Use of finerenone for the preparation of a medicament for the treatment of hypertensive renal damage

By elucidating the mechanism of hypertensive kidney injury driven by aldosterone/MR signaling, fenelazol targets and inhibits the PANX1/extracellular ATP/P2X7 signaling axis, blocking renal inflammation and fibrosis, thus resolving the unclear molecular mechanism of hypertensive kidney injury and providing a new treatment strategy.

CN122376590APending Publication Date: 2026-07-14RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Filing Date
2026-04-24
Publication Date
2026-07-14

AI Technical Summary

Technical Problem

Current technologies have not fully elucidated the molecular mechanisms by which aldosterone/MR signaling drives hypertensive kidney injury. The target and regulatory pathways of fenelazol in hypertensive kidney injury are unclear, and there is a lack of effective prevention and treatment strategies.

Method used

Using a hypertensive mouse model induced by deoxycorticosterone acetate-salt and a primary mouse renal tubular epithelial cell-bone marrow-derived macrophage co-culture model, this study revealed that aldosterone promotes intercellular communication by facilitating PANX1-dependent ATP release within renal tubular epithelial cells, activating macrophage P2X7, and activating NLRP3-mediated macrophage pyroptosis, thereby exacerbating renal inflammation and fibrosis. Fennellone targets and inhibits the PANX1/extracellular ATP/P2X7 signaling axis, blocking renal inflammation and fibrosis.

Benefits of technology

It significantly reduces hypertensive kidney injury by inhibiting the opening of PANX1 channels in renal tubular epithelial cells, reducing extracellular ATP release, blocking the activation of P2X7/NLRP3 inflammasomes, and alleviating renal interstitial inflammation and fibrosis, providing a new therapeutic target and intervention strategy for hypertensive kidney injury.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122376590A_ABST
    Figure CN122376590A_ABST
Patent Text Reader

Abstract

The present disclosure belongs to the technical field of biological medicine, and particularly relates to the application of finerenone in the preparation of a drug for treating hypertensive renal injury. The present disclosure provides the application of finerenone in the preparation of a drug for preventing and / or treating hypertensive renal injury, specifically, by using a deoxycorticosterone acetate-salt-induced hypertensive mouse model and a primary mouse renal tubular epithelial cell-bone marrow-derived macrophage co-culture model, it is first revealed that aldosterone and salt corticosteroid receptor signals mediate cell-to-cell communication by promoting PANX1-dependent ATP release in renal tubular epithelial cells, and then activate macrophage P2X7, activate NLRP3-mediated macrophage pyroptosis, and aggravate the molecular mechanism of aldosterone-driven renal inflammation and fibrosis. The present disclosure also provides the application of a substance targeting a PANX1 / extracellular ATP / P2X7 signal axis in the preparation of a drug for preventing and / or treating hypertensive renal injury.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure belongs to the field of biomedical technology, and specifically relates to the application of fenelazol in the preparation of drugs for the treatment of hypertension and kidney injury. Background Technology

[0002] The prevalence of hypertension among the global adult population has exceeded 30%, making it one of the most prevalent diseases threatening human health internationally. The resulting target organ damage to the kidneys is a significant cause of chronic kidney disease (CKD) and end-stage renal disease. Numerous studies have confirmed the role of the renin-angiotensin-aldosterone system. Overactivation of the α-aldosterone system (RAAS), especially abnormally elevated aldosterone levels, is a key risk factor for the progression of hypertension to kidney damage. Aldosterone mediates water and sodium retention and elevated blood pressure by binding to and activating the mineralocorticoid receptor (MR), and induces renal oxidative stress, inflammatory responses, and interstitial fibrosis, ultimately leading to a continuous deterioration of renal function.

[0003] Renal tubular epithelial cells (TECs) are the most abundant cell type expressing MR signals in the kidney and are the core target cells in aldosterone / MR signaling-mediated kidney injury. Damaged TECs can release various signaling molecules and engage in close intercellular communication with renal interstitial macrophages (RIMs), driving amplified inflammation and tissue damage. However, the specific molecular mechanisms by which aldosterone / MR signaling regulates communication between TECs and macrophages are not yet fully elucidated.

[0004] Extracellular adenosine triphosphate (eATP), as an important damage-associated molecular pattern (DAMP), plays a crucial role in tissue damage and inflammation regulation. Pannexin 1 (PANX1) is the main channel protein mediating the release of intracellular ATP into the extracellular space. The released eATP can activate the P2X7 receptor on the surface of macrophages, further activating the NOD-like receptor thermal protein domain associated protein 3 (NLRP3) inflammasome, inducing pyroptosis and the inflammatory cascade.

[0005] Finerenone is a highly selective nonsteroidal mineralocorticoid receptor antagonist (NSAID) that has been shown to have a clear nephroprotective effect in diabetic nephropathy. However, unlike traditional steroidal MRAs, which have established clear indications and mature treatment regimens in various disease areas such as heart failure, cirrhotic ascites, and primary aldosteronism, the clinical application of finerenone is currently relatively limited. It is only approved for the treatment of type 2 diabetes-related chronic kidney disease and heart failure. Its application in other disease areas lacks sufficient clinical research support and is still under investigation. More importantly, the specific molecular mechanism by which finerenone exerts its nephroprotective effect has not been systematically elucidated and verified. Currently, only a few studies have made preliminary explorations into its anti-oxidative stress effects and related molecular mechanisms, while its signal regulation mechanisms in anti-inflammatory and anti-fibrotic aspects still need to be further investigated.

[0006] Therefore, there is an urgent need in this field to elucidate a novel mechanism by which aldosterone / MR signaling drives hypertensive kidney injury, and to clarify the target and regulatory pathways of fenelazol in this process, so as to provide new theoretical basis and intervention strategies for the prevention and treatment of hypertensive kidney injury. Summary of the Invention

[0007] The purpose of this disclosure is to provide the application of fenelone in the preparation of drugs for the prevention and / or treatment of hypertensive kidney injury. Specifically, using a deoxycorticosterone (DOCA)-salt-induced hypertensive mouse model and a primary mouse renal tubular epithelial cell (mTECs)-bone marrow-derived macrophage (BMDMs) co-culture model, the molecular mechanism by which aldosterone and mineralocorticoid receptor signaling mediate intercellular communication by promoting PANX1-dependent ATP release in renal tubular epithelial cells, thereby activating macrophage P2X7, activating NLRP3-mediated macrophage (BMDM) pyroptosis, and exacerbating aldosterone-driven renal inflammation and fibrosis is revealed for the first time.

[0008] The objective of this disclosure is achieved through the following technical solution: In a first aspect of this disclosure, the present disclosure provides the use of fenelone in the preparation of a medicament for the prevention and / or treatment of hypertensive kidney injury.

[0009] In some specific embodiments of this disclosure, the hypertensive nephropathy is aldosterone-dependent hypertensive nephropathy or DOCA-inducing hypertensive nephropathy.

[0010] In some specific embodiments of this disclosure, fenelazine targets and inhibits the activation of the PANX1 / extracellular ATP / P2X7 signaling axis in renal tissue; furthermore, fenelazine can inhibit the expression and / or activation of PANX1 in renal tubular epithelial cells, reduce extracellular ATP levels, thereby inhibiting the activation of macrophage P2X7-NLRP3 inflammasomes and pyroptosis, alleviating renal inflammation, and thus treating and / or improving hypertensive nephropathy.

[0011] In some specific embodiments of this disclosure, the drug has at least one of the following functions: (1) inhibiting the transcriptional activation of PANX1 by blocking the mineralocorticoid receptor MR; (2) inhibiting the cleavage activation and channel opening of PANX1 protein, reducing the release of ATP from renal tubular epithelial cells; (3) inhibiting the expression and / or activation of PANX1, inhibiting the activation of extracellular ATP / P2X7 signaling in renal tissue, and reducing the level of extracellular ATP; (4) inhibiting the activation of NLRP3 inflammasomes in renal tissue, reducing renal cell pyroptosis, macrophage inflammation and renal tubular interstitial fibrosis; (5) reducing the infiltration of renal interstitial macrophages, reducing the number of P2X7 positive macrophages, and inhibiting macrophage M1 polarization; (6) reducing the level of urinary albumin, reducing renal tubular damage, and having no significant adverse effects on blood pressure.

[0012] In a second aspect of this disclosure, the disclosure provides the use of a substance targeting the PANX1 / extracellular ATP / P2X7 signaling axis in the preparation of a medicament for the prevention and / or treatment of hypertensive kidney injury.

[0013] In some embodiments of this disclosure, the substance is selected from at least one of: PANX1 inhibitor, ATP hydrolase, P2X7 receptor antagonist, renal tubule-specific PANX1 shRNA, and reagents that inhibit MR expression or activity; further, the PANX1 inhibitor is probenecid, the ATP hydrolase is apyrase, and the P2X7 receptor antagonist is AZ10606120.

[0014] In a third aspect of this disclosure, an intercellular communication regulation mechanism for hypertensive kidney injury is provided, comprising: direct transcriptional activation of PANX1 in renal tubular epithelial cells by aldosterone / MR signaling, promoting the release of ATP into the extracellular space; extracellular ATP activating the NLRP3 inflammasome in renal interstitial macrophages via the P2X7 receptor, inducing macrophage pyroptosis, migration, and pro-inflammatory responses; furthermore, blocking the PANX1 / extracellular ATP / P2X7 signaling axis can significantly inhibit renal interstitial fibrosis, reduce the release of pro-inflammatory factors, and improve renal structure and function.

[0015] In some specific embodiments of this disclosure, knocking down or inhibiting MR or PANX1 in renal tubular epithelial cells can block aldosterone-induced macrophage pyroptosis and migration.

[0016] In some specific embodiments of this disclosure, the intercellular communication occurs between renal tubular epithelial cells and bone marrow-derived macrophages.

[0017] In a fourth aspect of this disclosure, a pharmaceutical composition for treating hypertensive kidney injury is provided, the pharmaceutical composition comprising fenelone and pharmaceutically acceptable excipients, the pharmaceutical composition being able to target and inhibit the PANX1 / extracellular ATP / P2X7 signaling axis and reduce kidney inflammation and fibrosis.

[0018] The technical solution provided in this disclosure has the following technical contributions: (1) This disclosure is the first to demonstrate that fenelitonee can reduce extracellular ATP release by inhibiting the opening of PANX1 channels and PANX1 transcription in renal tubular epithelial cells, thereby blocking the activation of downstream P2X7 / NLRP3 inflammasomes, significantly reducing macrophage pyroptosis, renal interstitial inflammation and fibrosis, providing a new therapeutic target and intervention strategy for hypertensive kidney injury.

[0019] (2) This disclosure uses the mTECs-BMDMs co-culture system to clarify the key pathway of renal tubular epithelial cells mediating macrophage infiltration and activation through ATP signaling, reveal the molecular basis of intercellular communication in the renal injury microenvironment, and improve the inflammation-fibrosis mechanism of hypertensive nephropathy.

[0020] (3) This study shows that fenelitone has multiple effects such as inhibiting inflammasomes, reducing macrophage infiltration and reducing collagen deposition. It not only supports its expanded application in chronic kidney disease, but also provides a reliable experimental model and evaluation system for the development of novel renal protective drugs targeting PANX1 / extracellular ATP / P2X7.

[0021] (4) The technical effects of this disclosure have been fully verified by in vitro cell experiments and authoritative in vivo animal models. Combined with the existing clinical basis of fenelone, those skilled in the art can implement this disclosure without conducting human clinical trials and reasonably expect its therapeutic effects in humans. Attached Figure Description

[0022] Figure 1This study investigated the effect of different doses of feneritonema on systolic blood pressure in DOCA-salt treated mice. Sham: sham-operated group; DOCA-salt: DOCA-salt-induced hypertension model group; Vehicle: solvent control group (administered an equal volume of solvent); 3 mg / kg Fine: feneritonema 3 mg / kg intervention group; 10 mg / kg Fine: feneritonema 10 mg / kg intervention group; n = 6-7; nsp>0.05, ***p<0.001.

