Use of abcf1 in nk / t-cell lymphoma

Abstract

This invention belongs to the field of biomedical technology and discloses the application of ABCF1 in NK / T-cell lymphoma. This invention utilizes ABCF1 in the preparation of formulations for the diagnosis and prognostic assessment of NK / T-cell lymphoma, as well as in the treatment of NK / T-cell lymphoma. The ABCF1 obtained by this invention serves as a specific biomarker for the diagnosis of NK / T-cell lymphoma (NKTCL) and also possesses prognostic predictive value. It is stable in origin, readily available, and reproducible, enabling early auxiliary diagnosis, dynamic monitoring of treatment efficacy / relapse, and prognostic stratification, providing a new direction for the clinical diagnosis and treatment of NK / T-cell lymphoma.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of ABCF1 in NK / T-cell lymphoma. Background Technology

[0002] NK / T-cell lymphoma (NKTCL) is a subtype of non-Hodgkin lymphoma characterized by extranodal involvement, high invasiveness, and a high relapse rate. Patients generally have a poor prognosis, especially in the relapsed / refractory stage where treatment options are limited and clinical outcomes are unfavorable. This disease commonly affects the nasal cavity, nasopharynx, and upper respiratory and digestive tracts, exhibiting distinct geographical and demographic distribution patterns, and is closely associated with Epstein-Barr virus (EBV) infection. Clinical diagnosis primarily relies on histopathological examination, immunophenotype, and related molecular testing; efficacy evaluation and relapse monitoring often combine imaging, hematological markers, and EBV-related indicators.

[0003] In existing technologies, the main methods used for the diagnosis or prognostic assessment of NKTCL include: histological / immunohistochemistry and molecular detection, which rely on biopsy tissue, are invasive procedures, and are difficult to repeat frequently, making them unsuitable for long-term dynamic monitoring; detection of hematological or inflammatory markers, such as LDH, β2-microglobulin, and cytokines, but general hematological and inflammatory markers lack tumor specificity, making it difficult to achieve reliable disease stratification; detection of EBV-related markers, such as plasma EBV-DNA, has reference value in certain scenarios, but EBV-related markers are affected by multiple factors and are not consistent in all patients, making it difficult to meet the needs of accurate diagnosis and prognostic prediction on their own, and they are sensitive to factors such as tumor burden and treatment intervention.

[0004] Therefore, due to the atypical early symptoms of NKTCL, the invasive nature of tumor tissue acquisition, and the potential for sampling bias, there is currently a lack of specific biomarkers that can be used for the diagnosis of NKTCL and also have prognostic predictive value. The clinical diagnosis and treatment of NKTCL urgently require stable, readily available, and repeatable body fluid biomarkers to achieve early auxiliary diagnosis, dynamic monitoring of treatment efficacy / recurrence, and prognostic stratification. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide an application of ABCF1 in NK / T cell lymphoma.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In one aspect, the present invention utilizes ABCF1 in the preparation of formulations for the diagnosis of NK / T cell lymphoma.

[0007] Secondly, the present invention applies ABCF1 in the preparation of formulations for prognostic assessment of NK / T cell lymphoma.

[0008] Thirdly, this invention uses ABCF1 as a target in the preparation of a drug for treating NK / T cell lymphoma.

[0009] In a preferred embodiment of the application described in this invention, the ABCF1 is derived from exosomes.

[0010] Exosomes are liquid biopsy carriers with clinical translational potential. Using exosomes for screening tumor-related biomarkers, diagnostic subtyping, efficacy monitoring, and prognostic assessment provides an important direction for the research and translational application of tumor biomarkers.

[0011] Preferably, a quality control assay combining exosome ABCF1 with a universal exosome marker can be used to detect NK / T-cell lymphoma.

[0012] As a further preferred embodiment of the application described in this invention, the exosomes are derived from plasma.

[0013] The method for preparing exosomes from plasma includes: Collect plasma samples; centrifuge at 4°C to transfer the supernatant to remove cells and debris; collect the eluent using a qEV separation column (qEVoriginal Gen2, IZON, ICO-70) to obtain exosome eluent; concentrate the obtained exosome eluent by ultrafiltration.

