Engineered vectorized antibodies with reduced stability in systemic circulation and uses thereof
Patent Information
- Application Number
- EP2024840486
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-07-11
- Filing Date
- 2024-07-10
- Publication Date
- 2026-07-01
Smart Images

Figure US2024037402_16012025_PF_FP_ABST
Abstract
Description
[0001] ENGINEERED VECTORIZED ANTIBODIES WITH REDUCED STABILITY IN
[0002] SYSTEMIC CIRCULATION AND USES THEREOF
[0003] CROSS-REFERENCE TO RELATED APPLICATIONS
[0004] This application claims priority to, and benefit of, U.S. Provisional Application No. 63 / 512,942, filed July 11, 2023. the contents of which are incorporated by reference in their entirety herein.
[0005] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0006] The contents of the electronic sequence listing (BRAV- 004 001WO SEQLIST _st26.xml; Size: 221.184 bytes; and Date of Creation: July 9, 2024) are herein incorporated by reference in their entirety.
[0007] BACKGROUND
[0008] Constitutive expression of vectorized antibodies (vAbs) delivered via AAV vectors is a promising therapeutic approach, particularly for central nervous system (CNS) applications (Bajracharya et al. Current and Emerging Strategies for Enhancing Antibody Delivery to the Brain. Pharmaceutics. 13(12):2014, Nov 26 2021) for at least two reasons: 1) peripherally delivered therapeutic recombinant antibodies do not easily cross the blood-brain barrier (BBB); and 2) CNS cells are long-lived allowing for practically indefinite secretion of therapeutic vAbs following transduction by an AAV vector. However, antibodies readily escape from CNS into systemic circulation, resulting in potential safety concerns. Accordingly, compositions and methods for reducing vAbs in systemic circulation are needed.
[0009] SUMMARY
[0010] Antibody therapy is commonly used for treating various diseases such as cancer and autoimmune disorders. Typically, antibodies delivered systemically are only needed for treatment of a specific tissue (e.g., diseased tissue). For example, antibodies used for cancer therapy (e.g.. immune checkpoint inhibitors) are intended to target a tumor, but may also target other tissues of the body, potentially resulting in toxicity. There exists an ongoing need to control antibody expression and activity outside a tissue of interest.
[0011] The present disclosure provides two approaches for reducing or preventing antibody activity outside of a tissue of interest, which can be used in combination. First, in some aspects the disclosure provides a therapeutic antibody engineered to have a sequence motif which increases susceptibility of the therapeutic antibody to protease degradation in systemic circulation. Without being bound by theory, upon escape of the therapeutic antibody from the tissue of interest (e.g., when the antibody enters systemic circulation), proteases expressed in systemic circulation will degrade the antibody to render it inactive. In some aspects, the sequence motif is specific for a protease expressed in systemic circulation (i.e., the protease is not expressed in the tissue of interest or is expressed at a lower level compared to expression in systemic circulation). Thus, the antibody antigen binding and therapeutic effect will only be observed in the tissue of interest (e.g., expression in the CNS and degradation in systemic circulation). In other aspects, the disclosure provides a therapeutic antibody having a variant Fc domain with reduced binding to the neonatal Fc receptor (FcRn). Without wishing to be bound by theory, reduced binding of the therapeutic antibody to FcRn results in less protection from proteolytic degradation, and thus, the therapeutic antibody will be degraded and recycled at a faster rate in certain tissues (e.g. liver and kidney). In some aspects, the engineered therapeutic antibodies described herein are encoded by a transgene and delivered via adeno- associated viral (AAV) vectors. Without being bound by theory, the AAV vectors described herein are useful for treating a tissue specific disease, disorder, or condition with reduced impact outside the tissue of interest.
[0012] Accordingly, in some aspects, the disclosure provides an adeno-associated viral (AAV) vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in a tissue of interest, or antigen binding fragment thereof, wherein the therapeutic antibody comprises a sequence motif which increases susceptibility of the therapeutic antibody, or antigen binding fragment thereof, to protease degradation in systemic circulation.
[0013] In some embodiments, the sequence motif is 2-50 amino acids.
[0014] In some embodiments, the sequence motif comprises a protease sensitive domain. In some embodiments, the protease sensitive domain is recognized by a protease active in systemic circulation. In some embodiments, the protease is a human protease. In some embodiments, the protease cleaves the therapeutic antibody, or antigen binding fragment thereof, thereby degrading the therapeutic antibody, or antigen binding fragment thereof. In some embodiments, the protease is active at higher levels in systemic circulation relative to activity in the tissue of interest.
[0015] In some embodiments, increased susceptibility of the therapeutic antibody to protease degradation is relative to an antibody without the sequence motif. In some embodiments, the sequence motif comprises a thrombin cleavage site. In some embodiments, the thrombin cleave site comprises an amino acid sequence selected from LVPRG (SEQ ID NO: 86), LVPRGS (SEQ ID NO: 85), QVRLG (SEQ ID NO: 87), GVYARVTA (SEQ ID NO: 88), MKSRNL (SEQ ID NO: 89), RCKPVN (SEQ ID NO: 90), SSKYPN (SEQ ID NO: 91), NTLPRTFGG (SEQ ID NO: 92), SPIVKSFN (SEQ ID NO: 93) and SRGSLDPRSFLLRNPNDKYEPFWEDEE (SEQ ID NO: 94).
[0016] In some embodiments, the sequence motif comprises a Factor Xa cleavage site. In some embodiments, the Factor Xa cleavage site comprises an amino acid sequence selected from IEGR (SEQ ID NO: 95), IEGRGH (SEQ ID NO: 96), IEGRGIP (SEQ ID NO: 97), IEGRISE (SEQ ID NO: 98), IQGR (SEQ ID NO: 99), SGLSRIVN (SEQ ID NO: 100), and GVYARVTA (SEQ ID NO: 88).
[0017] In some embodiments, the sequence motif comprises a thrombin cleavage site and a Factor Xa cleavage site. In some embodiments, the thrombin cleavage site and the Factor Xa cleavage site are operably linked via linker. In some embodiments, the linker comprises a glycine or glycine-serine linker that is 3-6 amino acids in length.
[0018] In some embodiments, the therapeutic antibody comprises an Fc domain, and wherein the Fc domain comprises the sequence motif.
[0019] In some embodiments, the therapeutic antibody comprises a hinge region, and wherein the hinge region comprises the sequence motif. In some embodiments, the hinge region comprises a sequence of RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112), or a sequence having between 1 -5 insertions, deletions or substitutions relative thereto. In some embodiments, the sequence motif is inserted between amino acids 7 and 8 with respect to RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112) In some embodiments, the sequence motif is operably linked to the Fc domain or the hinge region via an N-terminal linker, a C-terminal linker, or both. In some embodiments, the linker comprises a glycine or glycineserine linker. In some embodiments, the linker is selected from the group consisting of GGG, GGGG (SEQ ID NO: 140), GGGGS (SEQ ID NO: 141), GGGS (SEQ ID NO: 142), SGGG (SEQ ID NO: 143) and SGGGG (SEQ ID NO: 144).
[0020] In some embodiments, the therapeutic antibody comprises a variable heavy (VH) chain and a variable light (VL) chain. In some embodiments, the therapeutic antibody is a fragment comprising the VH and VL chains. In some embodiments, the VH and VL chains are operatively linked via a linker. In some embodiments, the linker comprises the sequence motif.
[0021] In some embodiments, the therapeutic antibody is a single chain variable fragment (scFv), IgG, a diabody, aminibody, a Fab’ fragment, a F(ab’)2 fragment, a bispecific Fab dimer (Fab2), a trispecific Fab trimer (Fab3), an Fv. a bis-scFv, (scFv)2, a Camel Ig, a VHH, an Ig NAR, a triabody, a tetrabody, a disulfide stabilized Fv protein (“dsFv’), or a single-domain antibody (sdAb).
[0022] In some aspects, the disclosure provides an AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in a tissue of interest, wherein the therapeutic antibody comprises a variant Fc domain which has reduced binding to a neonatal Fc receptor (FcRn).
[0023] In some embodiments, the variant Fc domain comprises at least one amino acid deletion, at least one amino acid substitution, at least one amino acid insertion, or any combination thereof. In some embodiments, the amino acid deletion, substitution or insertion occurs at one or more of amino acid residues K246, P247, K248, D249, L251, M252, 1253, S254, R255, T256, P257, E258, V279, D280, V282, E283, V284, H285, N286, A287, K288, V305, L306, T307. V308, L309, H310, Q311, D312, W313, N315, K317, A339, K340, G341, P374, D376, A378, E380, E382, S383, N384, G385, Q386, P387, N389, S426, V427, H429, E430, A431. L432, H433. N434, H435. Y436, T437. and Q438, according to EU numbering. In some embodiments, the variant Fc domain comprises at least one amino acid substitution at one or more amino acid residues selected from K246, P247, K248, D249, L251, M252, 1253, S254, R255, T256. P257, E258, V279, D280, V282, E283, V284, H285. N286, A287, K288, V305, L306, T307. V308, L309. H310, Q31 1. D312, W313, N315, K3I7, A339, K340, G341, P374, D376, A378, E380, E382, S383, N384, G385, Q386, P387, N389, S426, V427, H429, E430, A431, L432, H433, N434, H435, Y436, T437, and Q438, according to EU numbering.
[0024] In some embodiments, the therapeutic antibody comprises a VH chain and a VL chain.
[0025] In some embodiments, the therapeutic antibody has increased susceptibility to proteolytic cleavage compared to an antibody without the variant Fc domain.
[0026] In some embodiments the therapeutic antibody comprises both a variant Fc domain and a sequence motif which increases susceptibility of the therapeutic antibody to protease degradation in systemic circulation. In some embodiments, the sequence motif is 2-50 amino acids. In some embodiments, the sequence motif comprises a protease sensitive domain. In some embodiments, the protease sensitive domain is recognized by a protease active in systemic circulation. In some embodiments, the protease is a human protease. In some embodiments, the protease cleaves the therapeutic antibody thereby degrading the therapeutic antibody. In some embodiments, the protease is active at higher levels in systemic circulation relative to activity in the tissue of interest. In some embodiments, increased susceptibility of the therapeutic antibody to protease degradation is relative to an antibody without the sequence motif. In some embodiments, the sequence motif comprises a thrombin cleavage site. In some embodiments, the thrombin cleavage site comprises an amino acid sequence selected from the group consisting of LVPRG (SEQ ID NO: 86), LVPRGS (SEQ ID NO: 85), QVRLG (SEQ ID NO: 87), GVYARVTA (SEQ ID NO: 88), MKSRNL (SEQ ID NO: 89), RCKPVN (SEQ ID NO: 90), SSKYPN (SEQ ID NO: 91), NTLPRTFGG (SEQ ID NO: 92), SPIVKSFN (SEQ ID NO: 93) and SRGSLDPRSFLLRNPNDKYEPFWEDEE (SEQ ID NO: 94). In some embodiments, the sequence motif comprises a Factor Xa cleavage site. In some embodiments, the Factor Xa cleavage site comprises an amino acid sequence selected from the group consisting of IEGR (SEQ ID NO: 95), IEGRGH (SEQ ID NO: 96), IEGRGIP (SEQ ID NO: 97), IEGRISE (SEQ ID NO: 98), IQGR (SEQ ID NO: 99), SGLSRIVN (SEQ ID NO: 100), and GVYARVTA (SEQ ID NO: 88). In some embodiments, the sequence motif comprises a thrombin cleavage site and a Factor Xa cleavage site. In some embodiments, the thrombin cleavage site and the Factor Xa cleavage site are operably linked via linker. In some embodiments, wherein the linker comprises a glycine or glycine-serine linker that is 3-6 amino acids in length. In some embodiments, the variant Fc domain comprises the sequence motif. In some embodiments, wherein the therapeutic antibody comprises a hinge region, and wherein the hinge region comprises the sequence motif. In some embodiments, the hinge region comprises a sequence of RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112), or a sequence having between 1-5 insertions, deletions or substitutions relative thereto. In some embodiments, the sequence motif is inserted between amino acids 7 and 8 with respect to RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112). In some embodiments, the sequence motif is operably linked to the variant Fc domain or the hinge region via an N- terminal linker, a C-terminal linker, or both. In some embodiments, the linker comprises a glycine or glycine-serine linker, optionally wherein the linker is selected from the group consisting of GGG, GGGG (SEQ ID NO: 140), GGGGS (SEQ ID NO: 141), GGGS (SEQ ID NO: 142), SGGG (SEQ ID NO: 143) and SGGGG (SEQ ID NO: 144).
[0027] In some embodiments, the sequence motif and the variant Fc domain act synergistically to reduce concentration of the therapeutic antibody in circulation. In some embodiments, the sequence motif comprises a thrombin cleavage site and / or Factor Xa cleavage site, and the variant Fc domain comprises an I253A substitution, or an I253A substitution, H310A substitution, and H435A substitution. In some embodiments, the tissue of interest is a tissue of the central nervous system (CNS). In some embodiments, the tissue of interest is muscle. In some embodiments, the tissue of interest is liver.
[0028] In some embodiments, the therapeutic antibody is an immune checkpoint inhibitor antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-PDl, an anti-PD-Ll, an anti-CTLA4, an anti-LAG3, an anti-TIM3, an anti-BTLA, an anti-GITR. an anti-TIGIT, an anti-VISTAS, an anti-ICOS. an anti-ICOSL, an anti-OX40, an anti-B7H3, an anti-B7H4, an anti-CD47, an anti-4-lBB, an anti-CD27, or an anti-CD70, antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-PDl or an anti-PD-Ll antibody.
[0029] In some aspects, the disclosure provides an AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in the CNS, or an antigen binding fragment thereof, wherein the therapeutic antibody is an anti-PDl or an anti-PD-Ll antibody, or antigen binding fragment thereof, and wherein the therapeutic antibody, or antigen binding fragment thereof, comprises one or more protease sensitive domains recognized by thrombin and / or Factor Xa.
[0030] In some aspects, the disclosure provides an AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in the CNS, wherein the therapeutic antibody is an anti-PDl or an anti-PD-Ll antibody, and wherein the therapeutic antibody comprises a variant Fc domain comprising at least one amino acid substitution, wherein the variant Fc domain has reduced binding affinity' to a FcRn.
[0031] In some embodiments, the anti-PD-Ll antibody comprising the variant Fc domain comprises one or more protease sensitive domains recognized by thrombin and / or Factor Xa.
[0032] In some embodiments, the anti-PD-Ll antibody is atezolizumab, durvalumab, avelumab, or envafolimab. In some embodiments, the anti-PDl antibody is nivolumab, pembrolizumab, or cemiplimab.
[0033] In some embodiments, the therapeutic antibody is an anti-CD20 antibody, or fragment thereof.
[0034] In some aspects, the disclosure provides an AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in the CNS. or an antigen binding fragment thereof, wherein the therapeutic antibody is an anti-CD20 antibody, or antigen binding fragment thereof, and wherein the therapeutic antibody, or antigen binding fragment thereof, comprises one or more protease sensitive domains recognized by thrombin and / or Factor Xa.
[0035] In some aspects, the disclosure provides an AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in the CNS, and wherein the therapeutic antibody is an anti-CD20 antibody, wherein the therapeutic antibody comprises a variant Fc domain comprising at least one amino acid substitution, wherein the variant Fc domain has reduced binding affinity to a FcRn.
[0036] In some embodiments, the anti-CD20 antibody comprising the variant Fc domain comprises one or more protease sensitive domains recognized by thrombin and / or Factor Xa.
[0037] In some embodiments, the anti-CD20 antibody is rituximab, Obinutuzumab, ofatumumab, ibritumomab, ocrelizumab, tositumomab, veltuzumab, GA101, TRU-015, or PRO131921.
[0038] In some embodiments, the AAV capsid is an AAV9 capsid. In some embodiments, the AAV9 capsid comprises an ammo acid sequence at least 90% identical to SEQ ID NO: 101.
[0039] In some embodiments, tropism of the AAV vector is for the CNS. In some embodiments, the AAV capsid comprises at least one modification that enhances permeability7of the AAV vector across the blood-brain barrier (BBB). In some embodiments, the AAV capsid comprises at least one modification that enhances tropism of the AAV vector for the CNS relative to an AAV vector comprising an AAV capsid without the modification. In some embodiments, the modification is one or more of an amino acid deletion, an amino acid substitution, or an amino acid insertion.
[0040] In some embodiments, the AAV capsid comprises a peptide insert, wherein the peptide insert enhances permeability of the AAV vector across the blood-brain barrier (BBB). In some embodiments, the AAV capsid comprises a peptide insert, wherein the peptide insert enhances tropism of the AAV vector for the CNS relative to an AAV vector comprising an AAV capsid without the peptide insert. In some embodiments, the peptide insert is derived from a cellpenetrating peptide (CPP). In some embodiments, the peptide insert comprises 4-50, 5-25, or 5-10 amino acids.
[0041] In some embodiments, the peptide insert comprises V[S / p][AWt]L; TV[S / p][A / m / t]L; TV[S / p][A / m / t]LK (SEQ ID NO: 81); or TV[S / p][A / m / t]LFK (SEQ ID NO: 82). In some embodiments, the peptide insert comprises at least 4 contiguous amino acids of VSALK (SEQ ID NO: 2), TVSALK (SEQ ID NO: 4), TVSALKF (SEQ ID NO: 145), VPALR (SEQ ID NO: 1), TVPALR (SEQ ID NO: 3), TVPMLK (SEQ ID NO: 12), TVPTLK (SEQ ID NO: 13), FTVSALK (SEQ ID NO: 5). LTVSALK (SEQ ID NO: 6), TVPALFR (SEQ ID NO: 9), TVPMLFK (SEQ ID NO: 10), or TVPTLFK (SEQ ID NO: 11). In some embodiments, the peptide insert comprises at least 4, at least 5, or at least 6 contiguous amino acids of TVSALK (SEQ ID NO: 4) or TVSALFK (SEQ ID NO: 8). In some embodiments, the peptide insert comprises TVSALK (SEQ ID NO: 4) or TVSALFK (SEQ ID NO: 8). In some embodiments, the peptide insert is between amino acids 588 and 589 of the amino acid sequence of SEQ ID NO: 101.
[0042] In some embodiments, the peptide insert is up to 21 amino acids and comprises 5-7 amino acids of VSALK (SEQ ID NO: 2), TVSALK (SEQ ID NO: 4), TVSALKF (SEQ ID NO: 145), VPALR (SEQ ID NO: 1). TVPALR (SEQ ID NO: 3), TVPMLK (SEQ ID NO: 12), TVPTLK (SEQ ID NO: 13), FTVSALK (SEQ ID NO: 5), LTVSALK (SEQ ID NO: 6), TVPALFR (SEQ ID NO: 9), TVPMLFK (SEQ ID NO: 10), or TVPTLFK (SEQ ID NO: 11). In some embodiments, the peptide insert is up to 21 amino acids and comprises 5-7 amino acids of TVSALFK (SEQ ID NO: 8). In some embodiments, the peptide insert is 5-21 amino acids and compnses 5-7 ammo acids of VSALK (SEQ ID NO: 2), TVSALK (SEQ ID NO: 4). TVSALKF (SEQ ID NO: 145), VPALR (SEQ ID NO: 1), TVPALR (SEQ ID NO: 3), TVPMLK (SEQ ID NO: 12), TVPTLK (SEQ ID NO: 13), FTVSALK (SEQ ID NO: 5), LTVSALK (SEQ ID NO: 6), TVPALFR (SEQ ID NO: 9), TVPMLFK (SEQ ID NO: 10), or TVPTLFK (SEQ ID NO: 11). In some embodiments, the peptide insert is 5-21 amino acids and comprises 5-7 amino acids of TVSALFK (SEQ ID NO: 8).
[0043] In some embodiments, the capsid comprises a sequence of SEQ ID NO: 126 or 127.
[0044] In some embodiments, the viral genome comprises at least one inverted terminal repeat (ITR). In some embodiments, the viral genome comprises from 5 ’ to 3 ’ : a 5 TTR, the transgene, and a 3’ITR. In some embodiments, the ITR is isolated or derived from AAV2.
[0045] In some embodiments, the viral genome comprises a promoter. In some embodiments, the promoter is a tissue specific promoter. In some embodiments, the tissue specific promoter is for a tissue of the CNS.
[0046] In some aspects, the disclosure provides a pharmaceutical composition comprising the AAV vector described herein, and a pharmaceutically acceptable carrier.
[0047] In some aspects, the disclosure provides a method for providing a therapeutic antibody to a tissue of interest and reducing stability- of the therapeutic antibody in systemic circulation, the method comprising administering to a subject the AAV vector described herein or a pharmaceutical composition described herein. In some embodiments, the concentration of the therapeutic antibody is reduced in systemic circulation compared to a therapeutic antibody without the sequence motif or variant Fc domain. In some embodiments, the concentration of the therapeutic antibody is higher in the tissue of interest relative to the concentration in systemic circulation.
[0048] In some embodiments, the therapeutic antibody is degraded and / or metabolized rapidly outside the tissue of interest.
[0049] In some embodiments, the tissue of interest is a tissue of the CNS. In some embodiments, the tissue of interest is a muscle tissue.
[0050] In some embodiments, the AAV vector or pharmaceutical composition is administered via a route of administration selected from: parenteral, oral, sublingual, nasal, subcutaneous, intrathecal, intravenous, intravitreal, intra-cistema magna. intracerebroventricular, intraparenchymal, and epidural.
[0051] In some aspects, the disclosure provides use of an AAV vector or pharmaceutical composition described herein for providing a therapeutic antibody to a tissue of interest and reducing stability of the therapeutic antibody in systemic circulation, comprising administering to a subject the AAV vector or pharmaceutical composition.
[0052] In some aspects, the disclosure provides use of an AAV vector described herein for use in the manufacture or a medicament for providing a therapeutic antibody to a tissue of interest and reducing stability of the therapeutic antibody in systemic circulation, comprising administering to a subject the AAV vector or pharmaceutical composition.
[0053] BRIEF DESCRIPTION OF THE DRAWINGS
[0054] A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:
[0055] FIG. 1 is a schematic showing the AAV vector injection, tissue collection and assay schedule described in Example 3.
[0056] FIG. 2A is a plot showing levels of durvalumab in the plasma of mice administered AAV vectors as described in Example 3. Vectors are identified by number on the x-axis (see Table 1), and durvalumab levels, in pg / mL, are shown on the y-axis.
[0057] FIG. 2B is a plot showing levels of durvalumab in the brain of mice administered AAV vectors as described in Example 3. Vectors are identified by number on the x-axis (see Table 1), and durvalumab levels, in ng / mg, are shown on the y-axis. FIG. 2C is a plot showing levels of durvalumab in the liver of mice administered AAV vectors as described in Example 3. Vectors are identified by number on the x-axis (see Table 1), and durvalumab levels, in ng / mg, are shown on the y-axis.
[0058] FIG. 2D is a plot showing levels of durvalumab in the heart of mice administered AAV vectors as described in Example 3. Vectors are identified by number on the x-axis (see Table 1), and durvalumab levels, in ng / mg, are shown on the y-axis.
[0059] FIG. 3 is a plot showing the ratio of durvalumab in the brain to durvalumab in plasma, normalized to durvalumab IgGl control vector D-001 . Vectors are identified by number on the x-axis (see Table 1), and the normalized braimplasma ratio is shown on the y-axis.
[0060] FIG. 4 is a plot showing the ratio of durvalumab in the liver to durvalumab in plasma, normalized to durvalumab IgGl control vector D-001. Vectors are identified by number on the x-axis (see Table 1), and the normalized braimplasma ratio is shown on the y-axis.
[0061] DETAILED DESCRIPTION
[0062] In some embodiments, the disclosure provides an AAV vector comprising a viral genome comprising a transgene encoding a therapeutic antibody or an antigen binding fragment thereof described herein. In some embodiments, the therapeutic antibody or antigen binding fragment comprises a sequence motif which increases susceptibility7of the therapeutic antibody to protease degradation in systemic circulation. In some embodiments, the therapeutic antibody comprises a variant Fc domain with reduced binding affinity to the FcRn. In some embodiments, the therapeutic antibody comprises a sequence motif which increases susceptibility7of the therapeutic antibody to protease degradation in systemic circulation and a variant Fc domain with reduced binding affinity to the FcRn.