[0023] Figure 2 The effect of fenelazol on urinary protein excretion in DOCA-treated mice. Fine: fenelazol intervention group (3 mg / kg); n = 7; **p<0.01.

[0024] Figure 3 The effect of fenelazol on the pathological changes in DOCA-induced mouse kidney tissue. Figure 3 A represents representative images of H&E staining of paraffin sections of mouse kidney tissue from each group and statistical data on renal tubular injury scores. Magnification: 200×, scale bar: 200µm. Figure 3 B represents representative images of Sirius red stained paraffin sections of mouse kidney tissue from each group, along with quantitative statistics on collagen deposition. Magnification: 200×, scale bar: 200µm; n = 5; *p<0.05, **p<0.01, ***p<0.001.

[0025] Figure 4 Fenone reduced DOCA-induced renal tissue inflammation and fibrosis factor expression. Fn, fibronectin; Vim, vimentin; Ccl2, monocyte chemoattractant protein 1; Il6, interleukin-6; β-actin (Actb) was used as an internal control, n = 6; *p<0.05, **p<0.01, ***p<0.001.

[0026] Figure 5 Fenone reduces DOCA-induced macrophage infiltration in renal tissue. The left side shows representative F4 / 80 immunohistochemical staining images of paraffin sections of mouse kidney tissue from each group, original magnification: 200x, scale bar: 200µm; the right side shows the quantitative statistical results of the F4 / 80 positive area in the kidney tissue of each group of mice; n = 4; **p<0.01, ***p<0.001.

[0027] Figure 6 It is fenestrone that reduces DOCA-induced elevation of urinary ATP levels in mice. n = 7; **p<0.01, ***p<0.001.

[0028] Figure 7The effects of DOCA-salt treatment and fenelone intervention on the mRNA expression level of the ATP release channel (Gja1 / PANX1) in mouse kidney tissue were investigated. Figure 7 A represents the effect of DOCA-salt treatment on Gja1 mRNA in mouse kidney tissue; Figure 7 B represents the effect of DOCA-salt treatment and fenelazol intervention on PANX1 mRNA in mouse kidney tissue, with Actb as an internal control; n = 7; nsp>0.05, *p<0.05, **p<0.01.

[0029] Figure 8 This study analyzed the correlation between the expression level of the renal tubular interstitial ATP release channel (Gja1 / PANX1) and renal function indicators in hypertensive patients. Figure 8 A represents the expression levels of Gja1 and PANX1 in the renal tubules and interstitium of healthy controls and hypertensive patients; Figure 8 B is a correlation analysis between the expression level of Gja1 / PANX1 in the renal tubules and interstitium and the serum creatinine (mg / dl) level; the healthy control group n = 31 and the hypertension group n = 20.

[0030] Figure 9 This study investigated the inhibition of DOCA-induced PANX1 expression and activation in the renal cortex of mice by fenestrone. Representative images and grayscale analysis of PANX1 protein in the renal cortex of mice from each group are presented, with β-actin as an internal reference (n = 4). *p<0.05, **p<0.01.

[0031] Figure 10 Fifenone reduced the number of DOCA-induced P2X7 and F4 / 80 double-positive cells in the tubulointerstitium of mouse kidneys. Microscopic magnification: 400×, scale bar, 100µm; red fluorescent labeling for P2X7, green fluorescent labeling for F4 / 80, blue fluorescent labeling for cell nuclei, n = 4; *p<0.05, ***p<0.001.

[0032] Figure 11 The effect of fenelazol on DOCA-induced pyroptosis in mouse renal cortical cells. Representative Western blot images and grayscale values ​​of NLRP3 and downstream effector molecules cleaved-Caspase-1 (c-Casp-1), GSDMD-N terminal (GSDMD-N), and mature IL-1β protein in the renal tissues of mice in each group were presented, with β-actin as an internal control (n = 4). *p<0.05, **p<0.01, ***p<0.001.

[0033] Figure 12The effect of phenelzine on DOCA-induced macrophage polarization in mouse kidney tissue. Figure 12 A shows representative immunofluorescence staining images of CD86 and CD206 in the kidney tissue of mice in each group; magnification is 400×, scale bar is 100µm, CD86 is labeled with green fluorescence, CD206 is labeled with red fluorescence, and cell nuclei are labeled with blue silver light; Figure 12 B is a quantitative statistical analysis of the positive areas of CD86 and CD206 staining in the kidney tissue of mice in each group, n = 4; Figure 12 C represents the statistical results of Cd86 and Mrc1 mRNA expression levels in the renal cortex of mice in each group detected by RT-qPCR, with Actb as an internal reference, n = 6; nsp>0.05, *p<0.05, **p<0.01.

[0034] Figure 13 The effects of different doses of PBN, Apyrase, and AZ10606120 on systolic blood pressure in DOCA-treated mice ( Figure 13 A) Kidney pathology ( Figure 13 The effect of B). n = 3; nsp>0.05, *p<0.05, ***p<0.001.

[0035] Figure 14 The effects of PBN treatment on DOCA-salt-induced urinary protein, urinary ATP, and renal tissue damage in mice were investigated. Figure 14 A represents the urinary albumin / creatinine ratio (UACR) of mice in each group, n = 5–6; Figure 14 B represents the urinary ATP / creatinine ratio of each group of mice, n = 5–6; Figure 14 C shows representative images of H&E staining (top row) and Sirius red staining (bottom row) of mouse kidney tissue from each group. Magnification: 200×; Scale bar: 100 µm. Figure 14 D represents the quantitative statistical analysis of renal tubular injury scores, n = 5; Figure 14 E represents the quantitative statistical analysis of renal interstitial fibrosis scores, n = 5; Figure 14 F represents the quantitative results of RT-qPCR detection of the expression levels of Fn, Vim, Ccl2, and Il6 mRNA in the renal cortex of mice in each group, with Actb as an internal control, n = 5–6; nsp>0.05, *p<0.05, **p<0.01, ***p<0.001.

[0036] Figure 15 Effect of PBN treatment on DOCA-induced urinary ATP / creatinine ratio in mice. n = 5–6; **p<0.01, ***p<0.001.

[0037] Figure 16This study investigated the effect of PBN treatment on DOCA-induced P2X7-positive macrophage infiltration in mouse kidney tissue. Representative images of P2X7–F4 / 80 double immunofluorescence staining in mouse kidney tissue from each group, along with statistical results of the positive area of ​​P2X7–F4 / 80 double staining; red fluorescent marker for P2X7, green fluorescent marker for macrophage F4 / 80, and blue for DAPI nuclear staining; magnification: 400×; scale bar: 100 µm; n = 5–6; p < 0.0001.

[0038] Figure 17 The effects of PBN treatment on DOCA-induced pyroptosis and macrophage polarization in mouse kidney tissue. Figure 17 A shows representative Western Blot images of NLRP3, cleaved Caspase-1 (c-Casp-1), GSDMD-N, and mature IL-1β in the renal cortex of mice in each group; Figure 17 B represents the quantitative statistical analysis of the gray values ​​of the above protein bands, with β-actin as an internal reference, n = 5–6; Figure 17 C represents the quantitative results of RT-qPCR showing the expression levels of M1 marker Cd86 and M2 marker Mrc1 mRNA in renal cortical macrophages of mice in each group, with Actb as an internal control, n = 5–6; nsp>0.05, *p<0.05, **p<0.01, ***p<0.001.

[0039] Figure 18 This study investigated the effect of renal tubule-specific PANX1 shRNA pelvic injection on PANX1 protein expression in mouse renal tubules. Figure 18 A is a transfection effect diagram of adeno-associated virus (AAV) with PANX1 shRNA driven by KSP promoter, with eGFP as its reporter gene; Figure 18 B shows the Western blot diagram and quantitative statistics, indicating the knockdown effect of PANX1 in the renal tubules after transfection with shRNA AAV driven by the KSP promoter; n = 3; ***p<0.001.

[0040] Figure 19 The effects of renal tubule-specific PANX1 shRNA on DOCA-induced systolic blood pressure, urinary protein, and renal tissue damage in mice were investigated. Figure 19 A represents the effect of PANX1 knockdown in renal tubules on systolic blood pressure; Figure 19 B represents the effect of PANX1 knockdown on the urine albumin / creatinine ratio (UACR). Figure 19 C represents the urinary ATP / creatinine levels in mice in the sham-operated group and the DOCA-salt-treated group; Figure 19D represents HE staining images (magnification: 200×; scale bar: 200 µm) and statistical data on renal tubular injury scores; Figure 19 E represents the Sirius red staining image (magnification: 200×; scale bar: 200 µm) and collagen deposition index data (%), n = 4; *p<0.05, **p<0.01, ***p<0.001.

[0041] Figure 20 This study investigated the effects of renal tubule-specific PANX1 shRNA on DOCA-induced pyroptosis and macrophage polarization in mouse renal tissue. Figure 20 A is a representative image of P2X7 (red) and F4 / 80 (green) immunofluorescence staining in a kidney tissue section (magnification: 400×; scale bar: 100 µm), and statistical data on the area of ​​P2X7 / F4 / 80 double-positive cells in the kidney, n = 3; Figure 20 B is a representative Western Blot image of NLRP3, c-Casp-1, GSDMD-N and mature IL-1β in the renal cortex of mice in each group; Figure 20 C represents the quantitative statistical analysis of the gray values ​​of the above protein bands, with β-actin as an internal reference, n = 3; Figure 20 D represents the quantitative results of Cd86 and Mrc1 mRNA expression levels in the kidney tissues of mice in each group, with Actb as an internal reference; n = 4; *p<0.05, **p<0.01, ***p<0.001.

[0042] Figure 21 The effects of Apyrase and AZ10606120 on DOCA-induced pyroptosis and macrophage polarization in mouse kidney tissue. Figure 21 A represents the urinary albumin / creatinine ratio (UACR) of mice in each group, n = 4–5; Figure 21 B shows representative images of H&E staining (top row, magnification: 200×; scale bar: 200 µm), Sirius red staining (middle row, magnification: 200×; scale bar: 200 µm), and P2X7–F4 / 80 immunofluorescence double staining (bottom row, magnification: 400×; scale bar: 100 µm) of kidney tissue from each group of mice. Figure 21 C represents the quantitative statistical analysis of renal tubular injury scores, n = 4; Figure 21 D represents the quantitative statistical analysis of renal interstitial fibrosis scores, n = 4; Figure 21 E represents the statistical results of the positive area of ​​P2X7–F4 / 80 double staining; red fluorescent marker is P2X7, green fluorescent marker is macrophage marker F4 / 80, and blue is DAPI nuclear staining, n = 3; Figure 21F represents the quantitative results of RT-qPCR detection of Fn, Vim, Ccl2, and Il6 mRNA expression levels in the renal cortex of mice in each group, with Actb as an internal control, n = 4–5; **p<0.01, ***p<0.001 compared with the Sham Vehicle group, #p<0.05, ##p<0.01, ###p<0.001 compared with the DOCA-salt Vehicle group.

[0043] Figure 22 The effects of Apyrase and AZ10606120 intervention on DOCA-induced pyroptosis and macrophage polarization in mouse kidney tissue. Figure 22 A is a representative Western Blot image of NLRP3, cleaved Caspase-1 (c-Casp-1), GSDMD-N and mature IL-1β in the renal cortex tissue of mice in each group, n = 4; Figure 22 B represents the quantitative statistical analysis of the gray values ​​of the above protein bands, with β-actin as an internal reference; Figure 22 C represents the quantitative results of RT-qPCR showing the expression levels of M1 marker Cd86 and M2 marker Mrc1 mRNA in renal cortical macrophages of mice in each group. Actb was used as an internal control, n = 4-5; nsp>0.05, **p<0.01, ***p<0.001 compared with the Sham Vehicle group, nsp>0.05, #p<0.05, ##p<0.01 compared with the DOCA-salt Vehicle group.

