Pseudomonas putida engineering strain with high astaxanthin production and construction method and application thereof

By constructing an engineered strain of *Pseudomonas putida*, integrating the mevalonate pathway and ERG gene, and utilizing a dual-plasmid system expression module, the problems of product inhibition and cytotoxicity in astaxanthin production were solved, achieving efficient and stable astaxanthin synthesis, reducing costs, and making it suitable for green biomanufacturing.

CN122629104APending Publication Date: 2026-08-25QINGDAO AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610579947.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-29
Publication Date
2026-08-25

AI Technical Summary

Technical Problem

In the existing technology, *Pseudomonas putida* faces challenges in product inhibition and cytotoxicity during astaxanthin production, and the raw material costs are high, the production cycle is long, making it difficult to achieve efficient and controllable large-scale production.

Method used

An engineered strain of *Pseudomonas putida* was constructed through genetic modification. The key gene cluster of the mevalonate pathway from *Enterococcus faecalis* and the ERG gene from *Saccharomyces cerevisiae* were integrated. The lycopene synthesis module and astaxanthin modification module were expressed using a dual plasmid system. The induction timing and intensity were optimized to achieve efficient production of astaxanthin.

Benefits of technology

It significantly improved the yield and carbon source conversion rate of astaxanthin, reduced production costs, and achieved efficient and stable astaxanthin synthesis, making it suitable for green biomanufacturing and circular economy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122629104A_ABST
    Figure CN122629104A_ABST
Patent Text Reader

Abstract

This invention discloses a high-astaxanthin-producing *Pseudomonas putida* strain, its construction method, and its applications, belonging to the fields of synthetic biology and microbial metabolic engineering. Using the industrial microorganism *Pseudomonas putida* KT2440 as the substrate bacterium, this invention utilizes genome site-specific integration technology to stably integrate key gene clusters of the mevalonate pathway from *Enterococcus faecalis* and *Saccharomyces cerevisiae* into the substrate bacterium genome, providing a sufficient and stable precursor supply for terpene synthesis. Simultaneously, this invention constructs two independent and compatible broad-host expression plasmids, including plasmid pVLT31- crtEBIY - idi The plasmid pBbB5k- is responsible for efficiently converting the upstream precursor into the key intermediate lycopene. crtZW This method is responsible for sequentially hydroxylating and ketolizing lycopene to ultimately generate astaxanthin. The construction method provided by this invention not only ensures the stability of precursor supply but also achieves flexible regulation and balance of metabolic flux in the synthetic pathway through modular expression with dual plasmids, effectively avoiding the accumulation of intermediate products and cytotoxicity issues. This provides a novel cell factory with great application potential for the green, efficient, and large-scale biomanufacturing of astaxanthin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of synthetic biology and microbial metabolic engineering technology, specifically relating to a high-astaxanthin-producing Pseudomonas putida strain, its construction method, and its application. Background Technology

[0002] Astaxanthin is a ketone carotenoid with powerful antioxidant activity, widely used in aquaculture, health products, cosmetics, and food additives. Astaxanthin is primarily derived from extraction from Haematococcus pluvialis and through chemical synthesis. However, this method suffers from high costs and the presence of isomer contamination. Microbial production of astaxanthin is a highly efficient, controllable, and environmentally friendly new technology. Compared to chemical synthesis, it can specifically produce highly bioactive natural L-astaxanthin with no harmful chemical residues and high product purity. Compared to Haematococcus pluvialis extraction, the production cycle is shortened from months to days, and fermentation tanks enable year-round, large-scale production, unaffected by climate or geography. Furthermore, synthetic biology tools allow for precise metabolic engineering of strains, continuously optimizing yield and energy efficiency while significantly reducing land and water resource consumption, making it a sustainable and environmentally friendly industrial production path.

[0003] Pseudomonas putida ( Pseudomonas putida This is a star industrial chassis for synthesizing terpenoids, with advantages including excellent stress tolerance, a powerful central metabolic flux, and flexible substrate utilization. *Pseudomonas putida* exhibits high tolerance to hydrophobic products, effectively resisting membrane stress and toxicity caused by terpene molecules, thus overcoming product inhibition bottlenecks common in chassis such as *E. coli*. Simultaneously, it possesses strong reducing power supply and energy metabolism capabilities, efficiently driving energy-intensive redox reactions in terpene synthesis. It can utilize inexpensive or even waste carbon sources such as glucose, glycerol, and lignin derivatives, reducing production costs.