[0014] As a preferred embodiment of the application described in this invention, the expression level of ABCF1 in patients with NK / T-cell lymphoma is higher than that in healthy individuals.

[0015] As a further preferred embodiment of the application described in this invention, when the expression level of ABCF1 is higher than that of healthy individuals, the prognosis of patients with NK / T-cell lymphoma is poor.

[0016] In a preferred embodiment of the application described in this invention, the agent is used to knock down or eliminate the expression of ABCF1.

[0017] As a further preferred embodiment of the application described in this invention, the method for knocking down or knocking out the expression of ABCF1 includes gene editing using CRISPR-Cas9 technology, and silencing ABCF1 using siRNA, plasmid-mediated shRNA, or virus-mediated shRNA.

[0018] As a further preferred embodiment of the application described in this invention, the nucleotide sequence of the shRNA is: GCCTCTTGTCTCAAGACCTTT; or CCAACCAATAACTTGGACATA.

[0019] Fourthly, the present invention provides an formulation for the diagnosis or prognostic assessment of NK / T-cell lymphoma, including a reagent for detecting the expression level of ABCF1 in plasma exosomes.

[0020] The reagent includes detection primers; the nucleotide sequence of the detection primers is CTCCTAAGCACATTGCCAACC; And / or GCTTCAATCGCTTGGTGTCAGC.

[0021] Fifthly, the present invention provides an agent for the prevention and / or treatment of NK / T cell lymphoma, comprising knocking down or eliminating substances expressing ABCF1 in cells; The substance includes plasmid-mediated shRNA or virus-mediated shRNA that can silence ABCF1; the nucleotide sequence of the shRNA is: GCCTCTTGTCTCAAGACCTTT; or CCAACCAATAACTTGGACATA.

[0022] As a preferred embodiment of the formulation described in this invention, it further includes a pharmaceutically acceptable carrier.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention relates to the application of ABCF1 in NK / T-cell lymphoma, particularly the application of ABCF1 in plasma exosomes in the preparation of formulations for the diagnosis and prognostic assessment of NK / T-cell lymphoma, as well as drugs for the treatment of NK / T-cell lymphoma. This enables the differentiation of NK / T-cell lymphoma patients from healthy individuals without the need for tissue biopsy; prognostic stratification of patients (e.g., high expression indicating a poor prognosis); and dynamic monitoring and relapse risk indication during treatment.

[0024] 2. The application of this invention has the following advantages: 1) Non-invasive and easy to repeat sampling: Using plasma exosomes as the detection target, sampling can be performed at multiple time points, which is suitable for long-term follow-up and efficacy / relapse monitoring.

[0025] 2) High stability and detectability: Exosomes have a membrane structure for protection, and the proteins / nucleic acids they carry are more stable in body fluids, which is beneficial to improving the consistency and repeatability of detection.

[0026] 3) It has both diagnostic and prognostic value: ABCF1 is associated with the prognosis of NKTCL patients and can support both auxiliary diagnosis and prognostic assessment.

[0027] 4) Standardization and transferability: A combined process of exosome isolation and ABCF1 protein detection can be adopted to form clear quality control nodes (such as exosome marker and negative control marker verification), which facilitates the standardization of clinical laboratories.

[0028] 5) Wide range of applicable scenarios: It can be used in various clinical scenarios such as initial screening assistance, risk stratification, efficacy evaluation, recurrence warning, and follow-up comparison of different treatment plans. Attached Figure Description

[0029] Figure 1 Exosomes were extracted from the plasma of different patients, and the expression of different exosome markers was detected by Western blotting. Figure 2 Electron micrographs and particle size analysis of exosomes extracted from plasma from different patients; Figure 3 Venn diagram showing the intersection of upregulated genes between the NKT and HC groups and between the PD and NKT groups; Figure 4 The expression levels of DCTN4, ABCF1, and RSU1 in NKT cell lines (NK92, KHYG1, NKYS, YT) and healthy human PBMCs were detected by qRT-PCR. Figure 5 The relationship between ABCF1 expression levels and prognosis in NKTCL patients; Figure 6 Western blot validation of ABCF1 in cell-derived exosomes overexpressing ABFC1; Figure 7 To detect the effect of ABCF1 knockdown on cell proliferation using CCK8 assays; Figure 8 Comparison of immunohistochemical (IHC) expression of ABCF1 in NKTCL tissues and non-tumor tissues; Figure 9 To knock down ABCF1 and inhibit the growth of xenografts in mice. Detailed Implementation

