METHOD FOR CHECKING THE QUALITY OF AN AMPLIFICATION LAMP AND KIT USED FOR THIS PURPOSE
A single-strand oligonucleotide with two primers addresses the complexity and cost issues of LAMP internal controls, enhancing LAMP assay reliability and efficiency by reducing non-specific signals and simplifying implementation.
Patent Information
- Application Number
- FR2022014563
- Authority / Receiving Office
- FR · FR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-12-27
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2042-12-27
AI Technical Summary
Current LAMP diagnostic tests lack effective and cost-efficient internal controls to reduce false negatives, often requiring multiple primers and experiencing non-specific signals, making them complex and costly to implement.
A single-strand oligonucleotide, referred to as the 'control oligonucleotide', is developed, requiring only two primers for isothermal amplification, with optional third sequences for detection, reducing non-specific signals and simplifying implementation.
The control oligonucleotide provides a cost-effective and easy-to-implement internal control for LAMP assays, ensuring proper amplification by minimizing non-specific signals and facilitating chemical synthesis, suitable for various targets with reduced complexity.
Smart Images

Figure 00000022_0000 
Figure 00000022_0001 
Figure 00000023_0000
Abstract
Description
Title of the invention: METHOD FOR CHECK THE QUALITY OF AN AMPLIFICATION LAMP AND KIT USED FOR THIS PURPOSE technical field
[0001] The present invention relates to the field of tools and methods for detecting molecules of interest.
[0002] More particularly, the present invention provides an oligonucleotide useful as an internal control in a process for controlling the quality of loop-mediated isothermal amplification, or LAMP (for "Loop-mediated isothermal AM-Plification"). This oligonucleotide can also be combined, in a kit, with the two or three primers necessary for its amplification and / or the detection of its amplification during this LAMP. PREVIOUS STATE OF THE ART
[0003] Numerous works and studies in fields including academic research; clinical and diagnostic research and analysis, with tests carried out on blood samples or cell or tissue biopsies; environmental monitoring; civil surveillance; food safety and in particular quality control; criminal trace analysis... involve the detection of biomarkers, molecules of interest or contaminants in a sample and in particular in a sample such as a liquid sample.
[0004] Several techniques have been developed for this purpose.
[0005] In the 2000s, an amplification method was developed to replace polymerase chain reaction (PCR) for nucleic acid amplification. This method, called LAMP and patented [1], has the major advantage of being isothermal, with amplification carried out at a constant temperature typically between 60°C and 65°C, and allows for rapid detection.
[0006] Several diagnostic tests using the LAMP method are available on the market for medical, environmental or agri-food applications. These tests are used for the detection of genomic DNA or RNA from viruses, pathogens or other [2], for the detection of miRNAs [3,4], or for the detection of biomarkers [5].
[0007] During a diagnostic test using LAMP, the sample to be analyzed goes through several stages before detection:
[0008] a. the sampling of the sample,
[0009] b. extraction from the complex matrix of protein / DNA / RNA targets of interest,
[0010] c. contacting the LAMP amplification mixture containing primers, enzymes, deoxyribonucleosides (dNTPs) and an amplification buffer, and
[0011] d. isothermal heating and monitoring of the production of amplicons produced by the LAMP over time, generally on the order of one hour.
[0012] Several of these steps may present problems causing a test to present itself as a false negative, and it is difficult for a person skilled in the art to identify which step is deficient.
[0013] A method providing an indicator to verify that the isothermal amplification (steps c and d) is proceeding correctly involves adding an internal control to the solution to be amplified. This control is an oligonucleotide target different from the one being detected, which will amplify and will serve as an indicator of the test's success.
[0014] The simplest way to implement an internal control in LAMP assays is to use multiplexing methods to detect several targets, with one target being replaced by the internal control to ensure the proper conduct of the test. In the case of PCR detection tests, the scientific literature on multiplexing is very extensive, but much less so for LAMP assays. For the latter, multiplexing is mainly performed by using fluorophore / quencher pairs on primers with wavelengths different from those of the target to be detected [6].
