Chlamydomonas reinhardtii snrk2.7 gene and application in adapting to osmotic stress and maintaining cell survival

Abstract

The present application relates to the technical field of genetic engineering, and specifically discloses a Chlamydomonas reinhardtii SnRK2.7 gene and application thereof in adaptation to osmotic stress and maintenance of cell survival. The present application first discloses SnRK2.7 the key biological function of the gene in maintaining Chlamydomonas cell homeostasis. By knocking out the gene through CRISPR / Cas9 gene editing technology and adopting an expression frame driven by an endogenous promoter for genetic back complementation, it is confirmed that SnRK2.7 the gene positively regulates cell osmotic stress tolerance and maintains cell long-term survival. In addition, the present application first discovers that the SnRK2.7 protein is specifically located in the Chlamydomonas expansion vesicle, which provides direct spatial evidence for the cell function. The above discovery not only expands the understanding of the osmotic stress signal transduction mechanism of Chlamydomonas, but also provides a new gene target and research tool for the improvement of microalgae stress adaptability, and has important basic research value and biological technology application potential.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to Chlamydomonas reinhardtii. SnRK2.7 Genes and their encoded proteins, and their applications in adapting to osmotic stress and maintaining cell survival. Background Technology

[0002] Drought, high salinity, and low temperature are important environmental factors that restrict plant growth and crop yield. These stress conditions can all induce osmotic stress, interfering with normal physiological and metabolic activities in plants and being one of the main causes of agricultural yield reduction. In recent years, significant progress has been made in the study of the molecular mechanisms of plant adaptation and tolerance to osmotic stress. Studies have shown that the SNF1-associated protein kinase 2 (SnRK2) family is a core regulatory factor in terrestrial plant responses to osmotic stress. Both an abscisic acid-independent rapid osmotic stress signaling pathway and an abscisic acid-dependent signaling pathway ultimately converge on SnRK2, fully demonstrating the pivotal role of this kinase family in osmotic signal transduction. From bryophytes to angiosperms, SnRK2 plays an increasingly diverse regulatory role in the growth, development, and stress responses of terrestrial plants.

[0003] Terrestrial plants are believed to have originated from a successfully land-dwelling aquatic algae ancestor, representing a monophyletic origin. Early differentiated green algae already exhibited dehydration responses similar to those of primitive terrestrial plants, and some algae... SnRK2 Gene expression levels are also induced by osmotic stress, leading to a crucial evolutionary question: Is the regulatory function of SnRK2 on osmotic stress pre-existing in green algae, or was it independently acquired during the adaptation of plants from aquatic to terrestrial environments? Unlike aquatic environments on land, green algae live in freshwater environments, and their survival strategies differ from those of terrestrial plants. Whether SnRK2 in green algae has developed a unique regulatory mechanism to adapt to aquatic environments after millions of years of natural selection and evolution remains to be further investigated.

[0004] Currently, the SnRK2 protein family has been systematically identified in the genomes of various flowering plants, but research on its structural characteristics, evolutionary trajectory, biological functions, and regulatory networks in green algae remains very limited. *Chlamydomonas reinhardtii* (… Chlamydomonas reinhardtii As a single-celled green alga, *Chlamydomonas reinhardtii* diverged from chain plants more than a billion years ago and is an important model organism for studying plant evolutionary biology and stress adaptation mechanisms. Although studies have identified members of the SnRK2 family encoding the *Chlamydomonas reinhardtii* genome, the biological functions of these genes have yet to be systematically studied, and their molecular mechanisms and regulatory networks remain unresolved. Summary of the Invention

[0005] The purpose of this invention is to provide Chlamydomonas reinhardtii. SnRK2.7To explore the application of the SnRK2 kinase family in the field of stress biology, and its role in adapting cells to osmotic stress and maintaining Chlamydomonas cell survival.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: This invention provides a *Chlamydomonas reinhardtii* species. SnRK2.7 The gene, whose complete open reading frame is 3411 bp in length from the start codon to the stop codon, is shown in SEQ ID NO.1. The coding region CDS sequence is shown in SEQ ID NO.2, which encodes a protein kinase consisting of 372 amino acids, and its amino acid sequence is shown in SEQ ID NO.3.