[0030] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0031] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0032] Example 1: Preparation of plasma exosome samples Exosomes are a type of extracellular vesicle that are widely found in body fluids such as plasma, serum, urine, saliva, and cerebrospinal fluid. They are usually formed by the fusion of intracellular multivesicles with the cell membrane and then released. They have a typical lipid bilayer membrane structure and their diameter is mostly distributed in the range of about 30-200 nm.

[0033] This invention establishes a reproducible and purity-controllable plasma exosome preparation process, and identifies exosomes using three evidence chains: morphology, particle size distribution, and biomarker proteins, to ensure the reliability and comparability of subsequent proteomics and biomarker detection.

[0034] Specifically as follows: 1) Sample collection: Plasma samples were collected from 10 healthy individuals (HC group), 13 patients with NK / T-cell lymphoma (NKT group), and 14 patients with relapse / progression (PD group) and stored at -80℃.

[0035] 2) Thawing and pretreatment: After the plasma was taken out from -80℃, it was thawed in a water bath at 25℃. It was then centrifuged at 2000×g for 10 min at 4℃ and the supernatant was transferred. Then it was centrifuged at 10000×g for 30 min and the supernatant was transferred to remove cells and debris and other impurities.

[0036] 3) Exosome separation (qEVoriginal Gen2, IZON, ICO-70): Wash and equilibrate the qEV separation column with at least 10 mL of 1×PBS. After rinsing, plug the bottom cap and remove the residual PBS at the top of the sieve plate. Add 500 μL of plasma sample to the top of the sieve plate and immediately remove the bottom cap to start effluent and discard the original liquid in the column. After the sample has completely entered the top sieve plate of the column and the flow at the bottom has stopped, add 2.4 mL of PBS to the top of the sieve plate to accumulate a 2.9 mL void volume (excluding exosomes) and discard it. After replacing with a new collection tube, add 1.6 mL of PBS and immediately collect the 1.6 mL eluent after the void volume as the high-purity exosome fraction.

[0037] 4) Concentration: The obtained 1.6 mL exosome eluent was concentrated to a final volume of 150 μL by ultrafiltration using an Amicon® Ultra-4.0 mL 10K ultrafiltration tube.

[0038] 5) Multidimensional Identification and Interpretation of Exosomes: 10 μL of the concentrated exosome sample was diluted 1000-2000 times for NTA detection, 5 μL was used for TEM observation, and the remainder was used for protein extraction and Western blot detection of exosome markers. CD63, CD81, and CD9 were used as positive markers for exosomes in WB, and Calnexin was used as a negative control marker. When the positive markers were detectable and Calnexin was not detected, it indicated that the isolate met the characteristics of exosomes and had minimal organelle contamination. Combined with TEM, the typical membrane vesicles and NTA particle size distribution were concentrated within the common range of exosomes, further confirming that the prepared exosomes were of qualified quality and could be used for subsequent differential screening and marker development.

[0039] like Figure 1 As shown, exosomes were isolated and extracted from collected plasma samples, and Western blot analysis was performed to detect exosome marker proteins CD63, CD81, and CD9, as well as the negative control protein Calnexin. The results showed that CD63, CD81, and CD9 were expressed in all three exosome groups (HC, NKT, and PD), while Calnexin was not detected. This indicates that the isolated particles conform to exosome characteristics, and the prepared product has high purity and low cell contamination, making it suitable for subsequent experimental analysis.

