Dcaps molecular marker of qtl associated snp site of wheat scab and application thereof
By amplifying QTL-associated SNP sites on wheat chromosome 5B using dCAPS molecular marker technology, the problem of low breeding efficiency in wheat scab breeding was solved, enabling early and accurate identification of disease-resistant varieties, improving breeding efficiency and reducing costs.
Patent Information
- Application Number
- CN202610762744.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-29
- Publication Date
- 2026-07-14
AI Technical Summary
Existing technologies lack efficient and accurate molecular markers for breeding wheat scab resistance, resulting in low breeding efficiency and difficulty in early screening of disease-resistant varieties.
Using dCAPS molecular marker technology, QTL-associated SNP sites on the long arm of wheat chromosome 5B were amplified using primer pairs SEQ ID NO.1 and SEQ ID NO.2. Allelic variations of resistance and susceptibility were distinguished by PCR and restriction endonuclease digestion combined with agarose gel electrophoresis.
It enables early and accurate identification of disease resistance in wheat varieties, significantly improves breeding efficiency, reduces costs, simplifies operating procedures, and is suitable for rapid screening of large-scale breeding materials.
Smart Images
Figure CN122382241A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to a molecular marker for identifying wheat resistance to Fusarium head blight and its application. Background Technology
[0002] Fusarium head blight (FBB) is a global fungal disease caused by Fusarium spp., primarily distributed in major wheat-producing regions such as China and the United States. This disease is prone to outbreaks under rainy and humid conditions, leading not only to significant wheat yield reductions but, more seriously, toxins such as deoxynivalenol (DON) accumulated in infected grains, which pose a serious threat to human and animal health. Therefore, many countries worldwide have established strict standards for DON residues in grains (usually ≤1.0 mg / kg). Currently, agricultural, chemical, and biological control measures each have limitations; breeding and promoting disease-resistant varieties are widely recognized as the most economical and effective way to control FBB.
[0003] The inventors focused on mapping QTLs for wheat scab resistance. From the cobalt-radiated mutant progeny of the variety Ning 7840, carrying the major resistance gene Fhb1, a stable, highly resistant line R227 was obtained through years of inoculation and screening. Under multiple inoculation conditions, the disease in this line was limited to the inoculated spikelet, rarely spreading to adjacent spikelets, and the DON toxin content in the grains was extremely low, exhibiting significantly better resistance than the wild type. This indicated the possible existence of resistance mutation sites other than Fhb1. By constructing a genetic segregating population (R227 / S127), combined with phenotypic inoculation identification and 16K SNP microarray analysis, a stable scab resistance locus was located on chromosome 5B, named Qfhb.yzu-5B. Comparison with known resistance loci confirmed Qfhb.yzu-5B as a novel resistance locus. Introducing this QTL into breeding is expected to reduce the incidence of diseased spikelets and improve breeding efficiency.
[0004] With the development of molecular biology, molecular marker-assisted selection has become an important means to improve breeding efficiency. dCAPS markers, which introduce or remove restriction enzyme sites through primer mismatch, have advantages such as simple operation, low cost, and short cycle time, and are widely used in crop genetic breeding. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides a dCAPS molecular marker that amplifies QTL-associated SNP sites in wheat scab and its application, thereby solving the aforementioned technical problems. This molecular marker has high diagnostic value and can be used as an auxiliary selection marker for disease resistance breeding.
[0006] The objective of this invention is achieved as follows: a primer pair for amplifying the dCAPS molecular marker of the QTL-associated SNP site in wheat scab.
[0007] The forward primer, as shown in SEQ ID NO.1, is 5'-AGACGGV GATGCAGAAGACCACGT-3'.
[0008] The reverse primer, as shown in SEQ ID NO.2, is 5'-CGCCTCTGTTTAGCAAGTCC-3'.
[0009] A dCAPS molecular marker for a QTL-associated SNP site of wheat scab was obtained by amplification using the primer pair. The dCAPS molecular marker is located on the long arm of chromosome 5B of the wheat Chinese Spring reference sequence.
[0010] Furthermore, the dCAPS molecular marker is located at 388,587,273 bp on the long arm.
[0011] An application of the primer pair in the breeding of wheat varieties resistant to Fusarium head blight.