[0004] Currently, this strain has been used to synthesize high-value terpenoids such as adenophoradiene (a precursor to artemisinin), lycopene, and farnesene. Through systems metabolic engineering, its yield is continuously increasing. Its application is moving from basic research to large-scale biomanufacturing, providing a green and efficient cell factory solution for the production of fragrances, pharmaceuticals, and nutritional products. However, there are currently no reports on the production of astaxanthin by *Pseudomonas putida*. Summary of the Invention

[0005] Based on the above needs, the purpose of this invention is to provide a high-yield astaxanthin-producing *Pseudomonas putida* engineered strain, its construction method, and its applications. This invention obtains a recombinant *Pseudomonas putida* strain through genetic modification and also provides a method for further fermenting and producing astaxanthin using the engineered *Pseudomonas putida* strain as a chassis cell. The engineered *Pseudomonas putida* strain can efficiently produce astaxanthin using glucose as a carbon source.

[0006] To achieve the above-mentioned objectives, the present invention employs the following technical solution: This invention provides a method for constructing a high-astaxanthin-producing engineered strain of *Pseudomonas putida*, the method comprising the following steps: (1) Synthesis mvaES Genes will mvaES Genes are linked to vector frameworks to construct a gene containing... mvaES A gene recombination vector is transformed into E. coli to obtain a gene containing... mvaES Gene-derived E. coli; synthesis ERG Genes will ERG Genes are linked to vector frameworks to construct a gene containing... ERG A gene recombination vector is transformed into E. coli to obtain a gene containing... ERG Genetically modified E. coli; (2) Containing mvaES Using *E. coli* as the donor bacterium and *Pseudomonas putida* as the recipient bacterium, genome integration was performed to obtain a strain containing... mvaES *Pseudomonas putridae*, a bacterium containing the gene *Pseudomonas putridae*. ERG E. coli containing the gene is used as the donor bacterium. mvaES *Pseudomonas putida*, a gene-containing bacterium, underwent genome integration as a recipient bacterium, and after screening and verification, bacteria containing the gene were obtained. mvaES Genes and ERG The engineered strain DM1; (3) Synthesis crtZW Genes, will the crtZW Genes are linked to vector frameworks to obtain genes containing crtZW Gene recombinant vectors were used; and transformed into E. coli to obtain genes containing crtZW Genetically modified E. coli; (4) Synthesis crtEBIY Genes and id Genes, will the crtEBIY Genes and id Genes are linked to vector frameworks to obtain genes containing crtEBIY Genes and id Gene recombinant vectors were used; and transformed into E. coli to obtain genes containing crtEBIY Genes and id Genetically modified E. coli; (5) The contents of the above crtZW The recombinant vector containing the gene was transformed into the engineered strain DM1 by conjugation to obtain the engineered strain DM2; crtEBIY Genes and id The recombinant vector of the gene was transformed into the engineered strain DM2 to obtain the high-astaxanthin-producing Pseudomonas putida engineered strain.

[0007] Furthermore, the aforementioned mvaES The nucleotide sequence of the gene is shown in SEQ ID NO.1; ERG The nucleotide sequence of the gene is shown in SEQ ID NO.2; crtEBIY The nucleotide sequence of the gene is shown in SEQ ID NO.3; crtZW The nucleotide sequence of the gene is shown in SEQ ID NO.4; id The nucleotide sequence of the gene is shown in SEQ ID NO.5.

[0008] Furthermore, in step (1), the vector framework is pK18; the recombinant vector is pK18- mvaES The recombinant vector is pK18- ERG .

[0009] Furthermore, in step (3), the vector framework is pBbB5k, and the recombinant vector is pBbB5k- crtZW .

[0010] Furthermore, in step (4), the vector framework is pVLT31, and the recombinant vector is pVLT31- crtEBIY - id .

[0011] Furthermore, the volume ratio of the recipient bacteria to the donor bacteria is 1:4~6.

[0012] The present invention also provides an engineered strain of *Pseudomonas putida* constructed using the aforementioned construction method.

[0013] Furthermore, the microbial engineered strain DM3 that synthesizes astaxanthin was inoculated into M9 medium with a final concentration of 2% glucose to produce astaxanthin.

[0014] Furthermore, based on the volume of the M9 culture medium, the M9 culture medium contains 2-5% glucose by volume.

