistochemical staining of serial sections in the same field of view, the brown cell nuclei represent positive cells in the active proliferation phase. The results confirm that targeted intervention with Lnc01876 not only reduced the formation of metastatic nodules but also significantly decreased the proliferative activity of tumor cells colonizing the metastatic microenvironment.

[0098] The above in vivo experiments confirm that antisense oligonucleotides targeting Lnc01876 can significantly inhibit the ability of CRC cells to metastasize to distant sites in vivo.

[0099] This application successfully screened for the CRC metastasis-specific target Lnc01876 and designed two highly efficient antisense oligonucleotide sequences targeting Lnc01876. The effective concentration of the antisense oligonucleotides was optimized to at least 50 nM, preferably 50-100 nM. In vitro and in vivo experiments demonstrated that the antisense oligonucleotides significantly inhibited the proliferation, invasion, and migration of CRC cells, and effectively suppressed tumor growth and lung metastasis in vivo, providing a new candidate drug for targeted therapy of CRC metastasis.

[0100] The above description is only a preferred embodiment of this application. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of this application, and these improvements and modifications should also be considered within the scope of protection of this application.

Claims

1. An antisense oligonucleotide targeting long non-coding RNA LncO1876, characterized in that, The sequence of the antisense oligonucleotide is shown in SEQ ID NO:2 or SEQ ID NO:

3.

2. The antisense oligonucleotide of claim 1, wherein, The antisense oligonucleotide is a locked nucleic acid-modified oligonucleotide.

3. The use of the antisense oligonucleotide of claim 1 or 2 in the preparation of a medicament for inhibiting the proliferation, invasion and / or migration of colorectal cancer cells.

4. Use of the antisense oligonucleotide of claim 1 or 2 in the preparation of a medicament for inhibiting the growth of colorectal tumors and / or lung metastases.

5. A pharmaceutical composition, characterized in that, The product comprises an effective dose of the antisense oligonucleotide of claim 1 or 2, and a pharmaceutically acceptable carrier or excipient.

6. The pharmaceutical composition according to claim 5, characterized in that, The effective concentration of the antisense oligonucleotide is 50 nM to 100 nM.

7. Use of the pharmaceutical composition of claim 5 or 6 in the preparation of a medicament for inhibiting the proliferation, invasion and / or migration of colorectal cancer cells.

8. Use of the pharmaceutical composition of claim 5 or 6 in the preparation of a medicament for inhibiting the growth of colorectal tumors and / or lung metastases.

9. Use of the antisense oligonucleotide of claim 1 or 2 in the preparation of a kit for screening candidate molecules that inhibit colorectal cancer metastasis.

10. A kit for inhibiting colorectal cancer metastasis, characterized in that, It contains the antisense oligonucleotide as described in claim 1 or 2.

Images