Construction method of FXI humanized mouse model and application thereof

Abstract

This invention relates to a method for constructing a humanized FXI mouse model, comprising: (1) constructing a targeting vector expressing the humanized FXI gene; (2) designing and obtaining sgRNA targeting the mouse FXI gene; (3) co-injecting or co-electroporating the targeting vector, sgRNA, and Cas9 protein into the cytoplasm or nucleus of mouse zygotes, and transplanting the zygotes into pseudopregnant mice, performing genotyping on the pseudopregnant pups, and screening for positive F0 mice with the correct humanized fragment inserted; (4) mating the F0 mice with background mice to obtain F1 mice, and screening for the humanized FXI mouse model. The humanized FXI mouse constructed by this invention has broad application prospects in the coagulation system, thrombotic diseases, and related drug screening.

Description

Technical Field

[0001] This invention relates to the field of animal genetic engineering, specifically to a method for constructing an FXI humanized mouse model and its application. Background Technology

[0002] Exposure of blood to negatively charged substances or artificial surfaces triggers a group of proteolytic reactions in the plasma, collectively known as contact activation, leading to thrombin generation and fibrin formation. Coagulation factor XI (F11) is a key component in blood clot formation and thrombus formation. It participates in the activation cascade of thrombin generation, promoting the conversion of fibrinogen into fibrin, thereby forming a thrombus. FXI activation is closely related to hemostasis, thrombosis, and vascular function; therefore, a thorough understanding of its physiological functions is crucial. FXI is primarily synthesized by the liver and secreted into peripheral blood. It is a unique plasma coagulating enzyme composed of two identical polypeptide chains linked by disulfide bonds. During FXI activation, the internal peptide bonds are cleaved by FXIIa (or XII), resulting in the production of coagulation factor XIa, a serine protease. Activated FXI triggers the intermediate stage of the intrinsic blood coagulation pathway through activating factor IX, thereby activating downstream pathways and playing a coagulation role. Studies have also shown that individuals with coagulation defects lack both FXI and FXII in their plasma, and FXI deficiency also leads to abnormal coagulation function.

[0003] Although FXI contributes limitedly to hemostasis, epidemiological data, animal model studies, and recent human trials suggest that this protein plays an important role in thromboembolic diseases. Excessive FXI activity may lead to excessive clotting and thrombus formation, thereby triggering thrombotic diseases such as venous thromboembolism and deep vein thrombosis. Studying the role of FXI in these diseases will contribute to a deeper understanding of disease mechanisms, achieving antithrombotic effects with minimal or no impact on hemostasis, and providing a basis for developing relevant therapeutic strategies.

[0004] Humanized mice are mice carrying functional human genes, cells, tissues and / or organs, immune systems, or microorganisms for biomedical research and clinical treatment development. Because the mouse genome is highly similar to the human genome and is easier to manipulate and modify, mice can readily mimic human biological characteristics and diseases, helping researchers decipher pathogenic mechanisms and molecular pathways, thus guiding drug development. Therefore, gene editing techniques were used to replace the mouse FXI gene with a corresponding human FXI gene fragment while preserving the UTR region of the mouse FXI gene, allowing human FXI expression to be controlled by the mouse's own promoter and regulatory sequences. This model can express human FXI protein in a BALB / c mouse background, thereby mimicking the biological characteristics of human FXI, and has application value in studying the coagulation system, thrombotic diseases, and related drug screening. Currently, there are no literature reports on the construction methods of humanized FXI mouse models or their application in targeted drug therapy. Summary of the Invention

[0005] To address the existing problems, the first aspect of this invention provides a method for constructing an FXI humanized mouse model, the method comprising the following steps:

[0006] (1) Construct a targeting vector expressing the humanized FXI gene for insertion of the humanized FXI gene;

[0007] (2) Design sgRNAs targeting the translation initiation site and subsequent coding region of the mouse FXI gene, and obtain the above sgRNAs using in vitro transcription technology;

[0008] (3) The targeting vector constructed in step (1), the sgRNA obtained in step (2) and the Cas9 protein were co-injected or co-electrotransduced into the cytoplasm or nucleus of mouse zygote cells, and the zygote was transplanted into pseudopregnant mice. Genotyping of pseudopregnant mice was performed, and positive F0 mice with the correct human fragment inserted were screened.