[0007] The above SnRK2.7 The gene-encoded protein may also include a protein derived from (1) having the protein function of (1) formed by substitution, deletion or addition of one or more (e.g., 1-30; preferably 1-20; more preferably 1-10, such as 5, 3) amino acid residues of the amino acid sequence of SEQ ID NO.3; or a protein derived from (1) having the protein function of (1) having 80% (preferably more than 90%, such as 95%, 98%, 99% or higher) homology with the protein sequence defined in (1).

[0008] Containing the above SnRK2.7 Recombinant gene expression vectors, transgenic cell lines, recombinant algal strains, or transgenic organisms are all within the scope of protection of this invention. The transgenic organisms include, but are not limited to, algae, photosynthetic bacteria, and terrestrial plants.

[0009] This invention discloses for the first time Chlamydomonas reinhardtii. SnRK2.7 Novel functions of genes in regulating osmotic stress tolerance and maintaining cell survival. Using CRISPR / Cas9 gene editing technology, [the following was achieved]. SnRK2.7 Knockout mutant ( snrk2.7 Under simulated drought (PEG treatment) and high salt stress conditions, the mutant showed a lower growth rate than the wild type; however, this growth was driven by an endogenous promoter. SnRK2.7 After gene replacement, the phenotype of the replaced lines could be completely restored to the wild-type level. Furthermore, under normal culture conditions (no osmotic stress), with prolonged culture time, snrk2.7 The mutant culture medium gradually turned yellow, contrasting sharply with the deep green of the wild-type and reintroduced strain cultures, indicating decreased mutant cell viability. Further observation of cell morphology using an optical microscope revealed that after 7 days of normal culture... snrk2.7 In the mutant, most cells showed cell membrane rupture, leakage of contents, or cell degradation, while wild-type and replacement strains maintained intact cell structure.

[0010] The above results indicate that SnRK2.7 Genes play a crucial role in maintaining cellular homeostasis. Further research revealed that the SnRK2.7 protein is specifically located in contractile vacuoles (osmotically regulated organelles responsible for the expulsion of intracellular water); simultaneously, snrk2.7 The mutant was highly sensitive to the V-ATPase-specific inhibitor concanamycin A, which interferes with the normal function of the contractile vacuole. Based on the above localization and inhibitor sensitivity results, it is speculated that the biological function of the SnRK2.7 protein may be closely related to its localization within the contractile vacuole.

[0011] Based on the above findings, the present invention described SnRK2.7 Genes can be used to improve the adaptability and survival rate of Chlamydomonas reinhardtii and other green algae under long-term culture or osmotic stress conditions, promote biomass accumulation, and provide important genetic resources for microalgae bioengineering.

[0012] It should be noted that the functions of the genes protected by this invention include not only those described above. SnRK2.7 Genes, including homologous genes with high homology (such as above 80%; better than 90%; better than 95%; better than 98%) as specified in SEQ ID NO.1.

[0013] Advantages of this invention: This invention reveals for the first time in *Chlamydomonas reinhardtii*. SnRK2.7 This study identified the key function of the SnRK2 gene in maintaining long-term cell survival and confirmed that its encoded protein is specifically located in the contractile vacuole—a core osmotic regulatory organelle in green algae responsible for water efflux. This discovery not only provides important clues for understanding the functional evolution of SnRK2 family proteins in green algae but also lays the molecular foundation for elucidating the contractile vacuole-mediated cellular homeostasis regulation mechanism. Furthermore, by constructing knockout mutants and complementation lines, this invention clarified the positive regulatory role of SnRK2.7 in maintaining long-term cell survival and adapting to osmotic stress, providing directly applicable gene elements for the genetic improvement of green algae. This gene resource can be used to improve the growth performance and culture stability of green algae under long-term culture and stress conditions such as salinity, alkalinity, and drought, promoting biomass accumulation. It has significant scientific research value and industrial application prospects, especially suitable for large-scale microalgae culture and bioproduct production. Attached Figure Description

