A tree breeding method for simultaneously increasing lignin content and reducing S / G ratio by knocking out paggrf20 gene

Abstract

This invention discloses a method for knocking out PagGRF20 A forest tree breeding method that simultaneously increases lignin content and reduces the S / G ratio through gene editing falls under the fields of gene editing and molecular breeding technology for forest trees. This involves knocking out genes using CRISPR / Cas9 gene editing technology. PagGRF20 The gene significantly upregulated the expression of key genes in the lignin biosynthesis pathway, promoted lignin accumulation, and reduced the S / G ratio of lignin monomers, resulting in a significantly increased lignin content and a relative enrichment of G-type lignin monomers. paggrf20 The mutant exhibits a 15%–35% increase in lignin content and a significantly reduced S / G ratio from 1.88 to 1.42–1.55 compared to the wild type, with deeper phloroglucinol-HCl staining in the xylem. This specific combination of properties is not reported in existing technologies and provides important genetic resources and breeding methods for cultivating new poplar varieties with high lignin content and low S / G ratios.

Description

Technical Field

[0001] This invention belongs to the field of gene editing and forestry molecular breeding technology, specifically involving a method for targeted improvement of the chemical composition of wood by knocking out the PagGRF20 gene through the CRISPR / Cas9 system, and the transgenic poplar plants with specific wood properties obtained therefrom. Background Technology

[0002] Wood is one of the most abundant biomass energy sources on Earth, widely used in pulp and paper making, construction, and the production of cellulose products. Lignin, an important component of secondary cell walls, is polymerized from three phenylpropane monomers (syringyl S, guaiacyl G, and p-hydroxyphenyl H). Lignin content and the S / G ratio (syringyl / guaiacyl) are key indicators determining the chemical properties and processing characteristics of wood. Traditionally, forestry molecular breeding and genetic engineering have focused on reducing lignin content and increasing the S / G ratio to improve biomass biodegradability and pulp yield. However, wood with high lignin content and low S / G ratio has unique value in specific industrial scenarios (such as certain biofuel production and specific material preparation), and current technologies lack effective means to target and obtain this specific combination of material properties.

[0003] Growth regulator factor (GRF) family transcription factors primarily regulate cell proliferation and organ growth in plants. In 2023, Beijing Forestry University published the CDS sequence (1026 bp, encoding 342 amino acids, molecular weight 38.15 kDa, containing conserved QLQ and WRC domains) of the 84K poplar PagGRF20 gene and reported that overexpression of PagGRF20 inhibited poplar growth and development (resulting in reduced plant height, root length, and leaf size). However, the study did not address the gene's regulatory effects on lignin biosynthesis or the chemical composition of wood.

[0004] In the field of poplar pectin gene editing, existing technologies have reported various strategies for reducing lignin content or altering the S / G ratio. For example, Zhou et al. (2015) reduced poplar pectin content by 19-23% and the S / G ratio by about 30% by knocking out the 4CL1 gene using CRISPR; Jang et al. (2021) knocked out the CSE gene, reducing the lignin content of 84K poplar by 16-29%; DeMeester et al. (2020) used the CCR2 hemizygous deletion to reduce the S / G ratio by 14%. Sulis et al. (2023) published a multiplex CRISPR editing study in Science, achieving the "optimal point for fiber production" by simultaneously editing 21 lignin-related genes, reducing lignin content by 35-50% and increasing the S / G ratio by 248%.

[0005] However, the above-mentioned existing technologies all have the following common limitations: (1) All gene editing strategies that have successfully improved the chemical composition of wood in the existing technologies directly target genes in the lignin biosynthesis pathway (such as 4CL, CSE, CCR, CAD, etc.), and no reports have been made on increasing lignin content by knocking out non-pathway genes (such as transcription factors); (2) Cases of reducing the S / G ratio in the existing technologies (such as 4CL1 knockout) are accompanied by a significant decrease in lignin content, and no reports have been made on specific combinations that reduce the S / G ratio while increasing lignin content; (3) The existing technologies have not reported on the negative regulation of lignin biosynthesis by GRF family members, nor have they provided any technical insights on how knocking out GRF family members can lead to lignin accumulation.