[0015] Furthermore, the optimal IPTG induction concentration for the engineered strain DM3 is 0.5 mM.

[0016] Furthermore, the engineered strain of *Pseudomonas putida* produces astaxanthin at a yield of not less than 5 mg / L.

[0017] Furthermore, the astaxanthin yield of the microbial engineered strain DM3, which is suitable for synthesizing astaxanthin, can reach 5.223 mg / L.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1. The chassis cells of this invention offer significant comprehensive advantages: This invention is the first to select *Pseudomonas putida* KT2440 as the chassis cell for astaxanthin synthesis, fully utilizing its natural high stress tolerance, strong reducing power supply, and efficient central carbon metabolism. The hydrophobic product tolerance effectively solves the problems of product inhibition and cytotoxicity in the astaxanthin synthesis process; compared to yeast, it grows more rapidly, is easier to genetically manipulate, and has no thick cell wall extraction obstacles.

[0019] 2. The engineered Pseudomonas putida strain provided by this invention can efficiently utilize carbon sources such as glucose (especially byproducts of the biodiesel industry) and has the potential to utilize renewable resources such as lignin-derived aromatic compounds, significantly reducing raw material costs and conforming to the concepts of green biomanufacturing and circular economy.

[0020] 3. This invention utilizes genome site-specific integration technology to integrate key gene clusters (genes) from the mevalonic acid pathway derived from Enterococcus faecalis. mvaE , mvaS ) and derived from brewer's yeast ( Saccharomyces cerevisiae )of ERG The gene is stably integrated into the genome, providing a sufficient and stable precursor supply for terpene synthesis and astaxanthin synthesis, thus overcoming the rate-limiting bottleneck, avoiding the risk of plasmid loss, and improving production stability. Simultaneously, a dual-plasmid system is used to express the lycopene synthesis module separately. crtE、crtB、crtI and crtY ) and astaxanthin modification module ( crtZ and crtW By optimizing the timing and intensity of induction, the growth of the bacteria and the synthesis of the product were effectively balanced, avoiding the accumulation of a large amount of intermediate products and significantly improving the final yield of astaxanthin and the carbon source conversion rate.

[0021] 4. This invention constructs two independent and compatible broad-host expression plasmids, wherein plasmid pVLT31- crtEBIY-idi Carrying a gene cluster that forms the lycopene synthesis module, responsible for the efficient conversion of upstream precursors into the key intermediate lycopene, plasmid pBbB5k- crtZW This is the gene cluster for the final modification module of astaxanthin, which is responsible for sequentially hydroxylating and ketolizing lycopene to ultimately generate astaxanthin. Attached Figure Description

[0022] Figure 1 The recombinant plasmid pK18- was constructed mvaES plasmid map; Figure 2 The recombinant plasmid pK18- was constructed ERG plasmid map; Figure 3 The recombinant plasmid pBbB5k- was constructed crtZW plasmid map; Figure 4 The recombinant plasmid pVLT31- was constructed crtEBIY - id plasmid map; Figure 5 Figure showing the yield of astaxanthin at different induction concentrations; Figure 6 Figure showing the results of astaxanthin production induced by 0.5 mM IPTG at different time points. Detailed Implementation

[0023] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the embodiments.

[0024] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques described in the literature in this field or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased.

[0025] The Enterococcus faecalis and Pseudomonas putida KT2440 described in this invention were obtained through commercial channels.

[0026] Example 1: Gene Acquisition and Construction of Engineered Strain DM1 1. Acquisition of genes Derived from commercially available strains of Enterococcus faecalis ( Enterococcus faecalis )of mvaES The gene, whose nucleotide sequence is as shown in SEQ ID NO.1, was synthesized by the biotechnology company, and the pK18 plasmid was purchased by the biotechnology company.