[0044] Figure 23 The effects of aldosterone and fenelone on ATP release levels and cell viability in mTECs. Figure 23 A is aldosterone (10) -7 M) Dynamic changes in ATP levels in the culture supernatant of mTECs after stimulation for different time periods (3, 6, 12 hours), n = 4–6; Figure 23 B represents the change in mTEC cell activity after intervention with 0.1-1 mM fenelazol; Figure 23 C is the effect of fenelazol (0.1-0.5mM) intervention on aldosterone stimulation (10) -7 Effect of M, 6 hours) on ATP levels in the supernatant of mTECs culture medium, n = 6; nsp>0.05, *p<0.05, **p<0.01, ***p<0.001.

[0045] Figure 24 The effects of aldosterone and fenelone on PANX1 expression in mTECs. Figure 22 A is the result of RT-qPCR showing aldosterone (10)-7 Effects of stimulation with fenelazol (100-500 µM) for 3 hours and intervention with fenelazol (100-500 µM) on the PANX1 mRNA level of mTECs, with Actb as an internal control, n = 3; Figure 22 B is a representative image from the Western Blot and the grayscale statistical results show that aldosterone stimulation (10) -7 The effects of intervention with phenelzine (100-500µM, 6 hours) and fenelitonee (100-500µM) on PANX1 protein expression in mTECs were investigated, with β-actin as an internal control, n = 3; nsp>0.05, *p<0.05, **p<0.01, ***p<0.001.

[0046] Figure 25 The effects of aldosterone and PBN on the cell viability and ATP release levels of mTECs. Figure 25 A represents the change in mTECs cell activity after intervention with 0.1-2 mMPBN; Figure 25 B is aldosterone stimulation (10) -7 Effects of M (6 hours) and PBN (0.5-2 mM) intervention on ATP levels in mTECs culture supernatant, n = 4; nsp>0.05, *p<0.05, **p<0.01.

[0047] Figure 26 MR can directly bind to the PANX1 promoter sequence to regulate PANX1 expression. Figure 26 A is a schematic diagram of the binding sequence of Nr3c2 (MR gene name) and the binding site of Nr3c2 to the PANX1 promoter predicted by the JASPAR website. TSS is the transcription start site. Figure 26 B represents the results of dual-luciferase reporter gene assay in HK2 cells, n = 3, WT represents the wild-type PANX1 promoter sequence, and MUT represents the predicted site deletion mutant promoter sequence; nsp>0.05, *p<0.05, **p<0.01.

[0048] Figure 27 This is a comparison of MR expression in BMDMs and mTECs. The left figure is a representative image from Western blotting, and the right figure is the quantitative statistical results of grayscale values, with β-actin as an internal reference, n = 3; ***p<0.001.

[0049] Figure 28This study investigates the effects of aldosterone stimulation on the expression of pyroptosis-related proteins in mTECs. The left image shows representative Western blot images of NLRP3, cleaved Caspase-1 (c-Casp-1), GSDMD-N, and mature IL-1β in each group of cells. The right image shows the quantitative statistical results of each grayscale value, with β-actin as an internal reference, n = 3; nsp>0.05, compared with the Ctrl group.

[0050] Figure 29 The effects of aldosterone stimulation and pyroptosis and migration of BMDMs in a co-culture system with mTECs are investigated. Figure 29 A is a schematic diagram of the co-culture system experiment; Figure 29 B is the Western blot analysis of changes in protein expression of NLRP3, cleaved-Caspase-1 (c-Casp-1), GSDMD-N terminal (GSDMD-N), and mature IL-1β in BMDMs under different treatment conditions. Treatment conditions included: aldosterone stimulation alone (10... -7 M, 6 hours), co-culture with mTECs, and co-culture combined with aldosterone stimulation; the left image is a representative image, and the right image is the quantitative statistical results of gray values, with β-actin as an internal reference, n = 3; Figure 29 C represents the changes in the migration ability of BMDMs as detected by the Transwell migration assay; treatment conditions included: aldosterone stimulation alone (10... - 7 M, 24 hours), co-culture with mTECs, and co-culture combined with aldosterone stimulation; the left side is a representative image (magnification of 100×, scale bar of 200 µm), and the right side is the statistical results of the area of ​​migration BMDMs, n = 4; nsp>0.05, *p<0.05, **p<0.01, ***p<0.001, ****p<0.001.

[0051] Figure 30 The effect of MR knockdown in mTECs or BMDMs on aldosterone-induced pyroptosis and migration of BMDMs in a co-culture system. Figure 30 A is the Western blotting analysis of the effects of knocking down the MR expression of mTECs or BMDMs in a mTECs–BMDMs co-culture system, followed by aldosterone stimulation (10... -7Effects of M, 6 hours) on the expression of NLRP3, cleaved-Caspase-1 (c-Casp-1), GSDMD-N terminal (GSDMD-N) and mature IL-1β protein in BMDMs; the left figure is a representative image, and the right figure is the quantitative statistical results of grayscale values, with β-actin as an internal reference, n = 4; Figure 30 B is the Transwell migration assay used to detect the co-culture system combined with aldosterone stimulation after knocking down MR expression in mTECs or BMDMs (10). -7 The migration ability of BMDMs under M, 24 hours; the left side is a representative migration image (original magnification: 100×; scale bar: 200 µm), and the right side is the quantitative statistical analysis results of the migration area of ​​BMDMs; nsp>0.05, *p<0.05, **p<0.01, ***p<0.001.

[0052] Figure 31 The effect of knocking down PANX1 expression in mTECs on aldosterone-induced pyroptosis and migration of BMDMs in a co-culture system. Figure 31 A is the Western blot analysis of BMDMs co-cultured with PANX1-knockdown mTECs in aldosterone (10) -7 Changes in protein expression of NLRP3, cleaved Caspase-1 (c-Casp-1), GSDMD-N and mature IL-1β under M, 6 hours stimulation; the left figure is a representative image, and the right figure is the quantitative statistical results of grayscale values, with β-actin as an internal reference, n = 4; Figure 31 B is a Transwell experiment showing that BMDMs co-cultured with PANX1-knockdown mTECs in aldosterone (10) -7 Migration data after stimulation (M, 24 hours). The left side shows representative migration images (original magnification: 100×; scale bar: 200 µm), and the right side shows the quantitative statistical analysis results of the migration area of ​​BMDMs. n = 3; nsp>0.05, *p<0.05, **p<0.01, ***p<0.001 compared with Ctrl NC Si group, #p<0.05 compared with Aldo NC Si group.

[0053] Figure 32 It is the dose-dependent effect of the extracellular ATP hydrolase Apyrase or P2X7 specific inhibitor AZ10606120 in mTECs and BMDMs. Figure 32The leftmost image (A) shows the change in mTEC cell activity after intervention with 0.1-1 U / mL Apyrase; the second from the left shows the change in mTEC cell activity after intervention with 10-100 µM AZ10606120; the third from the left shows the change in BMDM cell activity after intervention with 0.1-1 U / mL Apyrase; the rightmost image (A) shows the change in BMDM cell activity after intervention with 10-100 µM AZ10606120. Figure 32 B represents the change in ATP levels in the supernatant of mTECs culture medium after intervention with 0.1-0.5 U / mL Apyrase.

[0054] Figure 33 The effect of AZ10606120, a specific inhibitor of the extracellular ATP hydrolase Apyrase or P2X7, on pyroptosis and migration of BMDMs induced by aldosterone stimulation in a co-culture system. Figure 33 A shows the effects of Western blotting of apyrase or AZ10606120 intervention on the protein expression of NLRP3, cleaved Caspase-1 (c-Casp-1), GSDMD-N, and mature IL-1β in aldosterone-stimulated BMDMs under co-culture conditions; the left figure is a representative image, and the right figure is the quantitative statistical results of grayscale values, with β-actin as an internal reference, n = 3; Figure 33 B shows the cell migration of BMDMs in each group as displayed in the Transwell experiment. The left side shows representative migration images (original magnification: 100×; scale bar: 200 µm), and the right side shows the statistical results of BMDM migration area. n = 4; *p<0.05, **p<0.01, ***p<0.001 compared with the Ctrl group, #p<0.05, ##p<0.01 compared with the Aldo group. Detailed Implementation

[0055] The present invention will be further described in detail below with reference to specific embodiments to enable those skilled in the art to understand it. It should be noted that the following embodiments are for illustrative purposes only and are not intended to limit the scope of protection of the present invention. Unless otherwise specified, all reagents used in the embodiments are commercially available analytical grade, and all experimental methods used are conventional methods.

[0056] Terminology Explanation Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art. While similar or equivalent methods and materials to those described herein may be used in the practice or testing of this invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, this specification (including definitions) shall prevail. Furthermore, materials, methods, and examples are illustrative only and not intended to be limiting.

[0057] In this disclosure, the terms “comprising” or “including” are open-ended expressions used to refer to the phrase “including but not limited to” and are used interchangeably with it, meaning that they include the contents specified in this disclosure but do not exclude other contents.

[0058] The present disclosure is further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present disclosure in any way.

[0059] Unless otherwise stated, wild-type C57BL / 6 mice, provided by Vital Rivers, Inc., were used in this disclosure. All mice were housed at Vital Rivers, Inc. in Shanghai in a specific pathogen-free (SPR)-free (SPR)-free (SPR) facility, on a standard diet with free access to water. The animal protocols were approved by the Vital Rivers Ethics Committee.

[0060] Unless otherwise stated, all reagents, reagent consumables, and instruments used in this disclosure are commercially available. The main reagents are shown in Table 1, and the main instruments are shown in Table 2.

[0061] Table 1. Main Reagents Table 2. Main Equipment Unless otherwise stated, the primer sequences used in this disclosure were provided by Sangon Biotech Co., Ltd., and are shown in Table 3. The adeno-associated virus vector was constructed and provided by GenePharma, a company in Shanghai, China. The siRNA and shRNA related sequences are shown in Table 4.

[0062] Table 3. Primer sequences Table 4. Related sequences of siRNA and shRNA I. Experimental Methods 1. Animal models and grouping Eight-week-old wild-type C57BL / 6 mice were randomly divided into a sham-operated group (Sham), a DOCA-salt-induced hypertension model group (DOCA-salt), and different intervention groups based on the model: 1.1 Construction of the DOCA-salt-induced hypertension model group Mice were anesthetized and maintained using an isoflurane-oxygen gas mixture. After skin preparation and disinfection, a longitudinal incision was made on the left side of the spine, and the fascia and muscles were dissected layer by layer. The abdominal cavity was opened, the left renal pedicle was ligated, and the left kidney was removed. Subsequently, the muscles and skin were sutured layer by layer. The mice were kept warm until they awoke. One week after kidney removal, the mice were anesthetized in the same manner, and a DOCA sustained-release tablet was implanted subcutaneously in the neck. The mice were then administered 1.0% NaCl saline. Three weeks later, the mice were sacrificed, and urine and kidney tissue samples were collected for subsequent analysis.

[0063] 1.2 Sham surgery group Mice in the sham-operated group underwent the same surgical procedure but were not given DOCA extended-release tablets or saline. The sham-operated group and each model intervention group were given an equal volume of solvent as controls.

[0064] 1.3 Model Intervention Group During the modeling period, each intervention group was administered the drug at a pre-set dose daily. After the last administration, 24-hour urine and blood were collected intravenously. The mice were then sacrificed, and kidney tissue samples were collected for subsequent assays.

