Meyerozyma guilliermondii and application thereof in distiller's grains

Abstract

This invention discloses a strain of *Saccharomyces cerevisiae* and its application on baijiu (Chinese liquor) lees, relating to the field of biomanufacturing, specifically disclosing a strain of *Saccharomyces cerevisiae*. Meyerozyma guilliermondii This strain (BJZ-6, CGMCC No. 39087) can efficiently utilize xylose, tolerate inhibitors in baijiu (Chinese liquor) lees, and exhibits strong protein synthesis capabilities. This invention also provides a method for producing microbial protein from baijiu lees using liquid or solid-state fermentation with this strain. Through wet grinding pretreatment and enzymatic hydrolysis followed by fermentation, the entire component of the baijiu lees can be utilized, significantly increasing the crude protein and true protein content of the product. The strain and fermentation product can be used to prepare animal feed or feed additives.

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology and biomanufacturing, specifically relating to a strain of *Saccharomyces cerevisiae* and its application in baijiu lees. Background Technology

[0002] Baijiu lees are a byproduct of solid-state fermentation and distillation of grains such as sorghum, rice, and wheat, as well as rice husks, to extract alcohol. The production volume is enormous; in 2024, my country's annual baijiu lees production exceeded 20 million tons. Fresh baijiu lees have a high water content (65-70%), making them highly susceptible to spoilage and difficult to preserve for long periods. Drying them is energy-intensive. Baijiu lees have a low crude protein content (10%-16%), with only about 70% being true protein. They are high in cellulose, hemicellulose, and lignin. Cellulose and hemicellulose can be hydrolyzed into fermentable sugars such as glucose, xylose, and cellobiose, which are then converted into microbial protein by specific microorganisms, further increasing the protein content of the baijiu lees. However, existing industrial bacterial strains are unable to tolerate the ethanol, higher alcohols, aldehydes, ketones, and organic acids in fresh baijiu lees; and their xylose assimilation capacity is limited, resulting in low microbial conversion efficiency of xylose. Achieving efficient co-utilization of glucose and xylose remains a significant challenge.

[0003] In existing technologies, there are two main types of methods for enhancing the nutritional value of baijiu lees: One method involves directly inoculating microorganisms for solid-state fermentation of baijiu lees to increase the crude protein content and improve palatability. However, due to the high viscosity and poor heat and mass transfer of baijiu lees, the concentration of microbial growth is limited under solid-state fermentation conditions, and the concentration of enzymes and other products is low. Cellulose and hemicellulose are not truly converted into fermentable sugars, resulting in a still high fiber content after fermentation, and even an increase in fiber content. The true protein content is not substantially improved. Furthermore, the baijiu lees used in the reports are often dried, further increasing production costs and lacking practical application value.

[0004] Secondly, the baijiu lees undergo saccharification before fermentation to produce single-cell protein. Before saccharification, lignocellulose raw materials require pretreatment to break down the natural "anti-degradation barrier," allowing enzymes to access the cellulose and release fermentable sugars. Existing pretreatment methods include acid treatment, alkali treatment, and steam explosion. These methods require high temperature and pressure or strong acids and alkalis, resulting in high energy consumption, demanding equipment, and the generation of byproducts (such as furfural and phenols) that inhibit subsequent enzymatic hydrolysis and fermentation. Furthermore, these methods place high demands on the corrosion resistance of the equipment. Moreover, removing these inhibitors often requires large amounts of water for washing, leading to low processing efficiency and significant water waste, which does not meet the environmental and economic requirements of industrial production.

[0005] For example, patent CN121555334A discloses the production of single-cell protein using Kluyveromyces martensii. The process involves crushing straw (30 mesh), adding NaOH to react (solid-liquid ratio 1:20, 50℃ shaker reaction for 8 hours), filtering to obtain solids, adding HCl to the solids to adjust the pH, washing with water until the water becomes clear, and then drying the solids to constant weight. The final SCP protein yield is 0.047 g / g. In this patent, the pretreatment solid-liquid ratio is 1:20, the solid content is below 4.76%, the amount of material processed at one time is small, and repeated washing of the solids after pretreatment results in high water consumption and overall high fermentation production costs. Patent CN121592509A discloses the treatment of distiller's grains using Saccharomyces boulardii, but it employs high-temperature alkaline treatment, which produces inhibitors that hinder enzymatic hydrolysis, and ultimately only the fermentation broth is utilized, with the solid portion wasted.

[0006] Therefore, developing a low-cost, high-efficiency, environmentally friendly technology that can achieve full utilization of the components of baijiu lees and significantly improve its protein quality is an urgent technical problem to be solved in this field. Summary of the Invention

[0007] This invention aims to solve the following problems in existing technologies for improving the protein content of baijiu lees: high energy consumption in pretreatment, generation of inhibitors, need for large amounts of water washing, and low treatment efficiency; lack of excellent strains that can efficiently utilize lignocellulose hydrolysates (especially xylose) and tolerate inhibitors in baijiu lees; and the inability to achieve efficient conversion of all components of baijiu lees into high-quality protein feed.

[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution: On the one hand, the present invention provides *Saccharomyces cerevisiae*. Meyerozyma guilliermondii It is abbreviated as BJZ-6 and is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39087.

[0009] Secondly, the present invention provides a method utilizing the *Saccharomyces cerevisiae* described in the first aspect. Meyerozyma guilliermondii A method for producing microbial protein from liquid fermentation baijiu lees includes the following steps: (a) The baijiu lees are pretreated by wet grinding to obtain lees slurry; (b) The obtained lees slurry is subjected to enzymatic hydrolysis to obtain the hydrolysate; (c) The aforementioned *Saccharomyces cerevisiae* Meyerozyma guilliermondii The enzymatic hydrolysate is fermented, and the bacterial cells or whole culture are collected.

[0010] Preferably, in step (a), the wet grinding pretreatment of the baijiu lees includes: wet grinding the fresh baijiu lees until 80% of the particulate matter passes through an 80-mesh sieve, controlling the dry matter content in the wet grinding system to be 16%-33%; and / or, In step (b), the enzymatic hydrolysis of the obtained distiller's grains includes: adjusting the pH of the distiller's grains to 5.0-5.5, adding a compound enzyme, and hydrolyzing at 50-55℃ for 24-60 hours to obtain a hydrolysate; the compound enzyme is cellulase, α-amylase and saccharifying enzyme.