[0006] Therefore, no existing technology has yet discovered a technical solution that can simultaneously achieve the specific combination of "increased lignin content and decreased S / G ratio" in poplar by knocking out GRF family transcription factors. While those skilled in the art can anticipate that PagGRF20 may participate in the regulation of poplar growth and development based on existing technology, they cannot anticipate that knocking out PagGRF20 would significantly promote lignin accumulation, upregulate the expression of key genes in the lignin synthesis pathway, and reduce the S / G ratio. This specific combination is of significant value for the targeted breeding of new poplar varieties with high lignin content and enrichment of G-type monomers.

[0007] To address the aforementioned shortcomings in the prior art, this invention provides a method for targeted improvement of the chemical composition of wood by knocking out the PagGRF20 gene using the CRISPR / Cas9 system, and the transgenic poplar plant with a specific combination of wood properties obtained thereby.

[0008] Based on transcriptomic and gene family analysis, this invention identified the growth regulator PagGRF20 gene using 84K poplar (Populus alba × Populus glandulosa) as material. Unexpectedly, knocking out the PagGRF20 gene using CRISPR / Cas9 gene editing technology significantly upregulated the expression of key genes in the lignin biosynthesis pathway (PAL, C4H, 4CL, CCR, CAD, etc.), promoting lignin accumulation and reducing the S / G ratio (syringyl / guaiacyl ratio) of lignin monomers. This resulted in a pagggrf20 mutant of a superior forest tree species with significantly increased lignin content and a relative enrichment of G-type lignin monomers.

[0009] In existing technologies, GRF family members are reported to promote cell proliferation and organ growth (overexpression promotes growth / xylem development, while knockout usually leads to growth defects). However, this invention found that knocking out PagGRF20 not only did not lead to the expected growth defects, but also unexpectedly activated the lignin biosynthesis pathway, resulting in increased lignin content and a decreased S / G ratio. This reverse regulatory effect of knocking out growth regulators leading to lignin accumulation is unprecedented in the GRF family and even in the entire field of forest tree gene editing, representing a significant advancement and substantial characteristic. The specific phenotypic combination described above has not been reported in existing technologies. In existing technologies, knocking out genes in the lignin biosynthesis pathway (such as...) 4CL1, CSE While other methods (such as knocking out GRF family transcription factors) can also reduce the S / G ratio, these are accompanied by a significant decrease in lignin content. However, the effect of knocking out GRF family transcription factors leading to increased lignin content and a decreased S / G ratio is something that those skilled in the art could not have anticipated from existing technologies. In particular, knocking out a major GRF family member that regulates cell proliferation and organ growth leads to full activation of the lignin synthesis pathway and a large accumulation of lignin, which is completely inconsistent with the traditional understanding of the GRF family's function, indicating that PagGRF20 has a unique negative regulatory role in lignin biosynthesis. Summary of the Invention

[0010] In a first aspect, the present invention provides a method for improving the chemical composition of 84K poplar wood, comprising the following steps: Step 1: Cloning the PagGRF20 gene and designing target primers Using the 84K Yang genome sequence as a template, identification PagGRF20 Gene. A gRNA (shared with the A1 target) was designed targeting the G1 target site of this gene. The target sequence is located in the coding region of the PagGRF20 gene, and the specific gRNA target sequence is shown in SEQ ID NO: 1-3.

[0011] Step 2: Constructing gRNA expression cassettes The promoter-target-sgRNA module was constructed using a cleavage-ligation method (without T4 ligase buffer, powered by ATP). The specific steps are as follows: (1) Target primer double-strand fusion Dilute primers F and R for targets t1, t3, and t4 to 10 μM with double-distilled water. Mix 10 μL of primer F and 10 μL of primer R, incubate at 95℃ for 6 min in a PCR instrument, immediately remove and cool to room temperature for 10 min to form a double-stranded adapter (fusion target primer, final concentration 5 μM).

[0012] (2) Promoter-target-sgRNA module cleavage-ligation reaction The cleavage-ligation method was used, without T4 ligase buffer, and ATP was added for energy. The reaction system (20 μL) consisted of: 10 μL ddH₂O, 2 μL 10×FD buffer, 2 μL 10 mM ATP, 2 μL U3b promoter vector (diluted to 20 ng / μL), 1 μL adapter (fusion target primer, 5 μM), 1 μL T4 ligase, and 2 μL Bsa I (Eco31I). The reaction program was: 37℃ for 5 min; 25℃ for 5 min; for a total of 7 cycles.