[0065] (1) Fennellone was administered by gavage at doses of 3 mg / kg / day and 10 mg / kg / day. Fennellone was administered to mice starting on day 7 after subcutaneous implantation of DOCA tablets, once daily for 14 consecutive days at fixed times until the model was established. (2) Probenecid (INN: probenecid, abbreviation: PBN, chemical name: p-[(dipropylamino)sulfonyl]benzoic acid, alias: carboxybenzenesulfonamide) was administered via intraperitoneal injection at doses of 50 mg / kg / day and 100 mg / kg / day. PBN was administered to mice starting on day 7 after subcutaneous implantation of DOCA tablets, once daily for 14 consecutive days at fixed times until the modeling was completed.

[0066] (3) Adenosine triphosphate bisphosphatase (Apyrase) and selective P2X7 receptor antagonist AZ10606120 were administered via intraperitoneal injection. The dosage of Apyrase was 0.2 U / g / d, 0.4 U / g / d and 500 µg / kg / d, and the dosage of AZ10606120 was 500 µg / kg / d and 1 mg / kg / d. Apyrase and AZ10606120 were administered to mice starting on the 7th day after DOCA tablets were implanted subcutaneously, once daily for 14 consecutive days at a fixed time until the modeling was completed.

[0067] (4) AAV-mediated renal tubule-specific PANX1 knockdown group An AAV vector carrying the renal tubular epithelial cell (TECs)-specific promoter KSP was used. This vector carried a PANX1-targeting shRNA (sequence: ACAAGAUGGUCACAUGUAU, SEQ ID NO:27) and a negative control shRNA (sequence: GTTCTCCGAACGTGTCACGT, SEQ ID NO:28), and co-expressed enhanced green fluorescent protein (eGFP) for tracking. The viral titer was 1 × 10¹³ viral genome copies / mL (vg / mL). The AAV vector was constructed and provided by GenePharma, Shanghai, China. AAV transfection was performed via renal pelvic injection as follows: using an insulin syringe needle, 20 μL of AAV solution was rapidly injected into the mouse renal pelvis. After injection, the needle was held in place for 30 seconds before being slowly withdrawn.

[0068] Two weeks after injection, the expression level of PANX1 was detected by Western blotting, and the eGFP fluorescence intensity was analyzed by immunofluorescence to assess the gene knockdown efficiency. Successfully transfected mice were then subjected to DOCA-salt-induced hypertension model construction and drug intervention as described above.

[0069] 2. Renal tubular epithelial cell culture and in vitro intervention 2.1 Extraction and culture of primary renal tubular epithelial cells (mTECs) C57BL / 6 mice were euthanized using afodin, and then both kidneys were removed and placed on a clean culture surface. The renal cortex tissue was excised and minced using a disposable sterile scalpel. The renal cortex tissue was transferred to a 2 mg / mL collagenase V solution and digested for 30 minutes on a 37°C shaker.

[0070] Prepare complete mTECs medium, primarily DMEM / F12, containing 5% fetal bovine serum, 1% penicillin / streptomycin solution, 1% insulin-transferrin-selenoethanolamine solution, and 24 ng / mL recombinant mouse epidermal growth factor. Neutralize the digested renal cortex solution by adding twice the volume of complete mTECs medium. Pass the solution sequentially through 100µm, 70µm, and 40µm cell sieves, collect the filtered solution, centrifuge at 1000 rpm for 3 minutes, and discard the supernatant.

[0071] Add 3 mL of erythrocyte lysis buffer to the pellet, mix well by pipetting, and incubate at room temperature for 3 minutes; then add 3 mL of sterile PBS solution to neutralize; centrifuge at 1000 rpm for 3 minutes and discard the supernatant. Resuspend the pellet in 10 mL of mTECs complete culture medium, add to a 10 cm cell culture dish, and incubate at 37°C for 3 hours.

[0072] The recovered solution was centrifuged at 1000 rpm for 3 minutes, the supernatant was discarded, and 50 mL of solution was added to the precipitate for resuspending. The precipitate was then plated according to the research objective. The plates were then placed in a 37°C incubator for further culture. Two days after platening, the culture medium was replaced with serum-free mTECs fresh medium for cell synchronization. On the fourth day, cell stimulation or cell treatment could be performed according to the experimental objective.

[0073] 2.2 HK2 cell resuscitation and culture The complete culture medium for HK2 cells was prepared based on DMEM / F12, with the addition of 10% FBS and 1% P / S. After removing the HK2 cells from liquid nitrogen, they were quickly thawed in a 37°C water bath. Once thawed, 4 mL of DMEM / F12 medium was added for dilution, and the cells were centrifuged at 800 rpm for 3 minutes. The supernatant was discarded, and 10 mL of complete culture medium was added and mixed thoroughly by pipetting. The mixture was then transferred to 10 cm dishes. HK2 cells were cultured at 37°C, with the medium changed every 2-3 days. When the cell confluence reached 90%, passage or plating was performed: HK2 cells were digested with cell digestion solution at 37°C for approximately 45 seconds, and an equal volume of complete culture medium was added to neutralize the digestion. The cells were then collected by pipetting; centrifuged at 800 rpm for 3 minutes; the supernatant was discarded, and fresh culture medium was added for plating. When the cell confluence reached 70%, stimulation or intervention was initiated.

[0074] 2.3 Aldosterone stimulation and other drug interventions When mTECs or HK2 cells reach 70% confluence, administer aldosterone (10... -7A PANX1 high-expression model was constructed by stimulation with 1 μM (M). The control group received the same concentration of dimethyl sulfoxide (DMSO) as a reference. To clarify the role of MR signaling, cells were treated with fenelazol (100, 200, 500 µM) and pretreated for 1 hour beforehand; to clarify the role of PANX1, cells were treated with PBN (0.5, 1, 2 mM) and pretreated for 1 hour beforehand; to clarify the role of eATP, cells were treated with Apyrase (0.1, 0.2, 0.5, 1 U / mL) and pretreated for 1 hour beforehand; to clarify the role of P2X7, cells were treated with AZ10606120 (10, 20, 50, and 100 μM) and pretreated for 1 hour beforehand. The control group and the simple stimulation group received the same amount of DMSO to exclude solvent effects. Appropriate drug concentrations were selected for subsequent experiments using CCK8 and target activity assays.

[0075] After cell stimulation, cell culture medium was collected. The medium was centrifuged at 2000 rpm and 4°C for 5 minutes, and the supernatant was used for ATP detection. Cell proteins were collected simultaneously, and the total amount of cell proteins was determined by the BCA method for subsequent Western blot analysis, or cells were fixed for immunofluorescence analysis. The ATP level in the supernatant was calibrated using the BCA value of cell proteins, and the changes in ATP levels in each group were calculated based on the ATP level of the control group.

[0076] 3. Construction and intervention of mTECs–BMDMs co-cultivation system 3.1 Extraction and culture of bone marrow-derived macrophages (BMDMs) The BMDMs used in this disclosure were all derived from 6-8 week old male C57BL / 6 mice. The specific steps were as follows: Mice were anesthetized and sacrificed using afodin, and then soaked in 75% alcohol for 5 minutes; the skin of the hind limbs was cut open, and the muscles were bluntly dissected to remove the complete femur and tibia; the bones were placed in sterile PBS solution, and the muscles and ligaments attached to the bones were further removed; the bones were transferred to another sterile PBS solution, the two sides of the bones were cut open, and the bone marrow cavity was repeatedly flushed with a 1 mL syringe; the PBS solution containing bone marrow was passed through a 40 µm cell sieve, and the resulting filtrate was centrifuged at 800 rpm for 3 minutes, and the supernatant was discarded; 2 mL of erythrocyte lysis buffer was added to the precipitate and mixed well, and after thorough lysis for 2 minutes, sterile PBS solution was added to neutralize, followed by centrifugation at 800 rpm for 3 minutes, and the supernatant was discarded; fresh BMDMs complete culture medium was prepared, containing 15%... L929 supernatant, DMEM medium containing 10% FBS and 1% penicillin-streptomycin; BMDMs cells were resuspended in BMDMs complete medium and plated; then placed in a 37°C incubator for further culture; the medium was changed on the third and fifth days; stimulation was given on the seventh day.

[0077] L929 cells were routinely cultured in DMEM medium containing 10% FBS and 1% penicillin-streptomycin. After L929 cells were passaged, they were cultured for approximately 5 days, and the cell supernatant was collected. The L929 supernatant was filtered through a 0.22 µm cell sieve and then aliquoted and stored at -20°C.

[0078] 3.2 Construction of mTECs–BMDMs co-culture system A co-culture system was constructed using Transwell chambers. Logarithmic growth phase mouse renal tubular epithelial cells (mTECs) were seeded into the lower chamber of a Transwell chamber at a density of 5 × 10⁶ cells / mL. 5 Once the cells have adhered and reached 70%-80% confluence, mature BMDMs are seeded into the upper chamber of the Transwell at a density of 2 × 10⁶ cells / well. 5 Cells / well were added to both the upper and lower chambers with DMEM / F12 complete medium containing 5% fetal bovine serum and 1% penicillin / streptomycin solution. The cells were then cultured in a cell culture incubator at 37°C, 5% CO2, and saturated humidity to establish an mTECs–BMDMs co-culture system. Subsequent intervention treatments were performed after 24 hours of culture.

[0079] 3.3 Intervention on BMDMs or mTECs–BMDMs co-culture systems To clarify the effects of aldosterone and drug intervention on BMDMs or mTECs–BMDMs co-culture systems, the experimental groups and treatments were as follows: BMDMs cultured alone or the co-culture system were given aldosterone (10... -7Stimulation with M was performed, while the control group received an equal volume of DMSO as a solvent. To investigate the role of extracellular ATP in this co-culture system, Apyrase (0.5 U / mL) was added to the co-culture system for intervention. To clarify the function of the P2X7 receptor, the co-culture system was pretreated with the P2X7-specific antagonist AZ10606120 (50 µM) 1 hour before aldosterone stimulation.

[0080] 3.4 In vitro knockdown of siRNA-MR / PANX1 To clarify the roles of MR on mTECs / BMDMs and PANX1 on mTECs in the co-culture system, intervention was performed using RNAi transfection reagents and siRNAs (sequences SEQ ID NO: 21-26) for each target gene. The specific steps are as follows: Based on the required experimental volume, the target gene-siRNA solution / NC-siRNA solution was gently mixed with an equal volume of 2× buffer to prepare a small RNA mix, which was then incubated at room temperature. In a separate clean centrifuge tube, an equal volume of RNAi transfection reagent to the small RNA mix was added, followed by the small RNA mix, and the mixture was pipetted to form a transfection complex. The complex was incubated at room temperature for 5 minutes. The culture medium for the cells to be transfected was replaced with fresh medium, and then the appropriate volume of transfection complex was added according to the experimental design. The cells were incubated at 37°C for 24 hours, then the medium was replaced with fresh medium and incubated for another 24 hours. Cell knockout efficiency was then checked or stimulation was applied.

[0081] 4. Detection Indicators and Methods 4.1 Detection of blood pressure and urine protein in mice 4.1.1 Blood Pressure Measurement Blood pressure in mice was measured using the tail-neck method. Mice required prior acclimatization training. Mice were placed on a preheated platform (37°C) and restrained (to prevent movement). The tail-neck was then placed at the base of the mouse's tail, with the sensor positioned at the rear. Upon initiation of measurement, the system automatically inflated and deflated, detecting the blood flow recovery signal. Each mouse underwent 20 cycles, and the average of five values ​​from the stable period was taken as the blood pressure value.

[0082] 4.1.2 Determination of urinary albumin and creatinine in mice Mouse urine was collected via metabolic cages over a period of 2 hours. After collection, the urine was centrifuged at 2000 rpm, and the supernatant was collected for later use. Urinary albumin levels were detected using an ELISA kit, and urinary creatinine levels were measured using a colorimetric method. The urinary albumin / creatinine ratio (UACR) was calculated.

[0083] 4.2 Pathological staining of mouse kidney tissue 4.2.1 HE staining After embedding and sectioning, mouse kidney tissue was used to assess the degree of renal tubular damage by hematoxylin-eosin staining.