[0012] An application of the primer pair in the preparation of a reagent kit for wheat scab resistance.
[0013] A kit for breeding wheat resistant to Fusarium head blight, comprising the primer pair.
[0014] A method for identifying wheat scab resistance includes the following steps:
[0015] Step 1: Extract genomic DNA from wheat seedling leaves to obtain the genomic DNA to be tested;
[0016] Step 2: Perform PCR amplification on the genomic DNA to be tested using the primer pair described in claim 1 to obtain the PCR product;
[0017] Step 3: Genuine the PCR product based on its length;
[0018] When the length of the amplified product is 245bp, the wheat variety is a disease-resistant variety.
[0019] When the length of the amplified product is 227 bp, the wheat variety is a susceptible variety.
[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0021] 1. High accuracy and specificity: This molecular marker is tightly linked to the Fusarium head blight resistance QTL located on the long arm of wheat chromosome 5B. PCR amplification and subsequent enzyme digestion and electrophoresis clearly distinguished the resistance allelic variant (245bp fragment) and the susceptibility allelic variant (227bp fragment), with significant differences in the electrophoretic patterns. Figure 1 The identification results are reliable and can effectively avoid the errors caused by environmental factors and visual observation in traditional phenotypic identification.
[0022] 2. Significantly improves breeding efficiency: This marker enables early genotyping of wheat breeding populations, allowing for the screening of individual plants carrying favorable allelic variations during the seedling stage and the elimination of susceptible individuals.
[0023] 3. Simple operation, low cost, and short cycle: dCAPS labeling technology has a simple operation process, requiring only routine PCR amplification, restriction endonuclease digestion, and agarose gel electrophoresis detection, without the need for complex instruments or expensive fluorescent probes. It is suitable for rapid screening of large-scale breeding materials, significantly improving breeding efficiency and reducing breeding costs. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0025] Figure 1 Agarose gel electrophoresis images of molecular marker Y6F242398 on R227 and S127 and 22 wheat recombinant inbred lines (WF series) derived from their hybridization. Lines with a fragment size of 227bp are lines carrying unfavorable allelic variations; lines with a fragment size of 245bp are lines carrying favorable allelic variations.
[0026] Figure 2 This is an association analysis of the disease spikelet rate between some lines carrying favorable and unfavorable allelic variant genotypes in Example 1. Detailed Implementation
[0027] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0029] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0030] Example 1: Development and application of dCAPS molecular markers for wheat resistance to Fusarium head blight
[0031] Among the progeny of the cobalt-radiated mutant of the moderately resistant wheat variety Ning 7840, a stable and highly resistant mutant system, R227, was screened after several years of continuous inoculation and identification. Multiple years of spot inoculation results showed that in most cases, only the inoculated spikelets were infected, with very little spread to adjacent spikelets, and almost no DON accumulation was detected in the grains. The overall resistance level was significantly higher than that of the wild-type Ning 7840. These results suggest that there may be a new mutation site on R227 that enhances resistance to Fusarium head blight. A recombinant inbred line (RIL) population was constructed by crossing R227 with the agronomically excellent but highly susceptible Fusarium head blight line S127. The RIL population was then subjected to Fusarium head blight inoculation and identification.
[0032] From 2023 to 2025, 250 wheat scab inoculation tests were conducted on hybrids of R227 and S127. The results showed that the disease incidence rates for spikelets in R227 and S127 were 0.05 and 0.55, respectively. In 2023, highly susceptible, moderately susceptible, moderately resistant, and highly resistant lines accounted for 14.8%, 28.4%, 16.46%, and 40.3% of the RIL population, respectively. In 2024, these figures were 17.3%, 31.3%, 20.2%, and 31.3%, respectively. In 2025, the figures were 15.2%, 30.9%, 18.1%, and 35.8%, respectively. Genotypic analysis was performed using a 16K microarray, identifying multiple candidate association regions. Simultaneously, the molecular marker Y6F242398 (Y6F242398_F: 5'-AGACGGGATGCAGAAGACCACGT -3'; Y6F242398_R: 5'-CGCCTCTGTTTAGCAAGTCC -3') was designed. Individual plant genotypic analysis and phenotypic identification were performed using Y6F242398 on 250 wheat lines. The results showed a strong association between the marker genotype of Y6F242398 and the phenotypic rate of diseased spikelets in wheat scab. The average diseased spikelet rate of plants carrying the 245bp fragment resistance genotype was 0.34; the average diseased spikelet rate of plants carrying the 227bp fragment susceptible genotype was 0.46. These results demonstrate that the molecular marker Y6F242398 can accurately identify wheat scab resistance.