[0013] (3) PCR amplification of promoter-target-sgRNA module Using the ligation-by-digestion product as a template, PCR amplification was performed (50 μL system): ddH2O 20 μL, 2×Phanta mix 25 μL, primer F 2 μL, primer R 2 μL, template 1 μL. PCR reaction program: 95℃ 3 min; 95℃ 15 s, 58℃ 15 s, 72℃ 30 s, 33 cycles; 72℃ 5 min; 12℃ ∞.

[0014] (4) Rubber cutting and recycling PCR products were subjected to 1% agarose gel electrophoresis, and the target fragments were recovered by gel excision in a large-well gel (band size: U3b-Target approximately 470 bp, U6-1-Target approximately 270 bp). Recovery procedure: If the bands are not uniform, column purification is required. Centrifuge twice with 700 μL wash buffer, elute with 50-80 μL ddH2O, and determine the concentration of recovered DNA.

[0015] (5) BsaI enzyme digestion PCR product and Cas9 backbone vector BsaI digestion system (40 μL): 33 μL PCR product, 4 μL 10×FD buffer, 3 μL BsaI. Incubate at 37℃ for ≥1 h. The Cas9 backbone vector was also digested with BsaI, with a total amount ≤1 μg.

[0016] (6) Recovery and ligation of enzyme digestion products Ligation system (20 μL): U6 / U3 fragment X μL (U6 / U3b 150 ng, U3d 80 ng), Cas9 vector X μL (60 ng), 10×T4 ligase buffer 2 μL, T4 ligase 1 μL, ddH2O to a final volume of 20 μL. Incubate overnight at 16°C.

[0017] (7) Transformation The ligation product was directly transformed using DH5α competent cells, which have high transformation efficiency. The product was then plated on LB agar plates containing kanamycin (50 mg / L) and incubated overnight at 37°C.

[0018] (8) Microbial detection and sequencing Single clones were picked and inoculated into 4-5 mL LB (50 mg / L kanamycin) medium and incubated overnight at 37°C. Colony PCR identification (2×Taq mix): primers SP-L2 + SP-R, expected bands: single-fragment vector approximately 1300 / 1500 bp, 4-fragment vector (complete Cas9-sgRNA) approximately 1800 bp. Positive clones were sent for sequencing verification, and plasmids were extracted to obtain the pYLCRISPR-PagGRF20 recombinant vector.

[0019] Step 3: Agrobacterium-mediated transformation The built PagGRF20 The gene knockout vector was transferred into Agrobacterium GV3101, and leaves of 84K poplar tissue culture seedlings were infected, proliferated, differentiated, and rooted using the Agrobacterium-mediated method to obtain transgenic plants with stable PagGRF20 knockout.

[0020] Step 4: Mutant Identification Genomic DNA was extracted from transgenic plants, and PCR amplification and sequencing were performed on the G1 target using detection primers shown in SEQ ID NO:4-6. By sequencing analysis, biallelic mutants with base deletions or insertions at the G1 target were screened.

[0021] Step 5: Phenotypic Analysis of Lignin Synthesis For the obtained paggrf20 The mutants underwent the following analyses: histochemical staining (phloroglucinol-HCl staining) to observe lignin accumulation; lignin content determination (Klason method); lignin monomer S / G ratio determination (2D-HSQC NMR); and lignin synthesis pathway gene expression analysis (RT-qPCR detection). PAL, C4H, 4CL, CCR, CAD, F5H, COMT (e.g., genes).

[0022] Secondly, the present invention provides a transgenic 84K poplar plant in which the PagGRF20 gene is stably knocked out in the genome, and the xylem tissue of the plant has the following wood properties: lignin content is higher than that of the wild-type control, the S / G ratio is lower than that of the wild-type control, and the expression level of key genes in the lignin synthesis pathway is higher than that of the wild-type control.