[0084] 4.2.2 Sirius Red Staining After embedding and sectioning, mouse kidney tissue was stained with Sirius red to assess the level of renal interstitial fibrosis and collagen deposition.

[0085] 4.2.3 F4 / 80 Immunohistochemistry Detection of renal interstitial macrophage infiltration using macrophage markers (F4 / 80). Specific steps: Paraffin sections of mouse kidney tissue were baked, dewaxed, and dissolved in water; sufficient EDTA (pH 9.0) antigen retrieval solution was poured into a pressure cooker and heated to boiling; the sections were then placed in the retrieval solution, the pressure cooker lid was tightened, and heating continued until the pressure cooker released steam, then heating for another 1.5 minutes; the heat was turned off, water was poured in, and the lid was opened for natural cooling for approximately 1 hour; the sections were removed and washed three times with distilled water for 5 minutes each time; the sections were then immersed in 3% hydrogen peroxide solution for 30 minutes, followed by three washes with distilled water for 5 minutes each time; the sections were removed, circled with a stylus pen, and then placed in TBST solution; 5% bovine serum albumin (BSA) solution was added, and the sections were blocked at 37°C for 30 minutes; a primary antibody (mouse anti-F4 / 80 antibody) solution was prepared using 5% BSA solution, and 50-100 μL was added to each section. Incubate the sections overnight at 4°C with 50 µL of hematoxylin and ethanol. The next day, remove the sections and allow them to warm to room temperature for 15 minutes. Then, rinse the sections in TBST solution for 5 minutes, repeating 3 times. Dilute the corresponding secondary antibody with TBST solution, add 50-100 µL to each section, and incubate at 37°C for 45 minutes. Then, rinse the sections in TBST solution for 5 minutes, repeating 3 times. Prepare a fresh diaminobenzidine solution and add 50 µL to each section. Stain for 1 minute, then rinse with running water. Stain the nuclei of the sections with hematoxylin staining solution for 1 minute, then rinse with running water until no staining solution remains. Treat with hematoxylin inverted blue solution for a few seconds, then rinse with running water. Immerse the sections in anhydrous ethanol for 5 minutes, repeating twice. Then air dry. Mount with neutral resin, then observe under a microscope and take images.

[0086] 4.3 Multiplex Immunofluorescence Staining Paraffin sections of mouse kidney tissue underwent baking, dewaxing, rehydration, antigen retrieval, hydrogen peroxide treatment, blocking, incubation with primary antibodies (P2X7, F4 / 80, CD86, CD206), incubation with secondary antibodies (corresponding fluorescent rabbit or mouse antibodies), and staining using the tyrosine signal amplification method. The nuclei were stained with DAPI; subsequently, the sections were washed with TBST and mounted with anti-fluorescence quenching mounting medium. The sections were observed and photographed under a fluorescence microscope.

[0087] 4.4 Detection of extracellular ATP ATP levels in urine, cell supernatant, and co-culture supernatant were detected using a luciferase assay, corrected for creatinine / protein content. Specifically, an enhanced ATP assay kit was used for ATP detection. Cellular proteins were collected simultaneously, and the total cellular protein content in the cell protein supernatant was determined using the biquinoline carboxylic acid (BCA) assay. The ATP levels in the supernatant were calibrated using the BCA values ​​of the cellular protein, and the changes in each ATP level were calculated based on the ATP levels of the control group.

[0088] 4.5 Molecular-level detection 4.5.1 RT-qPCR Total RNA was extracted from mouse kidney tissue using a rapid RNA extraction kit, and the obtained RNA was reverse transcribed into cDNA using a reverse transcription kit. The mRNA expression levels of PANX1, P2X7, NLRP3, and inflammation and fibrosis-related genes were quantitatively analyzed by reverse transcription-real-time quantitative PCR using a qPCR kit.

[0089] 4.5.2 Western blot The specific steps for protein extraction from renal cortical tissue are as follows: Prepare protein lysis buffer according to the standard of 150 µL per sample; the lysis buffer formulation is: RIPA lysis buffer and PBS mixed at a ratio of 1:9, with the addition of 1× protease phosphatase inhibitor; place an appropriate amount of renal tissue block into a 1.5 mL EP tube, add the lysis buffer and small magnetic beads, and grind in a tissue homogenizer (frequency 60 Hz, time 30 seconds). After the tissue is ground until there are no obvious lumps, place the EP tube on ice for lysis for 30 minutes; place the EP tube in a pre-cooled centrifuge and centrifuge at 4℃, 12000 rpm for 20 minutes; after centrifugation, take a portion of the supernatant for protein quantification using the bisquinoline carboxylic acid assay (BCA); add 5× loading buffer to a portion of the supernatant by volume, heat in a metal bath at 100℃ for 10 minutes, and use for subsequent Western blotting experiments; aliquot the remaining supernatant and store at -80℃ for later use.

[0090] The specific steps for BCA quantification of tissue protein supernatant are as follows: 2 mg / mL BSA protein standard was serially diluted to concentrations of 2, 1, 0.5, 0.25, 0.125, 0.0625, and 0 mg / mL. 20 µL of each concentration was added to a 96-well plate, with replicates for each concentration. 2 µL of the tissue protein supernatant to be tested was diluted with 18 µL of PBS, and 20 µL was added to a 96-well plate, with replicates for each sample. BCA working solution was prepared at a ratio of A:B = 50:1, and 200 µL of working solution was added to each well. The plate was incubated at 37°C for 30 minutes. The optical density at 570 nm was measured using a microplate reader. A standard curve was plotted based on the standards, the protein concentration of each sample was calculated, and the loading amount for Western blotting was determined.

[0091] 4.5.3 PANX1 promoter luciferase reporter gene assay To verify the direct transcriptional regulation of the PANX1 gene by NR3C2 (mineralocorticoid receptor MR), a luciferase reporter plasmid containing the wild-type PANX1 promoter (WT) and the NR3C2 binding site mutant (Mut) was constructed.

[0092] (1) Plasmid transfection All plasmids used in this study were synthesized and provided by Gemma Corporation, including the wild-type PANX1 promoter-firefly luciferase reporter plasmid (plasmid sequence as shown in SEQ ID NO:29), the Nr3c2 binding site mutant PANX1 promoter-firefly luciferase reporter plasmid (plasmid sequence as shown in SEQ ID NO:30), and the Renida luciferase internal control plasmid (catalog number: C15002).

[0093] Table 5. Luciferase reporter plasmid sequences containing the PANX1 promoter WT and Mut The predicted sites for WT are underlined.

[0094] When the cells reached approximately 70% confluency, plasmid transfection was performed using Lipofectamine 3000 transfection reagent. The following mixtures were prepared using Opti-MEM serum-free medium: a mixture of wild-type PANX1 promoter-firefly plasmid and sea urchin internal control plasmid, and a mixture of mutant PANX1 promoter-firefly plasmid and sea urchin internal control plasmid. Two times the plasmid mass of Lipofectamine 3000 enhancer were added to each of these mixtures, and the mixtures were gently mixed. Separately, an equal volume of Lipofectamine 3000 liposome reagent was diluted with Opti-MEM medium and thoroughly mixed. Equal volumes of the diluted liposomes were added to each of the two plasmid mixtures, and the mixtures were gently mixed and incubated at room temperature for 10 minutes. The cell culture medium was replaced with fresh serum-free medium, and 100 µL of the transfection complex was added to each well. The cells were incubated at 37°C for 24 hours. The medium was then replaced with serum-containing complete medium, and the cells were cultured for another 48 hours, followed by cell stimulation.

[0095] (2) Dual-luciferase experiment Remove the firefly luciferase assay reagent and the kidney luciferase assay reagent from the dual-luciferase kit and thaw them at room temperature; remove the kidney luciferase assay substrate and dissolve it on ice, add it to the kidney luciferase assay reagent and mix well, then equilibrate at room temperature.

[0096] After the cells have been stimulated, wash them with PBS. After thoroughly removing the PBS, add firefly luciferase reporter gene lysis buffer to the cell wells; after the cells have fully lysed, aspirate the lysis buffer, centrifuge at 10,000 g, 4°C for 5 minutes, and collect the supernatant and store it on ice for later use.

[0097] Add 20 µL of cell lysis supernatant to a sterile, enzyme-free 96-well plate and incubate for 10 minutes to reach room temperature. Add 100 µL of firefly luciferase assay reagent equilibrated to room temperature to each well and react for 5 minutes at room temperature to stabilize the signal. Read the fluorescence value using a microplate reader capable of detecting chemiluminescence. Add 100 µL of sea cucumber luciferase assay reagent equilibrated to room temperature to each well, mix well, and react for 5 minutes; measure the chemiluminescence value. Dual-luciferase activity is expressed as the ratio of firefly luciferase activity to sea cucumber luciferase activity, reflecting the transcriptional activity of the PANX1 promoter.

[0098] 4.6 Transwell migration experiment Migration experiments were conducted using Transwell chambers with an 8.0 µm pore size. The specific steps are as follows: the extraction methods for mTECs and BMDMs were the same as described previously. Induced differentiated BMDMs were seeded in the upper chamber of the Transwell, and mTECs were seeded in the lower chamber to construct a co-culture system. After the co-culture system completed the appropriate stimulation or intervention, the culture medium was aspirated, and the cells were gently washed once with PBS. Sufficient 4% paraformaldehyde was added, and the cells were fixed at room temperature for 15 minutes. The fixative was discarded, and the cells were washed once with PBS. Sufficient crystal violet staining solution was added, and the cells were stained at room temperature for 20 minutes. The Transwell chambers were gently rinsed with running tap water until the outflowing water was clear and colorless. The interior of the upper chamber was gently wiped with a moistened cotton swab to remove BMDMs that had not penetrated the membrane. After the Transwell chambers were appropriately dried, they were observed under a microscope, and images of the BMDMs that had migrated to the lower membrane surface were taken. ImageJ software was used to perform area statistical analysis on the migrated BMDMs. The relative fold increase of migrated cells in each group was calculated based on the number of migrated cells in the control group to assess the changes in BMDM migration ability.

[0099] 4.7 Statistical Analysis The chart data were tested using GraphPad 9.0, and all data are presented as mean ± standard deviation. All data were tested for normality using the Shapiro-Wilk test. When only two groups were present, an unpaired two-tailed t-test was used. When more than two groups were present, one-way ANOVA and Tukey's multiple comparison test were used to examine differences between groups. When two categorical variables were present, two-way ANOVA followed by Tukey's multiple comparison test was performed. A p-value less than 0.05 was considered statistically significant, where * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001. The sample size for each test is indicated below the chart.

[0100] II. Research Results 1. Fennellone improves DOCA-induced renal tissue injury independently of hemodynamic changes. Based on previous literature review, the commonly used doses of fenelazine in animal experiments include 1, 3, and 10 mg / kg. Among these, the 1 mg / kg dose has been reported to fail to significantly improve kidney damage, specifically showing no statistically significant difference in the expression of kidney injury molecule-1 (Kim-1), therefore it was not included in this study. Based on this, we selected low-dose (3 mg / kg / day) and high-dose (10 mg / kg / day) fenelazine to intervene in a DOCA-salt-induced hypertensive mouse model via daily gavage for 2 weeks. Changes in systolic blood pressure were monitored using a non-invasive tail artery blood pressure measurement method. The results showed that DOCA-salt treatment successfully induced a significant increase in systolic blood pressure in mice (148.4±4.75 mmHg). After low-dose fenelazine intervention, no significant change in systolic blood pressure was observed (147.4±7.02 mmHg); while high-dose fenelazine significantly reduced systolic blood pressure to 118.9±12.13 mmHg. Figure 1 The above results indicate that the hypotensive effect of fenelazol in this model is significantly dose-dependent.

[0101] To eliminate the confounding factor of decreased blood pressure from directly affecting the renal protective effect and to focus on the non-hemodynamically dependent renal protective mechanism of the drug, this study selected low-dose fenelindone (3 mg / kg) as the standard intervention in subsequent experiments to conduct in-depth exploration of the molecular mechanism.