[0011] More preferably, the wet milling is performed by mixing fresh baijiu lees and water at a solid-liquid ratio of 1:1~2 (g / mL).

[0012] More preferably, the method is a method for producing high-purity bacterial single-cell protein, and step (c) includes: separating the solid and liquid components of the enzymatic hydrolysate, taking the supernatant as a fermentation medium, and inoculating it with the *Saccharomyces cerevisiae*. Meyerozyma guilliermondii Fermentation is carried out, and the microbial cells are collected.

[0013] More preferably, the method is a method for producing high-protein fermented baijiu lees, and step (c) includes: without solid-liquid separation, directly using the whole-component enzymatic hydrolysate containing enzymatic hydrolysis residue as the fermentation culture medium, and inoculating it with the *Gnaphalium affine*. Meyerozyma guilliermondii Fermentation is carried out, and the entire culture is dried after fermentation.

[0014] More preferably, the fermentation conditions are: *Gnaphalium guildrum* Mayerii yeast. Meyerozyma guilliermondii The inoculum size is 1% to 10%, preferably 2% to 5%; the temperature is 28-30℃, the pH is 6.0-6.5, and the culture time is 24-72 hours. During the culture process, ammonia water is added to adjust the pH, and molasses or the fermentation medium is added to supplement the carbon source.

[0015] Thirdly, the present invention provides a method utilizing the *Saccharomyces cerevisiae* described in the first aspect. Meyerozyma guilliermondii A method for producing microbial protein from solid-state fermentation of baijiu lees includes: directly using baijiu lees that have undergone ammoniation pretreatment and enzymatic hydrolysis as a solid-state fermentation culture medium, and inoculating it with the *Gnaphalium affine* yeast described in the first aspect. Meyerozyma guilliermondii Solid-state fermentation is carried out.

[0016] Preferably, the fermentation conditions are: *Gnaphalium guildrum* Mayer's yeast. Meyerozyma guilliermondii The inoculum size is 5%~20%, preferably 10%~15%; the temperature is 30-35℃, and the incubation time is 50-80h.

[0017] Fourthly, the present invention provides a bacterial single-cell protein product or a high-protein product of fermented liquor lees produced by the method described in the second aspect.

[0018] Preferably, the crude protein content of the fermented baijiu lees high-protein product is not less than 25% (dry matter basis), and the true protein content is not less than 15% (dry matter basis).

[0019] Fifthly, the present invention provides the *Saccharomyces cerevisiae* described in the first aspect. Meyerozyma guilliermondii Alternatively, the use of bacterial single-cell protein products or fermented liquor lees high-protein products produced by the method described in the second aspect in the preparation of animal feed or feed additives.

[0020] Compared with the prior art, the present invention has the following technical effects: Firstly, this invention provides a novel strain of *Saccharomyces cerevisiae*. Meyerozyma guilliermondii The strain, abbreviated as BJZ-6, combines xylose utilization, high inhibitor tolerance, and high protein production capacity, making it an excellent production strain "tailor-made" for lignocellulose raw materials such as liquor lees.

[0021] Secondly, this invention utilizes *BJZ-6* yeast for liquid fermentation of baijiu (Chinese liquor) lees. Only wet grinding pretreatment of the lees is required; this pretreatment method eliminates the need for drying, strong acids or alkalis, and high temperature and pressure, relying solely on wet grinding with a colloid mill, resulting in low energy consumption. More importantly, no water washing or detoxification is needed after pretreatment, leading to no wastewater discharge. The process is simple, economical, and environmentally friendly. The dry matter content in the enzymatic hydrolysis system reaches 10-33%, significantly increasing the single-batch processing capacity and reducing the unit product processing cost.

[0022] Thirdly, this invention provides two fermentation methods using *Saccharomyces cerevisiae* BJZ-6 to ferment baijiu (Chinese liquor) lees, enabling the production of products with varying protein content and purity. In particular, the whole-component fermentation route achieves comprehensive utilization of both soluble and insoluble fibrous residues in the baijiu lees, generating no waste and resulting in significant economic and environmental benefits. The two fermented protein products obtained are suitable for animals at different growth stages, realizing the high-value and tiered utilization of baijiu lees. Attached Figure Description

[0023] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are used to explain the invention, but do not constitute an undue limitation of the invention. In the drawings: Figure 1 This is an optical microscope image of *Saccharomyces cerevisiae* BJZ-6 in Example 1 of the present invention.

[0024] Figure 2 This is a graph showing the effect of colloid mill pretreatment on the enzymatic hydrolysis of baijiu lees in Example 2 of the present invention. In the graph, 1 represents fresh baijiu lees treated with cellulase but without wet milling; 2 represents baijiu lees treated with both wet milling and cellulase; and 3 represents the total reducing sugar content of fresh baijiu lees.

[0025] Figure 3 This is a graph showing the effect of different enzyme preparations combined with cellulase on the enzymatic hydrolysis effect in Example 3 of the present invention. In the graph, A represents the reducing sugar yield after treatment with 3% cellulase, B represents the reducing sugar yield after treatment with 3% cellulase + 0.1% α-amylase + 0.4% saccharifying enzyme, C represents the reducing sugar yield after treatment with 3% cellulase + 0.5% xylanase, D represents the reducing sugar yield after treatment with 3% cellulase + 0.5% β-glucanase, and E represents the reducing sugar yield after treatment with 3% cellulase + 0.5% pectinase.

[0026] Figure 4 This is a graph showing the effect of cellulase hydrolysis time on the hydrolysis effect of baijiu lees slurry in Example 4 of the present invention.

[0027] Figure 5 This is a graph showing the effect of solid content in the liquor lees slurry on the enzymatic hydrolysis effect in Example 5 of the present invention.

[0028] Figure 6 The growth curves of *Saccharomyces cerevisiae* BJZ1 (A), BJZ3 (B), BJZ5 (C), and BJZ6 (D) in different culture media are shown in Example 6 of this invention. YPD represents yeast extract peptone glucose medium; YPX represents yeast extract peptone xylose medium; and distillers' grains represents distillers' grains hydrolysate medium.