[0009] (4) F0 mice were bred with background mice to obtain F1 mice. Gene identification was performed on the tails of F1 mice to screen out the FXI humanized mouse model.

[0010] Preferably, step (1) includes the following steps: according to the structure and function of human FXI, insert human FXI CDS and polyA elements into the translation start site of the mouse FXI transcript, the selected human FXI gene amino acid sequence is shown in SEQ ID No.1, and the replaced mouse FXI gene amino acid sequence is shown in SEQ ID No.2.

[0011] Preferably, step (1) includes the following steps: selecting 1-625AA of the human FXI gene, replacing 1-624AA of the mouse FXI gene with homologous recombination technology, and constructing a successful targeting vector sequence as shown in SEQ ID No. 3.

[0012] More preferably, the gene sequence of sgRNA in step (2) is SEQ ID No.4 or SEQ ID No.5.

[0013] More preferably, the gene sequence of the sgRNA in step (2) is SEQ ID No. 5.

[0014] Preferably, the strain of mice providing fertilized eggs and pseudopregnant mice in step (3) is BALB / c.

[0015] Preferably, the 5' end primers used for F0 mouse genotype identification in step (3) are shown in SEQ ID No. 10 and SEQ ID No. 11, and the 3' end primers are shown in SEQ ID No. 12 and SEQ ID No. 13.

[0016] Preferably, the PCR reaction system used for F0 mouse genotyping in step (3) is as follows:

[0017] 1 2x Taq Master Mix, Dye Plus 12.5 \ 2 <![CDATA[ddH2O]]> 9.5 \ 3 Primer A 1 10mM 4 Primer B 1 10mM 5 Template 1 100ng / μL .

[0018] Preferably, the PCR reaction conditions used for F0 mouse genotyping in step (3) are as follows:

[0019]

[0020] A second aspect of the present invention provides the application of mice obtained by the above-described construction method in the study of the function and mechanism of action of the FXI gene.

[0021] Preferably, the application is for non-diagnostic and non-therapeutic purposes.

[0022] Preferably, the mouse is a BALB / c mouse.

[0023] A third aspect of the present invention provides the use of mice obtained by the above-described construction method in screening drugs for the treatment of diseases related to the FXI gene.

[0024] Preferably, diseases associated with the FXI gene are coagulation system or thrombotic diseases related to the FXI gene.

[0025] Preferably, the application is for non-diagnostic and non-therapeutic purposes.

[0026] Preferably, the mouse is a BALB / c mouse.

[0027] The beneficial effects of this invention are:

[0028] This invention selects the CDS (NM_000128.4) of the mouse FXI-202 (ENST00000403665.7) transcript and performs human gene replacement in mice. By using gene editing technology to completely replace the coding region of the mouse FXI gene with humanized material, the invention avoids interference with the screening and efficacy evaluation of human target antibodies caused by mouse FXI remaining in the model mice, and effectively improves the accuracy and reliability of animal models in drug screening and efficacy evaluation. Attached Figure Description

[0029] Figure 1 This is a strategy diagram of the humanized FXI mouse model of the present invention;

[0030] Figure 2 This is an electrophoresis image showing the results of gene identification at the 5' and 3' ends of FXI-KI-target F0 mice;

[0031] Figure 3 This is an electrophoresis image showing the results of gene identification at the 5' and 3' ends of FXI-KI-target F1 mice;

[0032] Figure 4 These are the results of FXI mRNA and protein expression detection in BALB / c and BALB / c-hFXI homozygous mice;

[0033] Figure 5 These are the results of FXI protein expression detection in BALB / c and BALB / c-hFXI homozygous mice. Detailed Implementation

[0034] The present invention will be further described by way of examples, but the present invention is not limited to the following examples.