[0102] Subsequently, we collected random urine samples from mice and calculated the urinary albumin-to-creatinine ratio (UACR) by measuring urinary albumin and creatinine levels to assess urinary protein excretion and the degree of early kidney damage. The results showed that compared with the control group, the UACR of mice treated with DOCA-salt was significantly increased, indicating that the model group already had significant kidney tissue damage. However, after intervention with fenelazol, urinary protein levels significantly decreased, indicating that this drug can alleviate glomerular filtration barrier damage and renal tubular reabsorption dysfunction. Figure 2 ).

[0103] We further stained and analyzed the kidney tissue. The H&E results showed that the kidneys of DOCA-salt group mice exhibited a series of characteristic pathological changes, including tubulointerstitial damage, thickening of the renal artery wall, and partial atrophy or sclerosis of the glomeruli. Among these, tubulointerstitial lesions were the most prominent, manifested as: (1) focal tubular atrophy and dilation; (2) brush border shedding and disordered arrangement of renal tubular epithelial cells; (3) formation of protein casts or granular casts; and (4) a significant increase in inflammatory cell infiltration in the interstitium. In addition, Sirius red staining further showed that there were many collagen fiber deposition foci in the renal cortex, which again confirmed the existence of tubulointerstitial fibrosis. Fenelidone treatment can effectively reverse the above pathological changes, reduce tubular atrophy and inflammatory infiltration, reduce cast formation, and significantly inhibit abnormal deposition of collagen fibers. Figure 3 ).

[0104] Based on the above physiological indicators and pathological morphological results, high- and low-dose fenelazine showed significant differences in their effects on lowering systolic blood pressure. Without affecting hemodynamics, fenelazine treatment still demonstrated clear renal protective efficacy in improving urinary protein excretion, reducing renal tubular damage, and delaying interstitial fibrosis.

[0105] 2. Fennellone reduces kidney inflammation. We extracted renal cortical RNA from each group of mice and used RT-qPCR to detect the mRNA expression levels of fibrosis-related genes fibronectin (Fn), mesenchymal transition marker vimentin (Vim), and inflammation-related chemokines monocyte chemoattractant protein-1 (Ccl2) and interleukin-6 (IL6). The results showed that compared with the sham-operated group, the mRNA expression of Fn, Vim, Ccl2, and IL6 in the renal tissue of mice treated with DOCA-salt was significantly upregulated. After intervention with fenelazol, the abnormally high expression of these genes was significantly inhibited, indicating that this drug can effectively antagonize DOCA-salt-induced pro-fibrosis and pro-inflammatory responses. Figure 4 ).

[0106] Building upon this, we further used immunohistochemical staining to label macrophage infiltration in renal tissue with the macrophage-specific marker F4 / 80. Microscopic observation revealed F4 / 80-positive macrophage aggregation foci in the renal cortex region, especially the tubulointerstitial region, of mice treated with DOCA-salt, indicating a strong local inflammatory response in the renal cortex. Fennellone intervention significantly reduced the number and area of ​​macrophage aggregation foci; at this point, positive cells were mostly scattered, and focal structures were significantly reduced in size. Figure 5 ).

[0107] This study demonstrates that in a DOCA-induced hypertensive kidney injury model, fenelazol significantly downregulates the expression of fibrosis and inflammation-related genes and effectively blocks focal recruitment and infiltration of macrophages in the renal interstitium. These anti-inflammatory and anti-fibrotic effects are all based on the fact that fenelazol does not alter blood pressure, collectively constituting a hemodynamically independent renal protective mechanism. These findings are consistent with previous findings on the renal protective mechanism of MR antagonists, which is primarily based on antioxidant activity, and provide a reliable basis for further investigation into the specific molecular mechanisms using low-dose interventions.

[0108] 3. Fennellone inhibits the activation of the PANX1 / extracellular ATP / P2X7 signaling axis in renal tissue. To investigate the molecular mechanisms underlying the nephroprotective effects of fenelazol, we first focused on extracellular ATP, an important DAMP molecule, at the in vivo level. We collected random urine samples from mice in each group, measured ATP concentrations, and corrected for urinary creatinine levels to calculate the urinary ATP / creatinine ratio, reflecting the relative level of ATP released from renal tubules into the urine. The results showed that compared to the sham-operated group, the ATP / creatinine ratio in the DOCA-treated group was significantly increased, suggesting increased ATP release from renal tubular cells under DOCA-induced kidney injury. However, fenelazol intervention significantly reduced urinary ATP levels. Figure 6 ).

[0109] Intracellular ATP is primarily released from the cell to the extracellular space via two major channel protein families: connexin 43 (Cx43, gene name: Gja1) and pannexin 1 (PANX1). Connexin 43 (Cx43, gene name: Gja1) and pannexin 1 (PANX1) are the two most thoroughly studied and abundantly expressed channel proteins in the kidney. To investigate whether DOCA-induced ATP release is mediated by these channels, we first examined the transcriptional levels of these two proteins in kidney tissue. The results showed that, compared with the sham-operated group, the mRNA expression of Gja1 in the renal cortex of mice treated with DOCA-salt was not significantly altered, while the expression of PANX1 was significantly upregulated. Notably, fenelazol intervention significantly inhibited DOCA-salt-induced upregulation of PANX1, decreasing its expression level. Figure 7 This expression pattern is consistent with the aforementioned trend in urinary ATP levels. DOCA-salt treatment simultaneously increases urinary ATP and PANX1 expression, while phenelzine inhibits both.

[0110] To verify whether the findings in animal experiments were consistent with clinical population data, we extracted transcriptomic data from 30 healthy volunteers and 17 hypertensive patients using the Ju CKD TubInt dataset in the Nephroseq database. We then analyzed the transcriptional expression levels of PANX1 and Gja1 in the renal tubulointerstitium of hypertensive patients and healthy controls. The results showed that, consistent with our animal experiments, PANX1 expression in the renal tubulointerstitium of hypertensive patients showed an increasing trend (p = 0.0548); while Gja1 expression did not show a significant difference between the two groups. Figure 8 A). Furthermore, we analyzed the correlation between renal function indicators and the expression of Gja1 and PANX1. The results showed a significant positive correlation between serum creatinine levels and PANX1 expression in renal tissue (r = 0.31, p = 0.043). Figure 8 B), while there was no significant correlation with Gja1 expression. These results further confirm the specific changes of PANX1 in hypertension-related kidney injury and its close association with the degree of kidney function impairment.

[0111] To further verify the activation status of PANX1 in DOCA-induced kidney injury and its regulatory role with fenetrin, we further examined the protein expression level of PANX1 in renal cortex tissue. Figure 9 As shown, compared with the sham-operated group, the total PANX1 protein expression in the renal cortex of mice treated with DOCA-salt was significantly upregulated; simultaneously, the level of cleaved PANX1 fragments was also significantly increased. Cleaved PANX1 is an important marker of PANX1 channel activation, and its increase suggests an increase in functionally open PANX1 channels, which may promote the extracellular release of ATP. Notably, fenelazol intervention significantly reduced the upregulation of total PANX1 and cleaved PANX1 expression induced by DOCA-salt. This result indicates that the therapeutic effect of fenelazol not only manifests in inhibiting the transcription and protein expression levels of PANX1, but may also reduce the activated form of PANX1, inhibit its channel function, and thus block the abnormal release of ATP.

[0112] Extracellular ATP can trigger downstream intracellular signaling by activating the purinergic receptor P2X7. As one of the core receptors recognizing extracellular ATP and triggering inflammatory responses, P2X7 plays a prominent role in the study of chronic kidney disease. We investigated the expression and localization of P2X7 in kidney tissue using immunofluorescence staining, and the results are as follows: Figure 11As shown, in the renal cortex of sham-operated mice, the expression level of P2X7 was low, with a small number of positive cells scattered in the tubulointerstitial region, co-localizing with the macrophage marker F4 / 80. However, in the DOCA-salt-induced hypertensive kidney injury model, the number of P2X7-positive cells significantly increased. Specifically, a large number of F4 / 80-positive macrophages in the interstitial region highly expressed P2X7, forming a distinct P2X7–F4 / 80 double-positive cell population. Additionally, P2X7-positive cells were also observed in the glomeruli. Fenelidone intervention significantly reduced the number of P2X7-positive cells in the renal cortex of DOCA-salt-treated mice, and the infiltration foci of P2X7–F4 / 80 double-positive macrophages were significantly reduced. Figure 10 ).

[0113] 4. Fennellone reduces pyroptosis and macrophage M1 polarization. Pyroptosis is a classic pathway by which P2X7 activation downstream induces macrophage inflammation and tissue damage. Therefore, we focused on this key inflammatory cell death pathway. We examined the expression levels of pyroptosis signaling pathway-related molecules in the renal cortex of mice in each group. The results showed that, compared with the sham-operated group, NLRP3 expression was significantly upregulated in the renal cortex of mice treated with DOCA-salt, and the protein levels of downstream effector molecules of the inflammasome—including cleaved caspase-1 (c-Casp-1), the N-terminal fragment of Gasdermin D protein (GSDMD-N), and mature interleukin-1β (IL-1β)—were significantly increased. GSDMD-N is a key executor of pyroptosis, and its accumulation reflects the occurrence of pyroptosis in tissues; while the release of mature IL-1β is a pyroptosis-driven signaling amplification of inflammation. Fennellone intervention significantly downregulated NLRP3 expression and the levels of the aforementioned pyroptosis-related molecules, indicating that fenelrenone can significantly alleviate renal cell pyroptosis and related inflammatory damage. Figure 11 ).

[0114] Macrophages can polarize into pro-inflammatory (M1) or anti-inflammatory / reparative (M2) types under different microenvironmental signals, and the dynamic balance between these two types during kidney injury directly affects the inflammatory outcome. We first identified macrophage subtypes using double immunofluorescence staining. The results showed that, compared with the sham-operated group, the number of M1 macrophages (CD86-positive) in the renal cortex of mice treated with DOCA-salt was significantly increased. Simultaneously, the number of M2 macrophages (CD206-positive, gene name: Mrc1) also showed a significant increase. Figure 12 A, Figure 12B). RT-qPCR results were consistent with the immunofluorescence staining trend, showing that DOCA-salt treatment simultaneously upregulated the mRNA expression of both M1 and M2 markers. Feneltone intervention significantly reduced the number of M1 macrophages, and the corresponding mRNA expression also decreased significantly; while the number of M2 macrophages and mRNA expression showed a decreasing trend, neither reached statistical significance. Figure 12 B). This result indicates that fenelazol selectively regulates macrophage polarization, primarily inhibiting the infiltration and activation of pro-inflammatory M1 macrophages, while having a relatively limited effect on M2 macrophages.

[0115] 5. PANX1 inhibitors reduce DOCA-induced renal tissue damage. To further clarify the functional role of PANX1 in MR signaling-induced kidney injury, we used the PANX1-specific inhibitor PBN to intervene in a DOCA-salt-induced hypertensive mouse model. Considering the previously reported antihypertensive potential of PBN, we first evaluated the effect of different dosages on blood pressure in mice. We set up two dosage groups, 50 mg / kg / d and 100 mg / kg / d, administered the medication intraperitoneally for 2 weeks and observed its effect on systolic blood pressure in mice. Figure 13 As shown, compared with the DOCA-salt model group, PBN treatment at 100 mg / kg / d significantly reduced systolic blood pressure in mice, while a dose of 50 mg / kg / d had no significant effect on blood pressure. To maintain consistency with the "non-hemodynamically dependent" intervention strategy used in the fenelone study and to focus on the direct renal protective effect of PANX1 blockade itself, we subsequently selected 50 mg / kg / d as the intervention dose for PBN.