[0027] 2. pK18- mvaES Carrier construction Using the commercially available Pseudomonas putida KT2440 genome as a template, primers were used... mvaES -up-F / R, mvaES -down-F / R to amplify homologous arms mvaES -up and mvaES- down. Using the aforementioned Enterococcus faecalis as a template, amplify the gene fragment. mvaES The PCR amplification system is shown in Table 1: Table 1 PCR amplification system

[0028] The PCR amplification program was: 98 ºC for 1 min; 30 cycles × (98 ºC for 10 s, 55 ºC for 5 s, 72 ºC for 3 min); 72 ºC for 1 min; 16 ºC to infinity. The primer sequences are shown below: mvaES-up-F: 5'- caagcttgcatgcctgcaggtcgataactcataaccggctaacggctgtgcgct3' (SEQ IDNO.6); mvaES -up-R: 5'- ccaggtggtttacctctttgcctgctctttgcacgcaatgatgggattgggggac-3' (SEQ IDNO.7); mvaES -down-F: 5'-taccgttcgctctttatcgaaactaaaccaaggattctccaatcaagtcagcacag-3' (SEQ ID NO. 8); mvaES -down-R: 5'-tacccggggatcctctagaGTCGACatgtacaacctctcatgcttgtacaagttttt-3' (SEQ ID NO.9); Using commercially available pK18 plasmid as a template, the pK18 framework fragment was amplified using primers pK18-F / R. The PCR amplification system is shown in Table 2. Table 2 PCR amplification system

[0029] The PCR amplification program was: 98 ºC for 1 min; 30 cycles × (98 ºC for 10 s, 55 ºC for 5 s, 72 ºC for 3 min); 72 ºC for 1 min; 16 ºC to infinity. The primer sequences are shown below: pK18-F: 5'-gtcgactctagaggatccccggg-3' (SEQ ID NO. 10); pK18-R: 5'-gtcgacctgcaggcatgcaagc-3' (SEQ ID NO. 11); PCR products were purified using a gel extraction and purification kit (Vazyme, catalog number DC301-01).

[0030] Using seamless cloning mvaES , mvaES -up、 mvaESThe -down fragment is connected to the pK18 framework, and its structure is shown in Table 3: Table 3 Seamless Cloning System

[0031] The ligation system was incubated at 50 ºC for 30 min to convert the ligation product. E. coli S17-1 competent cells were plated on LB agar plates containing 50 mg / L kanamycin (Km). Positive clones were verified by PCR and sequencing to obtain the recombinant plasmid pK18-. mvaES of E. coli S17-1-pK18 -mvaES The recombinant plasmid pK18 -mvaES The diagram is as follows Figure 1 As shown.

[0032] 3. Contains mvaES Construction of engineered strains of *Pseudomonas putida* with recombinant genes The above-mentioned E. coli S17-1-pK18- mvaES As a plasmid donor bacterium, the aforementioned *Pseudomonas putida* KT2400 is the plasmid recipient bacterium. After activating the plasmid donor and recipient bacteria separately, 1 mL of each was centrifuged and washed twice with ddH2O to remove antibiotics. The bacterial pellet was then resuspended in 500 μL of ddH2O. In a 1.5 mL centrifuge tube, 50 μL of recipient bacteria and 250 μL of donor bacteria were added, and the mixture was thoroughly mixed. The tube was incubated at 30°C and 200 rpm for 12 h. 100 μL of the culture was then plated onto plates containing 34 mg / L Cm (chloramphenicol) and 50 mg / L Km (kanamycin) antibiotics and incubated at 30°C for 12 h.

[0033] (1) Verify the first recombination Several single colonies were selected, and corresponding specific primers were designed based on the suicide plasmid vector sequence and gene sequence to perform colony PCR verification single exchange.

[0034] (2) Verify the second recombination Single-crossover strains were inoculated into antibiotic-free liquid LB medium and cultured, then plated onto LB solid medium containing 10% sucrose (without NaCl) and incubated at 30 °C for 12–18 h. Single colonies from the sucrose plates were selected and streaked onto 50 mg / L Km plates and 10% sucrose plates, respectively. The same streaks on both plates were numbered identically, and the plates were incubated at 30 °C. Colonies that grew on the sucrose plates but not on the Km plates were selected, and specific primers were designed based on the genome of *Pseudomonas putida* KT2440 to perform colony PCR verification of the double crossover.

[0035] (3) The correctly selected double-exchange strains were then subjected to secondary verification. Using a segment of the genome as a primer, the other end is set at... mvaES Genetically, PCR amplification was performed for verification to confirm the results. mvaES Gene transfer, obtaining a product containing mvaES Recombinant Pseudomonas putida engineered strain.

