An alpha-pyrone derivative and its use in the preparation of a pro-angiogenic medicament
By extracting and purifying α-pyranone derivatives from *Trichophyton floccosum*, the problem of the lack of effective angiogenesis-promoting drugs in the existing technology has been solved, and the promoting effect on PTK787-induced zebrafish vascular injury model has been achieved, providing a new direction for the treatment of cardiovascular diseases.
Patent Information
- Application Number
- CN202610837103.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-10
- Publication Date
- 2026-07-10
AI Technical Summary
There is a lack of drugs in the current technology that can effectively and stably promote angiogenesis, especially in the treatment of cardiovascular diseases. Existing candidate drugs have limitations in terms of efficacy, specificity and safety, and there is insufficient research on the regulation of angiogenesis by naturally derived active ingredients.
An α-pyranone derivative was extracted, isolated, and purified from the fermentation products of *Trichophyton floccosum*. The compound, exhibiting pro-angiogenic activity, was prepared using silica gel column chromatography, gel column chromatography, and semi-preparative high-performance liquid chromatography. It was then applied in pharmaceuticals at pharmacologically effective concentrations of 5-20 μg/mL and formulated into tablets, capsules, or granules using pharmaceutically acceptable carriers.
This compound exhibits significant pro-angiogenic effects in a PTK787-induced zebrafish vascular injury model, and significantly upregulates the expression of related genes such as VEGFR2, Ras, and PKB. This expands the screening range of naturally derived pro-angiogenic active ingredients and provides a new research basis for cardiovascular diseases.
Smart Images

Figure CN122355994A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biopharmaceutical product technology, specifically relating to an α-pyranone derivative and its application in the preparation of angiogenesis-promoting drugs. Background Technology
[0002] Cardiovascular disease (CVD) has become one of the leading causes of death and disability worldwide. With the accelerating aging of the population, the incidence and mortality rates of diseases such as coronary heart disease, myocardial infarction, and ischemic stroke continue to rise, seriously threatening human health and placing enormous pressure on social healthcare systems. Current research indicates that impaired angiogenesis and the resulting tissue ischemia are important pathological bases for the occurrence and progression of various cardiovascular diseases. However, current clinical interventions for ischemic cardiovascular disease mainly focus on antiplatelet, lipid-lowering, vasodilator, and reperfusion therapies. For the core pathological link of insufficient angiogenesis in damaged tissues, ideal drug interventions are still lacking. Especially in promoting functional angiogenesis, existing candidate drugs still have limitations in terms of efficacy, specificity, and safety.
[0003] The VEGF / VEGFR2 signaling pathway is one of the most critical regulatory pathways in angiogenesis, playing a central role in vascular endothelial cell proliferation, migration, and angiogenesis. Despite extensive research on this pathway, the development of existing angiogenesis-related drugs still faces challenges such as single-target therapy, limited mechanisms of action, and difficulties in clinical translation. Meanwhile, classic angiogenesis inhibitors are primarily used in anti-angiogenesis research, while lead compounds that can effectively and stably promote angiogenesis and possess significant development potential remain relatively scarce. Discovering lead structures with pro-angiogenic activity from natural products and further providing new candidate molecules for cardiovascular disease treatment has become an important direction in current research.
[0004] Edible and medicinal fungi have long been considered an important source of natural bioactive substances due to their rich diversity of secondary metabolites. Although studies have shown that some fungal metabolites possess lipid-regulating, anti-tumor, immunomodulatory, and antioxidant activities, research on their role in angiogenesis regulation remains limited, particularly lacking systematic screening, activity verification, and mechanistic studies targeting the angiogenesis-promoting effects of specific fungal-derived active ingredients. Therefore, current technologies lack effective compounds that combine natural origin, structural novelty, and angiogenesis potential, and also lack a research foundation that can provide a clear direction for cardiovascular disease drug development.