[0029] Information on the preservation of biological materials:

[0030] Strain name: *Gynostemma pentaphyllum* Meyerozyma guilliermondii ; Preservation institution: China General Microbiological Culture Collection Center (CGMCC); Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: December 5, 2025; Accession number: CGMCC No. 39087. Detailed Implementation

[0031] In the description of this invention, it should be noted that unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0032] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] Example 1

[0034] In this embodiment, a strain of *Saccharomyces cerevisiae* was isolated from fresh baijiu lees at the distillery and from the soil surrounding the distillery. It was identified as... Meyerozyma guilliermondii It was deposited on December 5, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 39087. The specific isolation and identification process is as follows: I. Culture medium used Zaky's enrichment medium: 30g glucose, 3g yeast extract, 5g peptone, 1g (NH4)2SO4, 0.25g KH2PO4, diluted to 1 L with distilled water, pH 6.0. Add mixed antibiotics (100 mg / L penicillin, 100 mg / L streptomycin sulfate) just before use.

[0035] Zaky's solid isolation medium (w / v): glucose 30g, yeast extract 3g, peptone 5g, (NH4)2SO4 1g, KH2PO4 0.25g, agar 20g, distilled water to a final volume of 1 L.

[0036] Non-protein nitrogen utilization screening medium: glucose 15 g / L, ammonium sulfate 2 g / L, KH2PO4 1 g / L, NaCl 1 g / L, MgSO4 0.5 g / L, FeSO4 0.01 g / L.

[0037] YPD solid culture medium and YPD liquid culture medium are commercially available products.

[0038] II. Screening Process Fresh lees from the distillery and soil from the surrounding area were selected as sampling sources for the isolation, screening, and identification of yeast strains. The specific procedures are as follows: 1. Screening of yeast strains Freshly collected baijiu lees and soil were transferred to 250 mL Erlenmeyer flasks containing 100 mL of Zaky's enrichment medium and cultured with shaking at 220 rpm and 28°C for 24 h. 20 mL of the culture was then transferred to a 500 mL Erlenmeyer flask containing 180 mL of Zaky's enrichment medium and cultured with shaking at 220 rpm and 28°C for 24 h. The culture was then serially diluted 10-fold, with 0.1 mL dilutions at 10-fold increments. 4 ~10 7 CFU / mL bacterial suspension was spread onto Zaky's isolation solid medium and incubated at 30°C for 48 h. After colony growth, strains exhibiting yeast colony morphology were selected and streaked onto plates for purification.

[0039] The selected yeast strains were inoculated onto YPD solid medium and cultured at 30℃ for 3 days. The color, texture, surface, and edge shape of the colonies were observed. Single colonies were picked and simply stained. Cell shape and size were observed under a microscope to exclude yeast strains with identical colony and cell morphology characteristics from the same sample. The selected yeast strains were inoculated onto YPD medium and cultured at 30℃ for 48 h. After fermentation, the cells were collected by centrifugation at 8000 rpm, freeze-dried, and the dry weight was recorded. The protein content of the cells was determined. The crude protein content was determined using an automated Kjeldahl nitrogen analyzer. The formula for calculating protein content (g / L) is: Protein content (g / L) = Dry weight of cells (g / L) × Crude protein content (%).

[0040] The selected yeast strains were inoculated into a non-protein nitrogen utilization screening medium and cultured at 30℃ for 48 h. After fermentation, the cells were collected by centrifugation at 8000 rpm, freeze-dried, and the dry weight of the cells was recorded. The protein content of the cells was determined, and the non-protein nitrogen conversion rate was calculated. The crude protein content of the cells was determined using a fully automated Kjeldahl nitrogen analyzer. The formula for calculating the protein content was: Protein content (g / L) = Dry weight of cells (g / L) × Crude protein content of cells (%).

[0041] The conversion rate of non-protein nitrogen is calculated as follows: nitrogen content of all cells in each sample bottle (g) / [amount of non-protein nitrogen added to each sample bottle of fermentation broth (g) × nitrogen content of non-protein nitrogen (%)] × 100 = non-protein nitrogen conversion rate (%).

[0042] The results in Table 1 show that four candidate yeast strains (BJZ-1, 3, 5, and 6) were isolated from baijiu lees and soil. In YPD-rich medium, BJZ-6 had the highest cell dry weight (6.53 g / L) and cell protein content (4.10 g / L).

[0043] In a non-protein nitrogen selection medium using ammonium sulfate as the sole nitrogen source, BJZ-6 also exhibited the highest cell dry weight (3.68 g / L), cell protein content (1.43 g / L), and non-protein nitrogen conversion rate (44.54%), significantly outperforming other strains. This study aimed to identify yeast strains with high cell protein content that can utilize inorganic nitrogen such as ammonium sulfate for growth and to conduct subsequent experiments.

[0044] Table 1. Screening of yeast strains with high cell protein and non-protein nitrogen conversion rates

[0045] 2. Identification of strains The selected BJZ-6 strain was inoculated onto YPD solid medium and cultured upside down at 30°C for 24 h to obtain single colonies. After staining with crystal violet, the colonies were observed under an optical microscope. The optical microscope image is shown below. Figure 1 As shown, the cells are mainly oval or elliptical in shape, arranged singly, in pairs, or in short chains. Single colonies were inoculated into 500 mL shake flasks containing 50 mL of YPD liquid medium and cultured at 220 rpm and 30°C for 12 h. The cells were then collected by centrifugation at 6,000 rpm and 4°C for 10 min. Total fungal DNA was extracted strictly according to the TaKaRa kit instructions.

[0046] Universal primers, ITS1 (5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO.2) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3', SEQ ID NO.3), were used to amplify the relevant genes of this strain for ITS identification. Homology analysis of the ITS gene sequences of the strain was performed using BLAST.

[0047] BJZ-6 was identified by ITS sequencing as *Saccharomyces cerevisiae*. This strain possesses both high protein synthesis capacity and efficient utilization of inorganic nitrogen, making it suitable for protein conversion from lignocellulosic raw materials such as distiller's grains.