[0063] In some embodiments, upon delivery of the AAV vector to a tissue of interest, the therapeutic antibody is expressed in the tissue of interest. In some embodiments, the therapeutic antibody escapes the tissue of interest and enters a tissue not of interest. In some embodiments, the therapeutic antibody escapes the tissue of interest and enters systemic circulation. In some embodiments, the therapeutic antibody is degraded in the tissue not of interest. In some embodiments, the therapeutic antibody is degraded in systemic circulation. In some embodiments, the therapeutic antibody is degraded by proteases. In some embodiments, the therapeutic antibody is degraded by proteolytic cleavage. In some embodiments, the therapeutic antibody is expressed at a higher concentration in the tissue of interest relative to expression in the tissue not of interest. In some embodiments, the therapeutic antibody is expressed at a higher concentration in the tissue of interest relative to expression in systemic circulation.
[0064] Definitions
[0065] As used herein, the term “adeno-associated virus’" or “AAV” refers to members of the dependovirus genus comprising any vector, sequence, gene, protein, or component derived therefrom. The term includes without limitation type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV ty pe 9, AAV type 10, AAV type 11, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV and any other AAV now known or later discovered. The genomic sequences of various AAV and autonomous parvoviruses, as well as the sequences of the ITRs, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as the GENBANK database. AAV includes without limitation AAV generated through any methods known in the art. For example, AAV includes recombinant AAV (rAAV) which in some embodiments is AAV generated using recombination methods.
[0066] As used herein, the term “AAV vector” refers to viral genome packaged in an AAV capsid. In some embodiments, the viral genome of the AAV vector comprises minimal AAV sequences to avoid replication (e.g., inverted terminal repeat sequences).
[0067] As used herein, the term "antibody" refers to a whole antibody comprising two light chain polypeptides and two heavy chain polypeptides. Whole antibodies include different antibody isotypes including IgM, IgG, IgA, IgD, and IgE antibodies. The term "antibody" includes a polyclonal antibody, a monoclonal antibody, a chimerized or chimeric antibody, a humanized antibody, a primatized antibody, a deimmunized antibody, and a fully human antibody. The antibody can be made in or derived from any of a variety of species, e.g., mammals such as humans, non-human primates (e.g., orangutan, baboons, or chimpanzees), horses, cattle, pigs, sheep, goats, dogs, cats, rabbits, guinea pigs, gerbils, hamsters, rats, and mice. The antibody can be a purified or a recombinant antibody.
[0068] As used herein, the terms "antibody fragment," "anti gen- binding fragment," "antigen binding portion", or similar terms refer to a fragment of an antibody that retains the ability to bind to a target antigen and inhibit the activity of the target antigen. Such fragments include, e.g., a single chain antibody, a single chain Fv fragment (scFv), a bispecific Fab dimer (Fab2), a trispecific Fab trimer (Fab3), an Fv, a bis-scFv, (scFv)2, a Camel Ig, a VHH, and Ig NAR, a disulfide stabilized Fv protein (dsFv), a single-domain antibody (sdAb), an Fd fragment, a Fab fragment, a Fab' fragment, or an F(ab')2 fragment. An scFv fragment is a single polypeptide chain that includes both the heavy and light chain variable regions of the antibody from which the scFv is derived. In addition, intrabodies, minibodies, triabodies. tetrabodies, and diabodies are also included in the definition of antibody and are compatible for use in the methods described herein. See, e.g., Todorovska et al., (2001) J. Immunol. Methods 248(l):47-66; Hudson and Kortt, (1999) J. Immunol. Methods 231(1): 177-189; Poljak, (1994) Structure 2(12): 1121-1123; Rondon and Marasco, (1997) Annu. Rev. Microbiol. 51 :257-283, the disclosures of each of which are incorporated herein by reference in their entirety.
[0069] As used herein, an ’‘antigen” is an entity which induces or evokes an immune response in an organism. An immune response is characterized by the reaction of the cells, tissues and / or organs of an organism to the presence of a foreign entity. Such an immune response typically leads to the production by the organism of one or more antibodies against the foreign entity, e.g., antigen or a portion of the antigen. As used herein, “antigens” also refer to binding partners for specific antibodies or binding agents in a display library.
[0070] As used herein, the term "bispecific" or "bifunctional antibody" refers to an artificial hybrid antibody having two different heavy / light chain pairs and two different binding sites. Bispecific antibodies can be produced by a variety- of methods including fusion of hybridomas or linking of Fab' fragments. See, e.g., Songsivilai & Lachmann, (1990) Clin. Exp. Immunol. 79:315-321; Kostelny et al., (1992) J. Immunol. 148: 1547-1553.
[0071] As used herein, "cancer antigen" refers to (i) tumor-specific antigens, (ii) tumor- associated antigens, (iii) cells that express tumor-specific antigens, (iv) cells that express tumor-associated antigens, (v) embryonic antigens on tumors, (vi) autologous tumor cells, (vii) tumor- specific membrane antigens, (viii) tumor- associated membrane antigens, (ix) grow th factor receptors, (x) growth factor ligands, and (xi) any other type of antigen or antigen- presenting cell or material that is associated with a cancer.
[0072] The term "carcinoma" is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. The compositions described herein can be used to treat patients who have, who are suspected of having, or who may be at high risk for developing any type of cancer, including cancers of the central nervous system (CNS).
[0073] A polypeptide or amino acid sequence "derived from" a designated polypeptide or protein refers to the origin of the polypeptide. Preferably, the polypeptide or amino acid sequence which is derived from a particular sequence has an amino acid sequence that is essentially identical to that sequence or a portion thereof otherwise identifiable to one of ordinary skill in the art as having its origin in the sequence. Polypeptides derived from another peptide may have one or more mutations relative to the starting polypeptide, e.g., one or more amino acid residues which have been substituted with another amino acid residue or which has one or more amino acid residue insertions or deletions.
[0074] A polypeptide can comprise an amino acid sequence which is not naturally occurring. Such variants necessarily have less than 100% sequence identity or similarity with the starting molecule. In some embodiments, the variant will have an amino acid sequence from about 75% to less than 100% amino acid sequence identity or similarity with the amino acid sequence of the starting polypeptide, more preferably from about 80% to less than 100%, more preferably from about 85% to less than 100%, more preferably from about 90% to less than 100% (e.g., 91%. 92%. 93%. 94%, 95%, 96%, 97%, 98%, 99%) and most preferably from about 95% to less than 100%, e.g., over the length of the variant molecule.
[0075] In some embodiments, there is one amino acid difference between a starting polypeptide sequence and the sequence derived there from. Identity' or similarity with respect to this sequence is defined herein as the percentage of amino acid residues in the candidate sequence that are identical (i.e., same residue) with the starting amino acid residues, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. It will also be understood by one of ordinary skill in the art that the polypeptides suitable for use in the methods disclosed herein may be altered such that they vary in sequence from the naturally occurring or native sequences from which they were derived, while retaining the desirable activity of the native sequences. For example, nucleotide or amino acid substitutions leading to conservative substitutions or changes at "non-essential" amino acid residues may be made. Mutations may be introduced by standard techniques, such as site- directed mutagenesis and PCR-mediated mutagenesis.
[0076] The polypeptides suitable for use in the compositions and methods disclosed herein may comprise conservative amino acid substitutions at one or more amino acid residues, e.g., at essential or non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a nonessential amino acid residue in a binding polypeptide is preferably replaced with another amino acid residue from the same side chain family. In some embodiments, a string of amino acids is replaced with a structurally similar string that differs in order and / or composition of side chain family members. Alternatively, in some embodiments, mutations are introduced randomly along all or part of a coding sequence, such as by saturation mutagenesis, and the resultant mutants can be incorporated into binding polypeptides described herein (e.g, and antibody) and screened for their ability to bind to the desired target.
[0077] As used herein, “treating” or “treat” describes the management and care of a subject for the purpose of combating a disease, condition, or disorder, such as the cancers described herein. “Treat” or “treating” as used herein includes the administration of AAV vectors of the disclosure to a subject with cancer to alleviate the signs or symptoms of cancer, or to eliminate the cancer.
[0078] The term “alleviate” is meant to describe a process by which the severity' of a sign or symptom of cancer is decreased. Importantly, a sign or symptom can be alleviated without being eliminated. In a preferred embodiment, the administration of AAV vectors of the disclosure leads to the elimination of a sign or symptom, however, elimination is not required. Effective dosages are expected to decrease the severity of a sign or symptom of the cancer. For instance, a sign or symptom of a disorder such as cancer, which can occur in multiple locations, is alleviated if the severity’ of the cancer is decreased within at least one of multiple locations.
[0079] As used herein, the term “severity” is meant to describe the potential of cancer to transform from a precancerous, or benign, state into a malignant state. Alternatively, or in addition, severity is meant to describe a cancer stage, for example, according to the TNM system (accepted by the International Union Against Cancer (UICC) and the American Joint Committee on Cancer (AJCC)) or by other art-recognized methods. Cancer stage refers to the extent or severity of the cancer, based on factors such as the location of the primary tumor, tumor size, number of tumors, and lymph node involvement (spread of cancer into lymph nodes). Alternatively, or in addition, severity is meant to describe the tumor grade by art-recognized methods (see. National Cancer Institute, www.cancer.gov). Tumor grade is a system used to classify cancer cells in terms of how abnormal they look under a microscope and how quickly the tumor is likely to grow and spread. Many factors are considered when determining tumor grade, including the structure and growth pattern of the cells. The specific factors used to determine tumor grade vary with each type of cancer. Severity also describes a histologic grade, also called differentiation, which refers to how much the tumor cells resemble normal cells of the same tissue type (see, National Cancer Institute, www.cancer.gov). Furthermore, severity describes a nuclear grade, which refers to the size and shape of the nucleus in tumor cells and the percentage of tumor cells that are dividing (see, National Cancer Institute, www.cancer.gov). A “subject” is a mammal. Mammals include, but are not limited to, domesticated animals, non-human primates, humans, dogs, rabbits, mice, rats and other rodents. In some cases a subject is a human suffering from a disease or disorder, such as a cancer as described herein.
[0080] As used herein, the term "effective dose" or "effective dosage" is defined as an amount sufficient to achieve or at least partially achieve the desired effect. The term "therapeutically effective dose" is defined as an amount sufficient to cure or at least partially arrest the disease and its complications in a patient already suffering from the disease. Amounts effective for this use will depend upon the severity' of the disorder being treated and the general state of the patient's own immune system.
[0081] As used herein, the term "Fc receptor" refers to a polypeptide found on the surface of immune effector cells, which is bound by the Fc region of an antibody. In some embodiments, the Fc receptor is an Fey receptor. There are three subclasses of Fey receptors, FcyRI (CD64), FcyRII (CD32) and FycRIII (CD16). All four IgG isotypes (IgGl, IgG2, IgG3 and IgG4) bind and activate Fc receptors FcyRI, FcyRIIA and FcyRIIIA. FcyRIIB is an inhibitory receptor, and therefore antibody binding to this receptor does not activate complement and cellular responses. FcyRI is a high affinity receptor that binds to IgG in monomeric form, whereas FcyRIIA and FcyRIIA are low' affinity7receptors that bind IgG only in multimeric form and have slightly lower affinity. The binding of an antibody to an Fc receptor is governed by specific residues or domains within the Fc regions. Binding also depends on residues located within the hinge region and within the CH2 portion of the antibody. In some embodiments, the agonistic and / or therapeutic activity7of the antibodies described herein is dependent on binding of the Fc region to the Fc receptor (e.g., FcyR). In some embodiments, the agonistic and / or therapeutic activity of the antibodies described herein is enhanced by binding of the Fc region to the Fc receptor (e.g., FcyR).
[0082] As used herein, the term “neonatal Fc receptor” or “FcRn” refers to the neonatal Fc receptor protein. The FcRn protein is encoded by the Fc Gamma Receptor And Transporter Gene “FCGRT” gene. The receptor binds the Fc region of IgG thereby protecting antibodies from degradation. The term also includes any alternative splice variants or transcript variants. As used herein, the term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double- stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences and as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, 1991; Ohtsuka et al., Biol. Chem. 260:2605-2608, 1985; and Cassol et al, 1992; Rossolini et al. Mol. Cell. Probes 8:91-98, 1994). For arginine and leucine, modifications at the second base can also be conservative. The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.
[0083] Polynucleotides used herein can be composed of any polyribonucleotide or polydeoxribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. For example, polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double- stranded regions, single- and double- stranded RNA, and RNA that is mixture of single- and double- stranded regions, hybrid molecules comprising DNA and RNA that can be single- stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, the polynucleotide can be composed of triplestranded regions comprising RNA or DNA or both RNA and DNA. A polynucleotide can also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically, or metabolically modified forms.
[0084] As used herein, the terms "polypeptide," "peptide", and "protein" are used interchangeably to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
[0085] As used herein, the term “protease” refers to naturally-occurring polypeptides that cleave peptide ponds of proteins or peptides. “Protease” encompasses mature forms of proteases, as well as the pro- and pre-forms of the protease. Proteases that cleave proteins are also referred to as "‘proteinases'’. Proteases that cleave peptides are referred to as “peptidases”.
[0086] As used here, the term “protease sensitive domain” refers to a region in a polypeptide that increases susceptibility of the polypeptide to cleavage by a protease (e.g. a proteinase or peptidase). In some embodiments, the region comprises a sequence motif identified by one or more proteases. In some embodiments, the sequence motif comprises at least two amino acid residues. In some embodiments, the sequence motif comprises a Factor Xa cleavage site or a thrombin cleavage site. Protease sensitive domains increase susceptibility of the polypeptide (e.g., an antibody) to protease degradation relative to a polypeptide without the protease sensitive domain.
[0087] As used herein, “systemic circulation” refers to the entirety of components earned along with oxygenated blood by the cardiovascular system as it carries oxygenated blood away from the heart, to the body, and returns deoxygenated blood back to the heart. Components of the systemic circulation include, but are not limited to, serum, blood plasma, blood cells, red blood cells, white blood cells, antibodies, proteins, nucleic acids, and immune cells.
[0088] As used herein, the term “therapeutically effective amount” means an amount of viral vector or agent to be delivered by the viral vector (e.g., an antibody) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, to treat, improve symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition.
[0089] As used herein, “transgene” refers to a nucleic acid sequence or gene that was not present in the genome of a cell or viral vector, but was artificially introduced into the genome, e.g., via genome editing.
[0090] As used herein, a “vector” is any molecule or moiety which transports, transduces, or otherwise acts as a carrier of a heterologous molecule such as the nucleic acids described herein.
[0091] As used herein, “viral genome” refers to the nucleic acid sequence(s) encapsulated in an AAV particle. Viral genomes comprise at least one transgene encoding a polypeptide, e.g., antibody, antibody-based composition or fragments thereof.
[0092] The term “promoter” refers to a DNA sequence that contains a transcription start site and additional sequences that facilitate polymerase binding and transcription. Exemplary eukaryotic promoters include a TATA box, and / or B recognition element (BRE) and act to promote the transcription associated transcribable polynucleotide sequence, such as a sequence encoding an antibody. A promoter can be synthetically produced or can be derived from a known or naturally occurring promoter. Promoters can be ubiquitous, i.e. driving expression in all cells in the body, or can be tissue-specific, i.e. driving expression only in a specific tissue or tissues.
[0093] As used herein “EU numbering” with respect to antibodies refers to the EU numbering system for numbering amino acid positions in antibodies, which is described, for example, at wwvv.imgt.org / IMGTScientificChart / Numbering / EIu_IGE[Gnber.html#refs. Other art- recognized numbering systems include Kabat. Chothia and IMGT. which are described in further detail below.
[0094] As used herein, the term “operably linked” refers to a first molecule being joined to a second molecule such that the first molecule is positioned in a way that it affects the function of the second molecule. Two molecules may or may not be part of a continuous single molecule and may be adjacent or non-adjacent. For example, a promoter is operably linked to a transcribable polynucleotide if the promoter regulates transcription of the transcribable polynucleotide molecule in a cell. As a further example, a signal peptide is operably linked to a protein if it has ability to affect localization of the protein, even if it is not directly linked to the protein (e.g.. it is indirectly linked via intervening sequences).
[0095] Where a range of values is provided, it is understood that endpoints are included and that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included.
[0096] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0097] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.
[0098] It will be appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. In other cases, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. It is intended that all combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and even’ combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such subcombination was individually and explicitly disclosed herein.
[0099] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0100] I. Antibodies
[0101] In some embodiments, the disclosure provides a transgene encoding a therapeutic antibody or fragment thereof. In some embodiments, the transgene encodes a fully antibody. In some embodiments, the transgene encodes an antibody fragment. In some embodiments, the antibody fragment comprises an antigen binding region. Examples of antibody fragments may include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments: diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.
[0102] In some embodiments, an antigen-binding fragment includes the variable region of a heavy chain polypeptide and the variable region of a light chain polypeptide. In some embodiments, an antigen-binding fragment described herein comprises the CDRs of the light chain and heavy chain polypeptide of an antibody.
[0103] As used herein, the term "variable domain" refers to specific antibody domains found on both the antibody heavy and light chains that differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. Variable domains comprise hypervariable regions. As used herein, the term "hypervariable region" refers to a region within a variable domain comprising amino acid residues responsible for antigen binding. The amino acids present within the hypervariable regions determine the structure of the complementarity’ determining regions (CDRs) that become part of the and gen-binding site of the antibody. As used herein, the term ‘ CDR’’ refers to a region of an antibody comprising a structure that is complementary to its target antigen or epitope. Other portions of the variable domain, not interacting with the antigen, are referred to as framework (FW) regions. The antigen-binding site (also known as the antigen combining site or paratope) comprises the amino acid residues necessary to interact with a particular antigen. The exact residues making up the antigen-binding site are typically elucidated by co- crystallography with bound antigen, however computational assessments can also be used based on comparisons with other antibodies (Strohl. W.R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA.2012. Ch.3, p47-54, the contents of which are herein incorporated by reference in their entirety). Determining residues making up CDRs may include the use of numbering schemes including, but not limited to, those taught by Kabat [Wu, T.T. et al., 1970, JEM. 132(2):211-50 and Johnson, G. et al., 2000, Nucleic Acids Res, 28(1): 214-8, the contents of each of which are herein incorporated by reference in their entirety]. Chothia [Chothia and Lesk, J. Mol. Biol. 196, 901 (1987), Chothia et al., Nature 342, 877 (1989) and Al-Lazikani, B. et al., 1997, J. Mol. Biol.273(4):927-48, the contents of each of which are herein incorporated by reference in their entirety], Lefranc (Lefranc, M.P. et al., 2005, Immunome Res. l :3) and Honegger (Honegger, A. and Pluckthun, A.2001. J. Mol. Biol.309(3):657-70, the contents of which are herein incorporated by reference in their entirety),
[0104] VH and VL domains have three CDRs each. VL CDRS are referred to herein as CDR- Ll. CDR-L2 and CDR-L3, in order of occurrence when moving from N- to C- terminus along the variable domain polypeptide. VH CDRS are referred to herein as CDR-H1, CDR-H2, and CDR-H3, in order of occurrence when moving from N- to C-terminus along the variable domain polypeptide. Each of CDRs have favored canonical structures with the exception of the CDR-H3, which comprises amino acid sequences that may be highly variable in sequence and length between antibodies resulting in a variety of three-dimensional structures in antigenbinding domains (Nikoloudis, D. et al., 2014. Peer J.2:e456; the contents of which are herein incorporated by reference in their entirety). In some embodiments, CDR-H3s are analyzed among a panel of related antibodies to assess antibody diversity. Various methods of determining CDR sequences are known in the art and may be applied to known antibody sequences (Strohl, W.R. Therapeutic Antibody Engineering, Woodhead Publishing, Philadelphia PA 2012. Ch.3, p47-54, the contents of which are herein incorporated by reference in their entirety).
[0105] As used herein, the term “Fv” refers to an antibody fragment comprising the minimum fragment on an antibody needed to form a complete antigen-binding site. These regions consist of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent association. Fv fragments can be generated by proteolytic cleavage but are largely unstable. Recombinant methods are known in the art for generating stable Fv fragments, typically through insertion of a flexible linker between the light chain variable domain and the heavy chain variable domain [to form a single chain Fv (scFv)] or through the introduction of a disulfide bridge between heavy and light chain variable domains (Strohl, W.R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA.2012. Ch.3, p46-47, the contents of which are herein incorporated by reference in their entirety).
[0106] As used herein, the term "light chain" refers to a component of an antibody from any vertebrate species assigned to one of two clearly distinct types, called kappa and lambda based on amino acid sequences of constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, antibodies can be assigned to different classes. There are five major classes of intact antibodies: IgA IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgA, and IgA2.
[0107] As used herein, the term "single chain Fv" or "scFv" refers to a fusion protein of VH and VL antibody domains, wherein these domains are linked together into a single polypeptide chain by a flexible peptide linker. In some embodiments, the Fv polypeptide linker enables the scFv to form the desired structure for antigen binding. In some embodiments, scFvs are utilized in conjunction with phage display, yeast display or other display methods where they may be expressed in association with a surface member (e.g. phage coat protein) and used in the identification of high affinity' peptides for a given antigen.
[0108] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous cells (or clones), i.e., the individual antibodies comprising the population are identical and / or bind the same epitope, except for possible variants that may arise during production of the monoclonal antibodies, such variants generally being present in minor amounts. In contrast to polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.
[0109] The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and is not to be construed as requiring production of the antibody by any particular method. The monoclonal antibodies herein include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and / or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies.
[0110] As used herein, the term "humanized antibody" refers to a chimeric antibody comprising a minimal portion from one or more non-human (e.g., murine) antibody source(s) with the remainder derived from one or more human immunoglobulin sources. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from the hypervariable region from an antibody of the recipient are replaced by residues from the hypervariable region from an antibody of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity7, affinity, and / or capacity7.
[0111] In some embodiments, viral genomes of the present disclosure encode antibody mimetics. As used herein, the term ‘"antibody mimetic” refers to any molecule which mimics the function or effect of an antibody and which binds specifically and with high affinity to their molecular targets. In some embodiments, antibody mimetics are monobodies. In some embodiments, antibody mimetics may include one or more non-peptide regions.
[0112] As used herein, the term “antibody variant” refers to a modified antibody (in relation to a native or starting antibody) or a biomolecule resembling a native or starting antibody in structure and / or function (e.g., an antibody mimetic). Antibody variants may be altered in their amino acid sequence, composition, or structure as compared to a native antibody. Antibody variants may include, but are not limited to, antibodies with altered isotypes (e.g., IgA. IgD, IgE, IgGl. IgG2. IgG3, IgG4. or IgM), humanized variants, optimized variants, multispecific antibody variants (e g., bispecific variants), and antibody fragments.
[0113] The preparation of antibodies, whether monoclonal or polyclonal, is known in the art. Techniques for the production of antibodies are well known in the art and described, e.g. in Harlow and Lane "Antibodies. A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1988; Harlow and Lane “Using Antibodies: A Laboratory7Manual” Cold Spring Harbor Laboratory7Press, 1999 and “Therapeutic Antibody Engineering: Current and Future Advances Driving the Strongest Growth Area in the Pharmaceutical Industry” Woodhead Publishing, 2012.
[0114] In some embodiments, the disclosure provides viral genomes comprising a transgene encoding antibodies that bind more than one epitope. As used herein, the terms “multibody” or “multi specific antibody” refer to an antibody wherein two or more variable regions bind to different epitopes. The epitopes may be on the same or different targets. In some embodiments, a multi-specific antibody is a "bispecific antibody." which recognizes two different epitopes on the same or different antigens.
[0115] In some embodiments, the transgene encodes a bispecific antibody. Bispecific antibodies are capable of binding two different antigens. Such antibodies typically comprise antigen-binding regions from at least two different antibodies. For example, a bispecific monoclonal antibody (BsMAb, BsAb) is an artificial protein composed of fragments of two different monoclonal antibodies, thus allowing the BsAb to bind to two different types of antigen.