[0036] 4. pK18- EGR Carrier construction EGR Gene( ERG12、ERG8、ERG19 The gene sequence of this substance is shown in SEQ ID NO.2 and was synthesized by a biotechnology company. mvaES Using recombinant Pseudomonas putida engineered strains as templates, primers were used... EGR -up-F / R, EGR- down-F / R to amplify homologous arms EGR -up and mvaES- down. Using the aforementioned brewer's yeast as a template, amplify the gene fragment. EGR The PCR amplification system is shown in Table 4: Table 4 PCR amplification system

[0037] The PCR amplification program was: 98 ºC for 1 min; 30 cycles × (98 ºC for 10 s, 55 ºC for 5 s, 72 ºC for 3 min); 72 ºC for 1 min; 16 ºC to infinity. The primer sequences are shown below: EGR -up-F: 5'-ccaagcttgcatgcctgcaggtcgacgaccctggaaaatttcatattggtattggg-3' (SEQ ID NO. 12); EGR -up-R: 5'-tcaacagctcatttcagaatatttgccagattagtttcgataagagcgaacggtatt-3' (SEQ ID NO. 13); EGR- down-F: 5'-gctcagtcgaaagactgggcctttaccaaggattctccaatcaagtcagc-3' (SEQ IDNO.14); EGR-down-R: 5'-tacccggggatcctctagaGTCGACatgtacaacctctcatgcttgtacaagttttt-3' (SEQ ID NO. 15); PCR products were purified using a gel extraction and purification kit (Vazyme, catalog number DC301-01).

[0038] Using seamless cloning ERG , ERG -up、 ERG The -down fragment is connected to the pK18 framework, and its structure is shown in Table 5: Table 5 Seamless Cloning System

[0039] The ligation system was incubated at 50 ºC for 30 min to convert the ligation product. E. coli S17-1 competent cells were plated on LB agar plates containing 50 mg / L kanamycin (Km). Positive clones were verified by PCR and sequencing to obtain the recombinant plasmid pK18-. ERG of E. coli S17-1-pK18 - ERG The recombinant plasmid pK18 - ERG The diagram is as follows Figure 2 As shown.

[0040] 5. Construction of engineered strain DM1 The above-mentioned E. coli S17-1-pK18- ERG As plasmid donor bacteria, containing mvaES The recombinant *Pseudomonas putida* strain was used as the plasmid recipient. After activating the plasmid donor and recipient bacteria separately, 1 mL of each was centrifuged and washed twice with ddH2O to remove antibiotics. The bacterial pellet was then resuspended in 500 μL of ddH2O. In a 1.5 mL centrifuge tube, 50 μL of recipient bacteria and 250 μL of donor bacteria were added, and the mixture was thoroughly mixed and incubated at 30°C and 200 rpm for 12 h. 100 μL of the culture was then plated onto plates containing 34 mg / L Cm (chloramphenicol) and 50 mg / L Km (kanamycin) antibiotics and incubated at 30°C for 12 h.

[0041] (1) Verify the first recombination Several single colonies were selected, and corresponding specific primers were designed based on the suicide plasmid vector sequence and gene sequence to perform colony PCR verification single exchange.

[0042] (2) Verify the second recombination The single-exchange strain was inoculated into antibiotic-free liquid LB medium and cultured, then plated onto LB solid medium containing 10% sucrose (without NaCl) and incubated at 30 °C for 12–18 h. Single colonies from the sucrose plates were selected and streaked onto 50 mg / L Km plates and 10% sucrose plates, respectively. The same number was used at the same streak line on both plates, and the plates were incubated at 30 °C. Colonies that grew on the sucrose plates but not on the Km plates were selected, and corresponding specific primers were designed for colony PCR verification of the double exchange.

[0043] (3) The correctly selected double-exchange strains were then subjected to secondary verification. Using a segment of the genome as a primer, the other end is set at... ERG Genetically, PCR amplification was performed for verification to confirm the results. ERG Gene transfer, obtaining a product containing mvaES Genes and ERG Recombinant Pseudomonas putida engineered strain DM1.

[0044] Example 2: Construction of engineered strains DM2 and DM3 for astaxanthin synthesis 1. Acquisition of genes Synthesized by a biotechnology company crtEBIY The gene, whose nucleotide sequence is shown in SEQ ID NO.3, was synthesized by a biotechnology company. crtZW Its nucleotide sequence is shown in SEQ ID NO.4, and it was synthesized from Escherichia coli (E. coli). Escherichia coli )of id The gene, whose nucleotide sequence is shown in SEQ ID NO.5. Both pBbB5k and pVLT31 plasmids were obtained through commercial channels.