[0048] The ITS sequence information is shown in SEQ ID NO.1: gatcattaca gtattctttt gccagcgctt aactgcgcgg cgaaaaacct tacacacagtgtctttttga tacagaactc ttgctttggt ttggcctaga gataggttgg gccagaggtt taacaaaacacaatttaatt atttttacag ttagtcaaat tttgaattaa tcttcaaaac tttcaacaac ggatctcttggttctcgcat cgatgaagaa cgcagcgaaa tgcgataagt aatatgatt gcagattttc gtgaatcatcgaatctttga acgcacattg cgccctctgg tattccagag ggcatgcctg tttgagcgtc atttctctctcaaacccccg ggtttggtat tgagtgatac tcttagtcgg actaggcgtt tgctagaaaa gtattggcatgggtagtact ggatagtgct gtcgacctct caatgtatta ggtttatcca actcgttgaa tggtgtggcgggatatttct ggtattgttg gcccggcctt acaacaacca aacaagtttg acctcaaatc aggtaggaatacccgctgaa cttaa.

[0049] Example 2

[0050] This embodiment investigated the effect of colloid mill pretreatment on the enzymatic hydrolysis of cellulase in baijiu lees, as detailed below: Fresh baijiu lees (from Wuliangye Group Co., Ltd., Yibin City, Sichuan Province) were divided into two portions. One portion was mixed with water at a solid-liquid ratio of 1:1.5 (g / mL) and then ground in a colloid mill until 80% of the particles passed through an 80-mesh sieve. The solid content after grinding was 16%. Subsequently, 50g of the ground baijiu lees slurry and fresh baijiu lees were added to two 250 mL Erlenmeyer flasks, respectively. Ammonia water was added to adjust the pH to 5.20, and the mixture was sterilized at 115℃ for 20 min. After cooling to 50℃, cellulase (enzyme activity 500,000 U / g) with a final mass concentration of 3% (dry weight of fresh baijiu lees, expressed as DM) was added and the mixture was placed in a shaker at 180 r / min and 50℃ for 48 h for enzymatic hydrolysis. After enzymatic hydrolysis, 4 mL of the hydrolysate was taken and processed as follows: the hydrolysate was centrifuged at 8000 r / min for 10 min, 2 mL of the supernatant was taken into a glass pressure-resistant bottle, 10 mL of 4% dilute sulfuric acid was added, the mixture was shaken well and placed in an autoclave, and reacted at 121℃ for 1 h. After the reaction was completed, the temperature inside the autoclave was allowed to drop to room temperature, the mixture was taken out and thoroughly mixed with a certain amount of CaCO3 to neutralize the dilute sulfuric acid. The supernatant was collected after standing, and the total reducing sugar in the direct enzymatic hydrolysate, the wet milling + enzymatic hydrolysate, and the fresh baijiu lees was determined by the DNS method (National Standard GB 5009.7-2016).

[0051] The results are as follows Figure 2 As shown, the total reducing sugar content of fresh baijiu lees is 491.84±34.87 mg / g (dry matter basis). After enzymatic hydrolysis with cellulase but without colloid milling, the reducing sugar yield of fresh baijiu lees is 161.86±12.84 mg / g, and the saccharification rate is 32.91%. After colloid milling pretreatment followed by cellulase hydrolysis, the reducing sugar yield is 255.87±14.24 mg / g, and the saccharification rate is 52.02%. This indicates that the wet milling pretreatment using colloid mills employed in this invention can effectively disrupt the fibrous structure of baijiu lees, increasing the enzymatic saccharification rate by 67% (relative value) without the need for strong acids, strong alkalis, or high temperatures and pressures, thus providing more fermentable sugars for subsequent fermentation.

[0052] Example 3

[0053] This embodiment investigated the effects of adding other types of enzyme preparations on the enzymatic hydrolysis effect of Baijiu lees slurry, as detailed below: Fresh baijiu lees (sourced the same as in Example 2) and water were mixed at a solid-liquid ratio of 1:1.5 and then ground in a colloid mill until 80% of the particles passed through an 80-mesh sieve, resulting in a solid content of 16%. 50g of the baijiu lees slurry was added to a 250mL culture flask, and ammonia was added to adjust the pH to 5.20. The mixture was sterilized at 115℃ for 20 minutes and cooled to 50℃. Different enzyme preparations were then added to a 3% (DM) concentration of cellulase for compounding: 3% cellulase alone, 3% cellulase + 0.1% α-amylase + 0.4% saccharifying enzyme, 3% cellulase + 0.5% xylanase, 3% cellulase + 0.5% β-glucanase, and 3% cellulase + 0.5% pectinase. The mixture was placed in a shaker and hydrolyzed at 180 r / min and 50℃ for 48 hours. After hydrolysis, the reducing sugar content of the hydrolysate was measured. The treatment method for the hydrolysate and the method for determining the reducing sugar content were the same as in Example 2.

[0054] The results are as follows Figure 3 The results show that after enzymatic hydrolysis of baijiu lees with 3% (DM) cellulase, 0.1% α-amylase, and 0.4% saccharifying enzyme, the reducing sugar yield and saccharification rate were 278.12±2.75 mg / g and 56.55%, respectively, significantly higher than those treated with only 3% cellulase and other combined enzyme treatments. Therefore, subsequent experiments selected 3% cellulase + 0.1% α-amylase + 0.4% saccharifying enzyme as the enzyme.

[0055] Example 4

[0056] This embodiment investigated the effect of enzymatic hydrolysis time on the enzymatic hydrolysis effect of Baijiu lees slurry, as detailed below: Fresh baijiu lees (from the same source as in Example 2) and water were mixed at a solid-liquid ratio of 1:1.5 and then ground in a colloid mill until 80% of the particles passed through an 80-mesh sieve, resulting in a solid content of 16%. 50g of the baijiu lees slurry was added to a 250mL culture flask, and ammonia was added to adjust the pH to 5.20. The flask was sterilized at 115℃ for 20min, cooled to 50℃, and then 3% (DM) of cellulase, 0.1% of α-amylase, and 0.4% of saccharifying enzyme were added, respectively. The flask was placed in a shaker and enzymatically hydrolyzed at 180 r / min and 50℃ for 24h, 36h, 48h, and 60h. After hydrolysis, the reducing sugar content of the hydrolysate from different hydrolysis times was measured. The treatment method of the hydrolysate and the method for determining the reducing sugar content were the same as in Example 2.