[0035] Experimental Example 1: Establishment of the FXI Humanized Mouse Model

[0036] This invention uses CRISPR / Cas9 technology to replace the mouse-derived FXI gene with the human FXI gene, thereby constructing a mouse model that expresses human FXI. BALB / c mice are a relatively mature mouse strain currently under study. Using BALB / c mice as the background mouse, a humanized BALB / c mouse model was successfully obtained (see details in [link to article]). Figure 1 The specific method is as follows:

[0037] (1) Determine the replacement region of the human source fragment and the inserted human source sequence

[0038] The mouse FXI gene has one transcript, namely the FXI (ENSMUST00000034064.4) transcript. The human FXI gene has two transcripts. In this experiment, the CDS (NM_000128.4) of the mouse corresponding FXI-202 (ENST00000403665.7) transcript was selected and replaced with the human gene in mice. The amino acid sequence of the selected human FXI gene is shown in SEQ ID No. 1 (AA: 1-625), and the amino acid sequence of the replaced mouse FXI gene is shown in SEQ ID No. 2 (AA: 1-624).

[0039] (SEQ ID No.1).

[0040] (SEQ ID No.2).

[0041] (2) Determination of the insertion site of the humanized FXI gene sequence and construction of the humanized targeting vector

[0042] Human FXI CDS and polyA elements were inserted into the translation start site of the murine FXI (ENSMUST00000034064.4) transcript, and human FXI was expressed under the regulation of the endogenous murine FXI gene. The sequence of the human FXI gene after substitution is shown in SEQ ID No. 3 (underlined segments indicate inserted fragments, 1552bp~3429bp indicates inserted human FXI gene fragments, 3430bp~3710bp indicates mouse 3'UTR, and 3720bp~3951bp indicates BGH pA).

[0043]

[0044]

[0045] (3) Design and screening of sgRNA in FXI humanized mice

[0046] Based on the replacement fragment, the approximate region of sgRNA was determined. Two groups of sgRNAs were designed using sgRNA evaluation software. The sgRNA sequence information and cleavage efficiency are shown in Table 1. sgRNA expression vectors were designed and constructed.

[0047] Table 1. sgRNA sequences targeting the FXI site

[0048] GPT0X0280-01-FXI-S1 TAGGATGACCTCATTACATC(SEQ ID No.4) 20 / 23＝87％ GPT0X0280-01-FXI-S2 ATATAACACCTGATGTAATG(SEQ ID No.5) 20 / 21＝95％

[0049] sgRNA construction method: Upstream and downstream primers for sgRNA were synthesized separately (see Table 2), and the primers were purified by PAGE. The upstream and downstream primers were diluted to 100 μmol / μl, mixed in a 1:1 ratio, and allowed to anneal slowly at room temperature. The resulting double strands were ligated to Puc57-sgRNA-NEO-Amp (Bsa I) for 1 h, transformed, and plated on Amp+ plates. Single clones were picked and identified by PCR. PCR-positive single clones were further sequenced for confirmation using the pUC57-T7-F primer. Using the correctly sequenced clone as a template, the DNA product transcribed from sgRNA was amplified by primer PCR. Using the transcribed DNA product as a template, sgRNA was transcribed and further purified. The constructed targeting vector was then transcribed and then reverse transcribed to obtain an injectable LssDNAdonor.

[0050] Table 2 sgRNA primer sequences

[0051]

[0052] sgRNA screening: Two sets of sgRNAs were designed and synthesized. After incubating the sgRNAs with Cas9 protein, they were injected into fertilized eggs at 0.5 days of age and cultured to blastocyst stage. The sgRNA cleavage activity was verified by identifying the KO positivity rate of the mouse FXI gene.

[0053] sgRNA cleavage assay method: The collected blastocysts were subjected to PCR amplification. The PCR protocol is shown in Table 4-5. The amplified bands were then subjected to next-generation sequencing, and the results were compared with the WT bands.

[0054] (4) Establishment of FXI humanized mouse model

[0055] The selected sgRNAs were used to design and construct LssDNA donors carrying human sequences. The LssDNA donors and the Cas9 / sgRNA system were injected into 0.5-day-old mouse zygotes and transplanted into 0.5-day-old pseudopregnant female mice, waiting for the birth of F0 generation mice.

