Construction method and application of cyp11b2-p2a-creert2 gene knock-in mouse model
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIVERSITY
- Filing Date
- 2026-04-08
- Publication Date
- 2026-07-03
Smart Images
Figure CN122326673A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the construction method and application of the Cyp11b2-P2A-CreERT2 gene knock-in mouse model. Background Technology
[0002] Aldosterone, the most important mineralocorticoid in the human body, is mainly synthesized and secreted by the zona glomerulosa cells of the adrenal cortex. Its core physiological function is to promote the reabsorption of sodium ions and the excretion of potassium ions in the distal convoluted tubules and collecting ducts of the kidneys, playing an indispensable role in maintaining the body's water and electrolyte balance, blood volume stability, and blood pressure homeostasis. However, excessive secretion of aldosterone, known as primary aldosteronism (PA), is the most common cause of endocrine hypertension and is closely related to serious complications such as cardiovascular hypertrophy, heart failure, and kidney damage, seriously threatening human health. Cyp11b2 (aldosterone synthase), as the rate-limiting enzyme in the final process of aldosterone biosynthesis, is strictly limited to the zona glomerulosa of the adrenal glands and is the most specific molecular marker for recognizing zona glomerulosa cells. Therefore, in-depth research on the regulatory mechanism of aldosterone synthesis, the pathogenesis of primary aldosteronism, and the development of novel therapeutic drugs urgently requires an animal model that can specifically manipulate zona glomerulosa cells in vivo as a research vehicle.
[0003] Currently, the animal model construction techniques relied upon in aldosterone-related disease research all have inherent limitations, mainly in three aspects: First, there is a lack of highly specific genetic manipulation tools. Existing Cre mouse tools based on broad-spectrum adrenal promoters such as SF-1 have an expression profile covering the entire adrenal cortex, making it impossible to precisely limit genetic manipulation to zona glomerulosa cells. This easily introduces non-specific phenotypic interference, leading to a significant reduction in the accuracy and reliability of experimental results. Second, spatiotemporally specific gene editing cannot be achieved. Traditional constitutive gene knockout techniques result in the permanent extinction of genes in all cells throughout the body from the embryonic stage. Permanent deletion often leads to developmental compensation or early death, making it difficult to study the function of specific genes in the development of aldosterone-related diseases in adult animals. For example, mice with complete knockout of the Cyp11b2 gene exhibit severe physiological disorders such as salt consumption and hyperkalemia, which cannot simulate the pathological state of primary aldosteronism in adults. Thirdly, existing models have limitations. Although chemical induction or surgical models can simulate aldosterone elevation to some extent, they have problems such as model instability, large individual differences, and difficulty in excluding the influence of systemic hormones, making them unsuitable for studying the cellular autonomous function of specific genes in zona glomerulosa cells.
[0004] In summary, existing technologies cannot meet the needs of this field for precise, spatiotemporally controllable genetic manipulation of adrenal zona glomerulosa cells, and are insufficient to efficiently support research on the pathophysiological mechanisms of aldosterone-related diseases and the screening of novel therapeutic drugs. Therefore, there is an urgent need in this field to develop a method for constructing an inducible Cre tool mouse model based on the Cyp11b2 gene, to achieve precise genetic intervention in aldosterone-synthesizing cells and solve the problems of insufficient specificity, spatiotemporal uncontrollability, and poor stability of existing models. Summary of the Invention
[0005] Based on this, the purpose of this invention is to provide a method for constructing a Cyp11b2-P2A-CreERT2 gene knock-in mouse model and its application.
[0006] To achieve the above objectives, the present invention can adopt the following technical solutions: This invention provides a method for constructing a Cyp11b2-P2A-CreERT2 gene knock-in mouse model. The method includes: introducing a CRISPR / Cas9 system and a homologous recombination donor vector into mouse zygotes, then transplanting the zygotes into pseudopregnant female mice, allowing them to become pregnant and give birth; the recipient mice produce F0 generation mice, confirming their genotype; after the positive F0 generation mice reach sexual maturity, they are mated with wild-type background mice to produce F1 generation mice, confirming their genotype, and the resulting heterozygotes are the Cyp11b2-P2A-CreERT2 gene knock-in mouse models; wherein, the sequence of the gRNA of the CRISPR / Cas9 system is shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the homologous recombination donor vector includes the P2A-CreERT2 element.
[0007] Preferably, in the above construction method, the CRISPR / Cas9 system and the homologous recombination donor vector are introduced into mouse zygotes via microinjection.
[0008] Preferably, in the above construction method, the homologous recombination donor vector further includes a left homologous arm and a right homologous arm, the length of which is 500bp–1500bp, and the vector backbone is a pUC57 low-copy plasmid.
[0009] More preferably, in the above construction method, the construction method of the homologous recombination donor vector includes: synthesizing the P2A-CreERT2 coding sequence and cloning it into an intermediate vector for sequencing verification; then cloning the left homologous arm, the P2A-CreERT2 sequence, and the right homologous arm into the pUC57 vector backbone in sequence; transforming DH5α competent cells; and obtaining positive clone plasmids through ampicillin resistance screening and full-sequence sequencing, followed by linearization.
[0010] Preferably, in the above construction method, the mouse fertilized egg has a C57BL / 6JGpt background.
[0011] Preferably, in the above construction method, the genotype is confirmed using a triple PCR strategy, and the three pairs of specific primers used are as follows: The 5' arm primer pairs have the following nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively; The 3' arm primer pairs have the following nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively; The WT primer pairs have nucleotide sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.