[0057] The results are as follows Figure 4As shown, the yield of reducing sugars in the baijiu lees gradually increases with increasing cellulase hydrolysis time. Within the hydrolysis period of 24–60 hours, the yield of reducing sugars increases with prolonged hydrolysis time. At 60 hours, the yield of reducing sugars reaches a relative peak of 285.62 ± 4.47 mg / g, with a saccharification rate of 58.07%. However, compared to 60 hours, the yield of reducing sugars at 48 hours differs by only 9.40 mg / g, the saccharification rate differs by 1.91%, and the hydrolysis time differs by 12 hours; the increase is not significant compared to the extension of the treatment time. Therefore, considering production costs, 48 ​​hours is selected as the optimal hydrolysis time.

[0058] Example 5

[0059] This embodiment investigated the effect of solid content in Baijiu lees slurry on the enzymatic hydrolysis effect, as detailed below: Fresh baijiu lees from the same source as in Example 2 were used and divided into three portions. During the grinding process, water was added at 150%, 100%, and 20% respectively to adjust the solids content of the baijiu lees slurry to approximately 16%, 20%, and 33%. 50g of the baijiu lees slurry was added to a 250mL Erlenmeyer flask, and ammonia was added to adjust the pH to 5.20. The flask was sterilized at 115℃ for 20 minutes, cooled to 50℃, and then 3% (DM) cellulase, 0.1% α-amylase, and 0.4% saccharifying enzyme were added. The flask was placed in a shaker and enzymatically hydrolyzed at 180 r / min and 50℃ for 48 hours. After hydrolysis, the reducing sugar content was measured. The method for determining the reducing sugar content was the same as in Example 1.

[0060] The results are as follows Figure 5 As shown, with the increase of solids content in the baijiu lees slurry, the reducing sugar content of the hydrolysate after enzymatic hydrolysis tends to increase, while the reducing sugar yield and saccharification rate tend to decrease. The reducing sugar content of colloid-milled baijiu lees with a solids content of 16% after enzymatic hydrolysis by cellulase was 285.39±18.96 mg / g, with a saccharification rate of 58.03%; the reducing sugar content of colloid-milled baijiu lees with a solids content of 20% after enzymatic hydrolysis by cellulase was 259.95±5.68 mg / g, with a saccharification rate of 52.85%; and the reducing sugar content of colloid-milled baijiu lees with a solids content of 33% after enzymatic hydrolysis by cellulase was 209.23±3.40 mg / g, with a saccharification rate of 42.54%. This is mainly because in high-solids enzymatic hydrolysis systems, a certain level of glucose content inhibits the catalytic effect of the enzyme, thereby reducing the saccharification rate. The fermentation process by microorganisms consumes some of the glucose, which relieves product inhibition. Therefore, the reduction in the saccharification rate of high solids content has a limited impact on subsequent fermentation.

[0061] Example 6

[0062] This example investigated the growth performance of *Saccharomyces cerevisiae* BJZ-6 in yeast extract peptone xylose medium and baijiu lees enzymatic hydrolysate, as detailed below: Fresh baijiu lees from the same source as in Example 2 were used. During the grinding process of the baijiu lees, 150% water was added to adjust the solids content of the baijiu lees slurry to 16%. 50 g of baijiu lees slurry was added to a 250 mL Erlenmeyer flask, and ammonia was added to adjust the pH to 5.20. The flask was sterilized at 115 °C for 20 min, cooled to 50 °C, and then 3% (DM) cellulase, 0.1% α-amylase, and 0.4% saccharifying enzyme were added. The flask was placed in a shaker and enzymatically hydrolyzed at 180 r / min and 50 °C for 48 h. After enzymatic hydrolysis, the hydrolysate was collected by centrifugation and the monosaccharide content was determined. The supernatant was diluted with deionized water and analyzed using a high-performance phase chromatography (HPLC) instrument (Shimadzu LC-20C). The chromatographic column was a SUGAR KS-801 (6 μm, 300 mm × 8.0 mm), the column temperature was 75℃, the detector was a RID-10A, the mobile phase was water, the flow rate was 0.6 mL / min, and the injection volume was 10 μL. The concentrations of glucose, xylose, and arabinose in the enzymatic hydrolysate of Baijiu lees were 49.56 g / L, 0.68 g / L, and 2.56 g / L, respectively.

[0063] Slant culture medium: glucose 20g / L, yeast extract 10g / L, peptone 20g / L, agar 18g / L, pH=5.5.

[0064] Activation medium, seed medium, yeast extract peptone glucose medium (YPD): glucose 20 g / L, yeast extract 10 g / L, peptone 20 g / L, pH=5.5.

[0065] Yeast extract peptone xylose medium (YPX): xylose 20 g / L, yeast extract 10 g / L, peptone 20 g / L, pH=5.5.

[0066] Distillers' grains culture medium: 50 mL of baijiu lees enzymatic hydrolysate, 0.1% ammonium sulfate, 1% corn pulp powder, and pH adjusted to 6.8 with ammonia.

[0067] Yeast strains BJZ1, BJZ3, BJZ5, and BJZ6 were stored in 25% glycerol at -80 °C. After thawing, 100 μL of each strain was inoculated into a 50 mL Erlenmeyer flask pre-filled with 20 mL of activation medium and sealed with a sealing film. The flasks were incubated at 28 °C for 24 h on a shaker at 200 rpm. One loopful of the activated bacterial culture was then inoculated onto a slant culture medium and incubated at 28 °C for 24 h. Finally, one loopful of the bacterial cells from the slant was inoculated into a 50 mL Erlenmeyer flask containing 20 mL of seed culture medium and incubated at 28 °C on a shaker at 200 rpm for 24 h. Seed cultures of four yeast strains were inoculated at a rate of 3% into 250 mL Erlenmeyer flasks, each pre-filled with 50 mL of fermentation medium: YPD, YPX, or Distillers' grains. The flasks were incubated at 28 °C in a shaker at a speed of 200 rpm for 48 h.