[0014] Figure 1 : SnRK2.7 Molecular identification results of gene knockout mutants are used to prove that the target gene has been successfully inserted into the foreign gene; Figure 2The immunoblotting results of the SnRK2.7-Venus-Flag fusion protein driven by the endogenous promoter in the mutant background were used to confirm the successful construction of the reinjection line. Figure 3 : snrk2.7 The growth phenotypes of mutants under simulated drought (25% PEG 6000) and high salt (0.1 M and 0.15 M NaCl) stress conditions were investigated. Results showed that after one week of culture on solid media containing the corresponding stress agents, the growth rate of the mutants was lower than that of the wild type, while the reintroduced lines recovered to wild-type levels. Figure 4 : snrk2.7 Cell survival of mutants after one week of culture under normal liquid culture conditions (no osmotic stress). The results showed that the mutant culture medium was significantly yellowed and cell viability decreased, while the wild-type and recombinant strain cultures remained a normal dark green. Figure 5 Subcellular localization results of SnRK2.7 protein. The fluorescence signal of the SnRK2.7-Venus fusion protein showed that this protein was mainly concentrated in the anterior region of Chlamydomonas cells; co-localization analysis of SnRK2.7-mCherry and the contractile vacuole marker protein (Venus marker) further confirmed that the SnRK2.7 protein is specifically localized to contractile vacuoles. Figure 6 Association analysis of SnRK2.7 protein with contractile vacuole functional integrity. Treatment with the V-ATPase-specific inhibitor concanamycin A... snrk2.7 The survival rate of mutant cells was lower than that of wild-type and reintroduced lines, indicating that the function of SnRK2.7 protein depends on the integrity of the contractile vacuole structure. Detailed Implementation

[0015] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0016] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0018] Unless otherwise stated, the implementation of this invention will utilize conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques have been fully explained in published literature. Furthermore, the methods employed in this invention, including DNA extraction, phylogenetic tree construction, gene editing methods, gene editing vector construction, and the acquisition of gene-edited plants, except for those used in the examples below, can all be implemented using methods already disclosed in existing literature.

[0019] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0020] Example 1 snrk2.7 Acquisition of mutants Sequences of SnRK2 family members were obtained based on previous studies, including genomic sequences. SnRK2.7 The gene sequence is 3,411 bp in length and consists of 372 amino acid residues. Its nucleotide sequence is shown in SEQ ID NO.1, its CDS sequence is shown in SEQ ID NO.2, and its encoded protein sequence is shown in SEQ ID NO.3.

[0021] Previously, there was no information about *Chlamydomonas rhine*. SnRK2.7 Regarding the reporting of gene function, the applicant conducted the following research and made the first discovery SnRK2.7 Genes play an important role in maintaining cell survival.

[0022] CRISPR / Cas9 gene knockout (1) Using an online gRNA design tool (http: / / crispr.hzau.edu.cn), targeting SnRK2.7A gRNA sequence (SnRK2.7-gRNA) was designed to target the gene region. The knockout efficiency and potential off-target risk of each candidate gRNA were comprehensively evaluated, and the gRNA sequence with the best score was selected.

[0023] Among them, SnRK2.7-gRNA (5'-3'): CATCTGCATGGAGTACGCGT (SEQ ID NO.4).

[0024] (2) Nanjing Genscript Biotech Co., Ltd. was commissioned to synthesize gRNA with backbone and chemical modification. The gRNA was dissolved and diluted with sterile water to a final concentration of 40 μM, aliquoted and stored at -20 ℃ for later use.

[0025] (3) Add the following components to a sterile PCR tube in sequence to prepare a 10 μL RNP reaction system (Table 1), incubate at 37 ℃ for 15 min, and store at room temperature for later use.