[0033] The PCR product based on this primer pair is 245 bp, and its sequence is shown in SEQ ID NO.3 or SEQ ID NO.4. Positions 19 and 20 of the sequence are T / C and C / A, respectively, which are polymorphic sites. Wheat germplasm at this site has two genotypes, TC and CA. The TC genotype cannot be digested by enzymes, while the CA genotype can be digested by enzymes.
[0034] SEQ ID NO.3:
[0035] AGACGGGATGCAGAAGAC[TC]CGTCCGTGCACAGGCGCATTGGTGCACACCTCACCTCACACCCCTCGCCTACCTCGCATGATACATTGATACTTTTTTTTTTTGAAAGGGCATGATACATTGATACTGATAGTGATAGGTACCGGTCTTCGTACTACGAGTCAATCATATCAGTCATTGCCGAGCTCTCTTCGCGGTCTGCAGGAAGGATGGACATACGCGTACTGGACTTGCTAAACAGAGGCG
[0036] SEQ ID NO.4:
[0037] AGACGGGATGCAGAAGAC[CA]CGTCCGTGCACAGGCGCATTGGTGCACACCTCACCTCACAACCCCTCGCCTACCTCGCATGATACATTGATACTTTTTTTTTTTGAAAGGGCATGATACATTGATACTGATAGTGATAGGTACCGGTCTTCGTACTACGAGTCAATCATATCAGTCATTGCCGAGCTCTCTTCGCGGTCTGCAGGAAGGATGGACATACGCGTACTGGACTTGCTAAACAGAGGCG
[0038] We selected 250 wheat lines derived from R227, S127 and their hybrids (Table 1), and used the dCAPS molecular marker Y6F242398 to identify the genotype of the QTL locus on chromosome 5B that is resistant to Fusarium head blight. The results were then combined with phenotypic analysis.
[0039] Table 1. Names and origins of 250 wheat varieties derived from R227 and S127.
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048] Note: 1 corresponds to the R227 allele of the resistant parent, 2 is heterozygous, and 3 corresponds to the S127 allele of the susceptible parent.
[0049] The specific steps are as follows:
[0050] 1. Extraction of DNA from Leaves
[0051] ① Take a plant leaf about 5cm long, tear it into pieces and put it into a 2mL centrifuge tube;
[0052] ② Add one grinding steel ball, tighten the lid, place it in liquid nitrogen for 60 seconds, and then grind it with a grinding machine for 30 seconds at a grinding frequency of 1400 r / min;
[0053] ③ Add 1000 μL of 1.14% CTAB extraction solution to the ground sample, place it in a 70℃ oven, let it stand for 1 hour, and shake it once every 20 minutes.
[0054] ④ Cool to room temperature, add 500 μL of chloroform, mix by inverting, balance and centrifuge at 12000 r / min for 5 min;
[0055] ⑤ Add 600 μL of the supernatant to a new 1.5 mL centrifuge tube, add an equal amount of isopropanol, invert and mix 40 times, incubate at -20℃ for 1 h; balance and centrifuge at 12000 r / min for 5 min, then discard the supernatant.
[0056] ⑥ Add 1 mL of 75% alcohol to wash, and let stand for 1 hour;
[0057] ⑦ Balance the liquid and centrifuge at 12000 r / min for 5 min. Discard the alcohol, remove excess liquid, and dry at room temperature.
[0058] ⑧ Add 400 μL of ddH2O, dissolve at room temperature for 30 min, and store at -20°C for later use.
[0059] 2. PCR amplification and detection
[0060] The 20 μL PCR reaction system consists of: 5 μL template DNA, 0.4 μL each of 10 μmol upstream and downstream primers, 0.4 μL of 10 mM dNTPs, 2 μL of 10×PCR buffer, 0.1 μL of rTaq enzyme, and ddH2O to make up the remaining 20 μL of the reaction system.