[0023] Thirdly, this invention provides the application of the above-mentioned method and transgenic plants in cultivating new poplar varieties with high lignin content and low S / G ratio. In the aforementioned new poplar varieties with high lignin content and low S / G ratio, the lignin content is increased by 15%-35% compared to the wild type, the S / G ratio is reduced from 1.88 to 1.42-1.55, and guaiac-based (G-type) lignin monomers are relatively enriched. Attached Figure Description

[0024] Figure 1 for PagGRF20 Sequencing identification diagram of gene knockout lines; Figure 2 Wild-type 84K poplar and paggrf20 Phenotypic diagram of xylem phloroglucinol-HCl staining in mutant poplar 84K; Figure 3 Wild-type 84K poplar and paggrf20 Results of lignin content and S / G ratio determination in mutant poplar 84K; Figure 4 Wild-type 84K poplar and paggrf20 RT-qPCR results of expression levels of key genes in the lignin synthesis pathway of mutant poplar 84K. Detailed Implementation

[0025] Example 1: PagGRF20 Construction of gene knockout vector (1) Material preparation: Vectors: U3b, U6-1, U6-29 promoter sgRNA small vectors, Cas9 backbone vector, Cas9 enzyme and reagents: Bsa I (Eco31I), T4 ligase, 10 mM ATP, 10×FD buffer (without loading buffer) (2) Double-stranded fusion of target primers: Dilute the target primers F and R for t1, t3, and t4 to 10 μM with double-distilled water. Mix 10 μL of primer F and 10 μL of primer R, mix gently, centrifuge to the bottom of the tube, react at 95℃ for 6 min in a PCR instrument, remove immediately, and cool at room temperature for 10 min to form double-stranded adapter (final concentration 5 μM).

[0026] (3) The promoter-target-sgRNA module cleavage-ligation reaction adopts the cleavage-ligation method, without T4 ligase buffer, and ATP is added to provide energy. Target1 is ligated to sgRNA, and the expression of sgRNA with Target1 is driven by the U3b promoter, finally obtaining the U3b-Target1-sgRNA module.

[0027] Reaction system (20 μL): ddH2O: 10 μL, 10×FD buffer: 2 μL, 10 mM ATP: 2 μL, U3b promoter vector: 2 μL (diluted to 20 ng / μL), Adaptor (fusion target primer, 5 μM): 1 μL, T4 ligase: 1 μL, Bsa I (Eco31I): 2 μL Reaction program: 37℃ for 5 min; 25℃ for 5 min; 7 cycles in total.

[0028] (4) PCR amplification of the promoter-target-sgRNA module using the ligation-by-cleavage product as a template for PCR amplification (50 μL system): ddH2O: 20 μL, 2×Phanta mix: 25 μL, primers F / R: 2 μL each, template: 1 μL PCR reaction program: 95℃ for 3 min, (95℃ for 15 s, 58℃ for 15 s, 72℃ for 30 s) for 33 cycles, 72℃ for 5 min, 12℃ for ∞ (5) Gel extraction and recovery: PCR products were subjected to 1% agarose gel electrophoresis, and the target fragment was extracted by gel extraction.

[0029] Recovery steps: If the bands are not uniform, column purification is required. Mix the PCR product with 400 μL of sol solution, pass through the column twice, centrifuge twice with 700 μL of wash buffer, centrifuge for 2 min to remove alcohol, evaporate the residual alcohol for 7 min, add 50-80 μL of ddH2O preheated at 65℃, place on the hot plate for 2 min, centrifuge and elute. The eluted solution can be added back to the filter cartridge for another wash (to increase the recovery rate), and the concentration of recovered DNA is measured.

[0030] (6) BsaI enzyme digestion PCR product recovery and Cas9 backbone vector BsaI digestion system (40 μL): PCR product: 33 μL, 10×FD buffer (green): 4 μL, BsaI: 3 μL Incubate in a 37℃ water bath for ≥1 h.

[0031] The Cas9 backbone vector was also digested with Bsa I enzyme, with a total amount ≤1 μg.

[0032] (7) Recovery and ligation of enzyme digestion products: run on macroporous gel and digest the gel. Dissolve the product in 30 μL of ddH2O and measure the concentration (concentrate the low concentration to the appropriate concentration).

[0033] Connection: 20 μL system (After measuring the concentration of the recovered product, add samples according to the ratio of the carrier backbone to the total nanograms of each fragment: Cas9 60 ng; U6 / U3b 150 ng; U3d 80 ng. For recovered products with very poor peak values ​​during concentration measurement, appropriately increase the total nanograms, such as U6 / U3b 200 ng; U3d 100 ng).

[0034] Ligation reaction system (20 μL): U6 / U3 fragment: X μL, Cas9: X μL, 10×T4 ligase buffer: 2 μL, T4 ligase: 1 μL, ddH2O: to 20 μL Incubate overnight at 16°C.