[0116] Bispecific antibodies have been designed to overcome certain problems, such as short half-life, immunogenicity and side-effects caused by cytokine liberation. They include chemically linked Fabs, consisting only of the Fab regions, and various types of bivalent and trivalent single-chain variable fragments (scFvs), fusion proteins mimicking the variable domains of two antibodies. The furthest developed of these newer formats are the bi-specific T-cell engagers (BiTEs) and mAb2's, antibodies engineered to contain an Fcab antigen-binding fragment instead of the Fc constant region.
[0117] Using molecular genetics, two scFvs can be engineered in tandem into a single polypeptide, separated by a linker domain, called a ‘"tandem scFv” (tascFv). TascFvs have been found to be poorly soluble and require refolding when produced in bacteria, or they may be manufactured in mammalian cell culture systems, which avoids refolding requirements but may result in poor yields. Construction of a tascFv with genes for two different scFvs yields a “bispecific single-chain variable fragments” (bis-scFvs). Only two tascFvs have been developed clinically by commercial firms; both are bispecific agents in active early phase development by Micromet for oncologic indications and are described as “Bispecific T-cell Engagers (BiTE).” Blinatumomab is an anti-CD 19 / anti-CD3 bispecific tascFv that potentiates T-cell responses to B-cell non-Hodgkin lymphoma in Phase 2. MT110 is an anti-EP-CAM / anti- CD3 bispecific tascFv that potentiates T-cell responses to solid tumors in Phase 1. Bispecific, tetravalent “TandAbs” are also being researched by Affimed (Nelson, A. L, MAbs.2010. Jan- Feb; 2(l):77-83).
[0118] In some embodiments, the antibody encoded by the transgene is a “miniaturized” antibody. Miniaturized antibodies are compacted 100 kDa antibodies (see, e.g., Nelson, A. L, MAbs., 2010. Jan-Feb; 2(l):77-83). These molecules, which can be monovalent or bivalent, are recombinant single-chain molecules containing one VL, one VH antigen binding domain, and one or two constant “effector” domains, all connected by linker domains. In some embodiments, the miniaturized antibody has increased tissue or tumor penetration.
[0119] In some embodiments, the antibody encoded by the transgene is a diabody. Diabodies are functional bispecific single-chain antibodies (bscAb). These bivalent antigen-binding molecules are composed of non-covalent dimers of scFvs, and can be produced in mammalian cells using recombinant methods. (See, e.g., Mack et. al., Proc. Nat. Acad. Sci., 92: 7021-7025, 1995). In some embodiments, the antibody encoded by the transgene is a “unibody”, in which the hinge region has been removed from IgG4 molecules. While IgG4 molecules are unstable and can exchange light-heavy chain heterodimers with one another, deletion of the hinge region prevents heavy chain-heavy chain pairing entirely, leaving highly specific monovalent light / heavy heterodimers, while retaining the Fc region to ensure stability and half-life in vivo. This configuration may minimize the risk of immune activation or oncogenic growth, as IgG4 interacts poorly with FcRs and monovalent unibodies fail to promote intracellular signaling complex formation.
[0120] In some embodiments, the antibody encoded by the transgene is an “intrabody”. Intrabodies are a form of antibody that is not secreted from a cell in which it is produced, but instead targets one or more intracellular proteins. Intrabodies are expressed and function intracellularly, and may be used to affect a multitude of cellular processes including, but not limited to intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling and cell division. In some embodiments, methods described herein include intrabodybased therapies. In some such embodiments, variable domain sequences and / or CDR sequences disclosed herein are incorporated into one or more constructs for intrabody-based therapy. For example, intrabodies may target one or more glycated intracellular proteins or may modulate the interaction between one or more glycated intracellular proteins and an alternative protein.
[0121] In some embodiments, the intrabodies are from a recombinant nucleic acid molecule and engineered to be retained intracellularly (e.g., retained in the cytoplasm, endoplasmic reticulum, or periplasm). Sequences from donor antibodies may be used to develop intrabodies. Intrabodies are often recombinantly expressed as single domain fragments such as isolated VH and VL domains or as a single chain variable fragment (scFv) antibody within the cell. For example, intrabodies are often expressed as a single polypeptide to form a single chain antibody comprising the variable domains of the heavy and light chains joined by a flexible linker polypeptide. Intrabodies typically lack disulfide bonds and can modulate the expression or activity of target genes through their specific binding activity. Single chain antibodies can also be expressed as a single chain variable region fragment] oined to the light chain constant region. Intrabodies are produced for use in the viral genomes using methods known in the art.
[0122] Intrabodies are promising therapeutic agents for the treatment of misfolding diseases, including Tauopathies, prion diseases, Alzheimer's, Parkinson's, and Huntington's, because of their virtually infinite ability to specifically recognize the different conformations of a protein, including pathological isoforms, and because they can be targeted to the potential sites of aggregation (both intra- and extracellular sites). These molecules can work as neutralizing agents against amyloidogenic proteins by preventing their aggregation, and / or as molecular shunters of intracellular traffic by rerouting the protein from its potential aggregation site (Cardinale, and Biocca, Curr. Mol. Med.2008, 8:2-11).
[0123] In some embodiments, the transgene region encodes an antibody comprising a single antigen-binding domain. These molecules are extremely small, with molecular weights approximately one-tenth of those observed for full-sized mAbs. Further antibodies may include "nanobodies” derived from the antigen-binding variable heavy chain regions (VHHS) of heavy chain antibodies found in camels and llamas, which lack light chains (Nelson, A. L, MAbs.2010. Jan-Feb; 2(l):77-83). Nanobodies are single heavy chain antibodies. In some embodiments, nanobodies may have a high solubility and a molecular weight that is lower than an antibody. In some embodiments, nanobodies may exhibit high stability in the presence of strong denaturing agents and / or extreme pH environments- conditions which may cause the degradation of full length antibodies. Nanobodies possess high affinity and specificity. Compared to antibodies, nanobodies may have a longer CDR3 (complementarity-determining region 3) which may form a binding surface that is stable, and convex relative to the concave or planar antigen-binding surface of an antibody. Nanobodies may possess weak immunogenicity and strong penetrability. The immunogenicity may be related to the size and chemical structure of the nanobodies. The small size of the nanobodies may also result in strong tissue penetrating ability.
[0124] In some embodiments, the nanobodies may be bispecific nanobodies.
[0125] In some aspects, the transgenes encode biosynthetic antibodies as described in U.S. Patent No.5,091,513, the contents of which are herein incorporated by reference in their entirety. Such antibody may include one or more sequences of amino acids constituting a region which behaves as a biosynthetic antibody binding site (BABS). The sites comprise 1) non- covalently associated or disulfide bonded synthetic VH and VL dimers, 2) VH-VL or VL-VH single chains wherein the VH and VL are attached by a polypeptide linker, or 3) individuals VH or VL domains. The binding domains comprise linked CDR and FR regions, which may be derived from separate immunoglobulins. The biosynthetic antibodies may also include other polypeptide sequences which function, e.g.. as an enzyme, toxin, binding site, or site of attachment to an immobilization media or radioactive atom. Methods are disclosed for producing the biosynthetic antibodies, for designing BABS having any specificity that can be elicited by in vivo generation of antibody, and for producing analogs thereof.
[0126] In some embodiments, antibodies or antibody-based compositions produced using methods known in the art and encoded by transgenes described herein. Such methods include, but are not limited to, immunization and display technologies (e.g., phage display, yeast display, and ribosomal display). Antibodies are developed, for example, using any naturally occurring or synthetic antigen.
[0127] Modifications for Reduced Antibody Stability
[0128] In some embodiments, the disclosure provides a therapeutic antibody comprising at least one modification which reduces stability of the antibody in systemic circulation. In some embodiments, the disclosure provides a therapeutic antibody comprising at least one modification which reduces stability of the antibody in the lymphatic system. In some embodiments, the disclosure provides a therapeutic antibody comprising at least one modification which reduces stability of the antibody outside a tissue of interest. In some embodiments, the tissue of interest is a tissue of the central nervous system, e.g. brain tissue. In some embodiments, the tissue of interest is a neuromuscular tissue. In some embodiments, the tissue of interest is a muscle tissue. In some embodiments, the tissue of interest is liver.
[0129] In some embodiments, the modification that reduces stability of the antibody is a sequence motif that increases susceptibility of the therapeutic antibody to protease degradation. In some embodiments, the sequence motif is a protease sensitive domain. In some embodiments, the motif is a protease target site. In some embodiments, the modification that reduces stability of the antibody is a variant Fc domain with reduced binding to FcRn. i. Protease Target Sites
[0130] In some embodiments, a therapeutic antibody described herein comprises a sequence motif which increases susceptibility or sensitivity of the therapeutic antibody to protease degradation. In some embodiments, a therapeutic antibody described herein comprises a sequence motif which increases susceptibility or sensitivity' of the therapeutic antibody to protease degradation in systemic circulation. In some embodiments, antibody stability is reduced by targeting and cleavage of the antibody by a protease (e.g. a proteinase or peptidase). Proteases are enzymes which cleave peptide bonds in proteins leading to degradation of the protein. Proteinases are a t pe of protease which cleave proteins, whereas peptidases are a type of protease which cleave peptides into amino acids. In some embodiments, the protease is active in systemic circulation.
[0131] In some embodiments, the protease is a mammalian protease. In some embodiments, the protease is a human protease. In some embodiments, the sequence motif is a protease sensitive domain. In some embodiments, the protease sensitive domain reduces antibody half-life in peripheral tissues. For example, in some embodiments, the protease sensitive domain is recognized by a protease found outside of the central nervous system (CNS). If the antibody crosses the blood-brain- barrier to peripheral tissue (e.g., muscle or liver), proteases cut at the protease sensitive domain to inactivate the antibody. In some embodiments the protease sensitive domain is recognized by a protease found outside muscle tissue.
[0132] In some embodiments the sequence motif comprises two protease sensitive domains. In some embodiments, the sequence motif comprises thrombin cleavage site and a Factor Xa cleavage site. In some embodiments, the thrombin cleavage site and a Factor Xa cleavage site comprise a sequence of LVPRGSIEGR (SEQ ID NO: 114). In some embodiments, the protease domains are operably linked via a linker. In some embodiments, the thrombin cleavage site, linker and Factor Xa cleavage site comprises a sequence of GGGGSLVPRGSGGGGIEGRGGGS (SEQ ID NO: 115).
[0133] In some embodiments, the antibody comprises 1. 2, 3, 4, or 5 protease sensitive domains. In some embodiments, the protease sensitive domains are operably linked via a linker. In some embodiments, the protease sensitive domain is specific for a protease expressed in peripheral tissue. In some embodiments, the protease is expressed at higher levels in systemic circulation compared to a target tissue. In some embodiments, the protease is expressed at higher levels in the lymphatic system compared to a target tissue. In some embodiments, the protease is expressed at higher levels in systemic circulation compared to a tissue of the central nervous system. In some embodiments, the protease is expressed at higher levels in the peripheral tissue compared to a tissue of the central nervous system.
[0134] In some embodiments, the antibody comprises 1, 2, 3, 4, or 5 peptidase sensitive domains. In some embodiments, the peptidase sensitive domains are operably linked via a linker. In some embodiments, the peptidase sensitive domain is specific for a peptidase expressed in peripheral tissue. In some embodiments, the peptidase is expressed at higher levels in systemic circulation compared to a target tissue. In some embodiments, the peptidase is expressed at higher levels in the lymphatic system compared to a target tissue. In some embodiments, the peptidase is expressed at higher levels in systemic circulation compared to a tissue of the central nervous system. In some embodiments, the peptidase is expressed at higher levels in the peripheral tissue compared to a tissue of the central nervous system.
[0135] In some embodiments, the antibody comprises 1, 2, 3, 4. or 5 proteinase sensitive domains. In some embodiments, the proteinase sensitive domains are operably linked via a linker. In some embodiments, the proteinase sensitive domain is specific for a proteinase expressed in peripheral tissue. In some embodiments, the proteinase is expressed at higher levels in systemic circulation compared to a target tissue. In some embodiments, the proteinase is expressed at higher levels in the lymphatic system compared to a target tissue. In some embodiments, the proteinase is expressed at higher levels in systemic circulation compared to a tissue of the central nervous system. In some embodiments, the proteinase is expressed at higher levels in the peripheral tissue compared to a tissue of the central nervous system.
[0136] In some embodiments, the linker comprises a glycine linker, or a glycine-serine linker. In some embodiments, the linker is 2-8 amino acids in length. In some embodiments, the linker is 3-7 amino acids in length. In some embodiments, the linker is 3-6 amino acids in length. In some embodiments, the linker is 3-4 amino acids in length. In some embodiments, the linker is selected from the group consisting of GGG, GGGG (SEQ ID NO: 140), GGGGS (SEQ ID NO: 141), GGGS (SEQ ID NO: 142), SGGG (SEQ ID NO: 143) and SGGGG (SEQ ID NO: 144).
[0137] In some embodiments, the protease sensitive domain is a thrombin cleavage site. In some embodiments, the thrombin cleavage site comprises the amino acid sequence LVPRG (SEQ ID NO: 86). In some embodiments, the thrombin cleavage site comprises the amino acid sequence LVPRGS (SEQ ID NO: 85). In some embodiments, the thrombin cleavage site comprises the amino acid sequence QVRLG (SEQ ID NO: 87). In some embodiments, the thrombin cleavage site comprises the amino acid sequence GVYARVTA (SEQ ID NO: 88). In some embodiments, the thrombin cleavage site comprises the amino acid sequence MKSRNL (SEQ ID NO: 89). In some embodiments, the thrombin cleavage site comprises the amino acid sequence RCKPVN (SEQ ID NO: 90). In some embodiments, the thrombin cleavage site comprises the amino acid sequence SSKYPN (SEQ ID NO: 91). In some embodiments, the thrombin cleavage site comprises the amino acid sequence NTLPRTFGG (SEQ ID NO: 92). In some embodiments, the thrombin cleavage site comprises the amino acid sequence SPIVKSFN (SEQ ID NO: 93). In some embodiments, the thrombin cleavage site comprises the ammo acid sequence SRGSLDPRSFLLRNPNDKYEPFWEDEE (SEQ ID NO: 94).
[0138] In some embodiments, the protease sensitive domain is an enterokinase cleavage site.
[0139] In some embodiments, the protease sensitive domain is a Factor Xa cleavage site. In some embodiments, the Factor Xa cleave site comprises the amino acid sequence IEGR (SEQ ID NO: 95). In some embodiments, the Factor Xa cleave site comprises the amino acid sequence IEGRGH (SEQ ID NO: 96). In some embodiments, the Factor Xa cleave site comprises the amino acid sequence IEGRGIP (SEQ ID NO: 97). In some embodiments, the Factor Xa cleave site comprises the amino acid sequence IEGRISE (SEQ ID NO: 98). In some embodiments, the Factor Xa cleave site comprises the amino acid sequence IQGR (SEQ ID NO: 99). In some embodiments, the Factor Xa cleave site comprises the amino acid sequence SGLSRIVN (SEQ ID NO: 100). In some embodiments, the Factor Xa cleave site comprises the amino acid sequence GVYARVTA (SEQ ID NO: 88).
[0140] In some embodiments, the protease sensitive domain is a Tobacco Etch virus (TEV) cleavage site. In some embodiments, the protease sensitive domain is a PreScission cleavage site. In some embodiments, the protease sensitive domain is a protease sensitive domain described in Jenny et al. (Jenny et al., Protein Expression and Purification; 31 pg. 1-11 (2003)) the contents of which are incorporated herein in their entirety.
[0141] In some embodiments, the sequence motif is inserted in a full-length antibody. In some embodiments, the sequence motif is inserted in an antibody fragment (e.g.. an antibody lacking an Fc domain). In some embodiments, the sequence motif is inserted in a region of the antibody that does not disrupt the molecule structure or function. In some embodiments, the sequence motif is inserted in the Fc region of an antibody. In some embodiments, the sequence motif is inserted in the hinge region of an antibody. In some embodiments, the sequence motif is inserted in a linker region of an antibody.
[0142] In some embodiments, the sequence motif is inserted in the hinge region of an antibody. In some embodiments, the hinge region comprises a sequence of RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112), or a sequence having between 1 -5 insertions, deletions or substitutions relative thereto. In some embodiments, sequence motif is inserted at a position between amino acids 6 and 9 with respect to
[0143] RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112). In some embodiments, sequence motif is inserted between amino acids 7 and 8 with respect to
[0144] RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112). The person of ordinary skill in the art will able, based on sequence alignment, be able to determine the appropriate insertion position in hinge sequences with one or more insertions or deletions relative to RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112).
[0145] In some embodiments, the sequence motif is operably linked to the Fc domain, hinge region, or antigen binding domain by a linker. In some embodiments, the linker is N terminal to the sequence motif. In some embodiments, the linker is C terminal to the sequence motif. In some embodiments, the sequence motif is operably linked to the Fc domain, hinge region, or antigen binding domain by both andN and C terminal linkers. In some embodiments, the linker comprises a glycine linker, or a glycine-serine linker. In some embodiments, the linker is 2-8 amino acids in length. In some embodiments, the linker is 3-7 amino acids in length. In some embodiments, the linker is 3-6 amino acids in length. In some embodiments, the linker is 3-4 amino acids in length. In some embodiments, the linker is selected from the group consisting of GGG, GGGG (SEQ ID NO: 140), GGGGS (SEQ ID NO: 141), GGGS (SEQ ID NO: 142), SGGG (SEQ ID NO: 143) and SGGGG (SEQ ID NO: 144).
[0146] In some embodiments, the sequence motif is 2-50 amino acids in length. In some embodiments, the sequence motif is 2-10 amino acids. In some embodiments, the sequence motif is 11-20 amino acids. In some embodiments, the sequence motif is 21-30 amino acids. In some embodiments, the sequence motif is 31-40 amino acids. In some embodiments, the sequence motif is 41-50 amino acids. In some embodiments, the sequence motif is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ,11, 12, 13, 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 8, 39, 40, 41, 42, 43, 44, 45, 46, 47, 49, 49, or 50 amino acids in length.
[0147] In some embodiments, the protease sensitive domain is inserted in a full-length antibody. In some embodiments, the protease sensitive domain is inserted in an antibody fragment (e.g. an antibody lacking an Fc domain). In some embodiments, the protease sensitive domain is inserted in a region of the antibody that does not disrupt the molecule structure or function. In some embodiments, the protease sensitive domain is inserted in the Fc region of an antibody. In some embodiments, the protease sensitive domain is inserted in the hinge region of an antibody. In some embodiments, the protease sensitive domain is inserted in a linker region of an antibody.
[0148] In some embodiments, the protease sensitive domain is 2-50 amino acids in length. In some embodiments, the protease sensitive domain is 2-10 amino acids. In some embodiments, the protease sensitive domain is 11-20 amino acids. In some embodiments, the protease sensitive domain is 21-30 amino acids. In some embodiments, the protease sensitive domain is 31-40 amino acids. In some embodiments, the protease sensitive domain is 41-50 amino acids. In some embodiments, the protease sensitive domain is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ,11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 8, 39, 40, 41, 42, 43, 44, 45, 46, 47, 49, 49, or 50 amino acids in length.
[0149] In some embodiments, the protease cleaves the therapeutic antibody, or antigen binding fragment thereof, by degrading the therapeutic antibody, or antigen binding fragment thereof. In some embodiments, susceptibility of a therapeutic antibody comprising a sequence motif described in to protease degradation in systemic circulation is increased relative to susceptibility of a therapeutic antibody to protease degradation without the sequence motif. In some embodiments, the protease is active at higher levels in a tissue not of interest relative to activity in the tissue of interest. In some embodiments, the protease is active at higher levels in systemic circulation relative to activity in the tissue of interest.
[0150] In some embodiments, the protease is expressed at higher levels in non-target tissue compared to a target tissue. In some embodiments, protease expression is increased by about 10%, about 20%. about 30%. about 40%, about 50%, about 60%, about 70%, about 80%, about 90%. about 95%, or about 99% in non-target tissue compared to a target tissue. In some embodiments, protease expression is increased in non-target tissue by about 1-fold, about 2- fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to a target tissue.
[0151] In some embodiments, the protease is expressed at higher levels in peripheral tissue compared to a target tissue. In some embodiments, protease expression is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in peripheral tissue compared to a target tissue. In some embodiments, protease expression is increased in peripheral tissue by about 1-fold, about 2- fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about
[0152] 9-fold, or about 10-fold compared to a target tissue.
[0153] In some embodiments, the protease is expressed at higher levels in peripheral tissue compared to a tissue of the CNS. In some embodiments, protease expression is increased by about 10%. about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in peripheral tissue compared to a tissue of the CNS. In some embodiments, protease expression is increased by about 1-fold, about 2-fold, about 3- fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about
[0154] 10-fold compared to a tissue of the CNS.
[0155] In some embodiments, the protease is expressed at higher levels in peripheral tissue compared to muscle tissue. In some embodiments, protease expression is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in peripheral tissue compared to muscle tissue. In some embodiments, protease expression is increased by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10- fold compared to muscle tissue.
[0156] In some embodiments, the protease is expressed at higher levels in systemic circulation compared to a target tissue. In some embodiments, protease expression is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in systemic circulation compared to a target tissue. In some embodiments, protease expression is increased in systemic circulation by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to a target tissue.
[0157] In some embodiments, the protease is expressed at higher levels in systemic circulation compared to a tissue of the CNS. In some embodiments, protease expression is increased by about 10%. about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%. about 90%, about 95%, or about 99% in systemic circulation compared to a tissue of the CNS. In some embodiments, protease expression is increased in systemic circulation by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to a tissue of the CNS.
[0158] In some embodiments, the protease is expressed at higher levels in systemic circulation compared to muscle tissue. In some embodiments, protease expression is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in systemic circulation compared to muscle tissue. In some embodiments, protease expression is increased in systemic circulation by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to muscle tissue.
[0159] In some embodiments, the protease is expressed at higher levels in systemic circulation compared to liver. In some embodiments, protease expression is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in systemic circulation compared to liver. In some embodiments, protease expression is increased in systemic circulation by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10- fold compared to liver.
[0160] In some embodiments, the protease has higher activity in non-target tissue compared to a target tissue. In some embodiments, protease activity is increased by about 10%, about 20%, about 30%. about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in non-target tissue compared to a target tissue. In some embodiments, protease activity’ is increased in non-target tissue by about 1-fold, about 2-fold, about 3-fold, about 4- fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to a target tissue.
[0161] In some embodiments, the protease has higher activity in peripheral tissue compared to a target tissue. In some embodiments, protease activity is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in peripheral tissue compared to a target tissue. In some embodiments, protease activity is increased in peripheral tissue by about 1-fold, about 2-fold, about 3-fold, about 4- fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to a target tissue.
[0162] In some embodiments, the protease has higher activity in peripheral tissue compared to a tissue of the CNS. In some embodiments, protease activity is increased by about 10%. about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in peripheral tissue compared to a tissue of the CNS. In some embodiments, protease activity is increased by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to a tissue of the CNS.
[0163] In some embodiments, the protease has higher activity in peripheral tissue compared to muscle tissue. In some embodiments, protease activity' is increased by about 10%, about 20%, about 30%. about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in peripheral tissue compared to muscle tissue. In some embodiments, protease activity7is increased by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to muscle tissue.
[0164] In some embodiments, the protease activity is higher in systemic circulation compared to a target tissue. In some embodiments, protease activity is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in systemic circulation compared to a target tissue. In some embodiments, protease activity is increased in systemic circulation by about 1-fold, about 2-fold, about 3- fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to a target tissue.
[0165] In some embodiments, the protease activity is higher in systemic circulation compared to a tissue of the CNS. In some embodiments, protease activity is increased by about 10%, about 20%. about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%. about 95%, or about 99% in systemic circulation compared to a tissue of the CNS. In some embodiments, protease activity' is increased in systemic circulation by about 1-fold, about 2- fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to a tissue of the CNS. In some embodiments, the protease activity is higher in systemic circulation compared to muscle tissue. In some embodiments, protease activity is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in systemic circulation compared to muscle tissue. In some embodiments, protease activity is increased in systemic circulation by about 1-fold, about 2-fold, about 3- fold, about 4-fold, about 5-fold, about 6-fold, about 7- fold, about 8-fold, about 9-fold, or about 10-fold compared to muscle tissue.