[0040] like Figure 2 As shown, transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) were used to further characterize the exosomes isolated from the above samples. TEM results showed that particles with typical membrane vesicle structures were observed in the exosome samples from the HC, NKT, and PD groups, and their morphology was consistent with that of exosomes. NTA results showed that the particle size of the particles in each group was mainly distributed within the common range of exosomes (approximately 100 nm), and exhibited a relatively concentrated peak-shaped distribution. These results further indicate that the isolates obtained from plasma of different groups conform to the morphological and particle size characteristics of exosomes, indicating that the exosome extraction process is reliable and can be used for subsequent biomarker detection and analysis.

[0041] Example 2: Screening for differentially expressed molecules associated with disease occurrence / relapse via exosomal proteomics sequencing Proteomic sequencing and quantitative analysis were performed on the plasma exosome samples from the HC group, NKT group and PD group obtained in Example 1 to systematically screen differentially expressed molecules (differentially expressed proteins / genes) related to the occurrence and relapse / progression of NKTCL.

[0042] Plasma exosome samples underwent DIA quantitative proteomic analysis (timsTOF Pro 2 mass spectrometer, Brucker, Germany). For pairwise comparisons between groups, the normalized mean signal of all samples within each group was calculated to determine the fold change between groups. Student's T-test was used to calculate the ratio between the two groups. p -value. Proteins meeting the following two conditions are selected as differentially expressed proteins between groups: intergroup ratio |log2(Fold change)|>=1; p -value<0.05.

[0043] To improve the "disease continuity relevance" of candidate biomarkers, a strategy of "two comparisons + intersection" is adopted, as follows: 1) Compare the NKT group and the HC group to obtain a set of upregulated molecules that reflect "disease occurrence-related factors"; 2) Compare the PD group and the NKT group to obtain the set of upregulated molecules that reflect "relapse / progression-related" factors; 3) Take the intersection of the two upregulated groups and preferentially retain molecules that are elevated during the disease occurrence stage and are further maintained or elevated during the relapse / progression stage, thereby reducing false positives caused by random differences and background noise.

[0044] like Figure 3 As shown, based on proteomic results, the NKT group and HC group were first compared to obtain the set of genes significantly upregulated in the NKT group; further, the PD group and NKT group were compared to obtain the set of genes significantly upregulated in the PD group. The intersection of these two sets of upregulated genes was then used to identify common candidate genes that may be persistently elevated during disease occurrence and relapse / progression. The results showed that the NKT group had 215 upregulated genes compared to the HC group, and the PD group had 139 upregulated genes compared to the NKT group. Three genes overlapped between the two groups: ABCF1, DCTN4, and RSU1, suggesting their potential involvement in the development and progression of NKTCL. These overlapping genes were identified as candidate molecular markers for further validation and functional studies.

[0045] Example 3: qRT-PCR validation of candidate genes in an NKT-related cell model To verify the consistency of proteome screening results at the cell model level, several NKT-related cell lines (such as NK92, KHYG1, NKYS, and YT) were selected as experimental groups, while healthy human PBMCs served as the control group. The expression levels of ABCF1, DCTN4, and RSU1 were detected using qRT-PCR. The purpose of this step was twofold: firstly, to verify whether the candidate molecules possess the characteristic of "endogenous high expression in tumor-associated cells," and secondly, to provide direction for subsequent mechanistic studies and clinical interpretation.

[0046] The primer sequences used for qRT-PCR detection of the expression levels of ABCF1, DCTN4, and RSU1 are as follows: ABCF1-F: CTCCTCAAGCACATTGCCAACC; ABCF1-R:GCTTCAATCGCTTGGTGTCAGC; DCTN4-F:GGATGAAGTGGAACCTCTACCTG; DCTN4-R:GATGTTTGTGGCGAGGATAGAGC; RSU1-F: CAACATGCTGGATGTCAACGGC; RSU1-R:TCAGTTCTGCGATGTTCGGTGG.

[0047] like Figure 4 As shown, qRT-PCR was used to detect the expression levels of ABCF1, DCTN4, and RSU1 in NKT cell lines and peripheral blood mononuclear cells (PBMCs) from healthy individuals. The qRT-PCR results showed that, compared with healthy PBMCs, all three candidate genes were upregulated to varying degrees in different NKT cell lines, with ABCF1 showing the most consistent and significant increase in expression across all NKT cell lines. These results suggest that ABCF1 is highly consistent with the molecular characteristics of NKT-related cells, further supporting its selection as a preferred candidate molecule for NKTCL-related biomarkers, and warranting further clinical correlation and functional validation as a key biomarker.