[0015] In 2012, Tanner et al. proposed a LAMP multiplexing method and described a DARQ LAMP procedure for multiplexing [7]. The described sequences could be used to perform internal control, but increasing the number of primers in solution leads to an increase in the non-specific signal. Indeed, with each addition of a sequence, it is necessary to ensure that the newly added primers do not generate crossovers with the previous ones through non-specific hybridization. Furthermore, each addition of a sequence introduces an additional overhead for the test.
[0016] In 2022, Quyen et al. proposed a multiplexing method with a first step consisting of a LAMP followed by a second solid-phase amplification step [8]. The primers used to amplify the amplicons obtained after LAMP are fixed to a solid support, whereby a double-stranded DNA amplification product labeled with a cyanine-3 fluorescent dye is indirectly fixed to the solid support. In this method, the sequence serving as a template for LAMP and which can serve as an internal control is a relatively long double-stranded sequence: for one of the strands, there is a B3 sequence at the 5' end and A F3c sequence is located at the 3' end of the strand, and for the other strand, an F3 sequence is located at the 5' end and a B3c sequence at the 3' end. Amplification of this template during the first step of LAMP requires four primers: an F3 primer, a B3 primer, an FIP primer, and a BIP primer labeled with cyanine 3. Finally, other primers are needed to continue LAMP: modified FIP and BIP primers. Following this amplification, oligonucleotides with a double stem-loop structure are generated: these were not synthesized prior to any amplification, and some are labeled with cyanine 3. Again, the proposed method has a significant cost, making it difficult to use for LAMP amplification with internal control.
[0017] There is therefore a real need to offer systematic internal controls in LAMP diagnostic tests in order to reduce false negatives. However, currently very few commercial LAMP diagnostic devices implement such an internal control because it is complex and costly to implement.
[0018] The inventors therefore set themselves the goal of proposing a simple, inexpensive internal control, not requiring a large number of elements such as primers and, in fact, presenting little or no non-specific signal. Description of the invention
[0019] The present invention makes it possible to achieve the goal set by the inventors. Indeed, the latter have been able to develop a single-strand oligonucleotide, hereinafter referred to as the "control oligonucleotide", combined only with two primers necessary for its amplification and optionally a third sequence useful for monitoring this amplification, as an internal control in a LAMP and not presenting the disadvantages of the internal controls currently offered on the market or described in the literature for such amplification.
[0020] The control oligonucleotide implemented in the invention has the particularity of requiring only two primers for its isothermal amplification. This reduction in the number of primers offers numerous advantages, such as ease of implementation and cost savings, since the sequences are not only few in number but also short. The non-specific signal is also reduced due to the reduced number of primers.
[0021] Indeed, this control oligonucleotide is relatively short, which facilitates its chemical synthesis but also reduces the formation of secondary chemical structures and non-specific amplification with the primers necessary for sample amplification.
[0022] Consequently, this oligonucleotide controls and at most three primers or sequences useful for its amplification and / or the detection of this amplification are easy to to be integrated, as an internal control, into LAMP assays. The sequence of the control oligonucleotide is generic: it can be used in conjunction with numerous targets in samples. Indeed, it is more likely to be suitable and not cross-react with a large number of samples.