[0026] Table 1 RNP reaction system

[0027] (4) According to SnRK2.7 For the genomic sequences flanking the gene target site, upstream and downstream primers containing 50 bp homologous arms were designed (Table 2). PCR amplification was performed using a plasmid containing a selection marker for resistance to Norilskine as a template to obtain a DNA fragment for homologous recombination repair. This fragment contains 50 bp homologous arms at each end, consistent with the flanking sequences of the target site, to guide homologous recombination repair after double-strand breaks.

[0028] 2. snrk2.7 Acquisition of mutants Chlamydomonas cells (OD) 750 = 0.5~0.6) were heat-shocked in a 40 ℃ water bath for 30 min, and the cell pellet was collected by centrifugation and resuspended in CRISPR resuscitation solution to a final concentration of 2×10. 8 Cells / mL. An antibiotic resistance gene fragment (containing 50 bp homologous arms at both ends) and an RNP complex were added to the cell suspension, gently mixed, and transferred to a 2 mm electroporation cuvette. Electroporation was performed using a BTX electroporator (350 V, 25 Ω, 600 μF). After electroporation, the cuvette was incubated at 16 °C for 1 h to allow cell recovery. The cell suspension was then transferred to a centrifuge tube containing 8 mL of CRISPR recovery medium and cultured under low light conditions for 24 h to promote homologous recombination repair and antibiotic resistance gene expression.

[0029] After resuscitation and culture, cells were evenly spread onto TAP solid plates containing nooresistive antibiotics (final concentration 10 μg / mL) using the embedding method, and cultured upside down until green single clones appeared. Single clones were picked and transferred to fresh antibiotic plates for expansion culture, and genomic DNA was extracted for PCR amplification and verification (Table 2). This confirmed that positive mutants had an insertion of the antibiotic resistance gene fragment at the target site. Figure 1 This allows for gene knockout.

[0030] Table 2. SnRK2.7 Primers used for gene knockout

[0031] Example 2 snrk2.7 Obtaining mutant replacement algal strains 1. Construction of SnRK2.7 complement vector To construct the SnRK2.7 complementation vector, genomic DNA of *Chlamydomonas reinhardtii* was first extracted using the phenol-chloroform method. Using this genomic DNA as a template, PCR amplification was performed using Phanta Max Master Mix (Vazyme, 2×) high-fidelity DNA polymerase to obtain the region containing its own promoter (from upstream of the transcription start site to the stop codon) and the complete coding region. SnRK2.7 A genomic DNA fragment encompassing all exons, introns, and cis-regulatory elements; containing a 3,411 bp open reading frame (ORF) sequence (as shown in SEQ ID NO.1) encoding a mature protein of 372 amino acids (as shown in SEQ ID NO.3). The complementation expression vector used the pRAM118 plasmid containing the Venus-Flag sequence as its backbone, carrying a hygromycin resistance selection marker; the above-mentioned expression was expressed using the MultiF Seamless Assembly Mix (ABclonal, 2×) seamless cloning kit. SnRK2.7 The amplified fragment was ligated into the vector to construct an endogenous promoter-driven SnRK2.7 complementation expression vector.

[0032] 2. Obtaining the replenished algal strain The linearized SnRK2.7-Venus-Flag fusion expression vector was introduced into Chlamydomonas reinhardtii using electroconversion. snrk2.7 Mutant. snrk2.7 The mutant was cultured to the logarithmic growth phase (OD). 750= 0.3~0.5), after two transfers for activation, the cells were expanded to 500 mL and cultured until the logarithmic growth phase. Logarithmic growth phase cells were collected, centrifuged, washed twice with electroporation buffer (MAXEfficiency Transformation Reagent, Invitrogen), and finally resuspended at 2×10⁻⁶. 8 The cell suspension was gently mixed with the linearized vector fragment and transferred to a 2 mm electroporation cuvette for transformation using a NEPA 21 electroporator. The electroporation parameters were set as follows: pulse voltage 200 V, pulse duration 8 ms, pulse interval 50 ms, number of pulses 2, attenuation rate 40%, and positive polarity; the transport pulse parameters were: voltage 20 V, pulse duration 50 ms, pulse interval 50 ms, number of pulses 5, attenuation rate 40%, and alternating positive and negative polarity.