[0048] Example 4: Validation of the association between ABCF1 and the prognosis of NKTCL patients After identifying ABCF1 as the preferred candidate molecule, we further evaluated the correlation between ABCF1 expression levels and the prognosis of NKTCL patients.

[0049] Plasma samples were collected from patients with NK / T-cell lymphoma and stored at -80°C. Plasma exosomes were prepared according to the method in Example 1. The expression level of ABCF1 was detected by qRT-PCR using the method in Example 3. Patients were grouped according to their ABCF1 expression levels, and Kaplan-Meier survival analysis was used to compare the survival differences between the two groups.

[0050] Subsequently, to assess the relationship between ABCF1 expression levels and the prognosis of NKTCL patients, ROC curve analysis was performed on the H-score of ABCF1 in tumor tissue, and the optimal cut-off value was determined accordingly. Based on this cut-off value, 97 NKTCL patients were classified into ABCF1-High (… n =74) and ABCF1-Low ( n =23). For example Figure 5 As shown, survival analysis results indicated that the overall survival of patients in the ABCF1-High group was significantly shorter compared to the ABCF1-Low group. P =0.032). That is, the overall survival probability of the ABCF1 high expression group was lower than that of the ABCF1 low expression group, and the difference between the two groups was statistically significant (log-rank test, p =0.032). This result indicates that the expression level of ABCF1 is closely related to patient prognosis. High expression of ABCF1 can serve as an indicator of poor prognosis in NKTCL patients and can be used to indicate the risk of relapse or progression in prognostic prediction, risk stratification, and follow-up management.

[0051] Example 5: Verification that ABCF1 can be loaded / exist in exosomes To confirm that ABCF1 is not only highly expressed in cells, but can indeed appear in exosome components, an ABCF1 overexpression model was established in YT cells (by transfecting expression vectors carrying the ABCF1-flag to form an ABCF1 overexpression group and an empty vector control group). Culture supernatants were collected and exosomes were isolated, and Western blot analysis was performed on the exosome proteins.

[0052] like Figure 6 As shown in the results, ABCF1 expression (Flag signal) was detected in exosomes of the ABCF1 overexpression group. Simultaneously, the exosome positive markers CD63 and TSG101 were positive, while the negative control marker Calnexin was not detected. This suggests that the detected signal originated from exosome components rather than organelle contamination, indicating that the obtained isolates conformed to exosome characteristics with minimal organelle contamination. These results demonstrate the presence of ABCF1 protein in exosomes, providing direct evidence for its use as an exosome-derived biomarker. Mechanistically, this supports the plausibility of "exosomal ABCF1" as a detectable entity.

[0053] Example 6: In vitro functional verification To evaluate the effect of ABCF1 on the biological behavior of tumor cells, ABCF1 knockdown models were constructed in NKYS cells and EL4 cells (using two independent shRNA sequences, denoted as shABCF1#2 and shABCF1#3, respectively), with a negative control shRNA (shCon) as a control. The OD450 value was detected at different time points by cell viability / proliferation assay (CCK-8 assay) and proliferation curves were plotted.

[0054] The nucleic acid sequences of the two shRNAs are as follows: ShAbcf1#2: GCCTCTTGTCTCAAGACCTTT; shAbcf1#3:CCAACCAATAACTTGGACATA.

[0055] like Figure 7 As shown, the test results indicated that, compared with the shCon group, the ABCF1 knockdown group exhibited decreased OD450 values ​​and slower proliferation rates in both NKYS and EL4 cells, and the differences were statistically significant. Figure 7 The above results suggest that knocking down ABCF1 can significantly reduce the proliferation levels of both cell types. ABCF1 has a promoting effect on tumor cell proliferation, and its high expression may be related to the occurrence, development, and progression of NKTCL. This is corroborated by the increasing trend of ABCF1 in patient exosomes / tissues, providing support for the biological rationale of ABCF1 as a biomarker.