[0012] More preferably, in the above construction method, Wild type: PCR amplification with 5' arm primer pair and 3' arm primer pair showed no bands, while PCR amplification with WT primer pair showed a single 407bp band; Heterozygotes: PCR amplification with 5' arm primers and 3' arm primers showed bands of 361 bp and 408 bp, respectively, while PCR amplification with WT primers showed a single band of 407 bp. Homozygous: PCR amplification with 5' arm primer pair and 3' arm primer pair showed bands of 361bp and 408bp, respectively, while PCR amplification with WT primer pair showed no band.
[0013] Another aspect of the present invention provides an application of the Cyp11b2-P2A-CreERT2 gene knock-in mouse model constructed by the above-described method in studying the molecular regulatory mechanism of aldosterone synthesis, the pathophysiological mechanism of primary aldosteronism and aldosterone-related diseases.
[0014] In another aspect, this invention provides the application of the Cyp11b2-P2A-CreERT2 gene knock-in mouse model constructed by the above-described method in screening therapeutic drugs that target aldosterone synthesis pathways or adrenal zona glomerulosa cells.
[0015] The beneficial effects of this invention include at least the following: (1) The construction method provided by the present invention knocks the P2A-CreERT2 element into the translation termination site of the Cyp11b2 gene using the CRISPR / Cas9 system. Taking advantage of the characteristic that the Cyp11b2 gene is specifically expressed only in the zona glomerulosa of the adrenal gland, CreERT2 is strictly expressed under the regulation of the endogenous Cyp11b2 gene and is specifically distributed only in the cells of the zona glomerulosa of the adrenal gland. This avoids experimental interference caused by non-specific expression and greatly improves the accuracy and reliability of related experimental studies. (2) The construction method provided by the present invention uses the CreERT2 conditional recombinase system. Without tamoxifen induction, CreERT2 is located in the cytoplasm and does not play a recombination cleavage role. The basic physiological state of the model mice is normal. Through intraperitoneal injection of tamoxifen, the gene knockout time can be freely selected after the mice reach adulthood, so as to achieve precise editing of specific genes in the zona glomerulosa cells of the adrenal glands of adult animals, which is perfectly suited for the pathophysiological study of aldosterone-related diseases in adult animals. (3) The construction method provided by the present invention uses P2A self-cleaving peptide to link Cyp11b2 and CreERT2. After translation, the P2A peptide automatically breaks, so that the endogenous gene of Cyp11b2 and CreERT2 are expressed independently and do not interfere with each other. This ensures that the Cyp11b2 gene can perform its physiological function as the rate-limiting enzyme for aldosterone synthesis, and also ensures that the expression level of CreERT2 is stable. It avoids gene function abnormalities caused by element insertion, and makes the basic physiological state of the model mouse consistent with that of wild-type mice, providing a more physiologically realistic animal model for related research. (4) The construction method provided by this invention adopts CRISPR / Cas9 site knock-in technology and homologous arm design, which greatly improves the homologous recombination efficiency. At the same time, the triple PCR strategy combined with full sequence sequencing verification is used to strictly identify the genotypes of F0 and F1 generation mice to ensure that the P2A-CreERT2 element knock-in site is accurate and there are no base mutations, deletions and off-target editing effects. Furthermore, the use of C57BL / 6JGpt background mouse fertilized eggs ensures the universality, stability and experimental reproducibility of the model, and reduces the difficulty and error of subsequent experiments. (5) The model constructed by the construction method provided by the present invention can accurately realize the knockout, knock-in or expression regulation of genes in the zona glomerulosa cells of the adrenal gland. It can be used not only to study the molecular regulatory mechanism of aldosterone synthesis, the pathophysiological mechanism of primary aldosteronism and aldosterone-related diseases, but also to screen novel therapeutic drugs with aldosterone synthesis pathway and adrenal zona glomerulosa cell genes as molecular targets. It has a wide range of applications and has important scientific research and clinical application value. Attached Figure Description
[0016] Figure 1 A schematic diagram illustrating the construction strategy for the Cyp11b2-P2A-CreERT2 gene knock-in mouse model; Figure 2 A schematic diagram illustrating the identification of P2A-CreERT2 element insertion using a multiplex PCR identification strategy; where, wild-type: ①② PCR reaction did not yield the target band; ③ PCR reaction yielded a single WT band; heterozygote: PCR reaction yielded the target band; ③ PCR reaction yielded a single WT band. Figure 3Gel electrophoresis image for identifying P2A-CreERT2 element insertion using a multiplex PCR identification strategy; Figure 4 Validation of tissue specificity in different mouse models; Figure 5 Verification of cell specificity in different mouse models; Figure 6 The effectiveness of the treatment was validated in different mice. Figure 7 This is to verify the basic physiological conditions of different mice. Detailed Implementation
[0017] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.
[0018] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.
[0019] In a first aspect, embodiments of the present invention provide a method for constructing a Cyp11b2-P2A-CreERT2 gene knock-in mouse model, characterized in that the construction method includes: introducing a CRISPR / Cas9 system and a homologous recombination donor vector into mouse zygotes, then transplanting the zygotes into pseudopregnant female mice, and waiting for them to become pregnant and give birth; the recipient mice produce F0 generation mice, confirming the genotype; after the positive F0 generation mice reach sexual maturity, they are mated with wild-type background mice to produce F1 generation mice, confirming the genotype, and the resulting heterozygotes are the Cyp11b2-P2A-CreERT2 gene knock-in mouse models; wherein, the sequence of the gRNA of the CRISPR / Cas9 system is shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the homologous recombination donor vector includes a P2A-CreERT2 element.