[0033] Immediately after electroporation, cells were transferred to resuscitation buffer and incubated at room temperature in the dark for 6 hours. Resuscitated cells were collected by centrifugation and plated onto solid selection medium containing 25 mg / L hygromycin, then cultured under low light conditions until green monoclonal antibodies appeared. Molecular identification was performed by PCR amplification and Western blotting to confirm the correct integration and expression of the complement vector.

[0034] Centrifuge and collect 3×10 7 Algal cells were resuspended in an appropriate amount of protein lysis buffer and then lysed using a liquid nitrogen freeze-thaw cycle. The cells were then centrifuged at low temperature, and the supernatant was collected. 5×SDS loading buffer was added, and the mixture was heated at 99 °C for 10 min to denature the proteins. The denatured samples were separated by SDS-PAGE, transferred to a PVDF membrane, and then incubated with specific antibodies for detection. Results are as follows: Figure 2 As shown, a specific band of the SnRK2.7-Flag fusion protein was detected in the replenished algal strain, while the wild-type and... snrk2.7 The absence of a corresponding signal in the mutant (negative control) indicates that the SnRK2.7 complement vector has been successfully integrated and correctly expressed.

[0035] Example 3 snrk2.7 Analysis of the growth status of mutants under osmotic stress For evaluation snrk2.7. To investigate the mutant's response to osmotic stress, two types of stress-treated plates were prepared. First, 5 mM MES solution (pH 7.2–7.4) and TAP medium containing 1.5% agar (pH 7.2–7.4) were prepared and sterilized at 121 °C for 20 min. 25 mL of the TAP medium was poured into a 60 mm diameter petri dish and allowed to solidify. Separately, PEG 6000 was added to the MES solution to a final concentration of 25% (w / v), mixed thoroughly, and 25 mL of this solution was poured over the TAP plate. The plate was allowed to equilibrate overnight, and the supernatant was discarded the next day and dried to obtain an osmotic stress plate containing 25% PEG 6000. Second, when preparing the TAP solid medium, NaCl was added to a final concentration of 0.1 M or 0.15 M, respectively. After sterilization, the plates were poured to prepare salt stress plates.

[0036] The Chlamydomonas strain to be tested was cultured to the logarithmic growth phase, and the OD was measured. 750 The cell concentration was determined by the value and adjusted to 2×10⁻⁶ using TAP liquid medium. 6 cells / mL (OD) 750 ≈ 0.3), and then performed a 10-fold serial dilution to obtain 2×10 5 2×10 4 and 2×10 3 A series of cell suspensions with cell concentrations of 100 cells / mL were prepared. 5 μL of each concentration suspension was taken and spotted onto a treatment plate in a longitudinal arrangement of different genotype algal strains and a horizontally increasing order of cell concentration from low to high. After the droplets were absorbed, the plate was inverted and cultured under continuous light for one week to observe the differences in growth phenotypes among the algal strains.

[0037] The results showed that after one week of cultivation on plates containing 25% PEG 6000 (simulated drought stress) or 0.1 M / 0.15 M NaCl (high salt stress), snrk2.7 The growth of the mutant was inhibited, and the colony formation was significantly lower than that of the wild-type control; while the replenished algal strain recovered to a growth level similar to that of the wild type. Figure 3 This shows that, SnRK2.7 The deletion of the gene reduces the tolerance of Chlamydomonas reinhardtii to osmotic stress, and this phenotype can be rescued by exogenous complementation vectors.