[0061] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 45 s, for 40 cycles; 72℃ extension for 5 min, and storage at 16℃.
[0062] The enzyme digestion system was as follows: 5 μL of PCR product, 2 μL of 10×K buffer, 0.1 μL of restriction enzyme FbaⅠ, and 20 μL of ddH2O to supplement the reaction system. Then, the enzyme digestion was carried out at 37℃ for 2 h.
[0063] The enzyme digestion products were separated by 5.0% agarose gel electrophoresis.
[0064] The primer nucleotide sequences are as follows:
[0065] Y6F242398_F:5'-AGACGGGATGCAGAAGACCACGT-3'
[0066] Y6F242398_R: 5' - CGCCTCTGTTTAGCAAGTCC - 3'.
[0067] like Figure 1 As shown, strains with a 227bp band after enzyme digestion of the amplification product are those carrying unfavorable allelic variations; strains with a 245bp band after enzyme digestion of the amplification product are those carrying favorable allelic variations.
[0068] 3. The dCAPS marker genotypes of some varieties were statistically analyzed in conjunction with phenotypes. An independent samples t-test was used to analyze the phenotypic data, revealing that 114 lines carried favorable allelic variations, while 129 lines carried unfavorable allelic variations.
[0069] like Figure 2 As shown, plants carrying favorable and unfavorable allelic variations were significantly correlated with the incidence of diseased spikelets. When the PCR combined with enzyme digestion and electrophoresis detection result was 245bp, it indicated that the line carried a favorable allelic variation, and when the detection result was 227bp, it was a line carrying an unfavorable allelic variation.
[0070] The above experiments have confirmed that wheat varieties can be identified for resistance to Fusarium head blight by detecting deletion sequences related to Fusarium head blight using the dCAPS primer Y6F242398.
[0071] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
[0072] Example 2: Application of dCAPS molecular markers
[0073] We collected 430 varieties from natural populations (mostly from Jiangsu Province), and used the dCAPS molecular marker Y6F242398 to identify the genotypes of QTLs associated with Fusarium head blight located on chromosome 5B. The results were then combined with phenotypic analysis.
[0074] Table 2. Names and origins of 430 varieties from natural populations.
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086] Note: 1 corresponds to the R227 allele of the resistant parent, 2 is heterozygous, and 3 corresponds to the S127 allele of the susceptible parent.
[0087] The specific steps are as follows:
[0088] 1. Extraction of DNA from Leaves
[0089] ① Take a plant leaf about 5cm long, tear it into pieces and put it into a 2mL centrifuge tube;
[0090] ② Add one grinding steel ball, tighten the lid, place it in liquid nitrogen for 60 seconds, and then grind it with a grinding machine for 30 seconds at a grinding frequency of 1400 r / min;
[0091] ③ Add 1000 μL of 1.14% CTAB extraction solution to the ground sample, place it in a 70℃ oven, let it stand for 1 hour, and shake it once every 20 minutes.
[0092] ④ Cool to room temperature, add 500 μL of chloroform, mix by inverting, balance and centrifuge at 12000 r / min for 5 min;
[0093] ⑤ Add 600 μL of the supernatant to a new 1.5 mL centrifuge tube, add an equal amount of isopropanol, invert and mix 40 times, incubate at -20℃ for 1 h; balance and centrifuge at 12000 r / min for 5 min, then discard the supernatant.
[0094] ⑥ Add 1 mL of 75% alcohol to wash, and let stand for 1 hour;
[0095] ⑦ Balance the liquid and centrifuge at 12000 r / min for 5 min. Discard the alcohol, remove excess liquid, and dry at room temperature.
[0096] ⑧ Add 400 μL of ddH2O, dissolve at room temperature for 30 min, and store at -20°C for later use.
[0097] 2. PCR amplification and detection
[0098] The 20 μL PCR reaction system consists of: 5 μL template DNA, 0.4 μL each of 10 μmol upstream and downstream primers, 0.4 μL of 10 mM dNTPs, 2 μL of 10×PCR buffer, 0.1 μL of rTaq enzyme, and ddH2O to make up the remaining 20 μL of the reaction system.