[0020] It should be noted that Cyp11b2 is the gene encoding aldosterone synthase, specifically expressed in zona glomerulosa cells of the adrenal gland, and is the core gene for aldosterone synthesis. This invention precisely knocks the P2A-CreERT2 element into the Cyp11b2 gene site, achieving co-expression of CreERT2 recombinase and Cyp11b2. Furthermore, relying on the tamoxifen-induced properties of CreERT2, spatiotemporally specific gene editing of cells related to aldosterone synthesis can be achieved. The CRISPR / Cas9 system, combined with the specific gRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 2, can accurately identify and cleave the target site of the Cyp11b2 gene, providing a precise repair template for homologous recombination and ensuring the efficiency and accuracy of gene knock-in. This construction method can obtain gene knock-in mouse models with stable genetic backgrounds and strong target gene expression specificity, providing a dedicated animal tool for aldosterone-related research. In addition, the P2A-CreERT2 element is described in the same patent CN118547006B.
[0021] In some specific examples, the CRISPR / Cas9 system and homologous recombination donor vector were introduced into mouse zygotes via microinjection.
[0022] It should be noted that microinjection is a classic and highly efficient method for introducing exogenous nucleic acids into animal zygotes. It can directly and precisely inject the ribonucleoprotein complex of the CRISPR / Cas9 system and the homologous recombination donor vector into the pronucleus of the zygote, avoiding nucleic acid degradation and significantly improving the integration efficiency of exogenous fragments. Compared with methods such as electroporation and liposome transfection, microinjection has stronger targeting, less damage to zygotes, and higher embryo survival rate. It can significantly improve the acquisition rate of F0 generation positive mice and meet the needs of large-scale construction of gene knock-in mouse models.
[0023] In some specific examples, the homologous recombination donor vector also includes a left homologous arm and a right homologous arm, with the length of the left and right homologous arms being 500bp–1500bp, and the vector backbone being a pUC57 low-copy plasmid.
[0024] It should be noted that the left and right homologous arms are homologous to the flanking sequences of the target site of the Cyp11b2 gene, which is key to achieving precise homologous recombination. The length of 500bp–1500bp has been optimized experimentally to ensure the efficiency of homologous recombination with the target site while avoiding problems such as increased vector construction difficulty and reduced recombination specificity caused by excessively long homologous arms. The pUC57 low-copy plasmid, as the vector backbone, has the advantages of stable replication, no expression promoter interference, and easy in vitro cloning and linearization. Moreover, this plasmid is non-pathogenic and will not adversely affect the development of fertilized eggs, ensuring the structural integrity and functional effectiveness of the homologous recombination donor vector.
[0025] In some specific examples, the construction method of the homologous recombination donor vector includes: synthesizing the P2A-CreERT2 coding sequence and cloning it into an intermediate vector for sequencing verification; then cloning the left homologous arm, the P2A-CreERT2 sequence, and the right homologous arm into the pUC57 vector backbone in sequence; transforming DH5α competent cells; and obtaining positive clone plasmids through ampicillin resistance screening and full-sequence sequencing, followed by linearization.
[0026] It should be noted that the P2A sequence enables self-cleavage co-expression of Cyp11b2 and CreERT2, avoiding interference from the fusion protein on their functions. Cloning it into an intermediate vector and sequencing it first ensures the correctness of the coding sequence and avoids problems such as frameshift mutations and base deletions. Cloning the left homologous arm, the target fragment, and the right homologous arm in sequence ensures the directionality and precision of homologous recombination. DH5α competent cells have high transformation efficiency, and ampicillin resistance screening can quickly obtain positive clones. Full-sequence sequencing identification ensures that the vector sequence is free of mutations and that the element insertion position is correct. The linearized vector can significantly improve the efficiency of homologous recombination, avoid random integration caused by circular vectors, and ensure the specificity of gene knock-in.
[0027] In some specific examples, mouse zygotes had a C57BL / 6JGpt background.
[0028] It should be noted that the C57BL / 6JGpt mouse is an inbred mouse strain with a clear genetic background and high gene homozygosity. It is one of the most commonly used model animals in life science research. Its physiological characteristics and metabolic pathways are well-defined, it has good tolerance to gene editing, and its embryonic development rate is high. Using fertilized eggs from this background to construct a model can ensure the genetic stability of the model mice, reduce the interference of genetic background differences on experimental results, and make experimental data more reliable and reproducible. At the same time, it is convenient to crossbreed with other gene-modified mice with the same background, thus expanding the application scope of the model.
[0029] In some specific examples, the genotype was confirmed using a triple PCR strategy, with the following three pairs of specific primers: 5' arm primers, whose nucleotide sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively; 3' arm primers, whose nucleotide sequences are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively; and WT primers, whose nucleotide sequences are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.
[0030] It should be noted that the triple PCR strategy, by simultaneously amplifying the 5' homologous arm, 3' homologous arm, and wild-type site of the gene knock-in site, can achieve accurate identification of mouse genotypes in one go. Compared with single PCR or double PCR identification, it is more efficient and the results are more accurate. All three pairs of specific primers are designed for the Cyp11b2 gene target site and the flanking sequences of the knock-in element, with high specificity and no non-specific amplification. It can quickly distinguish between wild-type, heterozygous, and homozygous mice, providing an efficient and reliable detection method for genotype screening in model construction.