[0056] Example 7: Organizational Level Validation To verify the correlation between ABCF1 and NKTCL at the histological level, immunohistochemical (IHC) detection was performed on NKTCL tumor tissue and corresponding rhinitis tissue to assess the expression level of ABCF1 protein.

[0057] like Figure 8 As shown in the results, compared with non-tumor tissues, ABCF1 staining signal was significantly enhanced in NKTCL tissues, with an increased proportion of positive cells and / or increased staining intensity, indicating that ABCF1 is highly expressed in NKTCL tissues. This histological evidence further supports the close relationship between ABCF1 and the occurrence and development of NKTCL, and provides a basis for using exosome ABCF1 as a diagnostic and / or prognostic biomarker for NKTCL.

[0058] Example 8: In vivo functional verification To further validate the effect of ABCF1 on tumor growth in vivo, a mouse subcutaneous xenograft model was established using EL4-stable knockdown cells (shABCF1#2 and shABCF1#3) and their negative control cells (shCon) established in Example 6. Specifically, 4-5 week old female C57 mice were subcutaneously inoculated with 1×10⁻⁶ cells. 6 EL4 cells of shCon, shABCF1#2, or shABCF1#3 were used. After tumor formation, tumor volume was measured periodically and growth curves were plotted. At the experimental endpoint, the tumors were dissected and weighed for comparison.

[0059] like Figure 9 As shown in the results, compared with the shCon group, the tumor volume growth of the shABCF1#2 and shABCF1#3 groups was significantly slowed down, and the final tumor weight was significantly reduced, indicating that knocking down ABCF1 can significantly reduce the rate of tumor volume growth and the final tumor weight. Mouse model experiments showed that ABCF1 participates in the tumor growth process in vivo, and knocking down ABCF1 can significantly inhibit tumor proliferation and growth. Consistent in vitro and in vivo functional evidence further supports the association between ABCF1 and the occurrence, development, and progression of NKTCL, and also provides experimental evidence for its potential intervention target.

[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. Application of ABCF1 in the preparation of formulations for the diagnosis of NK / T cell lymphoma.

2. Application of ABCF1 in the preparation of formulations for prognostic assessment of NK / T-cell lymphoma.

3. Application of ABCF1 as a target in the preparation of drugs for the treatment of NK / T cell lymphoma.

4. The application according to any one of claims 1-3, characterized in that, The ABCF1 is derived from exosomes.

5. The application according to claim 4, characterized in that, The exosomes are derived from blood plasma.

6. The application according to claim 1, characterized in that, The expression level of ABCF1 in patients with NK / T-cell lymphoma is higher than that in healthy individuals.

7. The application according to claim 3, characterized in that, The drug is used to knock down or eliminate the expression of ABCF1.

8. The application according to claim 7, characterized in that, The method for knocking down or knocking out ABCF1 expression includes gene editing using CRISPR-Cas9 technology, and silencing ABCF1 using siRNA, plasmid-mediated shRNA, or virus-mediated shRNA.

9. The application according to claim 8, characterized in that, The nucleotide sequence of the shRNA is: GCCTCTTGTCTCAAGACCTTT; or CCAACCAATAACTTGGACATA.

10. A formulation for the diagnosis or prognostic assessment of NK / T-cell lymphoma, characterized in that, The reagent includes a reagent for detecting the expression level of ABCF1 in plasma exosomes; the reagent includes detection primers; the nucleotide sequence of the detection primers is CTCCTAAGCACATTGCCAACC; And / or GCTTCAATCGCTTGGTGTCAGC.

11. An agent for the prevention and / or treatment of NK / T-cell lymphoma, characterized in that, This includes substances that knock down or eliminate ABCF1 expression in cells; said substances include plasmid-mediated shRNA or virus-mediated shRNA that can silence ABCF1; the nucleotide sequence of said shRNA is: GCCTCTTGTCTCAAGACCTTT; Or CCAACCAATAACTTGGACATA.

12. The formulation according to claim 11, characterized in that, It also includes pharmaceutically acceptable carriers.

Images