A parms molecular marker closely linked to soluble sugar and sucrose content of peanut kernel and application thereof
By developing PARMS molecular markers closely linked to the soluble sugar and sucrose content of peanut kernels, and using specific and universal primers for quantitative real-time PCR amplification, the high-cost screening problem of sucrose content traits in peanut varieties was solved, enabling early prediction and efficient screening.
Patent Information
- Application Number
- CN202610820983.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-09
- Publication Date
- 2026-07-10
AI Technical Summary
Existing technologies are insufficient to effectively locate and utilize significant associated variation sites related to sucrose content in peanut kernels, resulting in high costs and low efficiency in screening and detecting sucrose content traits in peanut varieties.
A PARMS molecular marker closely linked to the soluble sugar and sucrose content of peanut kernels was developed. Quantitative real-time PCR amplification was performed using specific primers Chr09-110014731Fc and Chr09-110014731Fa, and the universal primer Chr09-110014731R. Genotyping was then performed using FAM and HEX fluorescent probe tags, enabling rapid and low-cost detection of sucrose content.
This method enables early prediction and efficient screening of sucrose content in peanut kernels, reducing breeding costs and workload while improving screening efficiency.
Smart Images

Figure CN122357787A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic breeding and molecular biology, and more specifically, to a PARMS molecular marker closely linked to the soluble sugar and sucrose content of peanut kernels and its application. Background Technology
[0002] Peanuts are rich in fat (44.27%-53.86%) and protein (23.94%-36.35%), as well as a large amount of carbohydrates (9.89%-23.62%) and bioactive compounds such as sterols and choline. In recent years, the peanut food processing industry has developed rapidly, leading to an increase in the production and consumption of fresh peanuts, especially to meet the demand for higher sweetness. Sweetness has become a crucial factor influencing the flavor of peanuts. The sucrose content of peanut kernels is typically 2%-8%, and a noticeable sweetness is achieved when the content exceeds 5%. Therefore, sucrose content has become an important selection criterion for the breeding of fresh peanuts.
[0003] Peanut kernels contain various sugars, including sucrose, glucose, fructose, raffinose, and stachyose. Although existing techniques such as BSA-seq, QTL-seq, and genome-wide association analysis have identified different major-effect QTLs, the chromosomal locations of QTLs in different populations differ, reflecting the complexity of the sucrose accumulation regulatory network. Therefore, this invention aims to identify significant associated variant sites related to peanut sucrose content, develop relevant molecular markers and detection methods, and provide a basis for locating genes related to peanut sucrose content traits and for molecular-assisted breeding. Summary of the Invention
[0004] To address the shortcomings of existing technologies, the present invention aims to provide a PARMS molecular marker closely linked to the soluble sugar and sucrose content of peanut kernels and its application.
[0005] This invention provides the following technical solution: a PARMS molecular marker closely linked to the soluble sugar and sucrose content of peanut kernels, wherein the marker site is located at Arahy.09:110014731 in the peanut genome version arahy.Tifrunner.gnm1, and the base polymorphism of this site is A or C; the PARMS molecular marker primers include a specific primer Chr09-110014731Fc with the nucleotide sequence shown in SEQ ID NO.1, a specific primer Chr09-110014731Fa with the nucleotide sequence shown in SEQ ID NO.2, and a universal primer Chr09-110014731R with the nucleotide sequence shown in SEQ ID NO.3.
[0006] The present invention also provides a reagent or kit comprising the above-described PARMS molecular marker primers.
[0007] This invention also provides applications of the above primers, reagents containing primers, or kits, including but not limited to:
[0008] (1) Screening or identifying phenotypes related to peanut soluble sugar and / or sucrose content;
[0009] (2) Identification, improvement or molecular marker-assisted breeding of peanut germplasm resources;
[0010] (3) Genotyping of peanuts with significantly correlated soluble sugar and / or sucrose content;
[0011] (4) Early prediction of peanut soluble sugar and / or sucrose content.
[0012] The present invention also provides a method for identifying the phenotypic traits of soluble sugar and / or sucrose content in peanuts, comprising: attaching a FAM fluorescent probe tag to the 5' end of the above-mentioned Chr09-110014731Fc, the nucleotide sequence of which is shown in SEQ ID NO.4; attaching a HEX fluorescent probe tag to the 5' end of Chr09-110014731Fa, the nucleotide sequence of which is shown in SEQ ID NO.5; using the genomic DNA of the peanut to be tested as a template, performing real-time PCR amplification using the PARMS molecular marker primers, then scanning the fluorescence signal of the amplification product, and genotyping the peanut material to be tested based on the fluorescence signal.