[0166] In some embodiments, the protease sensitive domain reduces the antibody half-life in non-target tissue compared to the target tissue. In some embodiments, the protease sensitive domain reduces the antibody half-life by about 10%, about 20%, about 30%, about 40%, about 50%. about 60%, about 70%, about 80%, about 90%. about 95%, or about 99% in non-target tissue relative to the half-life in the target tissue.
[0167] In some embodiments, the protease sensitive domain reduces the antibody half-life in systemic circulation compared to the target tissue. In some embodiments, the protease sensitive domain reduces the antibody half-life by about 10%, about 20%, about 30%, about 40%, about 50%. about 60%, about 70%, about 80%. about 90%, about 95%. or about 99% in systemic circulation relative to the half-life in the target tissue.
[0168] In some embodiments, the protease sensitive domain reduces the antibody half-life in tissues outside of the CNS. In some embodiments, the protease sensitive domain reduces the antibody half-life by about 10%, about 20%, about 30%. about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in peripheral tissue relative to the half-life in the CNS.
[0169] In some embodiments, the protease sensitive domain reduces the antibody half-life in tissues outside muscle tissue. In some embodiments, the protease sensitive domain reduces the antibody half-life by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% in peripheral tissue relative to the half-life in muscle tissue.
[0170] In some embodiments, the protease sensitive domain and the variant Fc domain act synergistically to reduce the amount of antibody in systemic circulation (e.g.. the amount of antibody in plasma). In some embodiments, the protease sensitive domain and the variant Fc domain act synergistically to increase the ratio of the antibody in the target tissue relative to the amount of antibody in systemic circulation. In some embodiments, the target tissue comprises the CNS, e.g. the brain. In some embodiments, the target tissue comprises muscle, e.g. skeletal or cardiac muscle. IN some embodiments, the target tissue comprises the liver. ii. Variant Fc Domains
[0171] In some embodiments, a therapeutic antibody described herein comprises a variant Fc domain. In some embodiments, the variant Fc domain comprises at least one stability reducing mutation. In some embodiments, the Fc domain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 stability reducing mutations. In some embodiments, the stability reducing mutation in the Fc domain is deletion of one or more amino acid residues. In some embodiments, the stability reducing mutation in the Fc domain is insertion of one or more amino acid residues. In some embodiments, the stability reducing mutation in the Fc domain is substitution of one or more amino acid residues. In some embodiments, the at least one stability reducing mutation is an amino acid residue deletion, an amino acid residue substation, an amino acid residue insertion, or any combination thereof.
[0172] In some embodiments, the amino acid deletion, substitution, or insertion occurs at one or more of amino acid residues K246, P247. K248, D249, L251, M252, 1253, S254, R255, T256, P257, E258. V279, D280. V282, E283. V284, H285, N286. A287, K288. V305, L306. T307, V308, L309, H310, Q311, D312, W313, N315, K317, A339, K340, G341, P374, D376, A378, E380, E382, S383, N384, G385, Q386, P387, N389, S426, V427, H429, E430, A431, L432, H433, N434, H435, Y436, T437, and Q438, according to EU numbering.
[0173] In some embodiments, the Fc domain comprises at least one amino acid substitution at one or more amino acid residues selected from K246, P247, K248, D249, L251, M252, 1253, S254, R255, T256, P257, E258, V279, D280, V282, E283, V284, H285, N286, A287, K288, V305, L306, T307. V308, L309, H310, Q311, D312, W313, N315, K317, A339, K340, G341, P374, D376, A378, E380, E382, S383, N384, G385, Q386, P387, N389, S426, V427, H429, E430, A431, L432, H433, N434, H435, Y436, T437, and Q438, according to EU numbering.
[0174] In some embodiments, the Fc domain comprises at least one amino acid deletion at one or more amino acid residues selected fromK246, P247, K248, D249, L251, M252, 1253, S254, R255, T256, P257. E258, V279. D280, V282. E283, V284. H285, N286, A287, K288, V305, L306, T307, V308, L309, H310. Q311, D312. W313. N315, K317. A339, K340. G341, P374. D376, A378, E380, E382, S383, N384, G385, Q386, P387, N389, S426, V427, H429, E430, A431, L432, H433, N434, H435, Y436, T437, and Q438, according to EU numbering.
[0175] In some embodiments, the Fc domain comprises at least one amino acid insertion at one or more amino acid residues selected from K246, P247, K248. D249, L251, M252, 1253, S254, R255, T256, P257, E258, V279, D280, V282, E283, V284, H285, N286, A287, K288, V305, L306, T307, V308, L309, H310, Q311, D312. W313, N315, K317, A339, K340, G341, P374, D376, A378. E380, E382, S383, N384, G385, Q386. P387, N389, S426, V427, H429, E430, A431, L432, H433, N434, H435, Y436, T437, and Q438, according to EU numbering.
[0176] In some embodiments, the Fc domain comprises a substitution of 1253 according to EU numbering. In some embodiments, the 1253 substitution comprises an I253A substitution.
[0177] In some embodiments, the Fc domain comprises a substitution of 1253, H310 and H435 according to EU numbering. In some embodiments, the 1253 substitution comprises an I253A substitution, the H310 substitution comprises an H310A substitution, and the H435 substitution comprises an H435A substitution.
[0178] In some embodiments, the stability- reducing mutation in the Fc domain reduces FcRn binding affinity. In some embodiments, the Fc domain comprises one or more mutations as described in US Patent No. 11,198,739, the entire contents of which are incorporated herein.
[0179] In some embodiments, the Fc stability reducing mutation reduces FcRn binding affinity by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% relative to an Fc domain lacking the mutation.
[0180] Hi. Methods of Measuring Antibody Degradation
[0181] In some embodiments, antibody concentration is measured in the target tissue (e.g.. the CNS) compared to non-target tissue (e.g.. peripheral tissue). In some embodiments, antibody concentration is measured in the target tissue compared to systemic circulation. In some embodiments, antibody concentration is measured in the target tissue compared to the lymphatic system. Methods of measuring antibody concentration in a tissue are known in the art. Standard methods include but are not limited to western blot. ELISA, mass spectrometry, antibody endpoint titration, and A280 absorbance method.
[0182] In some embodiments, the concentration of the therapeutic antibody is higher in the target tissue compared to a non-target tissue. In some embodiments, the concentration of the therapeutic antibody is 1-100 fold higher in the target tissue compared to a non-target tissue.
[0183] In some embodiments, the concentration of the therapeutic antibody is higher in the CNS compared to systemic circulation. In some embodiments, the concentration of the therapeutic antibody is 1-100 fold higher in the CNS compared to systemic circulation
[0184] In some embodiments, the concentration of the therapeutic antibody is higher in the CNS compared to a peripheral tissue. In some embodiments, the concentration of the therapeutic antibody is 1-100 fold higher in the CNS compared to the peripheral tissue. In some embodiments, the concentration of the therapeutic antibody is higher in muscle tissue compared to systemic circulation. In some embodiments, the concentration of the therapeutic antibody is 1-100 fold higher in the muscle tissue compared to systemic circulation.
[0185] In some embodiments, the concentration of the therapeutic antibody is higher in muscle tissue compared to a peripheral tissue. In some embodiments, the concentration of the therapeutic antibody is 1-100 fold higher in the muscle tissue compared to the peripheral tissue.
[0186] In some embodiments, the concentration of the therapeutic antibody is higher in the liver compared to systemic circulation. In some embodiments, the concentration of the therapeutic antibody is 1-100 fold higher in the liver compared to systemic circulation.
[0187] In some embodiments, the concentration of the therapeutic antibody is higher in the liver compared to a peripheral tissue. In some embodiments, the concentration of the therapeutic antibody is 1-100 fold higher in the liver compared to the peripheral tissue.
[0188] In some embodiments, the ratio of antibody in the target tissue to the non-target tissue is determined. In some embodiments, the ratio is determined based on the concentration of antibody measured in the target and non-targe tissues. In some embodiments, the ratio of antibody in target tissue:antibody in non-target tissue is 1:0.5, 2:1.3:1, 4:1.5:1 or any range therebetween. In some embodiments, the ratio of antibody in target tissue: antibody in non- target tissue is 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1 or any range therebetween. In some embodiments, the ratio of antibody in CNS:antibody is systemic circulation is 1:0.5, 2:1, 3:1, 4:1, 5:1 or any range therebetween. In some embodiments, the ratio of antibody in CNS:antibody in systemic circulation is 10:1, 20: 1, 30: 1, 40: 1, 50: 1, 60: 1, 70:1, 80: 1, 90:1100:1 or any range therebetween. In some embodiments, the ratio of antibody in CNS:antibody in peripheral tissue is 1:0.5, 2:1.3:1, 4:15:1, or any range therebetween. In some embodiments, the ratio of antibody in CNS:antibody in peripheral tissue is 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1100:1 or any range therebetween. In some embodiments, the ratio of antibody in muscle tissue: antibody in systemic circulation is 1:0.5, 2:1, 3:1, 4:1, 5:1 or any range therebetween. In some embodiments, the ratio of antibody in muscle tissue: antibody in systemic circulation is 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1. 80:1. 90:1 100:1 or any range therebetween. In some embodiments, the ratio of antibody in muscle tissue: antibody in peripheral tissue is 1:0.5, 2:1, 3:1, 4:15:1 or any range therebetween. In some embodiments, the ratio of antibody in muscle tissue:antibody in peripheral tissue is 10: 1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1 100:1 or any range therebetween. In some embodiments, the ratio of antibody in liver: antibody in systemic circulation is 1:0.5.2:1, 3:1, 4:1 or 5:1 or any range therebetween. In some embodiments, the ratio of antibody in liver: antibody in systemic circulation is 10: 1, 20: 1, 30: 1, 40: 1, 50: 1, 60: 1, 70: 1, 80: 1, 90: 1, 100: 1. 110: 1, 150: 1, 200: 1, 300: 1 or greater. In some embodiments, the ratio of antibody in liver: antibody in peripheral tissue is 1 :0.5, 2: 1, 3: 1, 4: 1 or 5: l. In some embodiments, the ratio of antibody in liver: antibody in peripheral tissue is 10: 1, 20: 1, 30: 1, 40: 1, 50: 1, 60: 1, 70: 1, 80: 1, 90: 1, or 100: 1.
[0189] In some embodiments, the amount of intact antibody or antibody fragment is determined. In some embodiments, the amount of degraded antibody fragments is determined. In some embodiments, the amount of intact antibody or antibody fragment is higher in the target tissue compared to the non-target tissue, and the amount of degraded antibody fragments is higher in the non-target tissue compared to the target tissue. In some embodiments, the amount of intact antibody or antibody fragment is higher in the CNS compared to systemic circulation, and the amount of degraded antibody fragments is higher in systemic circulation compared to the CNS. In some embodiments, the amount of intact antibody or antibody fragment is higher in the CNS compared to peripheral tissue, and the amount of degraded antibody fragments is higher in the peripheral tissue compared to the CNS. In some embodiments, the amount of intact antibody or antibody fragment is higher in muscle tissue compared to systemic circulation, and the amount of degraded antibody fragments is higher in systemic circulation compared to the muscle tissue. In some embodiments, the amount of intact antibody or antibody fragment is higher in muscle tissue compared to peripheral tissue, and the amount of degraded antibody fragments is higher in the peripheral tissue compared to the muscle tissue.
[0190] Antibody Targets
[0191] In some embodiments, a therapeutic antibody described herein is specific for an antigen of interest. In some embodiments, the antigen is an infectious disease antigen. In some embodiments, the antigen is a non-infectious disease antigen. In some embodiments, the antigen is a cancer antigen. In some embodiments, the antigen is an immune checkpoint. In some embodiments, the antigen is a senescent cell surface protein. In some embodiments, the antigen is expressed on a cell of the central nervous system. In some embodiments, the antigen expressed on a cell of the central nervous system is associated with a disease selected from Alzheimer's disease, Parkinson’s disease, Dementia with Lewy bodies, Huntington’s disease, Amyotrophic lateral sclerosis, multiple sclerosis, multiple systems atrophy, spinal muscular atrophy, neuropathies, psychiatric disorders, migraine, pain, and ocular diseases In some embodiments, a therapeutic antibody described herein binds to a target antigen with an affinity of about 30nM to about lOOnM. In some embodiments, the therapeutic antibody binds to a target antigen with an affinity of about 30nM. In some embodiments, the therapeutic antibody binds to a target antigen with an affinity of about 40 nM. In some embodiments, the therapeutic antibody binds to a target antigen with an affinity7of about 50nM. In some embodiments, the therapeutic antibody binds to a target antigen with an affinity7of about 60nM. In some embodiments, the therapeutic antibody binds to a target antigen with an affinity^ of about 70nM. In some embodiments, the therapeutic antibody binds to a target antigen with an affinity' of about 80nM. In some embodiments, the therapeutic antibody binds to a target antigen with an affinity of about 90nM. In some embodiments, the therapeutic antibody binds to a target antigen with an affinity of about lOOnM. z. Immune Checkpoint Inhibitors
[0192] In some embodiments, a transgene described herein encodes an immune checkpoint inhibitor. Any immune checkpoint inhibitor is contemplated for use with the AAV vectors described herein. In some embodiments, the immune checkpoint inhibitor is an antibody. In some embodiments, the immune checkpoint inhibitor is a monoclonal antibody.
[0193] In some embodiments, the immune checkpoint inhibitor is an inhibitor of Programmed Death-Ligand 1 (PD-L1, also know n as B7-H1, CD274), Programmed Death 1 (PD-1), CTLA- 4, PD-L2 (B7-DC. CD273). LAG3. TIM3, 2B4, 4-1BB, A2aR, B7H1. B7H3. B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD47, CD70, CD80, CD86, CD 137, CD 160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDOL IDO2, ICOS (inducible T cell costimulator), ICOSL, KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collageneous structure), PS (phosphatidylserine), OX-40, SLAM, TIGIT, VISTAS, or VTCN1.
[0194] In some embodiments, the immune checkpoint inhibitor antibody is an anti-PDl, an anti-PD-Ll, an anti-CTLA4, an anti-LAG3, an anti-TIM3, an anti-BTLA, an anti-GITR, an anti-TIGIT, an anti-VISTAS, an anti-ICOS, an anti-ICOSL, an anti-OX40, an anti-B7H3, an anti-B7H4. an anti-CD47, an anti-4-lBB, an anti-CD27, or an anti-CD70, antibody.
[0195] In some embodiments, the immune checkpoint inhibitor antibody is an anti-PDl antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-PD-Ll antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-CTLA4 antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-LAG3 antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-TIM3 antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-BTLA antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-GITR antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-TIGIT antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-VISTAS antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-ICOS antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-ICOSL antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-OX40 antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-B7H3 antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-B7H4 antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-CD47 antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-4- IBB antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-CD27 antibody. In some embodiments, the immune checkpoint inhibitor antibody is an anti-CD70 antibody.
[0196] In some embodiments, the anti-PD-Ll antibody is atezolizumab, durvalumab, avelumab, or envafolimab. In some embodiments, the anti-PDl antibody is nivolumab, pembrolizumab, or cemiplimab.
[0197] In some embodiments, the anti-CTLA-4 antibody is ipilimumab.
[0198] In some embodiments, the immune checkpoint inhibitor reduces activity7of one or more immune checkpoint proteins. In some embodiments, the immune checkpoint inhibitor reduces the interaction between one or more immune checkpoint proteins and their ligands. ii. Senescent Cell Surface Protein Antibodies
[0199] In some embodiments, a transgene described herein encodes an antibody that binds a surface marker protein of a senescent cell, or a fragment thereof. In some embodiments, therapeutic antibodies specific for a surface marker protein of a senescent cell reduces the number of senescent cells. In some embodiments, therapeutic antibodies specific for a surface marker protein are used to treat age-related conditions, such as, but not limited to, Alzheimer's disease and tumorigenesis.
[0200] In some embodiments, the therapeutic antibody binds an epitope of a senescent cell surface marker protein. Examples of such proteins include, but are not limited to, DEP1, PTPRJ, CD148, B2MG, CD264, TNFR epitopes, TRAILR4, CD36, ICAM-1, Vimentin, DPP4, CD26, Notchl, Notch 3, SCAMP4, MICA, MICB. ULBP2, uPAR, DEP1, DcR2, Serpins, IGF epitopes, CXCR2, IL-6, IL-8, Cleaved Caspase, and Lamin Bl (Malavolta et al. The Emergence of Senescent Surface Biomarkers as Senotherapeutic Targets; Cells 2021 Jul; 10(7): 1740; and Gonzalex-Gualda E. et al. A guide to assessing cellular senescence In vitro and in vivo.' FEBS Journal . 2021 Jan, Vol. 288 (1): 56-80).
[0201] Hi. Tumor Antigen Antibodies
[0202] In some embodiments, a transgene described herein encodes an antibody that binds a tumor antigen, or a fragment thereof. In some embodiments, the tumor antigens are expressed by cancers of the central nervous system. In some embodiments, the antigen is selected from, but not limited to TfR, GITR, CD47, CD40, Ang2, EGFRvIII, Epha2, Ezh2, Fosll, Gage-1, Gal-3, Ganglioside GD3. GnT-V, HNRPL, Living, Mart-1, MELK, MRP-3, NY-Eso-1, Prame, Sart-1, Sart-2, Sart-3, Sox2, SoxlO, SSX-2, Tert, TRP-1, TRP-2, Ube2V, Whsc2, WT-1, YKL- 40, BCAN, CHI3LI, CLIP2, FABP7, NR2E1, NES, NRCAM, PDPN, NG2, VEGF, HER2, TSPO, IL13Ra2, EphA2, GD2, B7-H3, CD133, MET, aim-2, Apha2, GplOO, Mage-Al, PTH- rP, Soxl l, Tyrosinase, SLC01C1, NLGN4X, Art-2, Art-4, CD20, and B-cyclin.
[0203] In some embodiments, a transgene described herein encodes an antibody that binds CD20, or a fragment thereof. In some embodiments, a transgene described herein encodes the anti-CD20 antibody rituximab. In some embodiments, a transgene described herein encodes the anti-CD20 antibody obinutuzumab. In some embodiments, a transgene described herein encodes the anti-CD20 antibody ofatumumab. In some embodiments, a transgene described herein encodes the anti-CD20 antibody ibritumomab. In some embodiments, a transgene described herein encodes the anti-CD20 antibody ocrelizumab. In some embodiments, a transgene described herein encodes the anti-CD20 antibody tositumomab. In some embodiments, a transgene described herein encodes the anti-CD20 antibody veltuzumab. In some embodiments, a transgene described herein encodes the anti-CD20 antibody GAI 01. In some embodiments, a transgene described herein encodes the anti-CD20 antibody TRU-015. In some embodiments, a transgene described herein encodes the anti-CD20 antibody PRO131921.
[0204] Manufacturing of Polypeptides
[0205] In some embodiments, the sequences of the polypeptides encoded by the viral genomes described herein are derived from antibodies produced using hybridoma technology. Host animals (e.g. mice, rabbits, goats, and llamas) may be immunized by an injection with an antigenic protein to elicit lymphocytes that specifically bind to the antigen. Lymphocytes may be collected and fused with immortalized cell lines to generate hybridomas which can be cultured in a suitable culture medium to promote growth. The antibodies produced by the cultured hybridomas may be subjected to analysis to determine binding specificity of the antibodies for the target antigen. Once antibodies with desirable characteristics are identified, corresponding hybridomas may be subcloned through limiting dilution procedures and grown by standard methods. The antibodies produced by these cells may be isolated and purified using standard immunoglobulin purification procedures.
[0206] In some embodiments, the sequences of the polypeptides to be encoded in the viral genomes is generated using display technologies. Display technologies used to generate polypeptides include any of the display techniques (e.g. display library screening techniques) disclosed in International Patent Application No. WO2014074532, the contents of which are herein incorporated by reference in their entirety. In some embodiments, synthetic antibodies are designed, selected, or optimized by screening target antigens using display technologies (e.g. phage display technologies). Phage display libraries may comprise millions to billions of phage vectors, each expressing unique antibody fragments on their viral coats. Such libraries may provide richly diverse resources that are used to select potentially hundreds of antibody fragments with diverse levels of affinity for one or more antigens of interest (McCafferty, et al., 1990. Nature.348:552-4; Edwards, B.M. et al., 2003. JMB.334: 103-18; Schofield, D. et al., 2007. Genome Biol.8, R254 and Pershad, K. et al., 2010. Protein Engineering Design and Selection.23:279-88; the contents of each of which are herein incorporated by reference in their entirety). Often, the antibody fragments present in such libraries comprise scFv antibody fragments, comprising a fusion protein of Vn and VL antibody domains joined by a flexible linker. In some cases, scFvs may contain the same sequence with the exception of unique sequences encoding variable loops of the CDRs. In some cases, scFvs are expressed as fusion proteins, linked to viral coat proteins (e.g. the N-terminus of the viral pill coat protein). VL chains may be expressed separately for assembly with VH chains in the periplasm prior to complex incorporation into viral coats. Precipitated library members may be sequenced from the bound phage to obtain cDNA encoding desired scFvs. Antibody variable domains or CDRs from such sequences may be directly incorporated into antibody sequences for recombinant antibody production or mutated and utilized for further optimization through in vitro affinity maturation.
[0207] In some embodiments, the sequences of the polypeptides to be encoded in the viral genomes are produced using yeast surface display technology. In some embodiments, recombinant antibodies are developed by displaying the antibody fragment of interest as a fusion to on the surface of the yeast, where the protein interacts with proteins and small molecules in a solution. scFvs with affinity toward desired receptors may be isolated from the yeast surface using magnetic separation and flow cytometry. Several cycles of yeast surface display and isolation may be done to attain scFvs with desired properties through directed evolution.
[0208] In some embodiments, the AAV vectors described herein encode a conditionally active antibody. The method of preparing a conditionally active antibody is described in International Publications WO2016033331 and WO2016036916 and summarized herein. Briefly, a wildtype polypeptide is selected and the DNA is evolved to create mutant DNAs. Non-limiting examples of evolutionary' techniques that may be used to evolve the DNA include polymerase chain reaction (PCR), error prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, in vivo mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis, in vitro mutagenesis, ligase chain reaction, oligonucleotide synthesis or any combination thereof. Once mutant DNAs are created, they are expressed in a eukaryotic cell production host (i.e., fungal, insect, mammalian, adenoviral, plant), wherein a mutant polypeptide is produced. The mutant polypeptide and the corresponding wild-type polypeptide are then subjected to assays under both normal physiological conditions and aberrant conditions in order to identity' mutants that exhibit a decrease in activity' in the assay at normal physiological conditions as compared to the wild-type polypeptide and / or an increase in activity in the assay under aberrant conditions, as compared to the corresponding wild-type polypeptide. The desired conditionally active mutant may then be produced in the aforementioned eukary otic cell production host.
[0209] Methods for determining the affinity of an antibody for its antigen are known in the art. An exemplary method for determining binding affinity employs surface plasmon resonance. Surface plasmon resonance is an optical phenomenon that allows for the analysis of realtime biospecific interactions by detection of alterations in protein concentrations within a biosensor matrix, for example using the BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, N.J.). For further descriptions, see Jonsson, U., et al. (1993) Ann. Biol. Clin. 51 : 19-26; Jonsson, U., i (1991) Biotechniques 11 :620-627; Johnsson, B., et al. (1995) J. Mol. Recognit. 8: 125-131; and Johnsson, B., et al. (1991) Anal. Biochem. 198:268-277. IL AAV
[0210] Adeno-associated viruses (AAV) have proven to be useful as a biological tool due to their relatively simple structure, their ability to infect a wide range of cells without integration into the host genome, and their relatively benign immunogenic profde. In some embodiments, the genome of the virus is manipulated to contain a minimum of components for the assembly of a functional virus engineered to target a particular tissue and express or deliver a desired transgene.
[0211] In some embodiments, the disclosure provides an AAV vector comprising a viral genome comprising a transgene encoding a therapeutic antibody described herein.