[0005] In summary, existing technologies still face challenges in addressing the critical pathological link of "insufficient angiogenesis" in cardiovascular ischemic diseases, including limited sources of active molecules, insufficient candidate compounds, and inadequate mechanistic studies. There is an urgent need to develop new naturally derived active ingredients and related research systems to meet the practical needs of cardiovascular innovative drug development. Summary of the Invention
[0006] The purpose of this invention is to provide an α-pyranone derivative and its application in the preparation of pro-angiogenic drugs, specifically a compound extracted, isolated and purified from the fermentation product of *Inonotus hispidus* that promotes angiogenesis in zebrafish and can be used in drugs for the prevention and treatment of cardiovascular diseases.
[0007] This invention first provides an α-pyranone derivative with the structural formula (1):
[0008] (1).
[0009] The α-pyranone derivatives were isolated and purified from the fermentation product of *Fomitopsis coarseis*.
[0010] Furthermore, the method for preparing the α-pyranone derivative involves fermenting *Follium coarctans* to obtain a fermentation broth; extracting the fermentation broth to obtain a crude extract; and performing chromatographic separation on the crude extract to obtain the α-pyranone derivative.
[0011] The fermentation culture includes:
[0012] Prepare a resuscitation solid medium according to the weight ratio of water:glucose:potato:agar = 100:2:20:2, and adjust the pH to 6.5; inoculate the *Follium coarseum* onto the resuscitation solid medium and incubate at 28°C for 3 days.
[0013] A liquid culture medium was prepared according to the weight ratio of water:corn starch:glucose:peptone:potassium dihydrogen phosphate:magnesium sulfate = 100:1:1:0.2:0.1:0.05, and the pH was adjusted to 6.5. The revived *Follium coarctatiforme* was inoculated into the liquid culture medium and cultured statically at 25°C for 30 days.
[0014] The extraction of the fermentation broth includes: adding an equal volume of ethyl acetate to the fermentation broth and allowing it to stand for 3 days for extraction, repeating the extraction 4 times, combining the extracts and then recovering the ethyl acetate by rotary evaporation to obtain a crude extract.
[0015] The chromatographic separation includes one or more of silica gel column chromatography, gel column chromatography, and semi-preparative high-performance liquid chromatography.
[0016] The present invention also provides the use of the α-pyranone derivatives in the preparation of angiogenic drugs.
[0017] The present invention also provides a pro-angiogenic drug, wherein the drug contains a pharmacologically effective concentration of the α-pyranone derivative;
[0018] The pharmacologically effective concentration is 5-20 μg / mL.
[0019] Furthermore, the drug also contains a pharmaceutically acceptable carrier.
[0020] The dosage form of the above-mentioned pharmaceutical composition is any one of tablets, capsules, or granules.
[0021] This invention isolates a novel α-pyranone derivative from the fermentation products of *Trichophyton floccosum*, expanding the screening scope of naturally derived pro-angiogenic active ingredients. This compound exhibits significant pro-angiogenic effects in a PTK787-induced zebrafish vascular injury model, showing a dose-dependent effect, and significantly upregulates the expression of related genes such as VEGFR2, Ras, and PKB, suggesting that it may function through the VEGF / VEGFR2-related signaling pathway. Therefore, this invention provides a new lead compound and research foundation for ischemic cardiovascular diseases and other diseases related to insufficient angiogenesis, and has promising development and application prospects. Attached Figure Description
[0022] Figure 1 The compound in this invention 1 H-NMR spectrum;
[0023] Figure 2 The compound in this invention 13 C-NMR spectrum;
[0024] Figure 3 This is a fluorescence microscope image of the zebrafish angiogenesis activity test of the compound in this invention;
[0025] Figure 4 Figure u shows the experimental results of the zebrafish angiogenesis activity test of the compound in this invention;
[0026] Figure 5 This is a diagram showing the experimental results of the mechanism by which the compound in this invention promotes angiogenesis in zebrafish. Detailed Implementation
[0027] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.