[0116] Building upon this, we further evaluated the protective effect of PBN against DOCA-induced kidney injury. Urine analysis results showed that PBN intervention significantly reduced the increase in UACR in mice induced by DOCA-treatment (…). Figure 14 A). Kidney histopathological staining further confirmed the protective effect of PBN. H&E staining showed that PBN treatment significantly reduced focal tubular damage in the renal cortex of DOCA-treated mice, including brush border shedding of tubular epithelial cells, cast formation, and tubular atrophy; Sirius red staining results showed that PBN intervention significantly reduced DOCA-induced collagen fiber deposition in the renal cortex, especially in the perivascular and tubulointerstitial areas. Figure 14 B- Figure 14D). Furthermore, we detected the expression of fibrosis and inflammation-related genes in renal cortex tissue using RT-qPCR. The results showed that PBN intervention significantly inhibited the abnormally elevated mRNA levels of fibrosis factor Fn, mesenchymal transition marker Vim, and inflammatory factors Ccl2 and IL6 induced by DOCA-salt treatment. Figure 14 E). In conclusion, PBN treatment can effectively improve DOCA-induced renal histological damage.

[0117] 6. PANX1 inhibitors inhibit DOCA-induced extracellular ATP / P2X7 signaling activation in kidney tissue. To clarify the effects of the PANX1 inhibitor PBN on renal ATP release and downstream pathways, we first used collected mouse urine to detect ATP levels to assess changes in renal ATP excretion. Figure 15 As shown, the ATP level in the urine of mice treated with DOCA-salt was significantly increased, while PBN intervention could significantly reduce the increase in urinary ATP level induced by DOCA-salt, indicating that inhibiting PANX1 channel function can effectively block the abnormal release of ATP.

[0118] Building upon this, we further investigated the effects of PBN intervention on the expression of the ATP downstream signaling molecule P2X7 receptor and macrophage infiltration. Immunofluorescence staining of kidney tissue from mice in each group revealed that PBN treatment not only reduced the increase in the number of macrophages in kidney tissue induced by DOCA-salt treatment, but also significantly reduced the infiltration area of ​​P2X7-positive macrophages in kidney tissue. Figure 16 The above results indicate that the PANX1 inhibitor PBN can inhibit downstream P2X7-mediated macrophage recruitment by blocking upstream ATP release.

[0119] 7. PANX1 inhibitors reduce macrophage pyroptosis and M1 polarization. Subsequently, we detected molecules related to pyroptosis and macrophage polarization in the kidney tissues of mice in each group. For example... Figure 17 A and Figure 17As shown in Figure B, PBN intervention significantly inhibited the upregulation of NLRP3 protein expression in the renal cortex induced by DOCA-salt treatment. More importantly, DOCA-salt treatment significantly increased the levels of downstream effector molecules of the NLRP3 inflammasome, mainly including activated Caspase-1 (c-Casp-1), the N-terminal fragment of the pyroptosis executive molecule GSDMD (GSDMD-N), and mature IL-1β. PBN treatment significantly reversed the high expression of these molecules, indicating that PBN can effectively block the activation of the NLRP3 inflammasome-mediated pyroptosis pathway. Furthermore, we detected changes in the levels of macrophage polarization-related markers using RT-qPCR. The results showed that PBN significantly reduced the mRNA expression level of the M1 macrophage marker Cd86, while having no significant effect on the expression of the M2 macrophage marker Mrc1. Figure 17 C). This result indicates that PBN selectively inhibits M1 macrophage polarization, but has no effect on M2 polarization.

[0120] 8. Tubular-specific PANX knockdown reduces DOCA-induced kidney injury, macrophage pyroptosis, and M1 polarization. AAVs carrying PANX1 shRNA driven by the KSP promoter were administered via renal pelvic injection to achieve specific knockdown of PANX1 in renal tubular epithelial cells (mTECs). Figure 18 A, 18B).

[0121] like Figure 19 As shown in Figure A, PANX1 knockdown in mTECs had no significant effect on systolic blood pressure; however, it significantly reduced urinary albumin and ATP release in DOCA-treated mice. Figure 19 B, 19C), and reduce renal tubular damage and renal interstitial fibrosis (B, 19C). Figure 19 D, 19E).

[0122] Furthermore, after achieving mTECs-specific PANX1 knockdown in DOCA-salt model mice, the infiltration of P2X7-positive macrophages in kidney tissue was reduced ( Figure 20 A), the levels of pyroptosis-related proteins (NLRP3, c-Casp-1, GSDMD-N, and mature IL-1β) in the renal cortex decreased. Figure 20 B, 20C). RT-qPCR results showed that PANX1 knockdown in mTECs reduced the level of Cd86 mRNA, a marker of M1 macrophages, while the level of Mrc1 mRNA, a marker of M2 macrophages, did not change significantly. Figure 20 D).

[0123] 9. Inhibition of extracellular ATP / P2X7 signaling alleviates DOCA-induced kidney tissue damage. To further clarify the role of extracellular ATP and its downstream P2X7 receptor in DOCA-induced hypertensive kidney injury, we intervened in this mouse model using apyrase and AZ10606120, respectively, and systematically evaluated the ameliorative effect of targeting extracellular ATP / P2X7 signaling on kidney injury.

[0124] like Figure 21 As shown in Figure A, both Apyrase and AZ10606120 interventions effectively reduced DOCA-induced urinary albumin excretion. They also improved renal tissue damage, manifested as: renal tubular ciliary loss, reduced inflammatory cell infiltration in the renal tubular interstitium, reduced peritubular collagen fiber deposition, and a decrease in the number and size of local fibrotic foci in the renal tissue. Figure 21 B- Figure 21 D). Further immunofluorescence double staining confirmed that DOCA-salt treatment-induced P2X7-positive macrophage infiltration in renal tubules could be inhibited by apyrase and AZ10606120 intervention. Figure 21 B- Figure 21 E). RT-qPCR results showed that the upregulation of renal cortical fibrosis factor Fn, mesenchymal transition marker Vim, and inflammatory factors Ccl2 and Il6 induced by DOCA-salt treatment was also inhibited by apyrase and AZ10606120 intervention. Figure 21 F). The above results indicate that inhibiting extracellular ATP / P2X7 can significantly improve DOCA-induced kidney injury.

[0125] 10. Inhibition of extracellular ATP / P2X7 signaling reduces pyroptosis and macrophage M1 polarization. like Figure 22 A, Figure 22 As shown in Figure B, intervention with Apyrase or AZ10606120 reduced pyroptosis signaling induced by DOCA-salt-induced activation of the NLRP3 inflammasome in the renal cortex, manifested as decreased expression of elevated NLRP3 protein and its downstream signaling molecules Caspase-1 (c-Casp-1), GSDMD-N, and mature IL-1β in the renal cortex of DOCA-salt-treated mice. Furthermore, the level of Cd86 mRNA, a marker of M1 macrophages, in mouse renal cortex tissue was significantly inhibited, while the level of Mrc1 mRNA, a marker of M2 macrophages, only showed a decreasing trend without significant difference. Figure 22 C). This indicates that inhibiting extracellular ATP / P2X7 signaling can alleviate pyroptosis and inflammatory polarization of macrophages in a DOCA-salt-induced kidney injury model.

[0126] 11. Fennellone inhibits ATP release from mTECs promoted by aldosterone / MR signaling. To verify the effectiveness of renal tubular epithelial cells in mimicking the DOCA-salt model in vitro and to further explore the early molecular events of fenestrone intervention, we selected aldosterone and high-concentration NaCl (40 mM) as two independent stimuli to simulate the two major pathological components of the DOCA-salt model: mineralocorticoid receptor activation and high salt load, respectively, to treat mTECs. By collecting the cell supernatant after stimulation, we used bioluminescence to detect the ATP level in the cell supernatant. In the preliminary experimental stage, we found that aldosterone stimulation induced a certain amount of ATP release from mTECs, while NaCl stimulation had a weaker and more unstable effect on ATP release, suggesting that aldosterone may be the main driving factor for inducing ATP release in vivo.

[0127] Based on this, we further observed the time effect of aldosterone stimulation. The results showed that ATP release from mTECs exhibited a clear time dependence. ATP levels began to increase 3 hours after stimulation; peaked at 6 hours, approximately twice that of the control group; while still higher than the control group at 12 hours, the increase was significantly lower than at 6 hours. Figure 23 A). This trend indicates that the increased ATP release induced by aldosterone is an event occurring early in the stimulation process, rather than a sustained process. Therefore, we chose 6 hours after aldosterone stimulation as the key time point for our study. Under these conditions, we first performed a CCK-8 assay, which confirmed that 0.1–1 mM fenelazol had no significant effect on the viability of mTECs cells (A). Figure 23 B), pretreatment with 0.1-0.5 mM fenelone significantly inhibited aldosterone-induced ATP release ( Figure 23 C). This result further confirms that fenelazol can block the cellular stress response triggered by the aldosterone / MR signaling axis in the early stages.

[0128] 12. Effects of aldosterone stimulation and fenelazol intervention on PANX1 expression and activity in mTECs Based on in vivo studies suggesting that PANX1 may be a major channel protein mediating increased ATP release in the kidneys, we further used mTECs to investigate the effects of aldosterone stimulation and fenestrone intervention on PANX1 expression in order to clarify its specific role in this signaling axis.

[0129] We first examined changes in the transcriptional level of PANX1. For example... Figure 24As shown in Figure A, 3 hours after aldosterone stimulation, earlier than the point of significant ATP level increase, PANX1 mRNA expression in mTECs was significantly upregulated. Intervention with 0.1-0.5 mM fenelazol effectively inhibited the early increase in PANX1 mRNA induced by aldosterone. At the protein level, Western blot results showed that 6 hours after aldosterone stimulation, the total protein expression level of PANX1 significantly increased. Simultaneously, the level of its activated form, cleaved PANX1 fragment, also significantly increased, indicating that aldosterone stimulation not only led to the upregulation of PANX1 channel expression but also activated its functional state. Fenelazol significantly inhibited aldosterone-induced increase in total PANX1 protein expression and its activated fragment. Figure 24 B, C).

[0130] To further verify the functional role of PANX1 in ATP release, we intervened with mTECs using the PANX1-specific inhibitor PBN in addition to aldosterone stimulation. CCK-8 assays showed that 0.1–2 mM PBN had no significant effect on mTEC cell viability. Figure 25 A), Inhibiting PANX1 channel function significantly reduces aldosterone-induced ATP release ( Figure 25 B).

[0131] The above results suggest that aldosterone / MR activation is involved in multiple aspects of PANX1 transcriptional regulation, protein expression, and activity regulation. PANX1 is a key downstream effector molecule that induces ATP release from mTECs after aldosterone / MR signaling activation.

[0132] 13. Exploring the mechanism by which aldosterone / MR signal regulates PANX1 The above experimental results suggest that aldosterone / MR signaling activation can upregulate PANX1 expression at the transcriptional level. Given that MR, as a ligand-activated transcription factor, can directly bind to the promoter region of target genes and initiate their transcription, we further investigated whether MR participates in transcriptional regulation by binding to the PANX1 promoter.

[0133] First, bioinformatics predictions were performed using the JASPAR database to determine the binding site of MR (encoding gene Nr3c2) to the PANX1 promoter region. The results showed that the binding site is upstream of the PANX1 transcription start site. 303 bp to There is a potential MR-binding element in the 289 bp region ( Figure 26 A). Based on this, we designed and constructed a dual-luciferase reporter gene plasmid containing wild-type and corresponding site-deleted mutant PANX1 promoter sequences, and transformed it into human renal cortical proximal tubule epithelial cells (HK2 cells) for functional verification.

[0134] Dual-luciferase reporter gene assays showed that in HK2 cells transfected with the wild-type PANX1 promoter plasmid, aldosterone stimulation significantly enhanced luciferase activity, approximately 1.4 times that of the control group. Cells transfected with the mutant promoter plasmid, however, showed no significant response to aldosterone stimulation. Figure 26 B). The above results indicate that the aldosterone / MR complex can directly bind to specific response elements within the PANX1 promoter region, thereby initiating its transcription.