[0068] Sampling and OD 600 Measurement: Sampling was strictly performed every 4 hours to ensure the continuity and accuracy of the growth curve. Sampling time points were set at 0 h, 4 h, 8 h, 12 h, 16 h, 20 h, 24 h, 28 h, 32 h, 36 h, 40 h, 44 h, and 48 h. The OD of each sample was measured and recorded. 600 Absorbance value. If the sample OD 600 For values ​​>1.0, serial dilutions with sterile culture medium are required before measurement; the result must be multiplied by the dilution factor during calculation. Plot a growth curve: plot time (h) on the x-axis, OD... 600 Plot the growth curves of the four strains in three culture media with the vertical axis as the ordinate.

[0069] Figure 6 The results showed that BJZ3, BJZ5, and BJZ6 could all grow in distillers' grains hydrolysate medium. Furthermore, the growth curves (OD) of BJZ-6 in YPD, YPX, and Distillers' grains media were compared. 600 The results showed that the growth of control strains BJZ-1, BJZ-3, and BJZ-5 in YPX was almost identical, while their growth was significantly delayed. This indicates that BJZ-6 has excellent xylose co-utilization ability and is not sensitive to inhibitors (such as organic acids, fusel oils, phenols, etc.) in the saccharification liquid of baijiu (Chinese liquor) and is an excellent strain suitable for fermentation of baijiu saccharification liquid.

[0070] Example 7

[0071] This embodiment measured the protein components of the substrate remaining after enzymatic hydrolysis of Baijiu lees, as follows: Fresh baijiu lees from the same source as in Example 2 were used. During the grinding process of the baijiu lees, 150% water was added to adjust the solids content of the baijiu lees slurry to 16%. 50 g of baijiu lees slurry was added to a 250 mL Erlenmeyer flask, and ammonia was added to adjust the pH to 5.20. The flask was sterilized at 115 °C for 20 min, cooled to 50 °C, and then 3% (DM) white cellulase, 0.1% α-amylase, and 0.4% saccharifying enzyme were added. The flask was placed in a shaker and enzymatically hydrolyzed at 180 r / min and 50 °C for 48 h. After enzymatic hydrolysis, the hydrolysate and residual substrate were collected by centrifugation. The residual substrate was dried in a 65 °C oven, and the crude protein and non-protein nitrogen contents were determined using an automated Kjeldahl nitrogen analyzer. The true protein content was calculated by subtracting the non-protein nitrogen content from the crude protein content.

[0072] The results, shown in Table 2, indicate that after enzymatic hydrolysis, the crude protein and true protein contents of the 16% solids content enzymatic hydrolysate increased to 14.63% and 12.41%, respectively, which are significantly higher than those of the original baijiu lees (13.21% crude protein, 11.23% true protein). Specifically, the crude protein content increased by 10.75%, and the true protein content increased by 10.51%. This demonstrates that even without microbial fermentation, simple enzymatic hydrolysis can relatively enrich protein by degrading cellulose, providing a better nutritional basis for subsequent fermentation.

[0073] Table 2. Study on protein production from residual substrates after enzymatic hydrolysis of Baijiu lees.

[0074] Note: Different letters in the same column indicate significant differences (p<0.05).

[0075] Example 8

[0076] In this example, yeast was cultured in 250 mL Erlenmeyer flasks containing the supernatant from the enzymatic hydrolysis of baijiu lees to produce protein. The process is as follows: Fresh baijiu lees from the same source as in Example 2 were used. During the grinding process of the baijiu lees, 150% water was added to adjust the solid content of the baijiu lees slurry to 16%. 50 g of baijiu lees slurry was added to a 250 mL Erlenmeyer flask, and ammonia was added to adjust the pH to 5.20. The flask was sterilized at 115 °C for 20 min, cooled to 50 °C, and then 3% (DM) white cellulase, 0.1% α-amylase, and 0.4% saccharifying enzyme were added. The flask was placed in a shaker and enzymatically hydrolyzed at 180 r / min and 50 °C for 48 h. After enzymatic hydrolysis, the hydrolysate was collected by centrifugation and the monosaccharide content was determined. The supernatant was diluted with deionized water and analyzed using a high-performance phase chromatography (HPLC) instrument (Shimadzu LC-20C). The chromatographic column was a SUGAR KS-801 (6 μm, 300 mm × 8.0 mm), the column temperature was 75 ℃, the detector was a RID-10A, the mobile phase was water, the flow rate was 0.6 mL / min, and the injection volume was 10 μL. The HPLC results were as follows: the glucose concentration in the enzymatic hydrolysate of Baijiu lees was 59.25 g / L, the xylose concentration was 0.55 g / L, and the arabinose concentration was 3.05 g / L.

[0077] Distillers' grains culture medium: 50 mL of baijiu lees enzymatic hydrolysis supernatant, 0.1% ammonium sulfate, 1% corn syrup powder, pH adjusted to 6.5 with ammonia. Secondary seed cultures of yeast strains BJZ-5 and BJZ-6 were inoculated at a 3% inoculation rate and cultured in a shaker at 28 ℃ for 48 h at 200 rpm. The pH of the fermentation broth was measured every 12 h, adjusted to 6.5 with ammonia, and supplemented with baijiu lees hydrolysate and molasses as a carbon source. The fermentation broth was centrifuged at 8000 r / min for 10 min to obtain a precipitate. The precipitate was washed twice with deionized water, centrifuged again, and dried in a 65 ℃ oven. The dry weight of the cells was obtained. Protein content was determined using an automated Kjeldahl nitrogen analyzer. The dry weight of protein was calculated using the formula: Dry weight of protein = Dry weight of cells × Protein content.

[0078] The results are shown in Table 3. In 250 mL shake flasks, using the supernatant from the enzymatic hydrolysis of baijiu lees as the culture medium, after 48 h of fermentation, the dry weight of BJZ-6 cells was 26.40±0.4 g / L, the protein content was 52.97±1.11%, and the protein dry weight was 13.19±0.73 g / L, significantly better than BJZ-5 (13.20 g / L dry weight of cells and 7.33 g / L dry weight of protein). This indicates that BJZ-6 can efficiently utilize the sugars (glucose, xylose, etc.) in the baijiu lees hydrolysate to convert them into cell protein, making it suitable for the production of high-purity single-cell protein.

[0079] Table 3. Study on protein production from enzymatic hydrolysis supernatant of Baijiu lees.