[0013] In summary, the present invention has the following beneficial effects: The PARMS molecular marker primers and judgment method closely linked to the soluble sugar and sucrose content of peanuts provided by the present invention are simple, low-cost, and have stable judgment criteria compared with conventional chemical detection methods for detecting soluble sugar and sucrose content, which are costly and require large sample sizes. It can be used for early genotyping of peanuts, reducing breeding costs and workload, and improving screening efficiency. Attached Figure Description
[0014] Figure 1 This is a histogram of the frequency of soluble sugar and sucrose phenotypic traits in peanut samples of the present invention, wherein SSC represents soluble sugar and SC represents sucrose;
[0015] Figure 2 These are the Manhattan plot and QQ plot of the correlation analysis of soluble sugar and sucrose traits in Example 3, where SSC represents soluble sugar and SC represents sucrose.
[0016] Figure 3This is the Manhattan partial diagram and SNP linkage disequilibrium analysis diagram of Embodiment 3 of the present invention;
[0017] Figure 4 This is a statistical analysis of differentially expressed (including upregulated and downregulated) genes in candidate gene regions during the four developmental stages of peanut kernels in Example 3 of the present invention.
[0018] Figure 5 This is a gene expression analysis diagram of the gene region containing the tightly linked marker sites for soluble sugar and sucrose content in peanut kernels in Example 3 of the present invention;
[0019] Figure 6 The results of genotyping of soluble sugar and sucrose significant loci in peanut kernels according to Embodiment 3 of the present invention are as follows: (a) is the genotyping of SNPs, with the horizontal axis representing genotype and the vertical axis representing phenotypic value; (b) is the PARMS genotyping, with green dots representing HEX signals, blue dots representing FAM signals, and gray dots representing negative controls and uncertain samples; (c) is the accordion plot of population SNP genotyping. Detailed Implementation
[0020] The present invention will be further described in detail below with reference to the embodiments.
[0021] Unless otherwise specified, all reagents or materials used in the following examples are commercially available.
[0022] This invention groups 2741 local peanut varieties based on planting zoning and botanical typology, and uses the square root method to determine the sampling size. Within each group, UPGMA cluster analysis is performed using 13 phenotypic data, followed by intra-cluster random sampling, ultimately constructing the local variety population described in Example 1. Therefore, the local variety population exhibits a high level of genetic diversity.
[0023] The phenotypic data for sucrose content were obtained from a near-infrared quantitative analysis model. After internal cross-validation and optimization, the optimal spectral preprocessing method for this model was determined to be the minimum-maximum normalization method, with a sucrose content spectral range of 4597.7–11988.0 cm⁻¹. -1 With a dimension of 10, the model has a coefficient of determination of 81.59 and a root mean square error of 0.414. This model can predict the sucrose and soluble sugar content of peanut kernels relatively well.
[0024] Example 1: Peanut Sample Trait Analysis
[0025] The materials used in this embodiment cover 155 representative local varieties and 28 improved varieties from major producing areas in China. All materials were planted at three experimental bases in Laixi, Dongying, and Heze. The planting conditions were: ridge length 3.00 m, ridge width 0.85 m, and 36-40 plants per ridge.
[0026] After harvest, five plants were harvested from each row, and mature seeds were collected. The sucrose (SC) and soluble sugar (SSC) content were determined using a near-infrared spectrometer (Spectra Star XL, Unity, USA).
[0027] Table 1 below shows representative varieties with low and high sucrose content, providing research materials for the subsequent verification of sucrose-related molecular markers in peanut kernels using the markers of this invention.
[0028] Table 1. Results of sucrose content determination in different peanut varieties
[0029] Best Linear Unbiased Prediction (BLUP) was used to analyze and evaluate phenotypic data under three environments to reduce the adverse impact of environmental factors on the association analysis results. The analysis results were then used as phenotypic data for subsequent GWAS analysis.
[0030] Generate phenotypic frequency distribution plots using functions in the R package ggplot2, such as... Figure 1 As shown. From Figure 1 It can be seen that, according to the BLUP values, all traits conform to the normal distribution law, and there is no obvious skewness or kurtosis anomaly. The traits are controlled by multiple genes and have a uniform genetic background, with rich genetic variation. Moreover, the distribution is wide, the differences between individuals are huge, and the selection potential is large. Combined with the high-quality SNP data obtained by whole genome resequencing, the significant association region of the target trait can be anchored by GWAS.
[0031] The broad heritability of soluble sugars and sucrose (H 2 The coefficients were 0.81 and 0.86, respectively, indicating that the two traits have major genes and are highly controlled by genes. Correlation analysis revealed that the correlation coefficient between soluble sugar content and sucrose content was 0.91, showing a highly significant positive correlation.