[0135] 14. Analysis of the effect of aldosterone stimulation on pyroptosis in mTECs and BMDMs. Both renal tubular epithelial cells and macrophages express MR. We first investigated the expression level of MR in these two cell types. Western blot results showed that MR protein expression was detected in both mTECs and BMDMs, with the MR expression level in mTECs being approximately 2.4 times that in BMDMs. Figure 27 This result suggests that renal tubular epithelial cells have a higher basal expression level of MR, which may make them more sensitive to MR signal activation.

[0136] Then, we investigated whether pyroptosis occurred in mTECs and BMDMs under aldosterone stimulation. We found that 6 hours after aldosterone stimulation, at the peak of ATP release in mTECs, no obvious pyroptosis was observed in mTECs. Figure 28 ).

[0137] Subsequently, we systematically investigated the pyroptosis of macrophages. Based on the above findings, aldosterone stimulation induces increased ATP release from mTECs, and macrophages are the main cell type in the kidney that highly expresses the ATP receptor P2X7; the ATP released by mTECs may act on macrophages, thereby promoting their pyroptosis process. Therefore, to verify this hypothesis, we compared the effects of aldosterone stimulation on pyroptosis of BMDMs in a single BMDMs culture system and a co-culture system of mTECs–BMDMs. The experimental setup was as follows: Figure 29 As shown in A, the intervention time was 6 hours.

[0138] We examined changes in P2X7 expression in BMDMs, such as Figure 29As shown in Figure B, neither aldosterone stimulation alone nor co-culture with mTECs significantly altered the protein expression level of P2X7 in BMDMs, indicating that the co-culture system itself did not affect the basal expression of P2X7. Subsequently, we examined the pyroptosis level of BMDMs. The results showed that co-culture with mTECs alone did not induce pyroptosis in BMDMs. However, when BMDMs were co-cultured with mTECs and simultaneously stimulated with aldosterone, the protein expression of NLRP3, cleaved-Caspase-1, the GSDMD-N fragment, and mature IL-1β in BMDMs was significantly upregulated. Figure 29 B). Previous literature has reported that extracellular ATP / P2X7 signaling can chemotactically attract macrophages to inflammatory sites. Therefore, we further investigated the migration ability of BMDMs under different culture conditions. Figure 29 As shown in Figure C, aldosterone stimulation alone had no significant effect on the migration of BMDMs; co-culturing with mTECs slightly increased the migration level of BMDMs; and the addition of aldosterone stimulation to the co-culture system significantly enhanced the migration ability of BMDMs. Figure 29 C).

[0139] 15. Aldosterone-induced macrophage pyroptosis and migration depend on the presence of mTECs. To further clarify which cells play a major role in aldosterone / MR signaling, we used small interfering RNA (siRNA) to knock down MR expression in BMDMs and mTECs, respectively, and performed functional verification in a co-culture system.

[0140] We used Nr3c2 siRNA to knock down MR expression in BMDMs or mTECs, and then co-cultured them with corresponding cells treated with control siRNA (NC siRNA). The details of the three experimental groups are as follows: 1. mTECs treated with NC siRNA-BMDMs treated with NC siRNA; 2. mTECs treated with Nr3c2 siRNA-BMDMs treated with NC siRNA; 3. mTECs treated with NC siRNA-BMDMs treated with Nr3c2 siRNA.

[0141] like Figure 30As shown in Figure A, knockdown of the MR protein in mTECs significantly inhibited the pyroptosis response of BMDMs in the co-culture system, as evidenced by a significant decrease in the levels of NLRP3, cleaved-Caspase-1, GSDMD-N fragment, and mature IL-1β proteins. However, knockdown of the MR protein in BMDMs themselves had no significant effect on the expression of pyroptosis-related proteins in BMDMs in the co-culture system. Cell migration assays showed that knockdown of the MR protein in mTECs significantly inhibited the enhanced migration ability of BMDMs induced by co-culture-aldosterone stimulation; while knockdown of the MR protein in BMDMs had no significant effect on the increased migration of BMDMs under co-culture-aldosterone stimulation conditions. Figure 30 B). The above results indicate that, under aldosterone stimulation, the MR signaling of mTECs, rather than BMDMs themselves, plays a dominant role in inducing macrophage pyroptosis and cell migration.

[0142] 16. Knocking down PANX1 in mTECs reduces macrophage pyroptosis and migration in co-culture systems. To investigate whether PANX1 mediates pyroptosis in BMDMs co-cultured with mTECs under aldosterone stimulation, we knocked down PANX1 expression in mTECs. We co-cultured PANX1-knockdown mTECs with BMDMs and stimulated them with aldosterone to further clarify the role of PANX1 derived from mTECs in macrophage pyroptosis activation.

[0143] Western blot results showed that knocking down PANX1 expression in mTECs significantly inhibited pyroptosis in BMDMs in the co-culture system, as evidenced by a significant downregulation of NLRP3, cleaved-Caspase-1, GSDMD-N fragment, and mature IL-1β protein expression levels. Figure 31 A). Furthermore, Transwell migration experiments showed that knocking down PANX1 expression in mTECs effectively inhibited the enhanced migration ability of BMDMs induced by co-culture combined with aldosterone stimulation. Figure 31 B).

[0144] 17. Apyrase and AZ10606120 inhibit aldosterone-induced macrophage pyroptosis and migration. To clarify whether extracellular ATP / P2X7 signaling mediates pyroptosis and migration of BMDMs in a co-culture system, we intervened in an aldosterone-stimulated mTECs–BMDMs co-culture system using the extracellular ATP hydrolase apyrase and the P2X7-specific antagonist AZ10606120, respectively. CCK-8 assay results showed that 0.1–1 U / mL apyrase and 10–50 μM AZ10606120 had no significant effect on the cell viability of mTECs and BMDMs, while 100 μM AZ10606120 did not affect mTEC survival but led to BMDM death. Figure 32 A), 0.5 U / mL apyrase almost hydrolyzed all the extracellular ATP released by mTECs ( Figure 32 B). Therefore, 0.5 U / mL apyrase and 50 µM AZ10606120 were selected for subsequent experiments in the co-culture system.

[0145] Western blot results showed that both apyrase and AZ10606120 interventions significantly inhibited pyroptosis levels in BMDMs in the co-culture system, manifested as downregulation of NLRP3, cleaved-Caspase-1, GSDMD-N-terminal fragment, and mature IL-1β protein expression. Figure 33 A). Furthermore, Transwell migration experiments showed that both interventions effectively inhibited the enhanced migration ability of BMDMs induced by co-culture combined with aldosterone stimulation. Figure 33 B). The above results demonstrate that the extracellular ATP / P2X7 signaling axis is a key pathway mediating macrophage pyroptosis and migration in this co-culture system.

[0146] In summary, this disclosure found that in a DOCA-salt-induced hypertensive mouse model, the selective MRA fenelazol can effectively alleviate renal cell pyroptosis, macrophage inflammation, and renal tubular interstitial fibrosis by inhibiting PANX1 expression and activation and reducing renal ATP release at doses that do not alter blood pressure.

[0147] Gene editing or drug-targeted intervention of the PANX1 / extracellular ATP / P2X7 signaling axis can significantly reduce pyroptosis of renal tissue cells and macrophage-mediated inflammatory damage in DOCA-induced hypertensive mice, and improve renal tissue damage and tubulointerstitial fibrosis.

[0148] Aldosterone / MR signaling promotes increased early ATP release from renal tubular epithelial cells in a PANX1-dependent manner. Activation of aldosterone / MR signaling can directly transcribe and activate PANX1 protein expression, thereby promoting ATP release from renal tubular epithelial cells.

[0149] Renal tubular epithelial cells are key drivers of pyroptosis in renal macrophages. Under aldosterone stimulation, renal tubular epithelial cells and macrophages communicate via the PANX1 / extracellular ATP / P2X7 signaling axis, thereby inducing macrophage pyroptosis, promoting macrophage migration, and contributing to renal fibrosis.

[0150] The above specific embodiments are merely illustrative of the content of this disclosure and do not represent a limitation thereof. For those skilled in the art, various modifications and improvements can be made without departing from the spirit and substance of this disclosure, and these modifications and improvements are also considered to be within the scope of protection of this disclosure.

Claims

1. The use of fenelone in the preparation of a drug for the prevention and / or treatment of hypertensive kidney injury.

2. The application according to claim 1, characterized in that, The hypertensive nephropathy referred to here is either aldosterone-dependent hypertensive nephropathy or DOCA-induced hypertensive nephropathy.

3. The application according to claim 1, characterized in that, The fenelazol-based drug targets and inhibits the activation of the PANX1 / extracellular ATP / P2X7 signaling axis in kidney tissue. Furthermore, fenelazol can inhibit the expression and / or activation of PANX1 in renal tubular epithelial cells, reduce extracellular ATP levels, thereby inhibiting the activation of macrophage P2X7-NLRP3 inflammasomes and pyroptosis, alleviating renal inflammation, and thus treating and / or improving hypertensive nephropathy.

4. The application according to any one of claims 1-3, characterized in that, The drug has at least one of the following functions: (1) By blocking the mineralocorticoid receptor MR, the transcriptional activation of PANX1 is inhibited; (2) Inhibit PANX1 protein cleavage activation and channel opening, reducing ATP release from renal tubular epithelial cells; (3) Inhibit the expression and / or activation of PANX1, inhibit the activation of extracellular ATP / P2X7 signaling in kidney tissue, and reduce extracellular ATP levels; (4) Inhibits the activation of NLRP3 inflammasomes in renal tissue, and reduces renal cell pyroptosis, macrophage inflammation and renal tubular interstitial fibrosis; (5) Reduce renal interstitial macrophage infiltration, decrease the number of P2X7 positive macrophages, and inhibit macrophage M1 polarization; (6) It reduces urinary albumin levels, alleviates renal tubular damage, and has no significant adverse effects on blood pressure.

5. The use of a substance targeting the PANX1 / extracellular ATP / P2X7 signaling axis in the preparation of drugs for the prevention and / or treatment of hypertensive kidney injury.

6. The application according to claim 5, characterized in that, The substance is selected from at least one of the following: PANX1 inhibitor, ATP hydrolase, P2X7 receptor antagonist, renal tubule-specific PANX1 shRNA, and reagents that inhibit MR expression or activity; Furthermore, the PANX1 inhibitor is probenecid, the ATP hydrolase is apyrase, and the P2X7 receptor antagonist is AZ10606120.

7. A cell-to-cell communication regulatory mechanism for hypertensive kidney injury, characterized in that, include: Aldosterone / MR signaling directly transcribes and activates PANX1 in renal tubular epithelial cells, promoting the release of ATP into the extracellular space; Extracellular ATP activates the NLRP3 inflammasome in renal interstitial macrophages via the P2X7 receptor, inducing macrophage pyroptosis, migration, and pro-inflammatory responses. Furthermore, blocking the PANX1 / extracellular ATP / P2X7 signaling axis can significantly inhibit renal interstitial fibrosis, reduce the release of pro-inflammatory factors, and improve renal structure and function.

8. The intercellular communication regulation mechanism for hypertensive kidney injury according to claim 7, characterized in that, Knocking down or inhibiting MR or PANX1 in renal tubular epithelial cells can block aldosterone-induced macrophage pyroptosis and migration.

9. The intercellular communication regulation mechanism for hypertensive kidney injury according to claim 7, characterized in that, The intercellular communication occurs between renal tubular epithelial cells and bone marrow-derived macrophages.

10. A pharmaceutical composition for treating hypertensive kidney injury, characterized in that, The pharmaceutical composition comprises felindone and pharmaceutically acceptable excipients, and the composition is able to target and inhibit the PANX1 / extracellular ATP / P2X7 signaling axis and reduce kidney inflammation and fibrosis.