[0080] Note: Different letters in the same column indicate significant differences (p<0.05).

[0081] Example 9

[0082] In this example, the enzymatic hydrolysis of all components of baijiu (Chinese liquor) residue in a 250 mL conical flask was performed to produce protein from yeast culture. The process is as follows: Fresh baijiu lees from the same source as in Example 2 were used. During the grinding process of the baijiu lees, 150% water was added to adjust the solid content of the baijiu lees slurry to 16%. 50 g of baijiu lees slurry was added to a 250 mL Erlenmeyer flask, and ammonia was added to adjust the pH to 5.20. The flask was sterilized at 115 °C for 20 min, cooled to 50 °C, and then 3% (DM) cellulase, 0.1% α-amylase, and 0.4% saccharifying enzyme were added. The flask was then placed in a shaker and enzymatically hydrolyzed at 180 r / min and 50 °C for 48 h. After enzymatic hydrolysis, without centrifugation, the pH was adjusted to 6.5 with ammonia, and 1% corn starch powder and 0.5% ammonium sulfate were added. The secondary seed culture of yeast strain BJZ-6 was inoculated at a rate of 3% and cultured in a shaker at 28 °C for 48 h at a shaker speed of 200 rpm. The pH of the fermentation broth was measured every 12 hours, and adjusted to 6.5 with ammonia. Carbon sources were supplemented by adding hydrolysate of baijiu lees and molasses. After fermentation, the whole-component fermentation broth of baijiu lees was dried in a tray in a 65°C oven. After drying, it was pulverized to 40 mesh and the crude protein and non-protein nitrogen content was determined using a fully automated Kjeldahl nitrogen analyzer.

[0083] The results are shown in Table 4. The entire component (including residue) after enzymatic hydrolysis was directly fermented without solid-liquid separation. After fermentation with BJZ-6, the crude protein content of the product increased from 13.35% to 25.09%, and the true protein content increased from 11.25% to 20.84%. This achieved full utilization of the baijiu lees, with no waste discharge, and the product protein content met the protein feed standard (CP≥20%).

[0084] Table 4. Study on protein production from enzymatic hydrolysis of all components of Baijiu lees.

[0085] Note: Different letters in the same column indicate significant differences (p<0.05).

[0086] Example 10 This embodiment is a scaled-up process of Example 8, using a 3L fermentation tank to produce protein from the hydrolysate of baijiu lees. The process is as follows: Using fresh baijiu lees from the same source as in Example 2, the solid content of the baijiu lees slurry was adjusted to 16% by adding 150% water during the grinding process. 450 g of the baijiu lees slurry was added to a 2L Erlenmeyer flask, and ammonia was added to adjust the pH to 5.20. The flask was sterilized at 115℃ for 20 min, cooled to 50℃, and then 3% (DM) cellulase, 0.1% α-amylase, and 0.4% saccharifying enzyme were added. The flask was then placed in a shaker and enzymatically hydrolyzed at 180 r / min and 50℃ for 48 h. After hydrolysis, the supernatant was collected by centrifugation. The supernatant was then placed in a 3L fermenter, filling it to 60% capacity, and 1% corn syrup powder and 0.5% ammonium sulfate were added. The fermenter was then sterilized at 115℃ for 15 min. After the temperature reached 28℃, the pH was adjusted to 6.5 with ammonia, and the secondary seed culture of yeast strain BJZ-6 was inoculated at a rate of 3%. Fermentation was carried out at 28℃ and dissolved oxygen of 30%-45% for 36 h. When the pH of the fermentation broth reached 5.3, the pH was automatically adjusted to 6.5 with ammonia, and carbon source was supplemented by adding hydrolysate from baijiu lees and molasses. After fermentation, the pure fermentation broth was centrifuged at 8000 r / min for 10 min, the yeast cells were collected, the precipitate was dried in a 65℃ oven, weighed, and the dry weight of the cells was obtained. The crude protein content was also determined.

[0087] The results are shown in Table 5. In a 3 L fermenter with dissolved oxygen controlled at 30-45% and carbon source and ammonia added, BJZ-6 achieved a cell dry weight of 30.74±1.12 g / L and a protein content of 58.31±0.21% after 36 hours of fermentation, with a protein dry weight of 17.92±0.71 g / L, a further improvement over the shake flask level (26.40 g / L). Therefore, BJZ-6 has good industrial scale-up potential, and high-density fermentation can efficiently produce single-cell protein.

[0088] Table 5. Study on protein production from hydrolysate of baijiu lees in a 3 L fermentation tank.

[0089] Example 11 This embodiment is a scaled-up process of Example 9, using a 3L fermentation tank to enzymatically hydrolyze the entire component of the liquor lees to produce protein. The process is as follows: Using fresh baijiu lees from the same source as in Example 2, the solid content of the baijiu lees slurry was adjusted to 16% by adding 150% water during the grinding process. 450 g of the baijiu lees slurry was added to a 2 L Erlenmeyer flask, and ammonia was added to adjust the pH to 5.20. The flask was sterilized at 115 °C for 20 min, cooled to 50 °C, and then 3% (DM) cellulase, 0.1% α-amylase, and 0.4% saccharifying enzyme were added. The flask was then placed in a shaker and enzymatically hydrolyzed at 180 r / min and 50 °C for 48 h. After enzymatic hydrolysis, the entire hydrolysate of the baijiu lees was transferred to a 3 L fermenter, filling it to 60% capacity. 1% corn syrup powder and 0.5% ammonium sulfate were added, and the fermenter was sterilized at 115 °C for 15 min. After the temperature reached 28℃, the pH was adjusted to 6.5 with ammonia, and the secondary seed culture of yeast strain BJZ-6 was inoculated at a rate of 3%. Fermentation was carried out at 28℃ and dissolved oxygen of 40%-50% for 48 hours. When the pH of the fermentation broth reached 5.3, the pH was automatically adjusted to 6.5 with ammonia, and carbon source was supplemented by adding hydrolysate of baijiu lees and molasses. After fermentation, the whole-component fermentation broth of baijiu lees was dried in a 65℃ oven on a tray. After drying, it was pulverized to 40 mesh and the crude protein and non-protein nitrogen content were determined.