[0212] The wild-type AAV vector genome is a linear, single-stranded DNA (ssDNA) molecule approximately 5.000 nucleotides in length. Inverted terminal repeats (ITRs) traditionally cap the viral genome at both the 5' and the 3’ end, providing origins of replication for the viral genome. The wild-type AAV viral genome further comprises nucleotide sequences for two open reading frames, one for the four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40, encoded by Rep genes) and one for the three capsid, or structural, proteins (VP1, VP2, VP3. encoded by capsid genes or Cap genes). The Rep proteins are important for replication and packaging, while the capsid proteins are assembled to create the protein shell of the AAV, or AAV capsid. Though it varies by AAV serotype, VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. In other words, VP1 is the full-length capsid sequence, while VP2 and VP3 are shorter components of the whole. As a result, changes in the sequence in the VP3 region, are also changes to VP1 and VP2.
[0213] For use as a biological tool, the wild-type AAV viral genome can be modified to replace the rep / cap sequences with a nucleic acid sequence comprising a transgene described herein. In some embodiments, the viral genome is an artificial genome. Typically, in recombinant AAV viral genomes there are two ITR regions. The rep / cap sequences can be provided in trans during production to generate AAV vectors.
[0214] In addition to the transgene, in some embodiments AAV vectors comprise the viral genome, in whole or in part, of any naturally occurring and / or recombinant AAV serotype nucleotide sequence or variant. In some embodiments. AAV variants have sequences of significant homology at the nucleic acid (genome or capsid) and amino acid (capsids) levels, to produce constructs which are generally physical and functional equivalents, replicate by similar mechanisms, and assemble by similar mechanisms.
[0215] In some embodiments. AAV vectors of the present disclosure are recombinant AAV viral vectors which are replication defective and lacking sequences encoding functional Rep and Cap proteins within their viral genome. These defective AAV vectors may lack most or all parental coding sequences and essentially carry only one or two AAV ITR sequences and the nucleic acid of interest for delivery to a cell, a tissue, an organ, or an organism.
[0216] In some embodiments, the viral genome (e.g., an artificial genome) of the AAV vectors of the present disclosure comprise at least one control element which provides for the replication, transcription, and translation of a coding sequence encoded therein. Not all of the control elements need always be present as long as the coding sequence is capable of being replicated, transcribed, and / or translated in an appropriate host cell. Non-limiting examples of expression control elements include sequences for transcription initiation and / or termination, promoter and / or enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation signals, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficacy (e.g., Kozak consensus sequence), sequences that enhance protein stability, and / or sequences that enhance protein processing and / or secretion.
[0217] According to the present disclosure, AAV vectors comprise a virus that has been distilled or reduced to the minimum components necessary for transduction of a nucleic acid or cargo of interest. In this manner. AAV vectors are engineered as vehicles for specific delivery while lacking the deleterious replication and / or integration features found in wild-type viruses.
[0218] In some embodiments, AAV vectors of the present disclosure are produced recombinantly and are based on adeno-associated virus (AAV) parent or reference sequences.
[0219] Serotypes
[0220] There are numerous alternative AAV serotypes (over 100 have been cloned) having desirable characteristics. In some embodiments, the AAV vector is a recombinant AAV (rAAV). In some embodiments, the AAV vector comprises at least one component of AAV1, AAV2, AAV4, AAV5, AAV6, AV6.2, AAV7, AAV8, AAV9, rh.10, rh.39, rh.43 or CSp3. In some embodiments, the AAV vector comprises at least one component of an AAV with tropism for the CNS . In some embodiments the AAV with tropism for the CNS is AAV1, AAV2. AAV4, AAV5, AAV6, AAV8, or AAV9. In some embodiments, the AAV is an AAV1. In some embodiments, the AAV is an AAV2. In some embodiments, the AAV is an AAV4. In some embodiments, the AAV is an AAV5. In some embodiments, the AAV is an AAV6. In some embodiments, the AAV is an AAV8. In some embodiments, the AAV is an AAV9. In some embodiments, the AAV vector comprises at least one component of an AAV with tropism for muscle tissue.
[0221] In some embodiments, the AAV vector is of serotype 1. In some embodiments, the AAV vector is of serotype 2. In some embodiments, the AAV vector is of serotype 3. In some embodiments, the AAV vector is of serotype 4. In some embodiments, a AAV vector is of serotype 5. In some embodiments, the AAV vector of serotype 6. In some embodiments, the AAV vector is of serotype 7. In some embodiments, the AAV vector is of serotype 8. In some embodiments, a AAV vector is of serotype 9. In some embodiments, the AAV vector of serotype 10. In some embodiments, the AAV vector is of serotype 11. In some embodiments, a AAV vector is of serotype 12. In some embodiments, the AAV vector is of serotype 13. In some embodiments, the AAV vector is of serotype 2 / 1. In some embodiments, the AAV vector is of serotype 2 / 5. In some embodiments, a AAV vector is of serotype 2 / 8. In some embodiments, the AAV vector is of serotype 2 / 9. In some embodiments, the AAV vector is of serotype 3 / 1. In some embodiments, the AAV vector is of serotype 3 / 5. In some embodiments, a AAV vector is of serotype 3 / 8. In some embodiments, the AAV vector is of serotype 3 / 9.
[0222] Capsid Genes and Proteins
[0223] As used herein, tropism refers to a property of AAV wherein AAV variants may preferentially transduce a subset of organisms, tissues, or cell types. In some embodiments, the tropism of the AAV vector is for the CNS. In some embodiments, the tropism of the AAV vector is muscle.
[0224] In some embodiments, the AAV vectors are packages in a capsid structure. In some embodiments, the AAV vectors are capsid free. Non-limiting examples of capsid free viral vector donor and / or acceptor sequences such as AAVO are described in, for example, US Publication No. 20140107186, the contents of which are incorporated herein by reference in their entirety.
[0225] In some embodiments, the AAV vector comprises a capsid. In some embodiments, the capsid is a chimeric capsid. In some embodiments, the chimeric capsid described herein have one or more of enhanced transduction, reduced immunogenicity, enhanced crossing the bloodbrain barrier, improved expression, and / or increased expression compared to a non-chimeric capsid. In some embodiments, the AAV capsid comprises at least one modification that enhances tropism of the AAV vector for the CNS relative to an AAV vector comprising an AAV capsid without the modification. In some embodiments, the AAV capsid comprises at least one modification that enhances tropism of the AAV vector for muscle tissue relative to an AAV vector comprising an AAV capsid without the modification.
[0226] In some embodiments, the AAV capsid is genetically engineered to increase permeation across the blood brain barrier (BBB) by insertion of a targeting sequence or peptide insert as described herein into the capsid protein. The terms “targeting sequence’' and “peptide insert” are used interchangeably.
[0227] The naturally occurring AAV Cap gene expresses VP1, VP2. and VP3 proteins encoded by a single open reading frame of the Cap gene under control of the p40 promoter. In some embodiments, one or more open reading frames (ORFs) comprise nucleotide sequences encoding one or more capsid proteins. These proteins are encoded on the viral expression construct. In some embodiments, VP proteins are expressed from more than one ORF comprising nucleotide sequences encoding any combination of VP1, VP2, and / or VP3 by use of separate nucleotide sequences operably linked to at least one expression control sequence for expression in a viral replication cell, each producing one or more of VP1, VP2, and / or VP3 capsid proteins. In some embodiments, VP proteins are expressed individually from an ORF comprising a nucleotide sequence encoding any one of VP1. VP2. or VP3 by use of separate nucleotide sequences operably linked to one expression control sequence for expression in a viral replication cell, each producing only one of VP1, VP2, or VP3 capsid protein. In some embodiments, VP proteins are expressed from one ORF comprising nucleotide sequences encoding VP1. VP2, and VP3 capsid proteins operably linked to at least one expression control sequence for expression in a viral replication cell, each producing VP1, VP2, and VP3 capsid protein.
[0228] The Cap gene sequence, and the protein sequences that comprise the VP proteins VP1, VP2, VP3 that the Cap gene encodes, are less conserved than other AAV viral components, including the Rep gene and proteins. VP proteins comprise the capsid of the viral vector, the outermost surface of the viral vector, and therefore are the primary determinant of cellular tropism of the viral vector. The highly conserved sequences of the Rep genes allow for crosscomplementation with the sequences of other AAV variants. As a non-limiting example, the Rep sequences of one or more AAV variants are combined with the Cap sequences from any AAV variant.
[0229] The overall decreased conservation of the Cap nucleotide sequence, as compared to the Rep nucleotide sequences, described between AAV variants is often confined to discrete variable regions (VR). Variable regions in the Cap nucleotide sequence may encode discrete regions of the mature folded capsid proteins of the viral vector. Variation of the viral vector at regions that contact cellular proteins may regulate the virus-cell interactions that define the tropism of a single AAV variant. In some embodiments, AAV variants are defined by VR of the Cap genes, VP1, VP2, and / or VP3.
[0230] The protein subunit structure of capsid proteins is comprised of secondary structures such as helices and beta sheets. A group of beta-sheets may further comprise a tertiary structure known in the art as a beta barrel. In a non-limiting example, an AAV2 capsid subunit may comprise a beta barrel further comprised of beta sheets A, B, C, D. E, F, G, H. and I (Xi et al. PNAS 2002 Aug. 6; 99(16): 10405-10, the contents of which are herein incorporated by reference in their entirety). Beta sheet subunits may be connected by loop structures that extend away from the main beta sheet barrel and are commonly named by the adjacent beta sheets. In a non-limiting example, an AAV2 beta barrel may comprise beta sheets H and I which are connected by an HI loop. In some embodiments, AAV variants are defined by VR of structural elements, including but not limited to the HI loop. i. Modified AA V Capsid
[0231] In some embodiments, an AAV vector described herein comprises a modified AAV capsid. In some embodiments, a modified AAV capsid comprises at least one amino acid mutation (i.e., deletion, substitution, or insertion). In some embodiments, a modified capsid comprises at least one peptide insert. In some embodiments, a modified capsid comprises at least one peptide insert. In some embodiments, a peptide insert alters the tropism of the AAV capsid. In some embodiments, a peptide insert increases tropism of the AAV capsid for a specific tissue. In some embodiments, a peptide insert increases delivery of the AAV vector to a specific tissue. In some embodiments, a peptide insert described herein increases permeation of the AAV across the BBB.
[0232] Peptide inserts that enhance permeation through the BBB, e.g., when inserted into the capsid of an AAV, e.g., AAV1, AAV2, AAV8, or AAV9, are known to those of skill in the art.
[0233] In some embodiments, the AAV capsid is an AAV9 capsid. In some embodiments, the AAV9 capsid comprises an amino acid sequence at least 85% identical to SEQ ID NO: 101. In some embodiments, the AAV9 capsid comprises an amino acid sequence at least 90% identical to SEQ ID NO: 101. In some embodiments, the AAV9 capsid comprises an amino acid sequence at least 95% identical to SEQ ID NO: 101. In some embodiments, the capsid comprises a sequence of SEQ ID NO: 126 or 127. or a sequence at least 95% identical thereto. In some embodiments, the capsid comprises a sequence of SEQ ID NO: 126. In some embodiments, the capsid comprises a sequence of SEQ ID NO: 127.
[0234] In some embodiments, the AAV capsid comprises a peptide insert as described in US Patent No. 10,577,627, the contents of which are incorporated herein in their entirety. In some embodiments, the AAV capsid comprises a peptide insert as described in US Publication No. 20210277066, the contents of which are incorporated herein in their entirety
[0235] In some embodiments, a peptide insert is at least 4 amino acids in length. In some embodiments, a peptide insert is at least 5 amino acids in length. In some embodiments, a peptide insert is up to 50 amino acids in length. In some embodiments, a peptide insert is up to 40 amino acids in length. In some embodiments, a peptide insert is up to 30 amino acids in length. In some embodiments, a peptide insert is up to 20 amino acids in length. In some embodiments, a peptide insert is up to 10 amino acids in length. In some embodiments, a peptide insert described herein comprises 4-50 amino acids. In some embodiments, a peptide insert comprises 4-25 amino acids. In some embodiments, a peptide insert comprises 5-10 amino acids.
[0236] In some embodiments, the peptide insert is located between amino acids 588 and 589 of the amino acid sequence of SEQ ID NO: 101. In some embodiments, the peptide insert is located betw een amino acids 452 and 453 of the amino acid sequence of SEQ ID NO: 101.
[0237] In some embodiments, the peptide insert comprises at least 4, e.g.. 5, contiguous amino acids of the sequences VPALR (SEQ ID NO: 1) or VSALK (SEQ ID NO:2).
[0238] In some embodiments, the peptide insert comprises a sequence of X1X2X3X4X5, wherein:
[0239] (i) Xi, X2, X3, X4 are any four non-identical amino acids of V, A, L, I, G, P, S, T, or M; and
[0240] (li) X5is K, R, H, D, or E.
[0241] In some embodiments, the peptide insert comprises a sequence of at least 6 amino acids. In some embodiments, the peptide insert comprises at least 4, e g., 5 or 6 contiguous amino acids of the sequences TVPALR (SEQ ID NO:3), TVSALK (SEQ ID NO:4), TVPMLK (SEQ ID NO: 12) or TVPTLK (SEQ ID NO: 13).
[0242] In some embodiments, the peptide insert comprises a sequence of X1X2X3X4X5X6, wherein:
[0243] (i) Xi is T;
[0244] (ii) X2, X3, X4, Xs are any four non-identical amino acids of V, A, L, I, G. P, S, T, or
[0245] M; and (iii) X6is K, R, H, D. or E.
[0246] In some embodiments, the peptide insert comprises a sequence of X1X2X3X4X5X6, wherein:
[0247] (i) Xi, X2, Xs, X4 are any four non-identical amino acids from V, A, L, I, G, P, S, T, or M;
[0248] (ii) X5 is K, R, H, D, or E; and
[0249] (iii) Xe is E or D.
[0250] In some embodiments, the peptide insert comprises a sequence of at least 7 amino acids. In some embodiments, the peptide insert comprises at least 4, e.g., 5, 6, or 7 contiguous amino acids of the sequences FTVSALK (SEQ ID NO:5), LTVSALK (SEQ ID NO:6), TVSALFK (SEQ ID NO:8), TVPALFR (SEQ ID NO:9), TVPMLFK (SEQ ID NO: 10) or TVPTLFK (SEQ ID NO: 1 1). In some embodiments, the peptide insert is 5-21 amino acids and comprises at least 4, e.g., 5, 6, or 7 contiguous amino acids of the sequences FTVSALK (SEQ ID NO: 5), LTVSALK (SEQ ID NO:6), TVSALFK (SEQ ID NO:8), TVPALFR (SEQ ID NO:9), TVPMLFK (SEQ ID NO: 10) or TVPTLFK (SEQ ID NO: 11).
[0251] In some embodiments, the peptide insert comprises a sequence of X1X2X3X4X5X6X7, wherein:
[0252] (i) Xi is F, L, W, or Y;
[0253] (ii) X2 is T;
[0254] (iii) X3, X4, X5, Xe are any four non-identical amino acids of V, A. L, I, G, P, S. T, or M; and
[0255] (iv) X7 is K, R, H, D, or E.
[0256] In some embodiments, the peptide insert comprises a sequence of X1X2X3X4X5X6X7, wherein:
[0257] (1) Xi is T;
[0258] (ii) X2, X3, X4, X5 are any four non-identical amino acids of V, A, L, I, G, P, S, T, or M;
[0259] (iii) Xe is K, R. H, D, or E; and
[0260] (iv) X7 is E or D.
[0261] In some embodiments, the peptide insert comprises a sequence of X1X2X3X4X5X6X7, wherein:
[0262] (i) Xi, X2, X3, X4 are any four non-identical amino acids of V, A, L, I, G, P, S, T, or M;
[0263] (ii) X5is K, R, H, D, or E;
[0264] (iii) Xe is E or D; and (iv) X7 is A or I.
[0265] In some embodiments, the peptide insert comprises a sequence of V[S / p][A / m / t / ]L, wherein the upper case letters are preferred at that position. In some embodiments, the peptide insert comprises a sequence of TV[S / p][A / m / t / ]L. In some embodiments, the peptide insert comprises a sequence of TV[S / p][A / m / t / ]LK (SEQ ID NO:81). In some embodiments, the peptide insert comprises a sequence of TV[S / p][A / m / t / ]LFK. (SEQ ID NO: 82).
[0266] In some embodiments, the peptide insert does not consist of VPALR (SEQ ID NO: 1) or VSALK (SEQ ID NO:2)
[0267] Exemplary peptide inserts that include the above mentioned 5, 6, or 7-amino acid sequences are those represented by SEQ ID NOs: 1-68 and SEQ ID NO: 145. In some embodiments, the peptide insert comprises a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145. In some embodiments, the peptide insert consists of a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145. In some embodiments, the peptide insert comprises a sequence selected from the group consisting of SEQ ID NOs: 69-72. In some embodiments, the peptide insert consists of a sequence selected from the group consisting of SEQ ID NOs: 69-72.
[0268] Peptide inserts including reversed sequences can also be used, e g., KLASVT (SEQ ID NO: 83) and KFLASVT (SEQ ID NO: 84). In some embodiments, the peptide insert comprises a sequence selected from the group consisting of SEQ ID NOs: 83 and 84.
[0269] Peptide inserts disclosed herein can be modified according to the methods known in the art for producing peptidomimetics. See, e g., Qvit et al.. Drug Discov Today. 2017 February; 22(2): 454-462; Farhadi and Hashemian, Drug Des Devel Then 2018; 12: 1239-1254; Avan et al., Chem. Soc. Rev., 2014, 43, 3575-3594; Pathak, et al., Indo American Journal of Pharmaceutical Research, 2015. 8; Kazmierski, W. M., ed., Peptidomimetics Protocols, Human Press (Totowa N.J. 1998); Goodman et al., eds., Houben-Weyl Methods of Organic Chemistry: Synthesis of Peptides and Peptidomimetics, Thiele Verlag (New York 2003); and Mayo et al., J. Biol. Chem., 278:45746 (2003). In some embodiments, the modified peptidomimetic versions of the peptides and fragments disclosed herein exhibit enhanced stability in vivo, relative to the non-peptidomimetic peptides.
[0270] Methods for creating a peptidomimetic include substituting one or more, e.g., all, of the amino acids in a peptide sequence with D-amino acid enantiomers. Such sequences are referred to herein as "retro" sequences. In another method, the N-terminal to C-terminal order of the amino acid residues is reversed, such that the order of amino acid residues from the N-terminus to the C-terminus of the original peptide becomes the order of amino acid residues from the C- terminus to the N-terminus in the modified peptidomimetic. Such sequences can be referred to as "inverso" sequences.
[0271] Peptidomimetics can be both the retro and inverso versions, i.e., the "retro-inverso" version of a peptide disclosed herein. The new peptidomimetics can be composed of D-amino acids arranged so that the order of amino acid residues from the N-terminus to the C-terminus in the peptidomimetic corresponds to the order of amino acid residues from the C-terminus to the N-terminus in the original peptide. Other methods for making a peptidomimetic include replacing one or more amino acid residues in a peptide with a chemically distinct but recognized functional analog of the amino acid, i.e., an artificial amino acid analog. Artificial amino acid analogs include S-amino acids, & -substituted S -amino acids ("93-amino acids"), phosphorous analogs of amino acids, such as V-amino phosphonic acids and V -amino phosphinic acids, and amino acids having non-peptide linkages. Artificial amino acids can be used to create peptidomimetics, such as peptoid oligomers (e.g., peptoid amide or ester analogues), & -peptides, cyclic peptides, oligourea or oligocarbamate peptides; or heterocyclic ring molecules. Exemplary retro-inverso targeting peptidomimetics include KLASVT (SEQ ID NO: 83) and KFLASVT (SEQ ID NO: 84), wherein the sequences include all D-amino acids. These sequences can be modified, e.g., by biotinylation of the amino terminus and amidation of the carboxy terminus.
[0272] Viral Genomes
[0273] In some embodiments, the AAV vectors of the present disclosure comprise a viral genome comprising at least one transgene region encoding a therapeutic antibody described herein.
[0274] In some embodiments, the viral genome comprises an inverted terminal repeat (ITR). In some embodiments, the viral genome comprises a promoter. In some embodiments, the viral genome comprises a poly A tail. In some embodiments, the viral genome comprises a transgene encoding an antibody. In some embodiments, the viral genome comprises an untranslated region (UTR).
[0275] Any suitable ITRs may be used with the AAV vectors of the instant disclosure. In some embodiments, the AAV vector comprises an AAV9 capsid (or a derivative thereof in which the capsid comprises a targeting peptide) and AAV2 ITRs. An exemplary AAV2 5’ ITR for use with the AAV vectors of the disclosure comprises a sequence of CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCG GGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAG AGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 146). An exemplary AAV2 3’ ITR sequence comprises
[0276] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCAC TGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTC AGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG (SEQ ID NO: 147). However, the skilled artisan will understand that suitable ITR sequences are available from a variety- of sources. i. Transgenes
[0277] In some embodiments, the AAV vectors of the present disclosure comprise at least one transgene encoding a therapeutic antibody. In some embodiments, the transgene is constructed in such a way as to reflect a region similar to or mirroring the natural organization of an rnRNA. In some embodiments, the transgene comprises a combination of coding and non-coding nucleic acid sequences.
[0278] In some embodiments, the AAV vector comprises a viral genome comprising a transgene comprising nucleic acid sequences encoding more than one polypeptide of interest (e.g., an antibody). In some embodiments, a viral genome encoding more than one polypeptide is replicated and packaged into a viral vector. A target cell transduced with a viral vector comprising more than one polypeptide may express each of the polypeptides in a single cell.
[0279] In some embodiments, an AAV vector comprises a viral genome comprising a transgene comprising a nucleic acid sequence encoding a heavy chain and a light chain of an antibody, or fragments thereof. The heavy chain and light chain are expressed and assembled to form the antibody which is secreted. In some embodiments, the heavy and light chain are encoded by the same transgene. In some embodiments, the heavy and light chain are encoded by separate transgenes. In some embodiments, the heavy and light chain are encoded by separate transgenes operably linked via a linker.
[0280] In some embodiments, the transgene comprises at least one inverted terminal repeat (ITR). In some embodiments, the transgene comprises two ITR regions. In some embodiments, the transgene is flanked by ITRs. In some embodiments, at least one ITR region is derived from the same parental serotype of the capsid. In some embodiments at least one ITR region is from a different parental serotype of the capsid. In some embodiments, the ITR regions are from the same serotype. In some embodiments, the ITR regions are from different serotypes. In some embodiments, the ITR is a 3' ITR region. In some embodiments, the ITR is a 5' ITR region.
[0281] In some embodiments, the AAV vector comprises a viral genome comprising ITR regions from AAV serotype AAV1. In some embodiments, the AAV vector comprises a viral genome comprising ITR regions from AAV seroty pe AAV2. In some embodiments, the AAV vector comprises a viral genome comprising ITR regions from AAV serotype AAV3. In some embodiments, the AAV vector comprises a viral genome comprising ITR regions from AAV serotype AAV4. In some embodiments, the AAV vector comprises a viral genome comprising ITR regions from AAV serotype AAV5. In some embodiments, the AAV vector comprises a viral genome comprising ITR regions from AAV serotype AAV6. In some embodiments, the AAV vector comprises a viral genome comprising ITR regions from AAV serotype AAV7. In some embodiments, the AAV vector comprises a viral genome comprising ITR regions from AAV serotype AAV8. In some embodiments, the AAV vector comprises a viral genome comprising ITR regions from AAV serotype AAV9.
[0282] In some embodiments, each ITR is about 100 to about 150 nucleotides in length. In some embodiments, each ITR is about 100 to about 105 nucleotides in length. In some embodiments, each ITR is about 106 to about 110 nucleotides in length. In some embodiments, each ITR is about 111 to about 115 nucleotides in length. In some embodiments, each ITR is about 116 to about 120 nucleotides in length. In some embodiments, each ITR is about 121 to about 125 nucleotides in length. In some embodiments, each ITR is about 126 to about 130 nucleotides in length. In some embodiments, each ITR is about 131 to about 135 nucleotides in length. In some embodiments, each ITR is about 136 to about 140 nucleotides in length. In some embodiments, each ITR is about 141 to about 145 nucleotides in length. In some embodiments, each ITR is about 146 to about 150 nucleotides in length.
[0283] In some embodiments, the transgene comprises a promoter region. In some embodiments, the transgene comprises an intron region. In some embodiments, the transgene comprises a coding region. In some embodiments, the transgene comprises at least one ITR, a promoter, an intron region, and a coding region.