[0035] (8) Transformation: Use competent cells with high transformation efficiency (such as DH5α) to directly transform the ligation product. Using the ligation product as a template, amplify the assembled multi-module using PB-L+PB-R primers, then digest with enzymes and ligate to the Cas9 backbone. Spread on LB plates containing kanamycin (50 mg / L) and incubate overnight at 37°C.

[0036] (9) Shaking and bacterial testing: Select single clones and inoculate them into glass tubes containing 4-5 mL LB (50 mg / L kanamycin) medium. Shake overnight at 37°C.

[0037] Bacterial culture PCR identification: Bacterial culture identification was performed using 2×Taq mix (primers: SP-L2 + SP-R) (the band size for the 3-fragment vector was approximately 1300 / 1500 bp, and the band size for the 4-fragment vector was approximately 1800 bp).

[0038] Positive clones were sent for sequencing verification, and plasmids were extracted to obtain the pYLCRISPR-PagGRF20 recombinant vector.

[0039] Example 2: Genetic transformation of 84K poplar The built PagGRF20 The knockout vector plasmid was transformed into Agrobacterium GV3101 via heat shock. Agrobacterium cells were picked and incubated overnight at 28°C in a shaking incubator in 5 mL LB (25 mg / L rifampin + 50 mg / L kanamycin) liquid medium until the OD600 value reached 0.8. 1 mL of the incubator was then added to 100 mL LB (25 mg / L rifampin + 50 mg / L kanamycin) liquid medium for subculturing until the OD600 value reached 0.8. 600 =0.6-0.8.

[0040] Leaves from healthy 84K tissue culture seedlings approximately 4 weeks old were selected for infection. The leaves were transversely cut along the veins using a scalpel, infected with Agrobacterium for 13 minutes, and then transferred to a co-culture medium for dark incubation for 2-3 days. Afterward, they were transferred to a selection medium (hygromycin 3 mg / L) and incubated in the dark until callus formed. Once the callus reached approximately 0.5 cm in length, it was transferred to a differentiation medium (hygromycin 3 mg / L). When the shoots reached a height of 1 cm, they were transferred to a rooting medium to induce rooting. Subculture was then performed on the rooting medium.

[0041] Example 3: Identification of PagGRF20 knockout lines (1) DNA Extraction and PCR Amplification: Genomic DNA was extracted from wild-type and transgenic plants and used as templates. Amplification was performed using detection primers Q-102889-G1-F1 and Q-102889-G1-1287R2. The amplification products were ligated into a T-vector and transformed into *E. coli*. Single clones were picked and sent to the company for sequencing. The sequencing results are as follows: Figure 1 As shown. The detection primers are: Q-102889-G1-F1: TTGTGCTTGCATGTGTGCAC, Q-102889-G1-F2: GAGAAATATTATGCAACGAGAC (sequencing primers), Q-102889-G1-1287R2: AGCAGCAGCGAAGAGGGTTA Example 4: Phenotypic observation of PagGRF20 knockout lines PagGRF20 gene knockout plants and wild-type plants were simultaneously planted in a climate chamber, with a total of three batches. After about 90 days of growth, the phenotypic observation, photography, section microscopic observation and statistical analysis of different batches of plants were carried out.

[0042] like Figure 2 As shown, it is a wild-type 84K poplar and paggrf20 Phenotypic image of xylem from mutant 84K poplar stained with phloroglucinol-HCl. Stem segments from the 5th node of the plant were sectioned by shaking, with a section thickness of 50 μm. Immediately after sectioning, phloroglucinol-HCl staining was performed. After washing away excess stain, ordinary optical photography was used for observation. Compared with WT... PagGRF20 The gene knockout lines showed significantly increased lignin content and a significantly decreased S / G ratio.

[0043] The lignin monomer S / G ratio was determined using 2D-HSQC NMR analysis. Figure 3 As shown, compared with WT, its S / G ratio decreased significantly from 1.88 to 1.42-1.55, indicating that G-type lignin monomers are relatively enriched.

[0044] Analysis of gene expression in the lignin synthesis pathway ( Figure 4 ), PagGRF20 In gene knockout plants PAL, C4H, 4CL CCR The expression levels of genes such as F5H and COMT were significantly upregulated, by 2-3 times, while the expression of S-type monomeric synthetic genes such as F5H and COMT was downregulated or showed no significant change.