[0028] Example 1: Preparation of the compound
[0029] Prepare a resuscitation solid medium according to the weight ratio of water:glucose:potato:agar = 100:2:20:2, and adjust its pH to 6.5. Inoculate a certain amount of *Inonotus hispidus* onto the resuscitation solid medium and incubate at 28 ℃ for 3 days. Prepare a liquid culture solution according to the weight ratio of water:corn starch:glucose:peptone:potassium dihydrogen phosphate:magnesium sulfate = 100:1:1:0.2:0.1:0.05, and adjust its pH to 6.5. Take an appropriate amount of *Inonotus hispidus* (CGMCC NO.3.15188, sourced from the Institute of Microbiology, Chinese Academy of Sciences) from the resuscitation solid medium and inoculate it into 230 Erlenmeyer flasks containing 300 mL of the above liquid culture solution, and incubate for 30 days at 25°C. The culture was kept at a constant temperature of ℃ and incubated for 30 days. After the fermentation was completed, the culture medium was poured into a fermentation tank and a small amount of ethyl acetate was added for inactivation treatment. The tissue homogenate was obtained by breaking it up with a wall-breaking machine. An equal volume of ethyl acetate was added and the mixture was sonicated in a water bath for 30 min. After four extractions, the extracts were combined and the ethyl acetate was recovered by rotary evaporator to obtain crude extract (about 33 g).
[0030] The crude extract was dissolved in methanol and then ground and mixed with 100-200 mesh normal-phase silica gel at a 1:1 mass ratio. The solvent was evaporated. A blank chromatographic column was vertically fixed. The lower layer was first packed with 200-300 mesh normal-phase silica gel (3 times the mass of the sample), followed by a layer of defatted cotton. The sample and silica gel mixture was then added, and the top was packed with a layer of defatted cotton for buffering. Pressurized packing was used throughout the process, with each layer compacted. Elution was performed sequentially with petroleum ether-ethyl acetate at volume ratios of 1:0, 50:1, 40:1, 20:1, 10:1, 8:1, 5:1, 2:1, 1:1, 1:1.5, and 0:1. Elution was then performed three times with dichloromethane-methanol at ratios of 50:1, 20:1, 10:1, 5:1, 2:1, 1:1, 1:1.5, and 0:1. Each elution stage was monitored in real time by TLC (dichloromethane:methanol = 20:1). The components were concentrated by rotary evaporation under reduced pressure to obtain the primary separated products. The eluents of petroleum ether:ethyl acetate in the 1:1.5 and 0:1 ratios were collected and concentrated to solid state under reduced pressure to obtain the crude product (8.7 g). The crude product was then subjected to a polarity decreasing gradient elution (10%-100% methanol) using a SepaBean machine T medium-pressure preparative liquid chromatography system. The chromatographic signal was acquired in real time across the entire wavelength range using a DAD detector. Peak area integration was performed based on the UV absorption characteristics, and components with similar retention times (Fr. 16.1–Fr. 16.10) were combined. The component Fr.16.6 (2.5 g) was dissolved in methanol and eluted with acetonitrile-water at a flow rate of 4 mL / min, a volume ratio of 40:60, and a UV detection wavelength of 200-600 nm. The α-pyranone derivative (1.9 mg) was then separated using a Hitachi PM1000 semi-preparative high-performance liquid chromatography system (C18 reversed-phase column, 5 μm, 250×10 mm).