[0038] Example 4 snrk2. Cell viability analysis of 7 mutants under long-term normal culture conditions Under constant illumination (100 μmol photons m) -2 s -1 Under these conditions, wild-type and... snrk2.7 Mutants and replacement lines. Results showed ( Figure 4a) By day 7 of cultivation, snrk2.7 The culture medium of the mutant was significantly yellowed, while the culture medium of the wild type remained a normal dark green, indicating that the survival rate of the mutant cells was significantly lower than that of the wild type; the culture medium of the reintroduced strain was the same color as that of the wild type, and the phenotype was restored to the level of the wild type.

[0039] Further observation of cell morphology using an optical microscope (equipped with a 100× objective lens) revealed the following results: Figure 4 b): After 7 days of normal culture... snrk2.7 In the mutant, most cells showed cell membrane rupture, leakage of contents, or cell degradation, while wild-type and replacement strains maintained intact cell structure.

[0040] The above results indicate that SnRK2.7 Gene deletion can lead to decreased cell viability of Chlamydomonas reinhardtii under long-term normal culture conditions, while gene restoration can completely reverse this defect.

[0041] Example 5: Subcellular localization analysis of SnRK2.7 protein To clarify the subcellular localization characteristics of SnRK2.7 protein in Chlamydomonas reinhardtii, this study used confocal microscopy for observation and analysis.

[0042] 1. SnRK2.7 protein localization analysis Algal strains expressing the SnRK2.7-Venus fusion protein were cultured to the logarithmic growth phase. Algal cells were collected, and 5 μL of cell suspension was used to prepare slides for confocal microscopy. Images were acquired using a Zeiss LSM 900 inverted laser confocal microscope (equipped with a 63× objective lens). The excitation / emission wavelengths for each fluorescence channel were set as follows: 475 nm / 525 nm for the Venus channel and 632 nm / 679 nm for the chlorophyll autofluorescence channel. After imaging, the images were post-processed using the Airyscan processing module to improve the signal-to-noise ratio and resolution.

[0043] Confocal imaging results ( Figure 5 a) The fluorescence signal of the SnRK2.7-Venus fusion protein was mainly concentrated in the anterior end of Chlamydomonas cells and the region below the flagella, while the contractile vacuoles were located in this region, suggesting that the SnRK2.7 protein may be located in the contractile vacuoles.

[0044] 2. Construction of Chlamydomonas dual-fluorescent expression algal strain To verify whether the SnRK2.7 protein is localized to contractile vacuoles, we constructed a Chlamydomonas dual-fluorescent expression strain. First, we obtained a strain (CSI_LW10E3) with a Venus fluorescent protein-labeled contractile vacuole from the Chlamydomonas Resource Center at the University of Minnesota. Using the pMJ016C vector as a backbone, we constructed the SnRK2.7-mCherry fusion expression vector, which contains... SnRK2.7 The full-length sequence of the gene (as shown in SEQ ID NO.1) is followed by the fusion of the mCherry fluorescent protein gene and the HA tag sequence, and carries a spectinomycin resistance gene as a selection marker.

[0045] After linearizing the above-mentioned vector, it was transformed into Chlamydomonas cells with Venus labeling using a NEPA 21 electroporator. The electroporation parameters were set as follows: electroporation pulse voltage 200 V, pulse duration 8 ms, pulse interval 50 ms, number of pulses 2, attenuation rate 40%, and positive polarity; the transmission pulse parameters were: voltage 20 V, pulse duration 50 ms, pulse interval 50 ms, number of pulses 5, attenuation rate 40%, and alternating positive and negative polarity.

[0046] Immediately after electroporation, cells were transferred to resuscitation buffer and incubated at room temperature in the dark for 6 h. Cells were then collected by centrifugation and plated onto TAP solid selection medium containing 150 mg / L spectinomycin. The cells were incubated upside down under low light conditions until green monoclonal colonies appeared. Molecular identification was performed by PCR amplification and Western blotting to screen for algal strains stably expressing the SnRK2.7-mCherry fusion protein.