[0045] The method of this invention utilizes CRISPR / Cas9 gene editing technology to knock out PagGRF20 Genes promote lignin accumulation, reduce the S / G ratio, and alter wood cell characteristics, thereby obtaining superior tree varieties with increased lignin content and enrichment of G-type lignin monomers. paggrf20 Mutant.

Claims

1. A method for improving the chemical composition of 84K poplar wood, characterized in that, Includes the following steps: (a) Design and synthesize targeting PagGRF20 gRNA targeting the G1 gene site, wherein the target sequence of the gRNA is shown in SEQ ID NO: 1-3; (b) The gRNA target site was ligated to the promoter-sgRNA module using the cleavage-ligation method to construct a gRNA expression cassette; (c) The gRNA expression cassette was digested with BsaI and then ligated into the Cas9 backbone vector to construct... PagGRF20 Gene knockout vector; (d) the PagGRF20 The gene knockout vector was transformed into Agrobacterium GV3101 to obtain recombinant Agrobacterium; (e) The recombinant Agrobacterium was used to infect the leaves of 84K poplar tissue culture seedlings. After co-culture, screening, differentiation and rooting culture, transgenic plants with stable PagGRF20 knockout were obtained. Compared with wild-type 84K poplar, the transgenic plants simultaneously meet the following wood properties: (1) The lignin content in the xylem of the stem was significantly increased; (2) The S / G ratio of lignin monomers was significantly reduced; (3) Key genes in the lignin biosynthesis pathway PAL, C4H, 4CL, CCR, CAD The expression level was upregulated; (4) The staining of the xylem with phloroglucinol-HCl was significantly deepened.

2. The method as described in claim 1, characterized in that, The lignin content of the transgenic plants was increased by 15%-35% compared with the wild type, and the S / G ratio was reduced from 1.88 to 1.42-1.

55.

3. The method as described in claim 1, characterized in that, The gRNA target sequence mentioned in step (a) is: t1:GCCAGGAAGGTGCCGGAGGA CGG (SEQ ID NO:1) t3:TTGGAAGCAACATGTCACGT TGG (SEQ ID NO:2) t4: GGACGGATGGCAAAAAGTGG AGG (SEQ ID NO: 3).

4. The method as described in claim 1, characterized in that, The infection described in step (e) includes: culturing the recombinant Agrobacterium to OD200. 600 =0.6-0.8, centrifuge to collect bacterial cells, resuspend in LB liquid medium, and infect 84K poplar tissue culture seedling leaves for 13-20 min.

5. The method as described in claim 1, characterized in that, Step (e) is followed by a mutant identification step: extracting genomic DNA from the transgenic plant, and using detection primers to perform PCR amplification and sequencing identification of the G1 target. The detection primers are: Q-102889-G1-F1:TTGTGCTTGCATGTGTGCAC (SEQ ID NO:4) Q-102889-G1-F2:GAGAAATATTATGCAACGAGAC (SEQ ID NO:5) Q-102889-G1-1287R2: AGCAGCAGCGAAGAGGGTTA (SEQ ID NO: 6).

6. A transgenic 84K poplar plant, characterized in that, The plant genome PagGRF20 The gene was stably knocked out, and the xylem tissue of the plant stem simultaneously possessed the following woody characteristics: The lignin content was higher than that of the wild-type control, the S / G ratio was lower than that of the wild-type control, and the expression level of key genes in the lignin synthesis pathway was higher than that of the wild-type control.

7. The transgenic 84K poplar plant as described in claim 6, characterized in that, The plant is obtained by the method according to any one of claims 1-5.

8. The method as described in any one of claims 1-5, and the application of the transgenic 84K poplar plant as described in claim 6 or 7 in the cultivation of new poplar varieties with high lignin content and low S / G ratio.

9. The application as described in claim 8, characterized in that, Among the new poplar varieties with high lignin content and low S / G ratio, the lignin content is increased by 15%-35% compared with the wild type, the S / G ratio is reduced from 1.88 to 1.42-1.55, and the guaiac-based (G-type) lignin monomers are relatively enriched.

10. The method as described in claim 1, characterized in that, The PagGRF20 Gene replacement with PagGRF20 Homologous genes whose coding region sequences have at least 98% homology and whose encoded proteins are functionally equivalent.

Images