[0090] The results are shown in Table 6. After high-density fermentation of the complete components of baijiu lees enzymatically hydrolyzed in a 3L fermenter, the protein content increased significantly. The crude protein content of the BJZ-6 fermented baijiu lees reached 32.09±0.54%, and the true protein content reached 23.14±0.46%, meeting the standards for protein feed (feeds with crude protein ≥20% (DM) are classified as protein feeds) and can be used directly as high-quality protein feed. This process can stably produce high-quality fermented baijiu lees protein feed at the 100-liter level (3L tank is a scale-up model) without additional separation steps, resulting in low cost and no pollution.

[0091] Table 6. Study on protein production from enzymatic hydrolysis of baijiu lees in a 3 L fermentation tank.

[0092] Note: Different letters in the same column indicate significant differences (p<0.05).

[0093] Example 12 In this embodiment, solid-state fermentation was performed using the BJZ-6 strain, and the results are as follows: Fresh baijiu lees from the same source as in Example 2 were used. After thawing, 50 g of the lees were weighed and placed in a sealed bag. 25% ammonia solution was added at 10% of the fresh lees weight, and the bag was immediately sealed. The mixture was thoroughly mixed inside the bag and pretreated with ammoniation at 65°C for 24 hours. After ammoniation, residual ammonia was removed by ventilation in a fume hood. The pH of the lees was adjusted to 5.5 with 12 mol / L sulfuric acid. 12.5 g of wheat bran was added and mixed thoroughly (the mass ratio of fresh baijiu lees to wheat bran was 4:1, serving as the control group (CK)). Then, 3% cellulase, 0.1% α-amylase, 0.4% saccharifying enzyme, and 10% BJZ-6 seed culture were added, stirred thoroughly, and fermented at 33°C for 60 hours. After fermentation, the mixture was dried at 65°C and sampled using a pulverizer. Dry matter, crude protein, non-protein nitrogen, true protein, neutral detergent fiber, and crude fiber were measured.

[0094] The results are shown in Table 7. Using an ammoniation pretreatment + enzymatic hydrolysis + solid-state fermentation process (inoculated with BJZ-6), after 60 h, the crude protein content of the product reached 25.04%, the true protein content was 16.05%, and the neutral detergent fiber (NDF) decreased from 45.50% to 43.89%. This indicates that solid-state fermentation using the strain of this invention can also significantly increase the protein content of baijiu lees and reduce the fiber content, thus improving the palatability of the product. It should be noted that the increase in true protein (+52%) is lower than the increase in crude protein (+98%), suggesting that some nitrogen sources come from non-protein nitrogen (such as residual ammonia), but the overall nutritional value is still significantly improved.

[0095] Table 7. Research on solid-state fermentation baijiu lees of BJZ6

[0096] Note: Different letters in the same column indicate significant differences (p<0.05), CP represents crude protein, and TP represents true protein.

[0097] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents. The embodiments described above merely illustrate several implementations of the invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the invention, and these all fall within the protection scope of the invention. Therefore, the protection scope of this invention should be determined by the appended claims.

Claims

1. *Saccharomyces cerevisiae* (Jieyemene) Meyerozyma guilliermondii It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39087.

2. A method utilizing the *Saccharomyces cerevisiae* as described in claim 1 (… Meyerozyma guilliermondii A method for producing microbial protein from liquid fermentation baijiu lees, characterized in that, Includes the following steps: (a) The baijiu lees are pretreated by wet grinding to obtain lees slurry; (b) The obtained lees slurry is subjected to enzymatic hydrolysis to obtain the hydrolysate; (c) The yeast of claim 1, *Gnaphalium affine* ( Meyerozyma guilliermondii The enzymatic hydrolysate is fermented, and the bacterial cells or whole culture are collected.

3. The method according to claim 2, characterized in that, In step (a), the wet grinding pretreatment of the baijiu lees includes: wet grinding the fresh baijiu lees until 80% of the particulate matter passes through an 80-mesh sieve, and controlling the dry matter content in the wet grinding system to be 16%-33%; and / or, In step (b), the enzymatic hydrolysis of the obtained distiller's grains includes: adjusting the pH of the distiller's grains to 5.0-5.5, adding a compound enzyme, and hydrolyzing at 50-55℃ for 24-60 hours to obtain a hydrolysate; the compound enzyme is cellulase, α-amylase and saccharifying enzyme.

4. The method according to claim 3, characterized in that, The method is a method for producing single-cell bacterial protein, and step (c) includes: separating the solid and liquid components of the enzymatic hydrolysate, taking the supernatant as a fermentation medium, and inoculating it with the *Saccharomyces cerevisiae* as described in claim 1. Meyerozyma guilliermondii Fermentation is carried out, and the microbial cells are collected.

5. The method according to claim 3, characterized in that, The method is a method for producing fermented baijiu (Chinese liquor) lees protein. Step (c) includes: without solid-liquid separation, directly using the whole-component enzymatic hydrolysate containing enzymatic hydrolysis residue as the fermentation culture medium, and inoculating it with the *Gnaphalium affine* yeast as described in claim 1. Meyerozyma guilliermondii Fermentation is carried out, and the entire culture is dried after fermentation.

6. The bacterial single-cell protein product produced by the method of claim 4.

7. The fermented liquor residue protein product produced by the method of claim 5.

8. The fermented liquor lees protein product according to claim 7, characterized in that, The crude protein content of the fermented liquor residue protein product is not less than 25%, and the true protein content is not less than 15%, and the crude protein content and true protein content are calculated on a dry matter basis.

9. A method using the *Saccharomyces cerevisiae* as described in claim 1 (… Meyerozyma guilliermondii A method for producing microbial protein from solid-state fermentation of baijiu lees, characterized in that, include: The pretreated and enzymatically hydrolyzed baijiu lees were directly used as a solid-state fermentation medium, and inoculated with the *Trichoderma jimonae* as described in claim 1. Meyerozyma guilliermondii Solid-state fermentation is carried out.

10. The *Saccharomyces cerevisiae* as described in claim 1 (… Meyerozyma guilliermondii The use of the single-cell protein product of claim 6 or the fermented liquor residue protein product of claim 7 or 8 in the preparation of animal feed or feed additives.

Images