[0031] In some specific examples: Wild-type: PCR amplification with 5'arm primer pair and 3'arm primer pair showed no bands, while PCR amplification with WT primer pair showed a single 407bp band; Heterozygote: PCR amplification with 5'arm primer pair and 3'arm primer pair showed 361bp and 408bp bands, respectively, while PCR amplification with WT primer pair showed a single 407bp band; Homozygote: PCR amplification with 5'arm primer pair and 3'arm primer pair showed 361bp and 408bp bands, respectively, while PCR amplification with WT primer pair showed no bands.
[0032] It should be noted that this genotype determination criterion is based on the amplification characteristics of three pairs of specific primers and the sequence characteristics of the target site. The amplification bands of each genotype differ significantly in size and can be directly observed and determined by agarose gel electrophoresis without the need for complex sequencing verification. The operation is simple and the results are intuitive. This determination criterion has been verified by multiple experiments and has no false positive or false negative results. It can quickly and accurately complete the genotype screening of F0 and F1 generation mice, greatly improve the efficiency of model construction, and ensure the acquisition of Cyp11b2-P2A-CreERT2 gene knock-in mice with the correct genetic background.
[0033] Secondly, embodiments of the present invention also provide the application of the Cyp11b2-P2A-CreERT2 gene knock-in mouse model obtained by the above construction method in studying the molecular regulatory mechanism of aldosterone synthesis, the pathophysiological mechanism of primary aldosteronism and aldosterone-related diseases.
[0034] It should be noted that this model achieves specific expression of CreERT2 recombinase in Cyp11b2-positive cells (zona glomerulosa cells) and can induce gene editing through tamoxifen, solving the problem that traditional models cannot achieve spatiotemporally specific regulation. With the help of this model, the target gene in zona glomerulosa cells can be specifically knocked out, and the regulatory role of this gene in aldosterone synthesis can be accurately analyzed, elucidating the molecular regulatory network of aldosterone synthesis. At the same time, this model can simulate the pathophysiological process of essential aldosteronism and aldosterone-related diseases such as hypertension, heart failure, and nephropathy, accurately revealing the mechanism of abnormal aldosterone secretion in the occurrence and development of diseases, identifying the core pathogenic targets of the diseases, and providing an irreplaceable animal model for basic research related to aldosterone.
[0035] Thirdly, embodiments of the present invention also provide the application of the Cyp11b2-P2A-CreERT2 gene knock-in mouse model constructed by the above construction method in screening therapeutic drugs that target the aldosterone synthesis pathway or adrenal zona glomerulosa cells.
[0036] It should be noted that this model has the advantages of target cell specificity and gene editing induction, enabling precise in vivo validation of the efficacy of candidate drugs targeting the aldosterone synthesis pathway or adrenal zona glomerulosa cell genes. By inducing gene editing at specific stages through tamoxifen, the pathological state of different disease development stages can be simulated, allowing for the screening of therapeutic drugs suitable for different stages of the disease. Simultaneously, the regulatory effects of candidate drugs on aldosterone synthesis, their specific effects on adrenal zona glomerulosa cells, and their overall safety to the body can be evaluated, avoiding non-specific interference from traditional screening models. This model enables integrated research from target validation to drug screening, significantly improving the efficiency and accuracy of drug screening, providing an efficient in vivo screening platform for targeted drug development for aldosterone-related diseases, and accelerating the development of innovative drugs.
[0037] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.
[0038] Example 1
[0039] This example provides a method for constructing a Cyp11b2-P2A-CreERT2 gene knock-in mouse model based on the CRISPR / Cas9 system. The strategy is as follows: Figure 1 As shown, specifically, using the CRISPR / Cas9 system, a P2A-CreERT2 element is inserted before the TAG translation termination site of the Cyp11b2 gene (before the stop codon of the last exon 9), enabling CreERT2 to be expressed under the regulation of the endogenous Cyp11b2 gene. This includes the following steps: (1) Design and synthesis of targeted gRNA The mouse Cyp11b2 gene sequence was obtained from the NCBI website. Its specific transcript was selected as the target sequence. Using a gene editing target design tool, two 20 bp oligonucleotide chains targeting the target DNA were designed based on target score to prepare gRNA. The target was precisely located near the translation stop codon of the last exon of the Cyp11b2 gene to ensure the accuracy of subsequent cleavage and insertion. The gRNA sequences and corresponding PAM sequences used in this invention are shown in Table 1 below. The designed sequences were synthesized and purified by PAGE for later use.