[0284] In addition to the antibody encoded by the transgene, proteins encoded by the transgene region may include, in combination, certain mammalian proteins involved in immune system regulation.
[0285] The AAV vectors can also include an enhancer, such as a CMV Enhancer, mDlx enhancer, or an AQP4 enhancer. Suitable enhancers will be known to persons of ordinary’ skill in the art. The AAV vectors of the disclosure may optionally include regulatory elements that may be used to enhance expression of the CD20 antigen binding domain encoded by the vector. For example, AAV vectors as described herein can include a sequence of a Woodchuck Hepatitis Posttranscriptional Regulator}7Element (WPRE). An exemplary WPRE sequence is provided as SEQ ID NO: 138.
[0286] In some embodiments, the AAV vector transgene comprises one or more therapeutic modalities related to gene silencing or interference such as but not limited to. miRNA, siRNA. RNAi, shRNA, antisense oligos, long non-coding RNAs, and / or pri-miRNA. it. Untranslated Regions (UTRs)
[0287] By definition, wild t pe untranslated regions (UTRs) of a gene are transcribed but not translated. Generally, the 5'UTR starts at the transcription start site and ends at the start codon and the 3'UTR starts immediately following the stop codon and continues until the termination signal for transcription. Features typically found in abundantly expressed genes of specific target organs may be engineered into UTRs to enhance the stability and protein production.
[0288] In some embodiments, the transgene comprises a 5’UTR. In some embodiments, the transgene comprises an engineered 5’UTR. In some embodiments, the transgene comprises a wild-type 5' UTR. In some embodiments, a Kozak sequence, which is commonly known to be involved in the process by which the ribosome initiates translation of many genes, is included in the 5'UTR. In some embodiments, the 5'UTR in the viral genome includes a Kozak sequence. In some embodiments, the 5'UTR in the viral genome does not include a Kozak sequence.
[0289] In some embodiments, the transgene comprises a 3 ’UTR. In some embodiments, the transgene comprises an engineered 3 ’UTR. In some embodiments, the transgene comprises a wild-type 3’UTR. 3'UTRs are know n to have stretches of Adenosines and Uridines embedded therein. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR. have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3'UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo. Introduction, removal, or modification of 3'UTR AREs can be used to modulate the stability of polynucleotides. When engineering specific polynucleotides, e.g., transgene regions of viral genomes, one or more copies of an ARE can be introduced to make polynucleotides less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.
[0290] In some embodiments, an ARE is introduced into the 3'UTR. In some embodiments, an ARE is removed from the 3'UTR. In some embodiments, an ARE is modified in the 3'UTR.
[0291] In some embodiments, the viral genome comprises at least one miRNA seed, binding site or full sequence. microRNAs (or miRNA or miR) are 19-25 nucleotide noncoding RNAs that bind to the sites of nucleic acid targets and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation. A microRNA sequence comprises a "seed" region, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which sequence has perfect Watson-Crick complementarity to the miRNA target sequence of the nucleic acid. In some embodiments, the viral genome may be engineered to include, alter, or remove at least one miRNA binding site, sequence, or seed region.
[0292] In some embodiments, any UTR from any gene known in the art is incorporated into the viral genome of the AAV vector. In some embodiments, the UTRs, or portions thereof, are placed in the same orientation as in the gene from which they were selected. In some embodiments, the UTRs, or portions thereof, are placed in an altered orientation or location from which they were selected. In some embodiments, the UTR used in the viral genome of the AAV vector is inverted, shortened, lengthened, or made with one or more other 5'UTRs or 3'UTRs known in the art. As used herein, the term "altered" as it relates to a UTR, means that the UTR has been changed in some way in relation to a reference sequence. For example, in some embodiments, a 3' or 5'UTR is altered relative to a wild type or native UTR by the change in orientation or location as taught above or is altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides.
[0293] In some embodiments, the viral genome of the AAV vector comprises at least one artificial UTR which is not a variant of a wild ty pe UTR.
[0294] In some embodiments, the viral genome of the AAV vector comprises UTRs which have been selected from a family of transcripts w hose proteins share a common function, structure, feature, or property. Hi. Polyadenylation Sequence
[0295] In some embodiments, the viral genome of the AAV vector comprises at least one polyadenylation sequence. In some embodiments, the viral genome of the AAV vector comprises a polyadenylation sequence between the 3' end of the transgene coding sequence and the 5' end of the 3'UTR.
[0296] In some embodiments, the polyadenylation sequence or "polyA sequence" ranges from absent to about 500 nucleotides in length. In some embodiments, the polyadenylation sequence is, but is not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
[0297] 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65. 66, 67, 68, 69, 70, 71, 72,
[0298] 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90. 91. 92. 93. 94. 95, 96, 97,
[0299] 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 1 11. 112. 113. 1 14. 115. 116.
[0300] 117, 118, 119, 120, 121, 122, 123, 124, 125, 126. 127, 128, 129, 130, 131, 132, 133, 134, 135,
[0301] 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154,
[0302] 155, 156. 157, 158, 159, 160, 161, 162, 163. 164, 165, 166, 167, 168, 169, 170. 171, 172, 173,
[0303] 174, 175. 176. 177, 178. 179, 180. 181, 182. 183, 184, 185. 186, 187. 188, 189. 190, 191, 192.
[0304] 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211,
[0305] 212, 213, 214, 215, 216, 217, 218, 219, 220. 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232. 233, 234, 235, 236, 237, 238, 239. 240, 241, 242, 243, 244. 245, 246. 247, 248, 249, 250, 251. 252, 253. 254, 255, 256. 257, 258. 259, 260, 261, 262, 263. 264, 265. 266, 267, 268, 269, 270, 271 , 272, 273, 274, 275, 276, 277, 278. 279, 280, 281 , 282, 283. 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327. 328, 329, 330, 331, 332, 333, 334. 335, 336, 337, 338, 339, 340, 341. 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363,
[0306] 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403. 404, 405, 406, 407, 408, 409, 410. 411, 412, 413, 414, 415, 416, 417. 418, 419, 420, 421, 422. 423, 424, 425. 426, 427. 428, 429. 430, 431, 432. 433, 434. 435, 436. 437, 438, 439. 440, 441, 442, 443, 444, 445, 446, 447, 448. 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478. 479. 480, 481, 482, 483, 484, 485, 486. 487, 488, 489, 490, 491, 492, 493. 494, 495, 496, 497, 498. 499, and 500 nucleotides in length In some embodiments, the polyadenylation sequence is 50-100 nucleotides in length. In some embodiments, the poly adenylation sequence is 50-150 nucleotides in length. In some embodiments, the polyadenylation sequence is 50-160 nucleotides in length. In some embodiments, the polyadenylation sequence is 50-200 nucleotides in length. In some embodiments, the poly adenylation sequence is 60-100 nucleotides in length. In some embodiments, the poly adenylation sequence is 60-150 nucleotides in length. In some embodiments, the poly adenylation sequence is 60-1.60 nucleotides in length. In some embodiments, the polyadenylation sequence is 60-200 nucleotides in length. In some embodiments, the polyadenylation sequence is 70-100 nucleotides m length. In some embodiments, the polyadenylation sequence is 70-150 nucleotides in length. In some embodiments, the polyadenylation sequence is 70-160 nucleotides in length. In some embodiments, the poly adenylation sequence is 70-2.00 nucleotides in length. In some embodiments, the polyadenylation sequence is 80-100 nucleotides in length. In some embodiments, the poly adenylation sequence is 80-150 nucleotides in length. In some embodiments, the poly adenylation sequence is 80-160 nucleotides in length. In some embodiments, the polyadenylation sequence is 80-200 nucleotides in length. In some embodiments, the polyadenylation sequence is 90-100 nucleotides in length. In some embodiments, the poly adenylation sequence is 90-150 nucleotides in length. In some embodiments, the poly adenylation sequence is 90-160 nucleotides in length. In some embodiments, the polyadenylation sequence is 90-200 nucleotides in length. iv. Linkers
[0307] In some embodiments, the viral genomes are engineered with one or more spacer or linker regions to separate coding and / or non-coding regions. In some embodiments, the transgene of the AAV vector encodes one or more linker sequences. In some embodiments, the linker is a peptide linker that is used to connect the polypeptides encoded by the transgene region (i.e., light and heavy antibody chains during expression). Some peptide linkers are cleaved after expression to separate heavy and light chain domains, allowing assembly of mature antibodies or antibody fragments.
[0308] In some embodiments, linker cleavage is enzy matic. In some embodiments, linkers comprise an enzymatic cleavage site to facilitate intracellular or extracellular cleavage. Some transgene regions encode linkers that interrupt polypeptide synthesis during translation of the linker sequence from an mRNA transcript. Such linkers may facilitate the translation of separate protein domains (e.g.. heavy and light chain antibody domains) from a single transcript. In some embodiments, two or more linkers are encoded by a transgene region of the viral genome.
[0309] In some embodiments, the components of the therapeutic antibody (e.g., VH / VL chains, Fc domain) are encoded by separate nucleotide sequences operably linked via a linker. Linkers suitable for linking nucleotide sequences are known in the art and exemplary linkers are described herein.
[0310] In some embodiments, the transgene comprises a linker comprising furin cleavage sites. Furin is a calcium dependent serine endoprotease that cleaves proteins just downstream of a basic amino acid target sequence (Arg-X-(ArgZLys)-Arg) (Thomas, G., 2002. Nature Reviews Molecular Cell Biology 3(10): 753-66; the contents of which are herein incorporated by reference in its entirety). Furin is enriched in the trans-golgi network where it is involved in processing cellular precursor proteins. Furin also plays a role in activating a number of pathogens. This activity7can be taken advantage of for expression of polypeptides.
[0311] In some embodiments, the transgene encodes a 2A peptide. 2A peptides are small "‘selfcleaving’7peptides (18-22 amino acids) derived from viruses such as foot-and-mouth disease virus (F2A), porcine teschovirus-1 (P2A), Thoseaasigna virus (T2A), or equine rhinitis A virus (E2A). The 2A designation refers specifically to a region of picomavirus polyproteins that lead to a ribosomal skip at the glycyl-prolyl bond in the C-terminus of the 2A peptide (Kim, J.H. et al., 2011. PLoS One 6(4): el8556; the contents of which are herein incorporated by reference in its entirety). This skip results in a cleavage between the 2A peptide and its immediate downstream peptide. As opposed to IRES linkers, 2A peptides generate stoichiometric expression of proteins flanking the 2A peptide and their shorter length can be advantageous in generating viral expression vectors.
[0312] In some embodiments, the 2A peptide comprises F2A. In some embodiments, the F2A peptide comprises VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 139). In some embodiments, the 2A peptide, e.g. the F2A peptide, links the heavy chain and light chains of the antibody.
[0313] In some embodiments, the viral genome comprises an internal ribosomal entry site (IRES). An IRES is a nucleotide sequence (>500 nucleotides) that allows for initiation of translation in the middle of an mRNA sequence (Kim, J.H. et al., 2011. PLoS One 6(4): el 8556; the contents of which are herein incorporated by reference in its entirety). Use of an IRES sequence ensures co-expression of genes before and after the IRES, though the sequence following the IRES may be transcribed and translated at lower levels than the sequence preceding the IRES sequence.
[0314] In some embodiments, the transgene encodes one or more linkers comprising cathepsin, matrix metal lo proteinases or legumain cleavage sites. Such linkers are described e.g., by Cizeau and Macdonald in International Publication No. W02008052322, the contents of which are herein incorporated in their entirety. Cathepsins are a family of proteases with unique mechanisms to cleave specific proteins. Cathepsin B is a cysteine protease and cathepsin D is an aspartyl protease. Matrix metalloproteinases are a family of calcium-dependent and zinc- containing endopeptidases. Legumain is an enzyme catalyzing the hydrolysis of (-Asn-Xaa-) bonds of proteins and small molecule substrates.
[0315] In some embodiments, the transgene encodes a linker that is not cleaved. Such linkers may include a simple amino acid sequence, such as a glycine rich sequence. In some embodiments, linkers comprise flexible peptide linkers comprising glycine and serine residues. Exemplary glycine and glycine-serine linkers include, but are not limited to GGG, GGGG (SEQ ID NO: 140), GGGGS (SEQ ID NO: 141), GGGS (SEQ ID NO: 142). SGGG (SEQ ID NO: 143) and SGGGG (SEQ ID NO: 144). The linker may comprise flexible peptide linkers of different lengths. In some embodiments, the length of the encoded linker is between 5 and 50 amino acids. These flexible linkers are small and without side chains so they tend not to influence secondary protein structure while providing a flexible linker between antibody segments (George. R.A., et al., 2002. Protein Engineering 15(11): 871-9; Huston, J.S. et al., 1988. PNAS 85:5879-83; and Shan, D. et al., 1999. Journal of Immunology . 162(1 1):6589-95; the contents of each of which are herein incorporated by reference in their entirety). Furthermore, the polarity' of the serine residues improve solubility and prevents aggregation problems.
[0316] In some embodiments, transgenes encode small and unbranched serine-rich peptide linkers, such as those described by Huston et al. in US Patent No. US5525491, the contents of which are herein incorporated in their entirety'. In some embodiments, polypeptides encoded by the transgene, linked by serine-rich linkers, have increased solubility’.
[0317] In some embodiments, the transgene encodes an artificial linker, such as those described by Whitlow and Filpula in US Patent No. US5856456 and Ladner et al. in US Patent No. US 4946778, the contents of each of which are herein incorporated by their entirety / . Pay load regions of the AAV vectors may encode polypeptides that form one or more functional antibodies or antibody-based compositions. v. Promoters
[0318] In some embodiments, the transgene of the viral genome comprises at least one element to enhance the transgene target specificity and expression. Non-limiting examples of elements to enhance the transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulator}7elements (PREs), polyadenylation (Poly A) signal sequences and upstream enhancers (USEs), CMV enhancers and introns.
[0319] In some embodiments, the viral genome comprises an engineered promoter. In some embodiments, the viral genome comprises a promoter from a naturally expressed protein.
[0320] In some embodiments, expression of the polypeptides described herein require a specific promoter, including but not limited to, a promoter that is species specific, inducible, tissue-specific, or cell cycle-specific.
[0321] In some embodiments, the promoter drives expression of the polypeptide(s) encoded in the transgene region of the viral genome of the AAV vector. In some embodiments, the promoter drives expression in the cell being targeted.
[0322] In some embodiments, the promoter is naturally occurring. In some embodiments, the promoter is non-naturally occurring. Non-limiting examples of promoters include viral promoters, plant promoters, and mammalian promoters. In some embodiments, the promoters are human promoters. In some embodiments, the promoter is truncated.
[0323] In some embodiments, the promoter is expressed in the central nervous system (CNS). In some embodiments, the promoter is expressed in one or more of neurons, astrocytes, oligodendrocytes, microglia, and ependymal cells. In some embodiments, the promoter is expressed in neurons. In some embodiments, the promoter is expressed in astrocytes. In some embodiments, the promoter is expressed in oligodendrocytes. In some embodiments, the promoter is expressed in microglia. In some embodiments, the promoter is expressed in ependymal cells.
[0324] In some embodiments, the promoter is selected from neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF-P), synapsin (Syn), methyl-CpG binding protein 2 (MeCP2). Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2). neurofilament light (NFL) or heavy (NFH), 0-globin minigene nP2, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2) promoters. In some embodiments, tissue-specific expression elements for astrocytes include glial fibrillary acidic protein (GFAP) and EAAT2 promoters. In some embodiments, the tissue-specific expression element for oligodendrocytes is the myelin basic protein (MBP) promoter. In some embodiments, the tissue-specific expression element is the intemexin neuronal intermediate filament protein alpha (INA) promoter. In some embodiments, the tissue-specific expression element is the nestin (NES) promoter. In some embodiments, the tissue-specific expression elements include the myelin- associated oligodendrocyte basic protein (MOBP) promoter. In some embodiments, the tissuespecific expression element is the tyrosine hydroxylase (TH) promoter. In some embodiments, tissue-specific expression element is the forkhead box A2 (FOXA2) promoter. In some embodiments, the tissue-specific expression element is a promoter of a gene selected from: neuronal nuclei (NeuN), adenomatous polyposis coli (APC), ionized calcium-binding adapter molecule 1 (Iba-1), synapsin I (SYN), calcium / calmodulin-dependent protein kinase II, tubulin alpha I, neuron-specific enolase and platelet-derived growth factor beta chain. In some embodiments, the promoter is a pan-cell type promoter, e.g., cytomegalovirus (CMV), beta glucuronidase, (GUSB), ubiquitin C (UBC), or rous sarcoma virus (RSV) promoter.
[0325] In some embodiments, the promoter is not cell specific. In some embodiments, the promoter is a ubiquitin c (URC) promoter. In some embodiments, the promoter is a P* glucuromdase (GUSB) promoter. In some embodiments, the promoter is a neurofilament light (NFL) promoter. In some embodiments, the promoter is a neurofilament heavy (NFH) promoter.
[0326] In some embodiments, the promoter is a scn8a promoter. In some embodiments, the promoter is a phosphoglycerate kinase 1 (PGK) promoter. In some embodiments, the promoter is a chicken -actin (CBA) promoter. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the promoter is an RNA pol III promoter. As anon- limiting example, the RNA pol III promoter is U6. As a non-limiting example, the RNA pol III promoter is Hl. In some embodiments, the viral genome comprises two promoters. As a nonlimiting example, the promoters are an EFla promoter and a CMV promoter.
[0327] In some embodiments, the promoter is a muscle tissue specific promoter. Exemplary muscle specific promoters include muscle alpha-actin, muscle creatine kinase, myosin heavy chain, skeletal actin, C5-12, and desmin promoters.
[0328] In some embodiments, the promoter is liver-specific. Exemplary liver specific promoters include albumin, alpha! -antitrypsin, transthyretin and hemoplexin promoters.
[0329] In some embodiments, the viral genome composes an enhancer element, a promoter and / or a 5'UTR intron. In some embodiments, the enhancer element, also referred to herein as an "enhancer," may be, but is not limited to, a CMV enhancer. In some embodiments, the promoter may be, but is not limited to, a CMV, CBA, UBC, GUSB, NSE, Synapsin, MeCP2, and GFAP promoter. In some embodiments, the 5'UTR / intron may be, but is not limited to, SV40, and CBA-MVM. As a non-limiting example, the enhancer, promoter and / or intron used in combination may be: (1) CMV enhancer, CMV promoter, SV405'UTR intron, (2) CMV enhancer, CBA promoter, SV 40 5'UTR intron, (3) CMV enhancer, CBA promoter, CBA- MVM 5'UTR intron, (4) UBC promoter; (5) GUSB promoter; (6) NSE promoter; (7) Synapsin promoter, (8) MeCP2 promoter and (9) GFAP promoter.
[0330] In some embodiments, the promoter is less than 1 kb. In some embodiments, the promoter has a length of 200, 210. 220, 230. 240, 250, 260. 270, 280. 290, 300. 310, 320, 330.
[0331] 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520,
[0332] 530, 540, 550, 560, 570, 580, 590. 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710,
[0333] 720, 730, 740, 750, 760, 770, 780, 790, 800, or more than 800 nucleotides. In some embodiments, the promoter has a length between 200-300. 200-400. 200-500. 200-600. 200- 700. 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800, or 700-800 nucleotides.
[0334] In some embodiments, the promoter is a combination of two or more components of the same or different starting or parental promoters such as, but not limited to. CMV and CBA. In some embodiments, each component individually has a length of 200, 210. 220, 230. 240.
[0335] 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381, 382, 383, 384, 385,
[0336] 386, 387, 388, 389, 390, 400, 410. 420, 430, 440, 450. 460, 470, 480, 490, 500, 510, 520, 530,
[0337] 540, 550. 560, 570, 580, 590, 600, 610. 620. 630, 640, 650. 660, 670, 680, 690. 700, 710, 720,
[0338] 730, 740, 750, 760, 770. 780, 790, 800 or more than 800 nucleotides. In some embodiments, each component individually has a length between 200-300, 200-400, 200-500, 200-600. 200- 700, 200- 800. 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700. 600-800 or 700-800 nucleotides.
[0339] In some embodiments, the promoter drives expression of the polypeptides described herein (e.g., an antibody) for a period of time in targeted tissues. In some embodiments, expression driven by a promoter is for a period of 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours. 20 hours, 21 hours, 22 hours, 23 hours. 1 day, 2 days, 3 days. 4 days. 5 days, 6 days, 1 week. 8 days, 9 days, 10 days, 11 days. 12 days. 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months. 14 months, 15 months, 16 months. 17 months, 18 months. 19 months. 20 months, 21 months, 22 months, 23 months, 2 years. 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more than 10 years. In some embodiments, expression is for 1-5 hours, 1-12 hours. 1-2 days, 1-5 days, 1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6 months, 2-6 months, 3-6 months, 3-9 months. 4-8 months, 6-12 months, 1 -2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years, or 5-10 years.
[0340] In some embodiments, the promoter drives expression of the polypeptides described herein (e g., an antibody) for at least 1 month, 2 months, 3 months, 4 months. 5 months, 6 months, 7 months, 8 months. 9 months, 10 months, 11 months, 1 year, 2 years, 3 years 4 years. 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years, 22 years, 23 years, 24 years, 25 years, 26 years, 27 years, 28 years, 29 years, 30 years, 31 years, 32 years, 33 years, 34 years, 35 years, 36 years, 37 years, 38 years, 39 years, 40 years, 41 years, 42 years. 43 years. 44 years, 45 years, 46 years, 47 years, 48 years, 49 years, 50 years, 55 years, 60 years, 65 years, or more than 65 years.
[0341] Methods of Generating AAV Vectors
[0342] The present disclosure provides methods of generating AAV vectors described herein. Methods of making AAV vectors are well known in the art.
[0343] General principles of AAV production are reviewed in. for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbial and Immunol., 158:97-129). Various approaches are described in Ratschin et al , Mol. Cell. Biol. 4:2072 (1984); Hermonat et al, Proc. Natl. Acad. Sci. USA, 81 :6466 (1984); Tratschin et al, Mol. Cell. Biol. 5:3251 (1985); McLaughlin et al, J. Virol, 62: 1963 (1988); and Lebkowski et al, 1988 Mol. Cell. Biol, 7:349 (1988). Samulski et al (1989. J. Virol, 63:3822- 3828); U.S. Patent No. 5, 173,414; WO 95 / 13365 and corresponding U.S. Patent No. 5,658.776 ; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298
[0344] (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al. (1995) Vaccine 13: 1244-1250; Paul et al. (1993) Human Gene Therapy 4:609-615; Clark et al. (1996) Gene Therapy 3: 1124-1132; U.S. Patent. No. 5,786,211; U.S. Patent No. 5,871,982; and U.S. Patent. No. 6,258,595. In some embodiments, the AAV vector is produced using methods described in WO 2017 / 106326; WO 2020 / 081843; or WO 2020 / 223279. In some embodiments, the AAV vector is generated by viral genome replication in a viral replication cell. In some embodiments, a method of generating the AAV vector comprises obtaining a plasmid containing an AAV expression cassette and culturing a packaging cell carrying the plasmid in the presence of sufficient viral sequences to permit packaging of the AAV viral genome into an infectious AAV envelope or capsid.
[0345] In some embodiments, the AAV vectors are produced in mammalian cells.
[0346] In some embodiments, the AAV vectors comprise a viral genome, wherein one or more components are codon-optimized. Codon-optimization is achieved by any method known to one with skill in the art such as, but not limited to, by a method according to Genescript, EMBOSS, Bioinformatics, NUS, NUS2, Geneinfinity. IDT, NUS3. GregThatcher. Insilico, Molbio, N2P, Snapgene, and / or VectorNTI.
[0347] IV. Exemplary Vectorized Antibodies
[0348] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain.
[0349] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half-life in systemic circulation compared to the half-life in the CNS.
[0350] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site.
[0351] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85. In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0352] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, wherein the variant Fc domain decreases the antibody half-life in systemic circulation compared to the half-life in the CNS.
[0353] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0354] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the halflife in the CNS.
[0355] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and or Factor Xa cleavage site.