[0056] (5) Genotyping of humanized F0 mice

[0057] Five to seven days after birth, F0 generation mice were marked using the toe clipping method, and DNA was extracted from the excised tail tissue using the phenol-chloroform method. PCR identification was performed using primers designed for the target region (see Table 3). The PCR reaction conditions and procedures are shown in Tables 4 and 5.

[0058] Table 3. Identification primers for F0 and F1

[0059]

[0060] Table 4 PCR reaction system

[0061] 1 2x Taq Master Mix, Dye Plus 12.5 \ 2 <![CDATA[ddH2O]]> 9.5 \ 3 Primer A 1 10mM 4 Primer B 1 10mM 5 Template 1 100ng / μL

[0062] Table 5 PCR reaction conditions

[0063]

[0064]

[0065] Primers GPT0X0280-01-mFXI-5tF1 and GPT0X0280-01-hFXI-5tR1 are located outside the 5' homologous arm and inside the human fragment of the donor, respectively. If this primer pair amplifies and produces PCR products, it indicates that the target donor has been effectively inserted into the 5' end of the mouse genome. BGH-pA-tF1 and GPT0X0280-01-mFXI-3tR1 are located inside the human fragment of the donor and outside the 3' homologous arm, respectively. If this primer pair amplifies and produces PCR primers, it indicates that the target donor has been effectively inserted into the 3' end of the mouse genome. GPT0X0280-01-mFXI-wt-tF1 and GPT0X0280-01-mFXI-wt-tR1 represent the primer sequences of mouse-derived FXI. PCR-positive samples were sequenced using the sequencing protocol shown in Table 6. Then, the F0 generation mice with correct PCR and sequencing results were mated with wild-type BALB / cJGpt mice to produce F1 generation mice. The F1 generation mice were identified using the same methods as the F0 generation mice. The resulting positive F1 generation heterozygous mice were then stably inherited. Finally, the heterozygous F1 generation mice were mated to obtain homozygous offspring mice.

[0066] Table 6 Sequencing Protocols

[0067]

[0068] In this experiment, 88 F0 mice were obtained by injection of sgRNA (GPT0X0280-01-FXI-S1 and GPT0X0280-01-FXI-S2). Mice numbered 1-58 were obtained by injection of GPT0X0280-01-FXI-S1, and mice numbered 59-88 were obtained by injection of GPT0X0280-01-FXI-S2. The F0 identification results are as follows: Figure 2 As shown, the F1 identification results are as follows: Figure 3 As shown, Figure 2 and 3 WT represents the negative control; N represents the negative blank control (without template); P represents the positive control; M represents the DNA Marker: TRANS2KPLUS II bands: 8000bp, 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp.

[0069] like Figure 2 As shown, PCR confirmed that mice #5, #23, #25, #29, #50, #60, #64, #68, #76, #77, and #88 were positive for the 5' and 3' ends of the human FXI gene. However, sequencing of mice #23, #25, #29, #50, #60, #68, #77, and #88 failed. Therefore, mice #5, #64, and #76 are recommended for breeding. Furthermore, other batches of F0 mice were identified using the same method, all yielding breedable F0 positive mice. Positive F0 mice were bred with background mice to obtain F1 mice. Genetic identification of the F1 generation tails was performed. The results of the F1 generation gene identification are shown below. Figure 3 As shown, mice #165, #166, and #167 all tested positive for the 5' and 3' ends of the human FXI gene, indicating no tandem formation. Simultaneously, the mouse source test was also positive, demonstrating that the obtained mice were heterozygous positive mice resulting from correct gene recombination. After large-scale propagation of the F1 mice, they were crossbred to obtain homozygous mice.

[0070] Experiment 2: Validation of gene and protein expression in BALB / c-hFXI humanized homozygous mice

[0071] (1) Detection of FXI mRNA expression in BALB / c-hFXI humanized homozygous mice

[0072] 1. Test Methods

[0073] Liver tissues from BALB / c-hFXI homozygous mice and BALB / c background mice were collected for RT-QPCR detection of FXI gene expression.