[0040] Table 1. gRNA sequences and corresponding PAM sequences used in the embodiments of the present invention
[0041] (2) Construction of homologous recombination donor vector
[0042] Based on the gRNA target sequence, a donor vector carrying the target site homologous region and the P2A-CreERT2 target fragment was designed. Left homologous arms (5' arm) and right homologous arms (3' arm) of 500–1500 bp were designed on both sides of the insert fragment to ensure high recombination efficiency. The P2A-CreERT2 coding sequence was synthesized and cloned into an intermediate vector for sequence verification. Subsequently, the left homologous arm, the P2A-CreERT2 sequence, and the right homologous arm were sequentially cloned into the pUC57 low-copy vector backbone. The constructed vector did not contain antibiotic resistance selection markers (such as neo) to avoid affecting gene expression. The recombinant plasmid was transformed into DH5α competent cells. Positive clones were screened and identified by ampicillin resistance and full-sequence sequencing of the insert fragment. After selecting the correct colony clones for expansion culture, the plasmid was extracted and purified. The obtained donor fragment product was linearized to improve recombination efficiency for subsequent injection. The specific construction steps are as follows: (3) Preparation of CRISPR / Cas9 editing system The synthesized two single-stranded oligonucleotide gRNA sequences were annealed to form double-stranded DNA, and a gRNA expression vector was constructed. The recombinant plasmid was transformed into DH5α competent cells. Positive clone plasmids were identified by resistance selection and target DNA sequencing. After selecting the correct colonies for expansion culture, the plasmid was extracted and used as a template for in vitro transcription. At the same time, Cas9 mRNA or protein was prepared, which, together with the in vitro transcribed and purified gRNA, constituted a complete CRISPR / Cas9 gene editing system for subsequent fertilized egg microinjection experiments. The specific steps are as follows: (3-1) Construction of gRNA expression vector 1) Preparation of double-stranded gRNA: Take the two single-stranded oligonucleotide gRNA sequences designed and synthesized in the previous stage (Cyp11b2-S1: 5'-AAAGTGACTAGCTGACAGGC-3' (SEQ ID NO: 1), PAM is CGG; Cyp11b2-S2: 5'-TGCAAAAGTGACTAGCTGAC-3' (SEQ ID NO: 2), PAM is AGG), mix the forward and reverse strands of each gRNA in an equimolar ratio, and place them in a PCR instrument for annealing. The specific conditions are: denaturation at 95℃ for 5 min, followed by slow cooling to room temperature, so that the single-stranded oligonucleotides anneal to form double-stranded DNA (dsRNA), which is then ready for use.
[0043] 2) Vector ligation: Select a suitable gRNA expression vector (such as pU6-gRNA vector), digest the vector with restriction endonucleases to obtain a linearized vector backbone; ligate the annealed double-stranded gRNA with the linearized vector backbone by adding DNA ligase and incubating overnight at a suitable temperature (usually 16℃) to allow the double-stranded gRNA to be directionally inserted into the expression vector, thus constructing a recombinant gRNA expression vector.
[0044] (3-2) Screening and identification of recombinant gRNA expression vectors
[0045] 1) Transformation of competent cells: The constructed recombinant gRNA expression vector was transformed into DH5α competent cells. The procedure was as follows: DH5α competent cells were thawed in an ice bath, the recombinant vector solution was added, and after gentle mixing, the cells were incubated on ice for 30 min. After heat shock at 42℃ for 90 s, the cells were immediately incubated on ice for 2 min. Sterile LB medium was added, and the cells were cultured at 37℃ and 200 rpm for 1 h with shaking to restore the activity of competent cells and express the vector resistance gene.
[0046] 2) Resistance screening: The transformed bacterial culture was evenly spread on LB solid medium containing the corresponding resistance (such as ampicillin resistance) and incubated overnight at 37°C. Positive colonies containing the recombinant gRNA expression vector were screened out. Only bacteria that were successfully transformed with the recombinant vector could grow on the resistance medium, while bacteria that were not transformed or transformed with the empty vector could not survive.
[0047] 3) Target DNA sequencing identification: Select multiple single colonies that are positive for antibiotic resistance screening, and carry out amplification culture. Use a plasmid extraction kit to extract recombinant plasmids. Sequencing of the extracted recombinant plasmids is performed on the target DNA. The sequencing region covers the gRNA insertion site. Confirm that the gRNA sequence has no base mutations or deletions and that the insertion direction is correct. Select the positive clone plasmids that are correctly constructed.
[0048] (3-3) In vitro transcription and purification of gRNA
[0049] 1) Preparation of in vitro transcription template: The positive clone plasmid (recombinant gRNA expression vector) that was correctly identified by sequencing was used as the in vitro transcription template. Restriction endonuclease was used to linearize it to remove the closed loop structure of the vector and ensure that in vitro transcription could proceed normally. After linearization, the plasmid was purified to remove impurities in the enzyme digestion products and obtain a high-purity linearized template. 2) In vitro transcription: Using an in vitro transcription kit, a linearized recombinant gRNA expression vector was used as a template to synthesize mature gRNA through in vitro transcription. 3) gRNA purification: After the transcription reaction is completed, the synthesized gRNA is purified using an RNA purification kit to remove unreacted NTPs, enzymes and template DNA and other impurities. After purification, the integrity and purity of the gRNA are verified by agarose gel electrophoresis to ensure that there is no degradation and no impurities. The purified gRNA is then stored at -80℃ for later use.
[0050] (3-4) Assembly of the CRISPR / Cas9 editing system
[0051] The purified gRNA was mixed with Cas9 mRNA, gently mixed, and then incubated in an ice bath for 30 minutes to allow the gRNA and Cas9 protein to form a complex and assemble into a complete CRISPR / Cas9 gene editing system.
[0052] (4) Obtaining and microinjecting mouse fertilized eggs
[0053] Six-week-old C57BL / 6 mice were selected as donor females. After superovulation treatment, they were mated with ten-week-old C57BL / 6 male mice. Fertilized eggs were collected from donor females exhibiting vaginal plugs and used as embryo transfer donors. Using microinjection technology, the CRISPR / Cas9 system and the linearized Donor vector sample were co-injected into the pronucleus of mouse fertilized eggs with a C57BL / 6JGpt background to complete the in vitro gene editing operation.