[0045] 2. pBbB5k- crtZW Carrier construction Using commercially available pBbB5k plasmid as a template, the pBbB5k framework fragment was amplified using primers pBbB5k-F / R. The PCR amplification system is shown in Table 6. Table 6 PCR Amplification System

[0046] The PCR amplification program was: 98 ºC for 1 min; 30 cycles × (98 ºC for 10 s, 55 ºC for 5 s, 72 ºC for 3 min); 72 ºC for 1 min; 16 ºC to infinity. The primer sequences are shown below: pBbB5k-F: 5'-GGAAAGTTGTTGACGGTTGACGGTTGAggatccaaactcgagtaaggatc3' (SEQ ID NO. 16); pBbB5k-R: 5'-ATCAGGGCATTCCAAATCCACAACATatgtatatctccttcttaaaagatctttt-3' (SEQ ID NO. 17); PCR products were purified using a gel extraction and purification kit (Vazyme, catalog number DC301-01). Seamless cloning was then employed to... crtZW Connecting to the pBbB5k framework, its architecture is shown in Table 7: Table 7 Seamless Cloning System

[0047] The ligation system was incubated at 50 ºC for 30 min. The ligation product was then transformed. E. coli S17-1 competent cells were plated on LB agar plates containing 50 mg / L kanamycin. Positive clones were verified by PCR and sequencing, yielding cells containing the recombinant plasmid pBbB5k-. crtZW of E.coli S17-1-pBbB5k -crtZW The recombinant plasmid pBbB5k- crtZW The map is as follows Figure 3 As shown.

[0048] 3. pVLT31- crtEBIY - id Carrier construction by Escherichia coli Using the genome as a template and idi-F / R primers, gene fragments are amplified. id ,by mvaES The fragment was used as a template, and the primers were promoter-F / R to amplify the promoter fragment. The PCR amplification system is shown in Table 8. Table 8 PCR amplification system

[0049] The PCR program was: 98 ºC for 1 min; 30 cycles × (98 ºC for 10 s, Tm ºC for 5 s, 72 ºC for 3 min); 72 ºC for 1 min; 16 ºC to infinity. The primer sequences are shown below: promoter-F: 5'-cttggctgttttggcggatgagagagcaggcaaagaggtaaaccacctgg-3' (SEQ ID NO. 18); promoter-R: 5'-tcaataaaatgacgtgttccgtttgcatggggtcgcatccttgaaagcacgcaac -3' (SEQ ID NO. 19); idi-F: 5'-atgcaaacggaacacgtcattttattgaatgcacag-3' (SEQ ID NO. 20); idi-R: 5'- caaagtgcgtcgggtgatgcTCTttatttaagctgggtaaatgcagataatcgttttc-3' (SEQ ID NO. 21); Using commercially available pVLT31 plasmid as a template, the pVLT31 framework fragment was amplified using primers pVLT31-F / R. The PCR amplification system is shown in Table 9. Table 9 PCR Amplification System

[0050] The PCR amplification program was: 98 ºC for 1 min; 30 cycles × (98 ºC for 10 s, 55 ºC for 5 s, 72 ºC for 3 min); 72 ºC for 1 min; 16 ºC to infinity. The primer sequences are shown below: pVLT31-F: 5'-AGAgcatcacccgacgcactttgc-3' (SEQ ID NO. 22); pVLT31-R: 5'- atcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcgg-3' (SEQ ID NO. 23); PCR products were purified using a gel extraction and purification kit (Vazyme, catalog number DC301-01).

[0051] Using seamless cloning crtEBIY Fragments and id The fragments are connected to the pVLT31 frame, and its architecture is shown in Table 10: Table 10 Seamless Cloning System

[0052] The ligation system was incubated at 50 ºC for 30 min. The ligation product was then transformed. E. coli S17-1 competent cells were plated on LB agar plates containing 40 mg / L gentamicin sulfate. Positive clones were verified by PCR and sequencing to obtain the recombinant plasmid pVLT31- crtEBIY - id The recombinant plasmid pVLT31- crtEBIY - id plasmid map as follows Figure 4 As shown.

[0053] 4. Construction of the engineered strain DM3 for astaxanthin synthesis (1) The above-obtained... E.coli S17-1-pBbB5k- crtZW Inoculate into 20 mL LB liquid medium containing 50 mg / L Km and incubate overnight at 37°C for activation. Recipient bacteria DM1 are inoculated into 20 mL LB liquid medium without antibiotics and incubated overnight at 30°C for activation. Both donor and recipient bacteria are inoculated at a ratio of 1 / 100.