[0031] Example 2: Structural Identification of Compounds
[0032] The structure of this α-pyranone derivative was determined through comprehensive analysis of data from high-resolution mass spectrometry, ultraviolet spectroscopy, and nuclear magnetic resonance. Its physicochemical properties are as follows:
[0033] The compound is a yellow amorphous powder. Its [M+H] content is given by ESI-MS at 505.10 m / z. + Quasi-molecular ion peak, molecular formula C 27 H 20 O 10 The degree of unsaturation is 18. UV(MeCN) λ maxThe wavelengths were 200.5 (5.61), 209.1 (5.54), 218.4 (5.59), 239.6 (5.33), 254.5 (5.38), 288.3 (4.82) and 388.9 (5.78) nm; their carbon NMR and hydrogen NMR data are shown in Table 1.
[0034] Table 1. Carbon and proton NMR spectra of the compounds (400, 150 MHz, DMSO-d6)
[0035] No. δc <![CDATA[δ H ]]> 1 <![CDATA[18.11, CH2]]> 3.42 (s, 2H) 2, 2' 164.06, C 3, 3' 100.96, C 4, 4' 172.75, C 4-OH, 4'-OH 9.41 (s, 2H) 5, 5' 114.08, CH 6.15 (s, 2H) 6, 6' 156.60, C 7, 7' 120.15, CH 6.65 (d, 16.00, 2H) 8, 8' 145.55, CH 7.01 (d, 2.10, 2H) 9, 9' 133.55, C 10, 10' 115.75, CH 7.05 (d, 16.00, 2H) 11, 11' 153.25, C 12, 12' 147.16, C 12-OH, 12'-OH 9.04 (s, 2H) 13, 13' 116.38, CH 6.93 (dd, 8.30, 2.20, 2H) 14, 14' 126.96, CH 6.74 (d, 8.30, 2H), 1H)
[0036] Example 3
[0037] To further verify the beneficial effects of the compound described in this invention, its angiogenesis-promoting activity in zebrafish was tested. The specific experiments are as follows:
[0038] I. Experimental Methods:
[0039] 1. Zebrafish Embryo Acquisition: Male and female zebrafish were fed separately at 28 ℃ under 14 h light / 10 h darkness conditions to ensure normal spawning. Healthy, mature male and female zebrafish were placed in a mating tank at a 1:1 ratio. Fertilized eggs were obtained the following morning. After disinfection and washing, the fertilized eggs were transferred to zebrafish embryo culture water (5.0 mM NaCl, 0.17 mM KCl, 0.4 mM CaCl2, and 0.16 mM MgSO4) and cultured under controlled light at 28 ℃. Different concentrations of each sample were dissolved and added to 24-well plates along with different doses of PTK787.
[0040] 2. Angiogenesis Activity Assay: The positive control was ferulic acid (100 μg / mL). Ten zebrafish embryos developed to 24 hpf and demembranous were added to each well (two replicates per sample group). These zebrafish were used to induce a zebrafish vascular injury model by adding PTK787 (final concentration 0.25 μg / mL). After mixing, the wells were covered and incubated in a constant temperature incubator. Twenty-four hours after administration, intersegmental angiogenesis was observed and photographed under a fluorescence microscope, and the number of angiogenesis cells was counted.
[0041] 3. Study on the mechanism of angiogenesis: Zebrafish juveniles 24 h post-fertilization were randomly divided into a blank control, a model control (0.25 μg / mL PTK787), and three dosage groups (0.25 μg / mL PTK787, 5, 10, and 20 μg / mL test samples), with 30 fish in each group (10 fish per well × 4 wells). Juveniles were collected 24 h after drug intervention and stored at -80 ℃. Total RNA was extracted using the FastPure kit, reverse transcribed into cDNA using HiScript / Q RT Supermix, and calibrated to 100 ng / μL. 2 μL of template was then used for qPCR. The reaction system was ChamQ Universal SYBR qPCR Master Mix, primer sequences are shown in Table 2; amplification program: 95 ℃ for 10 min; 40 cycles (95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 15 s). Data processing used the LightCycler® system to export Cq values, which were then processed using Rpl13α as an intrinsic parameter, and calculated according to 2... -ΔΔCt The relative expression levels of the target gene were calculated using a method. One-way ANOVA and Tukey multiple comparisons were performed using GraphPad Prism 6. Results are expressed as mean ± standard deviation, and P < 0.05 was considered significant.