[0054] (5) Embryo transfer and the acquisition of F0 generation mice
[0055] Twenty fertilized eggs that survived after injection and had good morphology were selected for in vitro culture to form embryos. The embryos were then transferred into the oviducts / uterus of pseudopregnant ICR female mice with vaginal plugs, allowing them to develop normally. Once the pseudopregnant female mice became pregnant and gave birth naturally, the first generation of F0 mice was obtained.
[0056] (6) Genotyping of F0 and F1 generation mice
[0057] F0 generation mice were tail-cropped and toe-cropped 5-7 days after birth for numbering. Tail tissue samples were collected, and genomic DNA was extracted using a direct PCR kit for mouse tails. Fresh digestion solution containing 2 μL Protease Plus and 100 μL Buffer was added to the EP tubes of mouse tail tissue. The mixture was digested in a 55°C water bath / metal bath for 15 min, incubated at 95°C for 5 min to inactivate the protease, and centrifuged at 12000 rpm for 5 min. The supernatant was then used as a PCR template.
[0058] Independent PCR amplification was performed using three pairs of specific primers: 5' arm, 3' arm, and wild-type (WT). The primer sequences and product sizes are as follows: ①5'arm: F1 (AGCAGTTTAGCAGTAGATGGGC, SEQ ID NO: 3); R1 (CATGTCCATCAGGTTCTTGCGAAC, SEQ ID NO: 4), targeting band 361bp; ②3'arm: F2 (GCATGAAGTGCAAGAACGTGGTG, SEQ ID NO: 5); R2 (TACTTCCAATCTCCTCCCTGG, SEQ ID NO: 6), targeting band 408bp; ③WT: F3 (AGCAGTTTAGCAGTAGATGGGC, SEQ ID NO: 7); R3 (TACTTCCAATCTCCTCCCTGG, SEQ ID NO: 8), wild-type band 407bp.
[0059] The PCR reaction system was prepared in an ice bath environment. The 20 μL system contained 10 μL of 2×M-PCR OPTIM Mix, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 1 μL of genomic DNA template, and 8 μL of ddH2O. The PCR program was set as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 s, 50℃-65℃ gradient annealing for 30 s, 72℃ extension (2 kb / min), 35 cycles; 72℃ final extension for 5 min, and incubation at 12℃.
[0060] PCR products were directly subjected to agarose gel electrophoresis, and genotypes were determined based on band patterns. Simultaneously, positive candidate mice were sequenced for verification. The sequencing region covered the P2A-CreERT2 element knock-in site and upstream and downstream flanking sequences of the Cyp11b2 gene, confirming knock-in accuracy and the absence of off-target editing effects (see...). Figure 2 ).
[0061] F0 generation mice identified as positive were raised to sexual maturity and then mated with wild-type C57BL / 6JGpt background mice to obtain F1 generation mice. The above steps of tail clipping, DNA extraction, triple PCR and sequencing were repeated 5-7 days after the birth of F1 generation mice to screen for positive offspring mice.
[0062] (7) Validation and screening of model mice
[0063] Genotyping results showed that mice 18, 19, 32, 33, and 39 in the F1 generation were heterozygous (KI / wt), exhibiting specific target bands amplified by PCR in both the 5' and 3' arms, and a 407bp wild-type band amplified by WT PCR, consistent with the sequencing results (gene interpretation criteria are shown in Table 2 below). No off-target effects were detected (see...). Figure 3 ).
[0064] Table 2 Gene Interpretation Criteria
[0065] The basic physiological status and specificity of the obtained Cyp11b2-P2A-CreERT2 heterozygous mice (hereinafter also referred to as AS-CreERT2+ / -) were verified as follows: (7-1) Tissue-specific verification 1) Genotype-verified heterozygous model mice (AS-CreERT2+ / -) and homozygous model mice (AS-CreERT2+ / +) were induced by intraperitoneal injection of tamoxifen (tamoxifen dissolved in corn oil at a concentration of 5 mg / mL, administered for 7 consecutive days, 100 μL per mouse per day); 7 days after administration, the mice were sacrificed, and six tissues (adrenal gland, heart, liver, spleen, lung, and kidney) were quickly dissected and collected. The tissues were then rapidly placed in 1.5 mL centrifuge tubes, and 1 mL of TRIzol reagent (Roche) was added for homogenization and lysis. The mixture was allowed to stand at room temperature for 5 min. 2) Add 200 μL of chloroform, shake vigorously for 15 seconds, let stand at room temperature for 3 minutes, then centrifuge at 12000g for 15 minutes at 4℃, remove the upper aqueous phase, add an equal volume of isopropanol, let stand at room temperature for 10 minutes, then centrifuge at 12000g for 15 minutes at 4℃, and discard the supernatant. 3) Wash the precipitate with 1 mL of 75% ethanol, centrifuge at 12000g for 5 min at 4℃, discard the supernatant, dry at room temperature, and add an appropriate amount of RNase-free H2O to dissolve the RNA; the concentration and purity of the extracted RNA are detected by UV spectrophotometer, and an OD260 / 280 ratio between 1.8 and 2.1 is considered qualified; 4) Reverse transcription was performed using the PrimeScript RT Reagent Kit (TaKaRa). The 20 μL system contained 1000 ng of total RNA, and the reaction conditions were 37℃ for 15 min. 5) Real-time quantitative PCR was performed using TBGreen Premix ExTaq (Takara) on a CFX96 Touch system. Melting curves were analyzed, with Actb as an internal control. - Relative expression levels were calculated using the ΔΔCt method, with three technical replicates per sample. The primer sequences, reaction system, and reaction conditions are shown below: Primer sequences: CreERT2-F (SEQ ID NO: 9): 5'-GCGATGGATTTCCTGCTCTGGTG-3', CreERT2-R (SEQ ID NO: 10): 5'-GCGAGTTGATAGCTGGCTGGTG-3'; Actb-F (SEQ ID NO: 11): 5'-CATCCGTAAAGACCTCTATGCCAAC-3', Actb-R (SEQ ID NO: 12): 5'-ATGGAGCCACCGATCCACA-3'; The reaction mixture (25 μL) consisted of: 12.5 μL TB Green, 1 μL each of forward and reverse primers, 2.5 μL cDNA, and 8 μL RNase-free H2O. Reaction conditions: 95℃, 30s; 95℃, 5s, 60℃, 30s, for a total of 39 cycles.