[0074] 2. Test Results

[0075] RT-qPCR test results as follows Figure 4 As shown, murine FXI mRNA was detected in the liver tissue of wild-type mice, while human FXI mRNA was detected only in the liver tissue of homozygous BALB / c-hFXI mice, indicating that BALB / c-hFXI homozygous mice express only the human FXI gene.

[0076] (2) Detection of FXI protein expression in BALB / c-hFXI humanized homozygous mice

[0077] 1. Test Methods

[0078] Liver tissues and plasma were collected from BALB / c-hFXI homozygous mice and BALB / c background mice. The expression of FXI was detected using a human-mouse co-recognition FXI ELISA kit and a human-specific recognition FXI ELISA kit.

[0079] 2. Test Results

[0080] Test results as follows Figure 5 As shown, the human-mouse co-recognition FXI ELISA kit detected FXI protein expression in both liver tissue and plasma of BALB / c and BALB / c-hFXI mice; the human-specific FXI ELISA kit detected high expression of FXI protein in plasma of BALB / c-hFXI mice.

[0081] The above results demonstrate that the present invention successfully constructed a BALB / c-hFXI mouse model by replacing the mouse FXI gene with a humanized gene, indicating that this model has broad application prospects in the study of coagulation system, thrombotic diseases and related drug screening.

[0082] Although the implementation steps of this method have been described in detail, those skilled in the art can still modify some parameters and the overall scheme within the scope of this invention. Therefore, any changes, substitutions, adjustments, etc., made within the spirit and principles of this invention should be considered within the scope of this invention.

Claims

1. A method for constructing an FXI humanized mouse model, characterized in that, The construction method includes the following steps: (1) Construct a targeting vector expressing the humanized FXI gene for insertion of the humanized FXI gene; (2) Design sgRNAs targeting the translation initiation site and subsequent coding region of the mouse FXI gene, and obtain the above sgRNAs using in vitro transcription technology; (3) The targeting vector constructed in step (1), the sgRNA obtained in step (2) and the Cas9 protein were co-injected or co-electrotransduced into the cytoplasm or nucleus of mouse zygote cells, and the zygote was transplanted into pseudopregnant mice. Genotyping of pseudopregnant mice was performed, and positive F0 mice with the correct human fragment inserted were screened. (4) F0 mice were bred with background mice to obtain F1 mice. Gene identification was performed on the tails of F1 mice to screen out the FXI humanized mouse model.

2. The construction method according to claim 1, characterized in that, Step (1) includes the following steps: Based on the structure and function of human FXI, human FXI CDS and polyA elements are inserted into the translation start site of the mouse FXI transcript. The selected human FXI gene amino acid sequence is shown in SEQ ID No. 1, and the replaced mouse FXI gene amino acid sequence is shown in SEQ ID No.

2.

3. The construction method according to claim 1, characterized in that, Step (1) includes the following steps: Select human FXI gene 1-625AA, replace mouse FXI gene 1-624AA with homologous recombination technology, and construct a successful targeting vector sequence as shown in SEQ ID No.

3.

4. The construction method according to claim 1, characterized in that, The gene sequence of sgRNA in step (2) is SEQ ID No. 4 or SEQ ID No.

5.

5. The construction method according to claim 1, characterized in that, The strain of mice that provide fertilized eggs and pseudopregnant mice in step (3) is BALB / c.

6. The construction method according to claim 1, characterized in that, The 5' end primers used for F0 mouse genotype identification in step (3) are shown in SEQ ID No. 10 and SEQ ID No. 11, and the 3' end primers are shown in SEQ ID No. 12 and SEQ ID No.

13.

7. The construction method according to claim 1, characterized in that, The PCR reaction system used for F0 mouse genotyping in step (3) is as follows:

8. The construction method according to claim 1, characterized in that, The PCR reaction conditions used for F0 mouse genotyping in step (3) are as follows:

9. The mouse obtained by the method for constructing the FXI humanized mouse model according to any one of claims 1-8 can be used to study the related functions and mechanisms of action of the FXI gene.

10. The use of mice obtained by the method for constructing the FXI humanized mouse model according to any one of claims 1-8 in screening drugs for treating diseases related to the FXI gene.

Images