[0023] The present invention therefore relates to a method for controlling the quality of loop-mediated isothermal amplification of a reaction mixture containing an internal control and optionally at least one nucleotide sequence of interest, said method comprising
[0024] a) isothermal co-amplification mediated by loops of said internal control and of said nucleotide sequence of interest possibly present in said reaction mixture and
[0025] b) quality control of loop-mediated isothermal amplification by detecting the amplification product of said internal control,
[0026] characterized in that said internal control is in the form of an oligonucleotide of formula (I):
[0027] (Flc)m-F2-(F0')n-Fl-(Int)p-Blc-(B0')q-B2c-(Bl)r (I)
[0028] in which
[0029] m, n, p, q and r, whether identical or different, are equal to 0 or 1,
[0030] the F2 portion comprises 8 to 30 nucleotides,
[0031] the Fl portion comprises from 10 to 35 nucleotides,
[0032] The int separating portion Fl and portion B is, when p is equal to 0, a covalent bond and, when p is equal to 1, a portion comprising at least one nucleotide,
[0033] portion B comprises from 10 to 35 nucleotides,
[0034] the B2c portion comprises 8 to 35 nucleotides,
[0035] Fie represents, when m is equal to 0, the 5' end of portion F2 and, when m is equal to 1, a portion whose nucleotide sequence is complementary to the nucleotide sequence of portion Fl,
[0036] F0' represents, when n is equal to 0, a covalent bond linking portions F2 and Fl and, when n equals 1, a portion comprising at least one nucleotide,
[0037] B0' represents, when q is equal to 0, a covalent bond linking the portions B and B2c and, when q equals 1, a portion comprising at least one nucleotide, and
[0038] B1 represents, when r is equal to 0, the 3' end of portion B2c and, when r is equal to 1, a portion whose nucleotide sequence is complementary to the nucleotide sequence of portion B1 and
[0039] in that said reaction mixture contains at most two primers useful for loop-mediated isothermal amplification of said internal control and optionally another nucleotide sequence for detecting amplification of said internal control.
[0040] By "controlling the quality of an isothermal loop-mediated amplification", we mean verifying the proper preparation of the sample to be detected and that of the reaction mixture (enzyme, dNTPs, buffers, etc.), the functionality of all the components used for this amplification, the absence of factors inhibiting the latter and / or the absence of elements degrading the amplification products.
[0041] In what follows and what precedes, the expressions "oligonucleotide implemented in the invention", "control oligonucleotide", "internal control" and "oligonucleotide of formula (I)" are equivalent and may be used interchangeably.
[0042] First, it should be noted that the oligonucleotide implemented in the invention is easily prepared from the sequence of any FIP (for "Forward Inner Primer") primer of sequence 5'-Flc-F2-3' and BIP (for "Backward Inner Primer") primer of sequence 5'-Blc-B2-3' described in the prior art. Indeed, this oligonucleotide comprises an F2 portion also present in the FIP primer, an Fl portion complementary to the Fie portion present in the FIP primer, a B portion also present in the BIP primer, and a B2c portion complementary to the B2 portion present in the BIP primer, said oligonucleotide being able, in addition, to contain a Fie portion and a Bl portion. In certain embodiments, the oligonucleotide may have other sequences not related to FIP and BIP such as the B0', F0', and Int sequences.
[0043] In the context of the present invention, two nucleotide sequences are complementary to each other when a sufficient number of nucleotides from the first nucleotide sequence can bind, by means of hydrogen bonds, with the corresponding nucleotides of the second nucleotide sequence such that pairing between the two nucleotide sequences can occur. "Complementarity," as used here, refers to the pairing capacity between the nucleotides of a first nucleotide sequence and a second nucleotide sequence. Non-complementary nucleotides between two nucleotide sequences may be tolerated provided that the two nucleotide sequences remain capable of specifically hybridizing to each other.Furthermore, a first nucleotide sequence can hybridize to one or more segments of a second nucleotide sequence such that the intermediate or adjacent segments are not involved in the hybridization. In certain embodiments of the invention, a first nucleotide sequence, or a specific part thereof, is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a second nucleotide sequence, or a specified part thereof.
[0044] Typically, in the oligonucleotide implemented in the invention, the portion F2 can include from 10 to 27 nucleotides and, as specific examples, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 and 24 nucleotides.
[0045] Typically, in the oligonucleotide implemented in the invention, the Fl portion can comprise from 15 to 25 nucleotides and, by way of particular examples, 19, 20, 21 or 22 nucleotides.
[0046] Typically, in the oligonucleotide implemented in the invention, portion B may comprise from 17 to 27 nucleotides and, by way of particular examples, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.
[0047] Typically, in the oligonucleotide implemented in the invention, the B2c portion can comprise from 15 to 30 nucleotides and, by way of particular examples, 18, 19, 20, 21 or 22 nucleotides.