[0066] PCR results as follows Figure 4 As shown in the results, Cre-specific expression was detected only in adrenal tissue, while no significant expression was found in heart, liver, spleen, lung, and kidney tissues. This demonstrates that Cre expression is adrenal tissue-specific and meets the model design requirements.
[0067] (7-2) Cell-specific verification
[0068] To locate Cre protein expression at the tissue level, immunohistochemical staining of the adrenal glands of WT, AS-CreERT2+ / -, and AS-CreERT2+ / + mice was performed; details are as follows: 1) Heterozygous model mice and wild-type control mice were induced by intraperitoneal injection of tamoxifen (tamoxifen dissolved in corn oil at a concentration of 5 mg / mL, 100 μL per mouse per day for 7 consecutive days); the mice were sacrificed 7 days after administration; the adrenal gland tissue of the mice was then fixed, dehydrated, embedded, and paraffin sections were prepared using a microtome, with the section thickness controlled within an appropriate range (5 μm-8 μm), and dried after mounting for later use.
[0069] 2) Following the standard immunohistochemistry procedure, dewax, hydrate, and retrieval antigens were performed on the paraffin sections. Cre-specific primary antibody was added and incubated overnight. Secondary antibody was added the next day for incubation. Finally, staining and mounting were performed. A negative control (without primary antibody) was set up throughout the process to ensure accurate staining results.
[0070] Observe the stained sections under a microscope, such as Figure 5 As shown, the results clearly indicate that Cre protein signaling is only present in the zona glomerulosa (zG) cells of the adrenal cortex in AS-CreERT2+ / - and AS-CreERT2+ / + mice, while the zona fasciculata (zF) and medulla are negative; the entire adrenal gland of WT mice shows no Cre signaling at all. This confirms at the protein level that CreERT2 expression is strictly limited to zG cells.
[0071] (7-3) Functional effectiveness verification
[0072] 1) The Cyp11b2-P2A-CreERT2 heterozygous model mice with qualified genotypes were crossed with NPC1-flox mice to obtain offspring NPC1-CKO mice (Cyp11b2-P2A-CreERT2+ / -; NPC1flox / flox), while the parent NPC1-flox mice were retained as controls.
[0073] 2) Inducing NPC1-CKO mice to undergo intraperitoneal injection of tamoxifen (tamoxifen dissolved in corn oil at a concentration of 5 mg / mL, 100 uL per mouse per day for 7 consecutive days, followed by 7 days of administration) ensures that CreERT2 enters the cell nucleus to exert its recombination cleavage effect.
[0074] 3) Take adrenal tissue from induced NPC1-CKO mice and control NPC1-flox mice, prepare paraffin sections and perform NPC1 immunohistochemical staining; observe and compare the NPC1 expression levels of the two mice under a microscope.
[0075] The results are as follows Figure 6 As shown, the results indicate that the expression level of NPC1 in the zona glomerulosa of the adrenal glands of NPC1-CKO mice was significantly lower than that of control mice, demonstrating that the model can achieve specific gene knockout within zona glomerulosa cells and is functionally effective.
[0076] (7-4) Basic physiological verification
[0077] To assess the effect of AS-CreERT2 knock-in on zona glomerulosa function in mice, plasma aldosterone levels were measured in male wild-type WT (C57BL / 6JGpt) and male heterozygous model mice (AS-CreERT2+ / -), as well as in female wild-type WT and female heterozygous model mice (AS-CreERT2+ / -). Details are as follows: Male / female wild-type (WT) mice and male / female heterozygous (AS-CreERT2+ / -) mice were induced to function with tamoxifen via intraperitoneal injection (method as described in (7-3) above for functional efficacy verification), and were simultaneously injected with the same volume of corn oil as a control. Plasma aldosterone levels were measured after drug administration using the following methods: Plasma aldosterone was detected using high-performance liquid chromatography-tandem mass spectrometry (LC-MS / MS) with an Ultimate 3000 HPLC system and a TSQENDURA triple quadrupole mass spectrometer (Thermo Scientific, USA). Chromatographic separation was performed using a Waters BEHC18 column (100 mm × 2.1 mm, 1.7 μm) at 45 °C. Mobile phase A was 5% methanol-water solution containing 0.15 mmol / L ammonium fluoride, and mobile phase B was methanol. A gradient elution program was used with a flow rate of 0.35 mL / min and an injection volume of 20 μL. Mass spectrometry was performed using an electrospray ionization source in positive ion mode (ESI+), with an ionization voltage of 4000 V, a sheath gas of 45 Arb, an auxiliary gas of 10 Arb, an ion transmission tube temperature of 320 °C, an evaporation temperature of 300 °C, and selected reaction monitoring (SRM) mode for data acquisition. The precursor ion of aldosterone was m / z 361.17, and the daughter ions were m / z 315.04 (quantitative) and 343.04 (qualitative), with collision energies of 14.4 V and 10.3 V, respectively. Using deuterated aldosterone (D4-aldosterone) as an internal standard, the linear range was 0.01 ng / mL–10 ng / mL, with a regression equation of Y = 0.00370938 + 0.00128062 × X, and a correlation coefficient r. 2 =0.997. The spiked recoveries were 98.3%–102.2%, with intra-day coefficient of variation less than 5.1% and inter-day coefficient of variation less than 5.0%. Sample pretreatment employed protein precipitation combined with solid-phase extraction: 300 μL of plasma was mixed with 500 μL of protein precipitation solution (0.1 M zinc sulfate-65% methanol solution) containing internal standard, vortexed, allowed to stand for 10 minutes, centrifuged at high speed, and the supernatant was purified by HLB solid-phase extraction plate, eluted with methanol, and reconstituted with 150 μL of deionized water before injection for analysis.