[0042] Table 2: Genes detected by Q-PCR and corresponding primer sequences
[0043] Primer name Forword primers Reverse primers VEGFR2 ACTGAAGGAGGGCACTAGGA GCCGTGTTGATCGGGATGTA Ras AGCGCTAAGAACGCCACAAA AGGCTTCACTGGAGTGCTTTC PKB GTTGGTTCCTCCGTTCAAGC GGTCGTCTCTCGCTGTCAAA
[0044] The experimental results showed that the number of intersegmental vessels in zebrafish using the PTK787 injury model group was significantly different from that in the experimental group (## indicates P ≤ 0.01 compared to the control group; ** indicates P ≤ 0.01 compared to PTK787; P indicates statistical significance). This α-pyranone derivative exhibited pro-angiogenic activity against PTK787-induced zebrafish, and the pro-angiogenic activity became more pronounced with increasing compound concentration. Furthermore, at a concentration of 20 μg / mL, it showed a stronger pro-angiogenic effect on zebrafish compared to the positive control drug ferulic acid (see Appendix for details). Figure 3 and 4 Genetic testing results showed that, compared with the control group, the mRNA expression levels of all detected genes in the zebrafish of the vascular injury model group were significantly decreased (P<0.05). However, the α-pyranone derivative intervention group exhibited a specific regulatory effect, significantly upregulating the expression levels of VEGFR2, Ras, and PKB genes (P<0.05) (see appendix for details). Figure 5 ).
[0045] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. An α-pyranone derivative, characterized in that, The structural formula of the α-pyranone derivatives is as follows: 。 2. The α-pyranone derivative as described in claim 1, characterized in that, The α-pyranone derivatives were isolated and purified from the fermentation product of *Trichophyton floccosum*.
3. The method for preparing the α-pyranone derivative according to claim 1, characterized in that, The method involves fermenting *Follium coarctans* to obtain a fermentation broth; extracting the fermentation broth to obtain a crude extract; and performing chromatographic separation on the crude extract to obtain the α-pyranone derivative.
4. The method as described in claim 3, characterized in that, The fermentation culture includes: Prepare a resuscitation solid medium according to the weight ratio of water:glucose:potato:agar = 100:2:20:2, and adjust the pH to 6.5; inoculate the *Follium coarseum* onto the resuscitation solid medium and incubate at 28°C for 3 days. A liquid culture medium was prepared according to the weight ratio of water:corn starch:glucose:peptone:potassium dihydrogen phosphate:magnesium sulfate = 100:1:1:0.2:0.1:0.05, and the pH was adjusted to 6.
5. The revived *Follium coarctatiforme* was inoculated into the liquid culture medium and cultured statically at 25°C for 30 days.
5. The method as described in claim 3, characterized in that, The extraction of the fermentation broth includes: adding an equal volume of ethyl acetate to the fermentation broth and allowing it to stand for 3 days for extraction, repeating the extraction 4 times, combining the extracts and then recovering the ethyl acetate by rotary evaporation to obtain a crude extract. The chromatographic separation includes one or more of silica gel column chromatography, gel column chromatography, and semi-preparative high-performance liquid chromatography.
6. The use of the α-pyranone derivative of claim 1 in the preparation of angiogenic drugs.
7. A pro-angiogenic drug, characterized in that, The drug contains a pharmacologically effective concentration of the α-pyranone derivative of claim 1.
8. The drug as described in claim 7, characterized in that, The pharmacologically effective concentration is 5-20 μg / mL.
9. The drug as described in claim 7, characterized in that, The drug also contains a pharmaceutically acceptable carrier.
10. The medicament as claimed in claim 7, characterized in that, The dosage form of the drug is any one of tablets, capsules, or granules.