[0356] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0357] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0358] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0359] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0360] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0361] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0362] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0363] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0364] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0365] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0366] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0367] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85. In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0368] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0369] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0370] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0371] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0372] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0373] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0374] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0375] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0376] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody or antigen binding fragment thereof wherein the therapeutic antibody or fragment thereof comprises, a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0377] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, wherein the variant Fc domain increases antibody degradation outside the CNS.
[0378] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0379] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0380] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0381] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0382] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site, wherein the thrombin cleavage site increases antibody degradation outside the CNS. In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0383] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0384] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site, wherein the thrombin cleavage site increases antibody degradation outside the CNS.
[0385] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0386] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0387] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin and / or Factor Xa cleavage site cleavage site increases antibody degradation outside the CNS.
[0388] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0389] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases susceptibility7to protease degradation outside the CNS.
[0390] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody or antigen binding fragment thereof wherein the therapeutic antibody or fragment thereof comprises, a thrombin cleavage site, wherein the thrombin cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0391] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, wherein the variant Fc domain increases susceptibility to protease degradation outside the CNS.
[0392] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases susceptibility to protease degradation outside the CNS.
[0393] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site, wherein the thrombin cleavage site increases susceptibility to protease degradation outside the CNS.
[0394] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases susceptibility to protease degradation outside the CNS.
[0395] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases susceptibility to protease degradation outside the CNS.
[0396] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for n PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site, wherein the thrombin cleavage site increases susceptibility to protease degradation outside the CNS.
[0397] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases susceptibility- to protease degradation outside the CNS.
[0398] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibodyspecific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases susceptibility to protease degradation outside the CNS.
[0399] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases susceptibility to protease degradation outside the CNS.
[0400] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibodyspecific for aPD-Ll poly peptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases susceptibility7to protease degradation outside the CNS.
[0401] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases susceptibility- to protease degradation outside the CNS.
[0402] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases susceptibility to protease degradation outside the CNS.
[0403] In some embodiments, the AAV vector comprises: a) an AAV capsid, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases susceptibility' to protease degradation outside the CNS.
[0404] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain.
[0405] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0406] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0407] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85. In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0408] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0409] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0410] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the halflife in the CNS.
[0411] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0412] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0413] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0414] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0415] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0416] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0417] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site.
[0418] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0419] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0420] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0421] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0422] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0423] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0424] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0425] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0426] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0427] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0428] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0429] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site.
[0430] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0431] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0432] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0433] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0434] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site, wherein the thrombin cleavage site increases antibody degradation outside the CNS.
[0435] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, wherein the variant Fc domain increases antibody degradation outside the CNS.
[0436] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0437] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0438] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0439] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0440] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0441] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0442] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0443] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0444] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0445] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0446] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0447] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0448] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility to protease degradation outside the CNS.
[0449] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0450] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, wherein the variant Fc domain increases antibody susceptibility to protease degradation outside the CNS.
[0451] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility to protease degradation outside the CNS.
[0452] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0453] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody susceptibility to protease degradation outside the CNS.
[0454] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility to protease degradation outside the CNS.
[0455] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0456] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody susceptibility to protease degradation outside the CNS.
[0457] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility7to protease degradation outside the CNS.
[0458] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0459] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody susceptibility to protease degradation outside the CNS.
[0460] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility7to protease degradation outside the CNS.
[0461] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0462] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 1-68 and SEQ ID NO: 145, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody susceptibility to protease degradation outside the CNS.
[0463] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain.
[0464] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0465] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site.
[0466] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0467] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stabi 1 i ty reducing mutation, wherein the mutation reduces binding to the FcRn.
[0468] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0469] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0470] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the halflife in the CNS.
[0471] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0472] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0473] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability7reducing mutation, wherein the mutation reduces binding to the FcRn.
[0474] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and w herein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0475] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain. In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0476] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0477] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8. and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0478] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0479] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8. and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0480] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0481] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0482] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0483] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85.
[0484] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn. In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0485] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain.
[0486] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0487] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site.
[0488] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site comprising SEQ ID NO: 85. In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn.
[0489] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain decreases the antibody half- life in systemic circulation compared to the half-life in the CNS.
[0490] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0491] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0492] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, wherein the variant Fc domain increases antibody degradation outside the CNS.
[0493] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0494] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0495] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0496] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0497] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0498] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0499] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0500] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0501] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0502] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody degradation outside the CNS.
[0503] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody degradation outside the CNS.
[0504] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody degradation outside the CNS.
[0505] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility to protease degradation outside the CNS.
[0506] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8. and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0507] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody, or antigen binding fragment thereof, wherein the therapeutic antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, wherein the variant Fc domain increases antibody susceptibility to protease degradation outside the CNS.
[0508] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility to protease degradation outside the CNS.
[0509] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0510] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for an immune checkpoint protein, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody susceptibility to protease degradation outside the CNS.
[0511] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility to protease degradation outside the CNS.
[0512] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0513] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody susceptibility to protease degradation outside the CNS.
[0514] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility to protease degradation outside the CNS.
[0515] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for aPD-Ll polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or a Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0516] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a PD-L1 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody susceptibility to protease degradation outside the CNS.
[0517] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a protease sensitive domain, wherein the protease sensitive domain increases antibody susceptibility to protease degradation outside the CNS.
[0518] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a thrombin cleavage site and / or Factor Xa cleavage site, wherein the thrombin cleavage site and / or Factor Xa cleavage site increases antibody susceptibility to protease degradation outside the CNS.
[0519] In some embodiments, the AAV vector comprises: a) an AAV capsid comprising a peptide insert comprising a sequence selected from the group consisting of SEQ ID NOs: 4 and 8, and b) a transgene comprising a nucleotide sequence encoding a therapeutic antibody specific for a CD20 polypeptide, or antigen binding fragment thereof, wherein the antibody or fragment thereof comprises a variant Fc domain comprising at least one stability reducing mutation, wherein the mutation reduces binding to the FcRn, and wherein the variant Fc domain increases antibody susceptibility’ to protease degradation outside the CNS.
[0520] VI. Pharmaceutical Compositions
[0521] In some embodiments, the disclosure provides pharmaceutical compositions comprising an AAV vector described herein. In some embodiments, the methods described herein include the use of pharmaceutical compositions comprising the AAV vector as an active ingredient.
[0522] Pharmaceutical compositions ty pically include a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier" includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
[0523] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, oral, sublingual, nasal, intrathecal, intravitreal, epidural, intravenous, intraarterial, subcutaneous, intraperitoneal intramuscular or injection or infusion administration. In some embodiments, the AAV vector or pharmaceutical composition is administered via a route of administration selected from: parenteral, oral, sublingual, nasal, subcutaneous, intrathecal, intravenous, intravitreal, intra-cistema magna, intracerebroventricular, intraparenchymal. and epidural. Delivery can thus be systemic or localized.
[0524] Methods of formulating suitable pharmaceutical compositions are known in the art, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005; and the books in the series Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY). For example, solutions or suspensions used for parenteral application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0525] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy administration via syringe exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. In some embodiments, the carrier is a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. In some embodiments, proper fluidity is maintained by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0526] In some embodiments, sterile injectable solutions are prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0527] In some embodiments, the AAV compositions are prepared with carriers that will protect the AAV against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques, or obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to selected cells with monoclonal antibodies to cellular antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0528] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals.
[0529] Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, rats, birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.
[0530] In some embodiments, the compositions described herein are administered to humans.
[0531] V. Methods of Use
[0532] Methods of Delivery and Therapy
[0533] In some embodiments, the disclosure provides methods of delivering any composition described herein. In some embodiments, the disclosure provides methods of delivering an AAV vector described herein to a target tissue, e.g., to the central nervous system (brain). In some embodiments, the disclosure provides a method of delivering a therapeutic antibody to one or more tissues of the central nervous system. In some embodiments, one or more tissues of the central nervous system include one or more tissues of the brain. In some embodiments, one or more tissues of the brain include cortex, cerebellum, hippocampus, substantia nigra, amygdala. In some embodiments, the methods include delivery to neurons, astrocytes, oligodendrocytes, and glial cells.
[0534] In some embodiments, the compositions and methods are used to treat brain cancer. Brain cancers include gliomas (e.g.. glioblastoma multiforme (GBM)). metastases (e.g.. from lung, breast, melanoma, or colon cancer), meningiomas, pituitary7adenomas, primary CNS lymphomas, secondary' CNS lymphomas, and acoustic neuromas.
[0535] In some embodiments, the disclosure provides a method of delivering a therapeutic antibody to a tissue of interest, wherein the method comprises administering an AAV vector described herein to a subject. In some embodiments, the disclosure provides a method of delivering a therapeutic antibody to the CNS, wherein the method comprises administering an AAV vector described herein to a subject. In some embodiments, the disclosure provides a method of delivering a therapeutic antibody to skeletal muscle, wherein the method comprises administering an AAV vector described herein to a subject. In some embodiments, the disclosure provides a method of delivering a therapeutic antibody to cardiac muscle, wherein the method comprises administering an AAV vector described herein to a subject. In some embodiments, the disclosure provides a method of delivering a therapeutic antibody to myocytes, wherein the method comprises administering an AAV vector described herein to a subject. In some embodiments, the disclosure provides a method of delivering a therapeutic antibody to the liver, wherein the method comprises administering an AAV vector described herein to a subject
[0536] In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in target tissue, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in target tissue, and wherein the therapeutic antibody is degraded in non-target tissue. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in target tissue, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody^ is expressed in target tissue, and wherein the therapeutic antibody is degraded in systemic circulation. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in target tissue, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in target tissue, and wherein the therapeutic antibody is degraded in peripheral tissue. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in the CNS, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in the CNS, and wherein the therapeutic antibody is degraded in non-target tissue. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in the CNS, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in the CNS, and wherein the therapeutic antibody is degraded in systemic circulation. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in the CNS, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in the CNS, and wherein the therapeutic antibody is degraded in peripheral tissue.
[0537] In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in skeletal tissue, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in skeletal muscle, and wherein the therapeutic antibody is degraded in non-target tissue. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in skeletal tissue, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in skeletal muscle, and wherein the therapeutic antibody is degraded in systemic circulation. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in skeletal tissue, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in skeletal muscle, and wherein the therapeutic antibody is degraded in peripheral tissue. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in cardiac muscle, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in cardiac muscle, and wherein the therapeutic antibody is degraded in non-target tissue. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in cardiac muscle, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in cardiac muscle, and wherein the therapeutic antibody is degraded in systemic circulation. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in cardiac muscle, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in cardiac muscle, and wherein the therapeutic antibody is degraded in peripheral tissue. In some embodiments, the disclosure provides a method of expressing a therapeutic antibody in the liver, wherein the method comprises administering an AAV vector described herein to a subject, wherein the therapeutic antibody is expressed in the liver, and wherein the therapeutic antibody is degraded in peripheral tissue.
[0538] In some embodiments, the AAV vectors are useful in the field of medicine for the treatment, prophylaxis, palliation, or amelioration of neurological diseases and / or disorders. The present disclosure provides a method for administering to a subject in need thereof, including a human subject, a therapeutically effective amount of the AAV vectors of the disclosure to slow, stop, or reverse disease progression. As a nonlimiting example, disease progression may be measured by tests or diagnostic tool(s) known to those skilled in the art. As another non-limiting example, disease progression may be measured by change in the pathological features of the brain, CSF, or other tissues of the subject.
[0539] The present disclosure additionally provides a method for treating non-infectious diseases and / or disorders in a mammalian subject, including a human subject, comprising administering to the subject any of the AAV vectors or pharmaceutical compositions of the disclosure. In some embodiments, non-infectious diseases and / or disorders treated according to the methods described herein include, but are not limited to, Parkinson’s Disease (PD). Dementia with Lewy Bodies (DLB), Multiple System Atrophy (MS A), decreased muscle mass, spinal muscular atrophy (SMA) Alzheimer’s disease (AD), Amyotrophic lateral sclerosis (ALS), Huntington's Disease (HD), multiple sclerosis (MS), stroke, migraine, pain, neuropathies, psychiatric disorders including schizophrenia, bipolar disorder, and autism, cancer, immune system and autoimmune diseases and inflammatory diseases.
[0540] In some embodiments, methods of treating non-infectious diseases and / or disorders in a subject in need thereof comprise the steps of: (1) deriving, generating and / or selecting an antibody, antibody-based composition or fragment thereof that targets the antigen of interest; (2) producing an AAV vector with a viral genome that includes a transgene region encoding the selected antibody of (1); and (3) administering the AAV vector (or pharmaceutical composition thereof) to the subject. In some embodiments, the antibody or fragment thereof comprises a stability reducing mutation as described herein.
[0541] In some embodiments, a therapeutically effective amount of the AAV vector is administered to a subject. In some embodiments, the effective amount to be employed therapeutically will depend, for example, upon the therapeutic context and objectives. One skilled in the art will appreciate that the appropriate dosage levels for treatment, according to some embodiments, will thus vary depending, in part, upon the molecule delivered, the indication for which the AAV vector is being used, the route of administration, and the size (body weight, body surface or organ size) and / or condition (the age and general health) of the subject. In some embodiments, the clinician can titer the dosage and modify the route of administration to obtain the optimal therapeutic effect.
[0542] In some embodiments, a therapeutically effective amount of AAV vector inhibits and / or prevents a particular disorder, and / or the symptoms of the disorder.
[0543] In some embodiments, the concentration of the therapeutic AAV vector (e.g. therapeutic antibody) is higher in the tissue of interest relative to the concentration in systemic circulation. In some embodiments, the disclosure provides a method for expressing an antibody in a tissue of the central nervous system. In some embodiments, the antibody expressed outside the CNS or antibody which escapes the CNS is degraded such that the antibody is selectively expressed in the central nervous system. In some embodiments, the concentration of the therapeutic AAV vector (e.g. therapeutic antibody) is higher in the CNS relative to the concentration in systemic circulation. In some embodiments, the therapeutic antibody is degraded and / or metabolized rapidly outside the tissue of interest. In some embodiments, the therapeutic antibody is degraded and / or metabolized rapidly outside the CNS.
[0544] In some embodiments, the disclosure provides a method for expressing an antibody in muscle tissue. In some embodiments, the antibody expressed outside the muscle tissue or antibody which escapes the muscle tissue is degraded such that the antibody is selectively expressed in muscle tissue. In some embodiments, the concentration of the therapeutic AAV vector (e.g., therapeutic antibody) is higher in the muscle tissue relative to the concentration in systemic circulation. In some embodiments, the therapeutic antibody is degraded and / or metabolized rapidly outside the muscle tissue.
[0545] In some embodiments, the disclosure provides a method for expressing an antibody in the liver. In some embodiments, the antibody expressed outside the liver or antibody which escapes the liver is degraded such that the antibody is selectively expressed in the liver. In some embodiments, the concentration of the therapeutic AAV vector (e.g., therapeutic antibody) is higher in the liver relative to the concentration in systemic circulation. In some embodiments, the therapeutic antibody is degraded and / or metabolized rapidly outside the liver.
[0546] In some embodiments, the disclosure provides a method of reducing stability of an antibody in a peripheral tissue or in systemic circulation, comprising administering to a subject an AAV vector to a target tissue (e.g. the CNS, muscle or liver), wherein the antibody is expressed in the target tissue, wherein the antibody leaves the target tissue and enters the peripheral tissue or systemic circulation, and wherein the stability of the antibody is reduced in the peripheral tissue or systemic circulation compared to an antibody not having at least one stability- reducing mutation. In some embodiments, the disclosure provides a method of reducing stability of an antibody in a the lymphatic system, comprising administering to a subject an AAV vector to a target tissue (e.g. the CNS, muscle or liver), wherein the antibody is expressed in the target tissue, wherein the antibody leaves the target tissue and enters the lymphatic system, and wherein the stability- of the antibody is reduced in the lymphatic system compared to an antibody not having at least one stability reducing mutation.
[0547] In some embodiments, the disclosure provides a method of reducing stability of an antibody in a peripheral tissue, comprising administering to a subject an AAV vector to the central nervous system, wherein the antibody is expressed in the central nervous system, wherein the antibody crosses the blood-brain barrier and enters the peripheral tissue, and wherein the stability of the antibody is reduced in the peripheral tissue compared to an antibody not having at least one stability reducing mutation.
[0548] In some embodiments, the disclosure provides a method of reducing stability of an antibody in a peripheral tissue or in systemic circulation, comprising administering to a subject an AAV vector to a target tissue (e.g. the CNS, muscle or liver), wherein the antibody is expressed in the target tissue, wherein the antibody leaves the target tissue and enters the peripheral tissue or systemic circulation, and wherein the stability of the antibody is reduced in the peripheral tissue or systemic circulation compared to an antibody not having at least protease sensitive domain.
[0549] In some embodiments, the disclosure provides a method of reducing stability of an antibody in a peripheral tissue, comprising administering to a subject an AAV vector to the central nervous system, wherein the antibody is expressed in the central nervous system, wherein the antibody crosses the blood-brain barrier and enters the peripheral tissue, and wherein the stability of the antibody is reduced in the peripheral tissue compared to an antibody not having at least one protease sensitive domain.
[0550] In some embodiments, the AAV vectors described herein are delivered to a target tissue. In some embodiments, the AAV vectors described herein are delivered to the CNS. In some embodiments, the AAV vectors described herein are delivered to muscle tissue. In some embodiments, the disclosure provides a method of administering an AAV vector or pharmaceutical composition comprised herein to a tissue of interest. In some embodiments, the disclosure provides a method of administering an AAV vector or pharmaceutical composition comprised herein to the CNS. In some embodiments, the disclosure provides a method of administering an AAV vector or pharmaceutical composition comprised herein to muscle tissue. In some embodiments, the disclosure provides a method of administering an AAV vector or pharmaceutical composition comprised herein to the liver.
[0551] In some embodiments, the disclosure provides methods for providing a therapeutic antibody to a tissue of interest and reducing stability of the therapeutic antibody in systemic circulation, the method comprising administering to the subject an AAV vector described herein, or a pharmaceutical composition described herein.
[0552] In some embodiments, the AAV vectors are delivered to the CNS by direct administration. In some embodiments, the AAV vectors are administered to the cistemamagna, intraventricular space, brain ventricle, subarachnoid space, intrathecal space, or ependyma. In some embodiments, the AAV vectors are administered to the cerebral spinal fluid. In some embodiments, the AAV vectors are administered to one or more of the rostral lateral ventricle, the caudal lateral ventricle, the right lateral ventricle, the left lateral ventricle, the right rostral lateral ventricle, the left rostral lateral ventricle, the right caudal lateral ventricle, or the left caudal lateral ventricle. In some embodiments, the AAV vectors are delivered using stereotactic injection.
[0553] In some embodiments. AAV vectors are administered such that the vectors contact a neuron, astrocyte, oligodendrocyte, microglia, or ependymal cell. In some embodiments, the cells in contact with the AAV vector express the transgene (e.g. an antibody) encoded by the AAV vector. In some embodiments, the viral genome comprising a transgene is distributed in one or more of the lateral ventricle. CSF, striatum, thalamus, medulla, cerebellum, occipital cortex, and prefrontal cortex.
[0554] In some embodiments, the AAV vectors are delivered systemically. For example, in some embodiments, the AAV vectors are administered through intravenous injection. In some embodiments, the AAV vectors are administered through subcutaneous injection. In some embodiments, the AAV vectors are administered through intramuscular injection. In some embodiments, the AAV vectors are administered through intravenous infusion. In some embodiments, the systemically delivered AAV vectors are capable of crossing the blood brain barrier.
[0555] Cancer
[0556] Cancer is a group of more than 100 diseases associated w ith abnormal division and cell growth with characteristic spreading in the body. Cancer is caused by failure of tissue growth regulation. Genes associated with cancer include oncogenes, that promote cell growth and reproduction, and tumor suppressor genes, that inhibit cell division. Oncogenes include, but Ill are not limited to, growth factors, receptor and cytoplasmic tyrosine kinases, transcription factors, serine / threonine kinases and regulatory GTPases.
[0557] In some embodiments, methods of the present disclosure are used to treat subjects suffering from a cancer. In some embodiments, methods of the present disclosure are used to treat subjects suspected of developing a cancer.
[0558] In some embodiments, the cancer is leptomeningial metastases, glioma (e.g. glioblastoma), astrocytoma, oligodendroglioma, meningioma, medulloblastoma, schwannoma, ganglioma, craniopharyngioma, pituitary tumors, primary CNS lymphoma, secondary CNS lymphoma, or ependymoma. In some embodiments, the cancer is a cancer of the CNS. In some embodiments, the cancer is a brain cancer.
[0559] Therapies associated with cancer treatment include surgery, chemotherapy, radiation and antibody therapies. Antibodies for treatment and / or prevention of cancers have been on the market for nearly two decades, and are considered one of the most important strategies for treatment of malignancies and solid tumors. A number of cancer-associated antigens have been identified for treatment of cancers. In some embodiments, antibodies targeting such antigens are used to diagnose, prevent and / or treat the associated cancers (see. e.g. Scott et al, 2012. Nature Reviews Cancer 12, 278-287, and references therein). In some embodiments, the antibodies described herein target immune checkpoint proteins to prevent and / or treat cancer. In some embodiments, the antibodies described herein are immune checkpoint inhibitors.
[0560] Some solid cancer tumors are associated with expressed glycoproteins antigens. Such antigens include, but are not limited to, EPCAM (Epithelial cell adhesion molecule), CEA (Carcinoembryonic antigen), gpA33 (Glycoprotein A33 (Transmembrane)), mucins, TAG-72 (Tumor-associated glycoprotein 72), CAIX (Carbonic anhydrase IX), PSMA (Prostate-specific membrane antigen), and FBP (Folate-binding protein). Antibodies targeting the expressed glycoproteins may be used to treat associated tumors.
[0561] Some solid cancer tumors are associated with growth factor and differentiation signaling associated antigens. Such antigens include, but are not limited to, EGFR / ERBB1 / HER1 (epidermal growth factor receptor 1). ERBB2 (epidermal growth factor receptor 2). ERBB3 (epidermal growth factor receptor 3), MET (Tyrosine-Protein Kinase Met). IGF 1R (insulin-like growth factor 1 receptor), EPHA3 (EPH Receptor A3), TRAILR1, (Death receptor 4), and (Receptor activator of nuclear factor kappa-B ligand).
[0562] Some cancer tumors are associated with antigens of stromal and extracellular matrix. Such antigens include, but are not limited to, tenascin and FAP (Fibroblast Activation Protein, Alpha). In some embodiments, glioma are treated with vectorized antibodies targeting the stromal and extracellular matrix.
[0563] Some cancer tumors are associated with glycolipid antigens. Such antigens include, but are not limited to, gangliosides, such as GD2, GD3, and GM2 (monosialotetrahexosylganglioside 2). In some embodiments, cancers treated with antibodies targeting the glycolipid antigens include, but are not limited to neuroectodermal tumors (tumors of the central and peripheral nervous system).
[0564] The vasculature of solid tumors is abnormal, compared to normal vasculature. Antigens supporting the formation of abnormal microvasculature and progress of cancer include, but are not limited to, VEGF (Vascular endothelial growth factor), VEGFR (vascular endothelial growth factor receptor), integrin aVb3 and integrin a5bl. Antibodies targeting such antigens may be used to treat a number of solid tumors such as, but not limited to, CNS tumors by preventing the formation of abnormal vasculature.
[0565] In some embodiments, methods of the present disclosure are used for immunooncology applications. AAV vectors or pharmaceutical compositions of the present disclosure are used to develop an immunotherapy or as an immunotherapy in treatment of a subject suffering from cancer. Non-limiting examples of include active, passive or hybrid immunotherapies, checkpoint blockade, adoptive cell transfer (ACT), cancer vaccines, CAR or CAR-T therapies, dendritic cell therapy, stem cell therapies, natural killer (NK) cell-based therapies, and interferon or interleukin based methods.
[0566] In some embodiments, AAV vectors and methods of using the AAV vectors described in the present disclosure are used to prevent, manage and / or treat cancer.