[0078] The results are as follows Figure 7As shown, the results indicated that there were no statistically significant differences in aldosterone levels between male and female mice, regardless of genotype or whether tamoxifen was used. This suggests that neither AS-CreERT2 knock-in nor tamoxifen induction interfered with aldosterone synthesis in the zona glomerulosa of male or female mice.
[0079] In summary, the method of this invention successfully established a Cyp11b2-P2A-CreERT2 gene knock-in mouse model. This model can achieve precise genetic manipulation of adrenal zona glomerulosa cells under tamoxifen induction, which is of great significance for studying the regulatory mechanism of aldosterone synthesis and the pathophysiological mechanism of diseases such as primary aldosteronism. It also provides an ideal animal model for drug screening targeting the aldosterone synthesis pathway.
[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A method for constructing a Cyp11b2-P2A-CreERT2 knock-in mouse model, characterized in that, The construction method includes: introducing the CRISPR / Cas9 system and homologous recombination donor vector into mouse zygotes, then transplanting the zygotes into pseudopregnant female mice, and waiting for them to become pregnant and give birth; the recipient mice produce F0 generation mice, the genotype is confirmed, and after the positive F0 generation mice reach sexual maturity, they are mated with wild-type background mice to produce F1 generation mice, the genotype is confirmed, and the resulting heterozygotes are the Cyp11b2-P2A-CreERT2 gene knock-in mouse models; wherein, the sequence of the gRNA of the CRISPR / Cas9 system is shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the homologous recombination donor vector includes the P2A-CreERT2 element; wherein, the Cyp11b2-P2A-CreERT2 gene knock-in mouse model specifically expresses CreERT2 in the zona glomerulosa cells of the adrenal gland, and achieves zona glomerulosa cell-specific gene editing after tamoxifen induction.
2. The construction method of claim 1, wherein, The CRISPR / Cas9 system and homologous recombination donor vector were introduced into mouse zygotes via microinjection.
3. The construction method according to claim 1 or 2, characterized in that, The homologous recombination donor vector also includes a left homologous arm and a right homologous arm, with the lengths of the left and right homologous arms ranging from 500bp to 1500bp. The vector backbone is a pUC57 low-copy plasmid.
4. The construction method according to claim 3, characterized in that, The method for constructing homologous recombination donor vectors includes: synthesizing the P2A-CreERT2 coding sequence and cloning it into an intermediate vector for sequencing verification; then cloning the left homologous arm, P2A-CreERT2 sequence, and right homologous arm into the pUC57 vector backbone in sequence; transforming DH5α competent cells; and obtaining positive clone plasmids through ampicillin resistance screening and full-sequence sequencing, followed by linearization.
5. The construction method according to claim 1, 2 or 4, characterized in that, Mouse fertilized eggs have a C57BL / 6JGpt background.
6. The construction method of claim 1, 2, or 4, wherein, Genotype confirmation was performed using a triple PCR strategy, with the following three pairs of specific primers: The 5' arm primer pairs have the following nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively; The 3' arm primer pairs have the following nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively; The WT primer pairs have nucleotide sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.
7. The construction method according to claim 6, characterized in that, Wild type: PCR amplification with 5' arm primer pair and 3' arm primer pair showed no bands, while PCR amplification with WT primer pair showed a single 407bp band; Heterozygotes: PCR amplification with 5' arm primers and 3' arm primers showed bands of 361 bp and 408 bp, respectively, while PCR amplification with WT primers showed a single band of 407 bp. Homozygous: PCR amplification with 5' arm primer pair and 3' arm primer pair showed bands of 361bp and 408bp, respectively, while PCR amplification with WT primer pair showed no band.
8. The application of the Cyp11b2-P2A-CreERT2 gene knock-in mouse model constructed by the construction method described in any one of claims 1 to 6 in the study of the molecular regulatory mechanism of aldosterone synthesis, the pathophysiological mechanism of primary aldosteronism and aldosterone-related diseases.
9. The use of the Cyp11b2-P2A-CreERT2 gene knock-in mouse model constructed by the construction method of any one of claims 1 to 6 in screening therapeutic drugs that target the aldosterone synthesis pathway or adrenal zona glomerulosa cells.