[0054] (2) Transfer the overnight activated donor and recipient bacteria into LB liquid medium as described in (1) and culture until OD. 600 =0.6. Collect 1 mL of bacterial culture from each culture, centrifuge at 6000 rpm for 3 min, and discard the supernatant. Resuspend the precipitated bacteria in 2 mL of antibiotic-free LB medium, then centrifuge and discard the supernatant. Repeat once to remove the antibiotic. Resuspend the precipitated bacteria in 500 μL of antibiotic-free LB medium. Take a new 1.5 mL centrifuge tube, mix the recipient bacteria and donor bacteria at a volume ratio of 1:5, with a total volume of approximately 300 μL, and incubate at 30°C for 12-18 h. At this point, the bacterial concentration is already high, and centrifugation for concentration is not necessary. Directly take 100-200 μL of the mixed bacterial culture and spread it on LB agar plates containing Cm (chloramphenicol) and Km (kanamycin) resistance, and incubate at 30°C. Pick a single bacterium for PCR verification to obtain a single clone of the engineered strain DM2.

[0055] (3) The above E.coli S17-1-pVLT31- crtEBIY - id The donor strain was inoculated into 20 mL LB liquid medium containing Gm (gentamicin sulfate) and incubated overnight at 37°C for activation. The engineered strain DM2 was inoculated into 20 mL LB liquid medium containing 50 mg / L kanamycin and incubated overnight at 30°C for activation. Both the donor and recipient strains were inoculated at a ratio of 1 / 100. The overnight activated donor and recipient strains (3) were then transferred to LB liquid medium and cultured until OD.600 =0.6.

[0056] (4) Collect 1 mL of bacterial suspension from each culture, centrifuge at 6000 rpm for 3 min, and discard the supernatant. Resuspend the precipitated bacteria in 2 mL of antibiotic-free LB medium, then centrifuge to discard the supernatant. Repeat once to remove the antibiotic. Resuspend the precipitated bacteria in 500 μL of antibiotic-free LB medium. Take a new 1.5 mL centrifuge tube, mix the recipient bacteria and donor bacteria at a volume ratio of 1:5, with a total volume of approximately 300 μL, and incubate at 30°C for 12-18 h. At this point, the bacterial suspension concentration is already high, and centrifugation for concentration is not necessary. Directly take 100-200 μL of the mixed bacterial suspension and spread it on LB plates containing 34 mg / L Cm, 40 mg / L Gm, and 50 mg / L Km antibiotics, and incubate at 30°C. Pick a single bacterium for PCR verification to obtain a single clone of the engineered strain DM3.

[0057] Example 3: Astaxanthin Production and Detection by Escherichia coli Fermentation After the engineered strains DM1 and DM3 were induced to grow in culture medium, fermentation culture was carried out. The specific method included the following: 1. Cultivation conditions (1) The obtained engineered strains DM1 and DM3 were inoculated into 20 mL LB medium containing the corresponding resistance, and cultured overnight at 30°C and 200 rpm with shaking. Then, the cultures were transferred at 1% to M9 medium containing 2% glucose, with three replicates per group.

[0058] (2) Under the same conditions, grow until the optical density is OD 600 The pH was 0.2, and different concentrations (0, 0.05 mM, 0.1 mM, 0.50 mM, 1.00 mM) of IPTG were added for induction. The mixture was incubated at 30℃ with shaking at 200 rpm for 12 h.

[0059] (3) Take 2 ml of the induced bacterial solution to extract astaxanthin.

[0060] 2. Astaxanthin Extraction Method 1 mL of bacterial cells was extracted with 1 mL of anhydrous ethanol for 4 h. The supernatant was then filtered into a chromatographic vial for HPLC detection. The astaxanthin yield was determined by HPLC.

[0061] 3. HPLC method for detecting astaxanthin yield The HPLC instrument used was a Shimadzu HPLC System, Model LC-20A, with a ZORBAX SB-C18 3.5 μm column (4.6 × 150 mm), manufactured by Agilent, USA. Mobile phase A was methanol, and mobile phase B was ethyl acetate. The analysis time for each sample was 16 min. From 0 to 10 min, the concentration of mobile phase B increased from 0 to 40% per minute. From 10 to 16 min, the concentration of mobile phase B was maintained at 0, with a total flow rate of 1 mL / min. UV: 475 nm.