[0048] Typically, in the oligonucleotide implemented in the invention, when Int represents a portion comprising at least one nucleotide, the latter can comprise up to 3 nucleotides, 10 nucleotides, 30 nucleotides, 50 nucleotides and even 70 nucleotides.
[0049] It is evident that, to serve as an internal control, the oligonucleotide used in the invention must not contain any sequence capable of binding, directly or indirectly, to the analyte of interest and / or the nucleotide sequence of interest that could be detected, directly or indirectly, by the LAMP amplification whose quality is to be controlled. Furthermore, when the distinction between the LAMP amplification of the control oligonucleotide and that of the nucleotide sequence of interest is not made in space (fixation of the control oligonucleotide to a solid support) or in time (distinct amplification rates of the control oligonucleotide and the nucleotide sequence of interest), the control oligonucleotide must not contain any sequence capable of binding to the primers used for the LAMP amplification of the nucleotide sequence of interest.
[0050] In a first embodiment corresponding to the case where m, n, q and r are all equal to 0, the oligonucleotide used in the invention conforms to the formula (II) below:
[0051] 5'-F2-Fl-(Int)p-Blc-B2c-3' (II)
[0052] with p and the portions F2, Fl, Int, B le and B2c as previously defined.
[0053] The oligonucleotide of formula (II) has no internal secondary structure, i.e. Formula (II) does not contain any sequence of at least 4 consecutive nucleotides complementary to another sequence in said formula (II). It can be described as a linear oligonucleotide.
[0054] The 5' end of the oligonucleotide of formula (II) corresponds to the 5' end of portion F2 and its 3' end to the 3' end of portion B2c.
[0055] Advantageously, the oligonucleotide of formula (II) used in the invention can include less than 130 nucleotides, in particular less than 120 nucleotides, in particular less than 110 nucleotides, more particularly less than 100 nucleotides and especially less than 90 nucleotides.
[0056] With such a small size, the chemical synthesis of the oligonucleotide of formula (II) is simple and rapid, and the cost of this synthesis, and consequently the cost of internal control for LAMP amplification, is lower. However, its amplification time can be considered slow (approximately 45 min). The oligonucleotide of formula (II) is preferable for cases where cost is a more important consideration than amplification time.
[0057] In a second embodiment corresponding to the case where m, n, q and r are all equal to 1, the oligonucleotide used in the invention has a double stem-loop structure and conforms to the formula (III) below:
[0058] 5'-Flc-F2-F0'-Fl-(Int)p-Blc-B0'-B2c-Bl-3' (III)
[0059] with p and the portions Fie, F2, F0', Fl, Int, Blc, B0', B2c and B1 as previously defined.
[0060] The 5' end of the oligonucleotide of formula (III) corresponds to the 5' end of the Fie portion and its 3' end to the 3' end of the Bl portion.
[0061] In the oligonucleotide of formula (III) implemented in the invention, the Fie portion and the Fl portion hybridize to form the stem of the first stem-loop structure of this oligonucleotide. Typically, in the oligonucleotide with a double stem-loop structure of formula (III) implemented in the invention, the Fl portion and the Fie portion each comprise from 10 to 35 nucleotides, in particular between 15 and 25 nucleotides and, by way of specific examples, 19, 20, 21, or 22 nucleotides. The melting temperature (Tm) of Fl-Flc is notably higher than the temperature used during LAMP amplification and, in particular, 5°C to 7°C higher. Those skilled in the art may find additional information regarding these portions in [1].
[0062] In the oligonucleotide of formula (III) implemented in the invention, the portion F2-F0' forms the loop of the first stem-loop structure, hereinafter referred to as loop F0. Typically, the portion F2 comprises from 8 to 30 nucleotides, in particular from 10 to 27 nucleotides and, by way of particular examples, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 and 24 nucleotides and the portion F0' is such that the loop F0 comprises from 10 to 70 nucleotides.