[0032] Example 2 Whole genome resequencing
[0033] DNA was extracted from one-month-old fresh leaves of the local peanut variety described in Example 1 using a plant genomic DNA extraction kit. The purity and concentration of the DNA were determined using NanoDrop and Qubit, respectively. After random fragmentation, approximately 500 bp fragments were recovered by electrophoresis, ligated with adapters, and then subjected to cluster preparation. High-throughput sequencing of the insert fragments was performed using paired-end sequencing. Sequencing quality was assessed using the Q30 standard, and the raw data was filtered using FASTX-Toolkit software: paired reads containing adapters were removed; paired reads with an N base content exceeding 10% of the read length were removed; and paired reads with a low-quality base ratio (Q≤5) exceeding 50% in the single-end sequence were removed. Resequencing coverage of at least 20× was ensured for each individual.
[0034] Using the whole genome sequence of cultivated peanut (https: / / www.peanutbase.org / ) as a reference genome, the filtered reads were aligned and genetic variations were detected using the BWA and SAMTOOLS software packages. SNP filtering criteria included: deletion rate ≤20%; minimum allele frequency (MAF) >5%; and coverage depth between 5× and 50×.
[0035] At the population level, the types of genetic variations (SNPs) among individuals are obtained, which can be combined with the phenotypic data obtained in Example 1 to perform genome-wide association analysis.
[0036] Example 3 Genome-wide association analysis
[0037] The population structure Q-value was calculated using STRUCTURE 2.3.3 software, and the kinship coefficient between individuals was estimated using SPAGeDi software. The convergence criterion was set to 10. -5 The maximum number of iterations was 10,000. GWAS employed the Optimized Compressed Mixed Linear Model (ECMLM) in TASSEL 5 software to screen for significantly associated SNP sites (significance threshold set to p < 10). -5 To control for false positives from multiple testing, the Bonferroni correction method was used for statistical adjustment.
[0038] like Figure 2 As shown, the Manhattan plot on the left displays significant SNPs associated with the soluble sugar and sucrose content traits of peanut kernels. The blue and red horizontal lines represent -log 10 (p) > 5 and -log 10 The significance level was greater than 7 (p). In the figure, "SSC" represents soluble sugar content, and "SC" represents sucrose content. From Figure 2The left figure shows that the significantly associated SNP clusters were located on chromosomes 9, 19, and 20. The right figure is a QQ plot, illustrating that the mixed linear model (MLM) used in this study is suitable for this analysis.
[0039] Figure 3 This section provides a detailed view of SNP associations in magnified views of trait SSC / SC on chromosomes Arahy.09, Arahy.19, and Arahy.20. Red dots represent SNPs significantly associated with trait SC. Figure 3 It can be seen that there are three SNP gene regions that are significantly associated with the trait, which can be used to screen candidate gene loci; Figure 3 The linkage disequilibrium heatmaps show the linkage disequilibrium of three significant SNP clusters in Arahy.09: 109.531–110.512 Mb, Arahy.19: 154.642–155.628 Mb, and Arahy.20: 142.593–143.577 Mb, respectively.
[0040] Three genomic regions associated with SC / SSC were identified in Arahy.09, Arahy.19, and Arahy.20. These regions contained 58, 391, and 403 genes, respectively. GO analysis showed that these genes were mainly involved in molecular functions related to xylanase activity and diamine oxidase activity. Furthermore, these genes were significantly enriched (p<0.001) in two KEGG pathways: the phenylalanine metabolism pathway and the isoquinoline alkaloid synthesis pathway.
[0041] Using RNA-seq technology, considering differentially expressed genes across four developmental stages and combining this with gene regions identified through genome-wide association analysis, RNA sequencing results revealed a total of 317 differentially expressed genes between the two varieties with extremely high sucrose content. GO analysis found that these genes are mostly related to molecular binding and catalytic functions, and are significantly enriched in pathways related to the biosynthesis of phenylpropanoids and secondary metabolites. Figure 4 Notably, 50.30% of these differentially expressed candidate genes are located on Arahy.09 (as shown in Table 2). Furthermore, 13 of the 19 Hub genes identified in the weighted co-expression network analysis (WGCNA) are located on Arahy.09. Therefore, we developed a diagnostic marker located on this chromosome that is closely associated with SC and SSC, namely Arahy.09_110014731.
[0042] Table 2. Candidate genes differentially expressed at four developmental stages of peanut kernels.
[0043] Example 4: Validation of differential expression by qRT-PCR
[0044] Six peanut germplasms with extreme traits (high sucrose / soluble sugar content individuals: cc82: 6.94%; HT: 7.08%; JHT1: 7.23%; low sucrose / soluble sugar content individuals: cc111: 2.18%; cc115: 2.32%; cc142: 2.56%) were selected. Samples from each germplasm were collected from four developmental stages of peanut kernels: Phase I to Phase IV (S1-S4), corresponding to the R6-R9 stages defined by Boote (1982). Three replicates were performed for each sample. Total RNA was extracted using the EASY spin plant RNA kit (Ailab, Beijing, China). All samples were treated with DNase I (Takara, China), and RNA concentration was determined using a Thermo Nanodrop 2000. cDNA was synthesized using M-MLV reverse transcriptase, and qRT-PCR was performed using the BYBR Premix Ex Taq kit (Takara) on a Step One system (Applied Biosystems).