[0062] Different concentrations of IPTG were selected for induction of expression, and the results are as follows: Figure 5 As shown, 0.5 mM IPTG and 1 mM IPTG showed good induction effects; considering all factors, 0.05 mM was the most suitable induction concentration. The results under 0.5 mM IPTG induction are as follows... Figure 6 As shown, the astaxanthin yield reached 5.223 mg / L after 24 h of induction.

[0063] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A method for constructing a high-astaxanthin-producing engineered strain of *Pseudomonas putida*, characterized in that, The construction method includes the following steps: (1) Synthesis mvaES Genes will mvaES Genes are linked to vector frameworks to construct a gene containing... mvaES A gene recombination vector is transformed into E. coli to obtain a gene containing... mvaES Genetically modified E. coli; synthesis ERG Genes will ERG Genes are linked to vector frameworks to construct a gene containing... ERG A gene recombination vector is transformed into E. coli to obtain a gene containing... ERG Genetically modified E. coli; (2) Containing mvaES Using *E. coli* as the donor bacterium and *Pseudomonas putida* as the recipient bacterium, genome integration was performed to obtain a strain containing... mvaES *Pseudomonas putridae*, a bacterium containing the gene *Pseudomonas putridae* ERG E. coli containing the gene is used as the donor bacterium. mvaES *Pseudomonas putida*, a gene-containing bacterium, underwent genome integration as a recipient bacterium, and after screening and verification, bacteria containing the gene were obtained. mvaES Genes and ERG The engineered strain DM1; (3) Synthesis crtZW Genes, will the crtZW Genes are linked to vector frameworks to obtain genes containing crtZW Gene recombination vectors; It is then transformed into E. coli to obtain bacteria containing... crtZW Genetically modified E. coli; (4) Synthesis crtEBIY Genes and idi Genes, will the crtEBIY Genes and idi Genes are linked to vector frameworks to obtain genes containing crtEBIY Genes and idi Gene recombination vectors; It is then transformed into E. coli to obtain bacteria containing... crtEBIY Genes and idi Genetically modified E. coli; (5) The contents of the above crtZW The recombinant vector containing the gene was transformed into the engineered strain DM1 by conjugation to obtain the engineered strain DM2; crtEBIY Genes and idi The recombinant vector of the gene was transformed into the engineered strain DM2 to obtain the high-astaxanthin-producing Pseudomonas putida engineered strain.

2. The construction method according to claim 1, characterized in that, The mvaES The nucleotide sequence of the gene is shown in SEQ ID NO.1; ERG The nucleotide sequence of the gene is shown in SEQ ID NO.2; crtEBIY The nucleotide sequence of the gene is shown in SEQ ID NO.3; crtZW The nucleotide sequence of the gene is shown in SEQ ID NO.4; idi The nucleotide sequence of the gene is shown in SEQ ID NO.

5.

3. The construction method according to claim 1, characterized in that, The carrier frame in step (1) is pK18.

4. The construction method according to claim 1, characterized in that, In step (3), the vector framework is pBbB5k, and the recombinant vector is pBbB5k- crtZW .

5. The construction method according to claim 1, characterized in that, In step (4), the vector framework is pVLT31, and the recombinant vector is pVLT31- crtEBIY - idi .

6. The construction method according to claim 1, characterized in that, The volume ratio of the recipient bacteria to the donor bacteria is 1:4~6.

7. An engineered strain of *Pseudomonas putida* constructed using any one of the construction methods described in claims 1 to 6.

8. The use of the engineered strain of *Pseudomonas putida* according to claim 7 in the production of astaxanthin and / or in increasing astaxanthin yield.

9. The application according to claim 8, characterized in that, The application of the engineered strain of *Pseudomonas putida* includes the following steps: (1) The engineered strain of *Pseudomonas putida* was inoculated into LB medium containing resistance and cultured overnight with shaking. Then, the culture was transferred to M9 medium at an inoculation rate of 1-5% by volume for further culture and growth until the optical density reached OD. 600 The concentration was 0.2-0.8, IPTG was added for induction, and the mixture was cultured with shaking. (2) Take the bacterial culture induced by IPTG and extract it with anhydrous ethanol for 4-10 h, extract the supernatant and obtain a solution containing astaxanthin.

10. The application according to claim 8, characterized in that, The molar concentration of IPTG is 0.05~1mM, and the IPTG induction time is 15~30h.