[0567] VII. Kits
[0568] In some embodiments, the disclosure provides a kit comprising an AAV vector described herein. In some embodiments, a kit includes an AAV vector as disclosed herein, and instructions for use. In some embodiments, the kits comprise, in a suitable container, an AAV vector described herein, one or more controls, and various buffers, reagents, enzymes and other standard ingredients known in the art.
[0569] The container can include at least one vial, well, test tube, flask, bottle, syringe, or other container means, into which an AAV vector may be placed, and in some instances, suitably aliquoted. Where an additional component is provided, the kit can contain additional containers into which this component may be placed. The kits can also include a means for containing an AAV vector and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained. Containers and / or kits can include labeling with instructions for use and / or warnings.
[0570] In some embodiments, a kit comprises a container comprising an AAV vector and a pharmaceutically acceptable carrier, or a pharmaceutical composition comprising the AAV vector, and instructions for treating or delaying progression of cancer or reducing or inhibiting tumor growth in a subject in need thereof. In some embodiments, a kit comprises a container comprising an AAV vector and a pharmaceutically acceptable carrier, or a pharmaceutical composition comprising the AAV vector, and instructions for administering the AAV vector to a subject in need thereof, alone or in combination with another agent, for treating or delaying progression of cancer or reducing or inhibiting tumor growth in the subject.
[0571] EXAMPLES
[0572] Example 1: Degradation of Antibodies Comprising a Protease Sensitive Domain
[0573] Antibodies engineered to have a protease sensitive domain were generated. Specifically, fully intact antibodies or antigen binding fragments were engineered to have a thrombin cleavage site or a Factor Xa cleavage site, in a location that does not modulate the structure or function of the antibody or antigen binding fragment (e.g., hinge region or linker domains). In some cases, the antibody was engineered to have both a thrombin cleavage site or a Factor Xa cleavage site, which were optionally connected by a linker.
[0574] In vitro Antibody Degradation Assay
[0575] Degradation of the antibodies described herein comprising a protease sensitive domain is measured using an antibody binding assay. First, the AAV vector encoding a therapeutic antibody (e.g. an immune checkpoint inhibitor comprising a protease sensitive domain) is transduced into cells in vitro. The cells are separated into treatment groups comprising control or a protease (e.g. thrombin or Factor Xa). Following administration of the protease, supernatant is collected and incubated with immobilized antigen (e.g., an immune checkpoint protein that is the target of the therapeutic antibody). A secondary antibody is used to measure therapeutic antibody bound to the antigen. The ratio of bound antigen in the control versus protease treated groups are compared to determine the relative amount of functional antibody. In vivo Antibody Degradation
[0576] Degradation of the antibodies described herein comprising a protease sensitive domain was measured in vivo comparing the concentration of antibody in the target tissue to that in systemic circulation. Specifically, animals were administered AAV vector encoding a therapeutic antibody (e.g. an immune checkpoint inhibitor comprising a protease sensitive domain) to the central nervous system (e.g. via intrathecal injection). Following administration, blood samples were collected, and brain, liver and heart tissue was collected from each animal. The amount of antibody was measured in the heart, liver and brain tissue and blood (e.g, the serum or plasma) using methods known in the art. The relative amount of antibody was compared between the target tissue, and in systemic circulation.
[0577] Sample is also collected to measure full length antibody to that of antibody fragments in the target tissue (CNS) and systemic circulation using methods known in the art. The ratio of full-length antibody to antibody fragments is determined for target tissue and systemic circulation.
[0578] The experimental protocol and results are provided in Example 3. below.
[0579] Example 2: Reduced FcRn binding Antibodies
[0580] Antibodies engineered to have a variant Fc domain with reduced binding to FcRn w eregenerated. Specifically, amino acid substitutions in the Fc domain were evaluated for reduced binding to FcRn and used to generate therapeutic antibodies with the variant Fc domain.
[0581] In vitro Antibody Binding Assay
[0582] Reduced binding of the antibodies described herein comprising a variant Fc domain to reduce binding of FcRn is measured using an in vitro antibody binding assay. First, the AAV vector encoding a therapeutic antibody (e.g.. an immune checkpoint inhibitor comprising one or more Fc mutations to reduce FcRn binding) or a control antibody (e.g., an immune checkpoint inhibitor without Fc mutations) are transduced into cells in vitro. Supernatant comprising secreted antibody is then incubated with immobilized FcRn. The amount of bound antibody is determined for each group to measure inhibition of FcRn binding in vitro.
[0583] In vivo Antibody Binding Assay
[0584] Reduced binding of the antibodies described herein comprising a variant Fc domain to reduce binding of FcRn is measured using an antibody binding assay. Specifically, animals are administered AAV vector encoding a therapeutic antibody (e.g., an immune checkpoint inhibitor comprising one or more Fc mutations to reduce FcRn binding) or a control antibody (e.g., an immune checkpoint inhibitor without Fc mutations) to the central nervous system (e.g, via intrathecal injection). Following administration, blood samples are collected, and brain tissue is collected from each animal. The amount of antibody is measured in the brain tissue and blood (e.g., the serum or plasma) using methods known in the art. FcRn prevents degradation of antibodies to which it is bound, so antibodies with inhibited binding have increased antibody degradation. The relative amount of antibody is compared between the target tissue, and in systemic circulation using methods known in the art. Sample is also collected to measure full length antibody to that of antibody fragments ...
Claims
CLAIMSWhat is claimed is:
1. An adeno-associated viral (AAV) vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in a tissue of interest, or antigen binding fragment thereof, wherein the therapeutic antibody comprises a sequence motif which increases susceptibility of the therapeutic antibody, or antigen binding fragment thereof, to protease degradation in systemic circulation.
2. The AAV vector of claim 1, wherein the sequence motif is 2-50 amino acids.
3. The AAV vector of claim 1 or 2, wherein the sequence motif comprises a protease sensitive domain.
4. The AAV vector of claim 3. wherein the protease sensitive domain is recognized by a protease active in systemic circulation.
5. The AAV vector of any one of claims 1-4, wherein the protease is a human protease.
6. The AAV vector of claim 4 or 5, wherein the protease cleaves the therapeutic antibody, or antigen binding fragment thereof, thereby degrading the therapeutic antibody, or antigen binding fragment thereof.
7. The AAV vector of any one of claims 4-6, wherein the protease is active at higher levels in systemic circulation relative to activity in the tissue of interest.
8. The AAV vector of any one of claims 1-7, wherein increased susceptibility of the therapeutic antibody to protease degradation is relative to an antibody without the sequence motif.
9. The AAV vector of any one of claims 1-8, wherein the sequence motif comprises a thrombin cleavage site.
10. The AAV vector of claim 9. wherein the thrombin cleavage site comprises an amino acid sequence selected from LVPRG (SEQ ID NO: 86). LVPRGS (SEQ ID NO: 85). QVRLG (SEQ ID NO: 87), GVYARVTA (SEQ ID NO: 88), MKSRNL (SEQ ID NO: 89), RCKPVN (SEQ ID NO: 90), SSKYPN (SEQ ID NO: 91), NTLPRTFGG (SEQ ID NO: 92), SPIVKSFN (SEQ ID NO: 93) and SRGSLDPRSFLLRNPNDKYEPFWEDEE (SEQ ID NO: 94).
11. The AAV vector of any one of claims 1-8. wherein the sequence motif comprises a Factor Xa cleavage site.
12. The AAV vector of claim 11, wherein the Factor Xa cleavage site comprises an amino acid sequence selected from IEGR (SEQ ID NO: 95), IEGRGH (SEQ ID NO: 96), IEGRGIP (SEQ ID NO: 97), IEGRISE (SEQ ID NO: 98), IQGR (SEQ ID NO: 99), SGLSRIVN (SEQ ID NO: 100), and GVYARVTA (SEQ ID NO: 88).
13. The AAV vector of any one of claims 1-12, wherein the sequence motif comprises a thrombin cleavage site and a Factor Xa cleavage site.
14. The AAV vector of claim 13, wherein the thrombin cleavage site and the Factor Xa cleavage site are operably linked via linker.
15. The AAV vector of claim 14, wherein the linker comprises a glycine or glycine-serine linker that is 3-6 amino acids in length.
16. The AAV vector of any one of claim 1-15. wherein the therapeutic antibody comprises an Fc domain, and wherein the Fc domain comprises the sequence motif.
17. The AAV vector of any one of claims 1-15, wherein the therapeutic antibody comprises a hinge region, and wherein the hinge region comprises the sequence motif.
18. The AAV vector of claim 17, wherein the hinge region comprises a sequence of RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112), or a sequence having between 1-5 insertions, deletions or substitutions relative thereto and wherein the sequence motif is inserted between amino acids 7 and 8 with respect to SEQ ID NO: 112.
19. The AAV vector of any one of claims 16-18, wherein the sequence motif is operably linked to the hinge region or Fc domain via an N-terminal linker, a C-terminal linker, or both.
20. The AAV vector of claim 19, wherein the linker comprises a glycine or glycine-serine linker, optionally wherein the linker is selected from the group consisting of GGG, GGGG (SEQ ID NO: 140), GGGGS (SEQ ID NO: 141), GGGS (SEQ ID NO: 142). SGGG (SEQ ID NO: 143) and SGGGG (SEQ ID NO: 144).
21. The AAV vector of any one of claims 1 -20, wherein the therapeutic antibody comprises a variable heavy (VH) chain and a variable light (VL) chain.
22. The AAV vector of claim 21 , wherein the therapeutic antibody is a fragment comprising the VH and VL chains.
23. The AAV vector of claim 22, wherein the VH and VL chains are operatively linked via a linker.
24. The AAV vector of claim 23, wherein the linker comprises the sequence motif.
25. The AAV vector of any one of claims 1-24, wherein the therapeutic antibody is a single chain variable fragment (scFv), IgG, a diabody, a minibody, a Fab’ fragment, a F(ab’)2 fragment, a bispecific Fab dimer (Fab2), a trispecific Fab trimer (Fab3), an Fv, a bis-scFv, (scFv)2, a Camel Ig, a VHH, an Ig NAR, a triabody, a tetrabody, a disulfide stabilized Fv protein C’dsFv”). or a single-domain antibody (sdAb).
26. An AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in a tissue of interest, wherein the therapeutic antibody comprises a variant Fc domain which has reduced binding to a neonatal Fc receptor (FcRn).
27. The AAV vector of claim 26, wherein the variant Fc domain comprises at least one amino acid deletion, at least one amino acid substitution, at least one amino acid insertion, or any combination thereof.
28. The AAV vector of claim 27, wherein the amino acid deletion, substitution or insertion occurs at one or more of amino acid residues K246, P247, K248, D249, L251, M252, 1253, S254, R255, T256, P257, E258, V279, D280, V282, E283, V284, H285, N286, A287, K288, V305, L306, T307, V308, L309, H310, Q311, D312, W313, N315, K317, A339, K340, G341, P374, D376, A378, E380, E382, S383, N384, G385, Q386, P387, N389, S426, V427, H429, E430, A431, L432, H433, N434, H435, Y436, T437, and Q438, according to EU numbering.
29. The AAV vector of claim 27, wherein the variant Fc domain comprises at least one amino acid substitution at one or more amino acid residues selected from K246, P247, K248, D249, L251, M252, 1253, S254, R255, T256. P257, E258, V279, D280, V282, E283, V284, H285, N286. A287, K288. V305, L306, T307, V308, L309. H310, Q311. D312, W313, N315, K317, A339, K340, G341, P374, D376, A378, E380, E382, S383, N384, G385, Q386, P387, N389, S426, V427, H429, E430, A431, L432, H433, N434, H435, Y436, T437, and Q438, according to EU numbering.
30. The AAV vector of any one of claims 26-29. wherein the therapeutic antibody comprises a VH chain and a VL chain.
31. The AAV vector of any one of claims 26-30, wherein the therapeutic antibody has increased susceptibility to proteolytic cleavage compared to an antibody without the variant Fc domain.
32. The AAV vector of any one of claims 26-31. wherein the therapeutic antibody comprises a sequence motif which increases susceptibility of the therapeutic antibody to protease degradation in systemic circulation.
33. The AAV vector of claim 32, wherein the sequence motif is 2-50 amino acids.
34. The AAV vector of claim 32 or 33, wherein the sequence motif comprises a protease sensitive domain.
35. The AAV vector of claim 34, wherein the protease sensitive domain is recognized by a protease active in systemic circulation.
36. The AAV vector of claim 35, wherein the protease is a human protease.
37. The AAV vector of claim 35 or 36, wherein the protease cleaves the therapeutic antibody thereby degrading the therapeutic antibody.
38. The AAV vector of any one of claims 35-37, wherein the protease is active at higher levels in systemic circulation relative to activity in the tissue of interest.
39. The AAV vector of any one of claims 26-38, wherein increased susceptibility of the therapeutic antibody to protease degradation is relative to an antibody without the sequence motif.
40. The AAV vector of any one of claims 26-39, wherein the sequence motif comprises a thrombin cleavage site.
41. The AAV vector of claim 40, wherein the thrombin cleavage site comprises an amino acid sequence selected from the group consisting of LVPRG (SEQ ID NO: 86), LVPRGS (SEQ ID NO: 85), QVRLG (SEQ ID NO: 87), GVYARVTA (SEQ ID NO: 88), MKSRNL (SEQ ID NO: 89), RCKPVN (SEQ ID NO: 90), SSKYPN (SEQ ID NO: 91), NTLPRTFGG (SEQ ID NO: 92), SPIVKSFN (SEQ ID NO: 93) and SRGSLDPRSFLLRNPNDKYEPFWEDEE (SEQ ID NO: 94).
42. The AAV vector of any one of claims 26-39, wherein the sequence motif comprises a Factor Xa cleavage site.
43. The AAV vector of claim 42, wherein the Factor Xa cleavage site comprises an amino acid sequence selected from the group consisting of IEGR (SEQ ID NO: 95), IEGRGH (SEQ ID NO: 96), IEGRGIP (SEQ ID NO: 97), IEGRISE (SEQ ID NO: 98), IQGR (SEQ ID NO: 99), SGLSRIVN (SEQ ID NO: 100), and GVYARVTA (SEQ ID NO: 88).
44. The AAV vector of any one of claims 26-43, wherein the sequence motif comprises a thrombin cleavage site and a Factor Xa cleavage site.
45. The AAV vector of claim 44, wherein the thrombin cleavage site and the Factor Xa cleavage site are operably linked via linker.
46. The AAV vector of claim 45, wherein the linker comprises a glycine or glycine-serine linker that is 3-6 amino acids in length.
47. The AAV vector of any one of claims 26-46, wherein the variant Fc domain comprises the sequence motif.
48. The AAV vector of any one of claims 26-46. wherein the therapeutic antibody comprises a hinge region, and wherein the hinge region comprises the sequence motif.
49. The AAV vector of claim 48, wherein the hinge region comprises a sequence of RVEPKSCDKTHTCPPCPAPEFEGGPSVF (SEQ ID NO: 112), or a sequence having between 1-5 insertions, deletions or substitutions relative thereto, and wherein sequence motif is inserted between amino acids 7 and 8 with respect to SEQ ID NO: 112.
50. The AAV vector of any one of claims 47-49, wherein the sequence motif is operably linked to the variant Fc domain or the hinge region via an N-terminal linker, a C-terminal linker, or both.
51. The AAV vector of claim 50, wherein the linker comprises a glycine or glycine-serine linker, optionally wherein the linker is selected from the group consisting of GGG, GGGG (SEQ ID NO: 140), GGGGS (SEQ ID NO: 141), GGGS (SEQ ID NO: 142). SGGG (SEQ ID NO: 143) and SGGGG (SEQ ID NO: 144).
52. The AAV vector of any one of claims 32-51 , wherein the sequence motif and the variant Fc domain act synergistically to reduce concentration of the therapeutic antibody in circulation.
53. The AAV vector of any one of claims 1-52, wherein the tissue of interest is a tissue of the central nervous system (CNS).
54. The AAV vector of any one of claims 1-53, wherein the tissue of interest is muscle or liver.
55. The AAV vector of any one of claims 1-54, wherein the therapeutic antibody is an immune checkpoint inhibitor antibody.
56. The AAV vector of claim 55, wherein the immune checkpoint inhibitor antibody is an anti-PDl, an anti-PD-Ll, an anti-CTLA4, an anti-LAG3, an anti-TIM3, an anti-BTLA, an anti- GITR, an anti-TIGIT, an anti-VISTAS, an anti-ICOS, an anti-ICOSL, an anti-OX40, an anti- B7H3, an anti-B7H4, an anti-CD47, an anti-4-1 BB, an anti-CD27, or an anti-CD70, antibody.
57. The AAV vector of claim 56, wherein the immune checkpoint inhibitor antibody is an anti-PDl or an anti-PD-Ll antibody.
58. An AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in the CNS. or an antigen binding fragment thereof, wherein the therapeutic antibody is an anti-PDl or an anti-PD-Ll antibody, or antigen binding fragment thereof, and wherein the therapeutic antibody, or antigen binding fragment thereof, comprises one or more protease sensitive domains recognized by thrombin and / or Factor Xa.
59. An AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in the CNS, wherein the therapeutic antibody is an anti-PDl or an anti- PD-Ll antibody, and wherein the therapeutic antibody comprises a variant Fc domain comprising at least one amino acid substitution, wherein the variant Fc domain has reduced binding affinity to a FcRn.
60. The AAV vector of claim 59, wherein the anti-PD-Ll antibody comprises one or more protease sensitive domains recognized by thrombin and / or Factor Xa.
61. The AAV vector of any one of claims 57-60, wherein the anti-PD-Ll antibody is atezolizumab, durvalumab, avelumab, or envafolimab.
62. The AAV vector of any one of claims 57-60, wherein the anti-PDl antibody is nivolumab, pembrolizumab, or cemiplimab.
63. The AAV vector of any one of claims 1-54, wherein the therapeutic antibody is an anti- CD20 antibody, or fragment thereof.
64. An AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in the CNS. or an antigen binding fragment thereof, wherein the therapeutic antibody is an anti-CD20 antibody, or antigen binding fragment thereof, and wherein the therapeutic antibody, or antigen binding fragment thereof, comprises one or more protease sensitive domains recognized by thrombin and / or Factor Xa.
65. An AAV vector comprising an AAV capsid and a viral genome, wherein the viral genome comprises a transgene comprising a nucleotide sequence encoding a therapeutic antibody for expression in the CNS, wherein the therapeutic antibody is an anti-CD20 antibody, and wherein the therapeutic antibody comprises a variant Fc domain comprising at least one amino acid substitution, wherein the variant Fc domain has reduced binding affinity to a FcRn.
66. The AAV of claim 65, wherein the anti-CD20 antibody comprises one or more protease sensitive domains recognized by thrombin and / or Factor Xa.
67. The AAV vector of any one of claims 63-66, wherein the anti-CD20 antibody is rituximab, Obinutuzumab, ofatumumab, ibritumomab, ocrelizumab, tositumomab, veltuzumab, GA101, TRU-015, or PRO131921.
68. The AAV vector of any one of claims 1-67, wherein the AAV capsid is an AAV9 capsid.
69. The AAV vector of claim 68, wherein the AAV9 capsid comprises an amino acid sequence at least 90% identical to SEQ ID NO: 101.
70. The AAV vector of any one of claims 1-69, wherein tropism of the AAV vector is for the CNS.
71. The AAV vector of any one of claims 1-70, wherein the AAV capsid comprises at least one modification that enhances permeability of the AAV vector across the blood-brain barrier (BBB).
72. The AAV vector of any one of claims 1-71, wherein the AAV capsid comprises at least one modification that enhances tropism of the AAV vector for the CNS relative to an AAV vector comprising an AAV capsid without the modification.
73. The AAV vector of claim 71 or 72, wherein the modification is one or more of an amino acid deletion, an amino acid substitution, or an amino acid insertion.
74. The AAV vector of any one of claims 1-70, wherein the AAV capsid comprises a peptide insert, wherein the peptide insert enhances permeability of the AAV vector across the blood-brain barrier (BBB).
75. The AAV vector of any one of claims 1-70. wherein the AAV capsid comprises a peptide insert, wherein the peptide insert enhances tropism of the AAV vector for the CNS relative to an AAV vector comprising an AAV capsid without the peptide insert.
76. The AAV vector of claim 74 or 75, wherein the peptide insert is derived from a cellpenetrating peptide (CPP).
77. The AAV vector of any one of claims 74-76, wherein the peptide insert comprises 4- 50, 5-25, or 5-10 amino acids.
78. The AAV vector of any one of claims 74-77, wherein the peptide insert comprises V[S / p][A / m / t]L; TV[S / p][A / m / t]L; TV[S / p][A / m / t]LK (SEQ ID NO: 81); or TV[S / p][A / m / t]LFK (SEQ ID NO: 82).
79. The AAV vector of any one of claims 74-78, wherein the peptide insert comprises at least 4 contiguous amino acids of VSALK (SEQ ID NO: 2), TVSALK (SEQ ID NO: 4), TVSALKF (SEQ ID NO: 145), VPALR (SEQ ID NO: 1), TVPALR (SEQ ID NO: 3), TVPMLK (SEQ ID NO: 12), TVPTLK (SEQ ID NO: 13), FTVSALK (SEQ ID NO: 5),LTVSALK (SEQ ID NO: 6), TVPALFR (SEQ ID NO: 9), TVPMLFK (SEQ ID NO: 10), or TVPTLFK (SEQ ID NO: 11).
80. The AAV vector of any one of claims 74-79, wherein the peptide insert comprises at least 4, at least 5, or at least 6 contiguous amino acids of TVSALK (SEQ ID NO: 4) or TVSALFK (SEQ ID NO: 8).
81. The AAV vector of any one of claims 74-80, wherein the peptide insert comprises TVSALK (SEQ ID NO: 4) or TVSALFK (SEQ ID NO: 8).
82. The AAV vector of any one of claims 74-81, wherein the peptide insert is between amino acids 588 and 589 of the amino acid sequence of SEQ ID NO: 101.
83. The AAV vector of claim 82, wherein the capsid comprises a sequence of SEQ ID NOS: 126 or 127.
84. The AAV vector of any one of claims 1-83, wherein the viral genome comprises at least one inverted terminal repeat (ITR).
85. The AAV vector of claim 84. wherein the viral genome comprises from 5?to 3?: a 5’ITR, the transgene, and a 3’ITR.
86. The AAV vector of any one of claims 1-85, wherein the viral genome comprises a promoter.
87. The AAV vector of claim 86, wherein the promoter is a tissue specific promoter.
88. The AAV vector of claim 87, wherein the tissue specific promoter is for a tissue of the CNS.
89. A pharmaceutical composition comprising the AAV vector of any one of claim 1-88, and a pharmaceutically acceptable carrier.
90. A method for providing a therapeutic antibody to a tissue of interest and reducing stability of the therapeutic antibody in systemic circulation, the method comprising administering to a subject the AAV vector of any one of claims 1-88 or the pharmaceutical composition of claim 89.
91. The method of claim 90, wherein the concentration of the therapeutic antibody is reduced in systemic circulation compared to a therapeutic antibody without the sequence motif or variant Fc domain.
92. The method of claim 90 or 91, wherein the concentration of the therapeutic antibody is higher in the tissue of interest relative to the concentration in systemic circulation.
93. The method of any one of claims 90-92, wherein the therapeutic antibody is degraded and / or metabolized rapidly outside the tissue of interest.
94. The method of any one of claims 90-93. wherein the tissue of interest is a tissue of the CNS.
95. The method of any one of claims 90-93, wherein the tissue of interest is a muscle tissue or liver.
96. The method of any one of claims 90-95, wherein the AAV vector or pharmaceutical composition is administered via a route of administration selected from: parenteral, oral, sublingual, nasal, subcutaneous, intrathecal, intravenous, intravitreal. intra-cistema magna, intracerebroventricular, intraparenchymal, and epidural.
97. Use of the AAV vector of any one of claims 1-88 or the pharmaceutical composition of claim 89 for providing a therapeutic antibody to a tissue of interest and reducing s tabi 1 i ty of the therapeutic antibody in systemic circulation, comprising administering to a subject the AAV vector or pharmaceutical composition.
98. Use of the AAV vector of any one of claims 1-88 in the manufacture of a medicament for providing a therapeutic antibody to a tissue of interest and reducing stability of thetherapeutic antibody in systemic circulation, comprising administering to a subject the AAV vector.