[0047] 3. Microscopic observation of algal strains expressing dual fluorescence Algal strains expressing the SnRK2.7-mCherry fusion protein were cultured to the logarithmic growth phase. Algal cells were collected, and 5 μL of cell suspension was used to prepare slides for confocal microscopy. Images were acquired using a Zeiss LSM 900 inverted laser confocal microscope (equipped with a 63× objective lens). The excitation / emission wavelengths for each fluorescence channel were set as follows: Venus channel 475 nm / 525 nm, mCherry channel 587 nm / 610 nm, and chlorophyll autofluorescence channel 632 nm / 679 nm.

[0048] The results show that ( Figure 5(b) The Venus fluorescence signal labeled with contractile vacuoles highly overlaps with the SnRK2.7-mCherry signal, indicating a clear co-localization between the two. This result demonstrates that the SnRK2.7 protein is specifically localized in the contractile vacuoles of Chlamydomonas, a key organelle involved in maintaining cellular homeostasis. This clear subcellular localization provides important morphological evidence for a deeper understanding of the functional mechanisms of SnRK2.7 in maintaining long-term cell survival.

[0049] Example 6: Association Analysis of SnRK2.7 Protein with Contractile Vacuole Functional Integrity To investigate the association between SnRK2.7 protein function and contractile vacuoles, this study treated Chlamydomonas cells with the V-ATPase-specific inhibitor concanamycin A (Conc A), which can interfere with the normal function of contractile vacuoles.

[0050] wild type, snrk2.7 The mutant and the replacement lines were cultured to the exponential growth phase, and then treated with concanamycin A. One day after treatment, the culture medium of the wild-type and the replacement lines remained green, while... snrk2.7 The mutant culture medium turned noticeably white ( Figure 6 a). Further, using fluorescein diacetate (FDA) as a fluorescent probe, the viability of the treated cells was detected by flow cytometry. The results showed that most wild-type and replacement cell lines maintained high viability, while... snrk2.7 The mortality rate of mutant cells was higher than that of wild-type and reintroduced lines. Figure 6 b). The above results indicate that impaired bubble function can lead to snrk2.7 The mutant cells showed significantly reduced activity, suggesting that the function of the SnRK2.7 protein depends on the integrity of the contractile vacuole structure.

[0051] Based on the above results, SnRK2.7 protein is located in the contractile vacuole, and its function is closely related to the integrity of the contractile vacuole. Together, they constitute a regulatory module that coordinates cell homeostasis and long-term survival.

Claims

1. Chlamydomonas reinhardtii SnRK2.7 Genes, characterized by, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The Chlamydomonas reinhardtii according to claim 1 SnRK2.7 Gene-encoded proteins are characterized by, The amino acid sequence of the protein it encodes is shown in SEQ ID NO.3, and the protein is located in the contractile vacuoles of Chlamydomonas reinhardtii.

3. Containing the contents of claim 1 SnRK2.7 Recombinant algal strains.

4. The application of the gene according to claim 1, the protein according to claim 2, or the recombinant algal strain according to claim 3 in adapting to osmotic stress and maintaining cell survival.

5. The application according to claim 4, characterized in that, Under simulated drought and high salt stress conditions snrk2.7 The growth rate of the knockout mutant was significantly lower than that of the wild type, and the reintroduced algal strain could fully recover to the wild type phenotype. Furthermore, under normal culture conditions, as the culture time increases, snrk2.7 The knockout mutant culture medium gradually turned yellow, and the cells showed signs of cell membrane rupture, leakage of contents, or cell degradation, while the wild-type and replenished strain culture medium remained dark green, and the cells maintained their intact cell structure.

6. A method for improving cell tolerance to osmotic stress and maintaining cell survival, characterized in that, The Chlamydomonas rhinestones as described in claim 1 SnRK2.7 Genes were transferred into the target algal strain, and transgenic algal strains were obtained through screening. The transgenic algal strains exhibited higher cell viability under long-term culture conditions than the original target algal strains. Furthermore, under drought and high-salt stress conditions, the transgenic algal strains showed greater tolerance to osmotic stress than the original target algal strains. SnRK2.7 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the target algal strain is Chlamydomonas reinhardtii.

Images