[0099] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 45 s, for 40 cycles; 72℃ extension for 5 min, and storage at 16℃.
[0100] The enzyme digestion system was as follows: 5 μL of PCR product, 2 μL of 10×K buffer, 0.1 μL of restriction enzyme FbaⅠ, and 20 μL of ddH2O to supplement the reaction system. Then, the enzyme digestion was carried out at 37℃ for 2 h.
[0101] The enzyme digestion products were separated by 5.0% agarose gel electrophoresis.
[0102] The primer nucleotide sequences are as follows:
[0103] Y6F242398_F:5'-AGACGGGATGCAGAAGACCACGT-3'
[0104] Y6F242398_R: 5' - CGCCTCTGTTTAGCAAGTCC - 3'.
[0105] like Figure 1 As shown, strains with a 227bp band after enzyme digestion of the amplification product are those carrying unfavorable allelic variations; strains with a 245bp band after enzyme digestion of the amplification product are those carrying favorable allelic variations.
[0106] 3. dCAPS marker genotypes were statistically analyzed in conjunction with phenotypes for some varieties. A band of 245 bp indicated a variety carrying a favorable allelic variant, while a band of 227 bp indicated a variety carrying an unfavorable allelic variant. A total of 102 varieties were found to carry favorable allelic variants, and 279 varieties carried unfavorable allelic variants. Favorable allelic variants accounted for 66% of varieties from Shandong Province. In natural populations, all varieties from Hubei, Shanghai, and Zhejiang carried unfavorable alleles; most varieties came from Jiangsu Province, with 72 out of 326 varieties carrying favorable allelic variants, accounting for 22%.
[0107] The above experiments have confirmed that detecting QTL allelic variants related to wheat scab using the dCAPS molecular marker Y6F242398 can identify allelic variants at the Qfhb.yzu-5B locus in wheat varieties. In a natural population constructed in the inventors' laboratory, 24% of the varieties carried the favorable allelic variant, indicating that most varieties did not have a mutation at this locus. Extending this marker allows for the selection of varieties carrying the favorable allelic variant at this locus during breeding, effectively avoiding the drawback of traditional breeding methods where scab resistance / susceptibility allelic variants cannot be visually identified, thus saving time and labor.
[0108] The above description of the embodiments is only for the purpose of helping to understand the method and core ideas of the present invention. It should be noted that those skilled in the art can make several improvements and modifications to the present invention without departing from the principles of the present invention, and these improvements and modifications also fall within the protection scope of the claims of the present invention.
Claims
1. A primer pair for amplifying dCAPS molecular markers at QTL-associated SNP sites in wheat scab, characterized in that, The forward primer, as shown in SEQ ID NO.1, is 5'-AGACGGV GATGCAGAAGACCACGT-3'. The reverse primer, as shown in SEQ ID NO.2, is 5'-CGCCTCTGTTTAGCAAGTCC-3'.
2. A dCAPS molecular marker for QTL-associated SNP sites in wheat scab, characterized in that, The dCAPS molecular marker, obtained by amplification using the primer pair described in claim 1, is located on the long arm of chromosome 5B of the wheat Chinese spring reference sequence.
3. The dCAPS molecular marker for wheat scab QTL-associated SNP sites according to claim 2, characterized in that, The dCAPS molecular marker is located at 388,587,273 bp on the long arm.
4. An application of the primer pair as described in claim 1, characterized in that, Application in the breeding of wheat varieties resistant to Fusarium head blight.
5. An application of the primer pair as described in claim 1, characterized in that, Application in the preparation of wheat kits resistant to Fusarium head blight.
6. A reagent kit for breeding wheat resistant to Fusarium head blight, characterized in that, Includes the primer pair as described in claim 1.
7. A method for identifying wheat scab resistance, characterized in that, Includes the following steps: Step 1: Extract genomic DNA from wheat seedling leaves to obtain the genomic DNA to be tested; Step 2: Perform PCR amplification on the genomic DNA to be tested using the primer pair described in claim 1 to obtain the PCR product; Step 3: Genuine the PCR product based on its length; When the length of the amplified product is 245bp, the wheat variety is a disease-resistant variety. When the length of the amplified product is 227 bp, the wheat variety is a susceptible variety.