[0045] pass The method calculates the relative expression level of each gene, and standardizes gene expression levels based on a reference gene (actin).
[0046] Table 3. Primer sequences for gene amplification
[0047] The qRT-PCR reaction conditions were as follows: first, an initial denaturation step was performed at 95℃ for 10 minutes, followed by 40 cycles, each cycle consisting of 95℃ for 15 seconds and 60℃ for 30 seconds.
[0048] The qRT-PCR reaction system is shown in Table 4:
[0049] Table 4 qRT-PCR reaction system
[0050] The changes in gene expression levels detected by qRT-PCR were highly consistent with the transcriptome analysis results of peanut kernels at four developmental stages. Figure 5 ).
[0051] Example 5: Development of Molecular Diagnostic Markers Related to Sucrose and Soluble Sugar Content in Peanut Kernels Based on the PARMS Typing Platform
[0052] PARMS molecular marker primers were designed, and their sequences are shown in Table 5 below. Genotyping was performed on the significantly associated SNP loci. Based on the genotyping results of each SNP locus, the phenotypic data related to sucrose and soluble sugars were grouped, and statistical analysis was performed using Student's t-test or Mann-Whitney U test. The results are shown in [Table 5]. Figure 6 .
[0053] Table 5 PARMS molecular marker primer sequences
[0054] FAM fluorescent probe: GAGGTGACCAAGTTCATGCT (SEQ ID NO.4)
[0055] HEX fluorescent probe: GAAGGTCGGAGTCAACGGATT (SEQ ID NO.5)
[0056] Figure 6 In the diagram, (a) shows the SNP genotyping, with the horizontal axis representing the genotype and the vertical axis representing the phenotypic value; (b) shows the PARMS genotyping, with green dots representing HEX signals, blue dots representing FAM signals, and gray dots representing negative controls and uncertain samples; and (c) shows the accordion plot of the population SNP genotyping.
[0057] The significance of the sucrose measurement values of the two sets of signals (students' t test) was statistically analyzed to confirm whether it could be used as a molecular marker to identify sucrose content. Figure 6 It can be seen that this locus is closely linked to the soluble sugar and sucrose content of peanut kernels. Furthermore, individuals with CC at this locus represent individuals with high sucrose content, while those with AA represent individuals with low sucrose content.
[0058] This invention develops a novel molecular marker locus, Arahy.09: 110014731, which is closely linked to the soluble sugar and sucrose content of peanut kernels. This locus is located in the co-localization region of the two traits. The designed PARMS molecular marker primers for this locus can determine the levels of soluble sugar and sucrose content, and can be used for early genotypic identification of peanut breeding, reducing breeding costs and workload.
[0059] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.
Claims
1. A PARMS molecular marker closely linked to the soluble sugar and sucrose content of peanut kernels, characterized in that, The marker site is located at Arahy.09:110014731 in the peanut genome version arahy.Tifrunner.gnm1, and the base polymorphism of this site is A or C; the PARMS molecular marker primers include the specific primer Chr09-110014731Fc with the nucleotide sequence shown in SEQ ID NO.1, the specific primer Chr09-110014731Fa with the nucleotide sequence shown in SEQ ID NO.2, and the universal primer Chr09-110014731R with the nucleotide sequence shown in SEQ ID NO.
3.
2. A reagent or kit, characterized in that, The reagent or kit includes the PARMS molecular marker primers as described in claim 1.
3. The application of the PARMS molecular marker primers as described in claim 1 or the reagents or kits as described in claim 2, characterized in that, Including but not limited to: (1) Screening or identifying phenotypes related to peanut soluble sugar and / or sucrose content; (2) Identification, improvement or molecular marker-assisted breeding of peanut germplasm resources; (3) Genotyping of peanuts with significantly correlated soluble sugar and / or sucrose content; (4) Early prediction of peanut soluble sugar and / or sucrose content.
4. A method for identifying the phenotypic traits of soluble sugar and / or sucrose content in peanuts, characterized in that, A FAM fluorescent probe tag is attached to the 5' end of Chr09-110014731Fc as described in claim 1, and its nucleotide sequence is shown in SEQ ID NO.4; a HEX fluorescent probe tag is attached to the 5' end of Chr09-110014731Fa, and its nucleotide sequence is shown in SEQ ID NO.5; using the genomic DNA of the peanut to be tested as a template, the PARMS molecular marker primers are used for real-time PCR amplification, and the fluorescence signal of the amplification product is scanned. Genotyping of the peanut material to be tested is performed based on the fluorescence signal.