[0063] In the oligonucleotide of formula (III) implemented in the invention, the Bl portion and the Blc portion hybridize to form the stem of the second stem-loop structure. Typically, in the oligonucleotide with a double stem-loop structure of formula (III) implemented in the invention, the B1 portion and the Blc portion each comprise from 10 to 35 nucleotides, in particular from 17 to 27 nucleotides and, by way of specific examples, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. The temperature Tm of Bl-Blc is notably higher than the temperature used during amplification and, in particular, higher by 5°C to 7°C. Those skilled in the art can find additional information regarding these portions in [1].
[0064] In the oligonucleotide of formula (III) implemented in the invention, the portion B0'-B2c forms the loop of the second stem-loop structure, hereinafter referred to as loop B0. In addition, the portion B2c comprises from 8 to 35 nucleotides, in particular from 15 to 30 nucleotides and, by way of particular examples, 18, 19, 20, 21 or 22 nucleotides and the portion B0' is such that the loop B0 comprises from 10 to 70 nucleotides.
[0065] Although the oligonucleotide of formula (III) used in the invention is longer, and therefore more expensive and complex, to synthesize chemically than the oligonucleotide of formula (II), its amplification rate is significantly faster than that of the oligonucleotide of formula (II) (approximately 15 min). The oligonucleotide of formula (III) is therefore preferable in cases where the speed of the test is more important than its cost.
[0066] The oligonucleotide of formula (III) implemented in the invention is clearly different from the double stem-loop oligonucleotides described in [8] since the latter are prepared during LAMP amplification.
[0067] In a third embodiment corresponding to the case where m is equal to 0 and n, q and r are equal to 1, the oligonucleotide used in the invention has a single stem-loop structure and conforms to the formula (IV) below:
[0068] 5'-F2-F0'-Fl-(Int)p-Blc-B0'-B2c-Bl-3' (IV)
[0069] with p and the portions F2, F0', Fl, Int, Blc, B0', B2c and B1 as previously defined.
[0070] The 5' end of the oligonucleotide of formula (IV) corresponds to the 5' end of portion F2 and its 3' end to the 3' end of portion Bl.
[0071] In a fourth embodiment which corresponds to the case where r is equal to 0 and m, n and q are equal to 1, the oligonucleotide used in the invention has a single stem-loop structure and conforms to the formula (V) below:
[0072] 5'-Flc-F2-F0'-Fl-(Int)p-Blc-B0'-B2c-3' (V)
[0073] with p and the portions Fie, F2, F0', Fl, Int, Blc, B0' and B2c as previously defined.
[0074] The 5' end of the oligonucleotide of formula (V) corresponds to the 5' end of the Fie portion and its 3' end to the 3' end of the B2c portion.
[0075] Control oligonucleotides of formula (IV) or (V) are intermediates between those of formula (II) and (III). Indeed, they are longer and therefore more expensive than those of formula (II) but shorter and therefore less expensive than those of formula (III), and exhibit a higher amplification rate than that observed for oligonucleotides of formula (II).
[0076] In the context of the invention, the oligonucleotide of formula (I), and therefore the oligonucleotides of formulas (II), (III), (IV), and (V), are synthesized prior to their introduction into the reaction mixture and thus prior to any LAMP amplification step. Furthermore, the preparation of the double stem-loop oligonucleotides described in [8] requires at least four primers (F3, B3, FIP, and BIP-cy3).
[0077] For the oligonucleotide used to be a relevant internal control, it and any nucleotide sequence of interest must be in the same reaction mixture and undergo LAMP amplification of both the oligonucleotide and the nucleotide sequence of interest in the same volume of this mixture. This volume can be the volume of the reaction mixture contained in a single reaction chamber or the volume of a drop of this reaction mixture. In this way, the amplification of the oligonucleotide and the nucleotide sequence of interest, if present, is carried out under the same conditions in terms of the components of the reaction mixture and the temperature.
[0078] In the context of the control process according to the invention, the oligonucleotide used may be in solution in the reaction mixture.
[0079] Alternatively, it can be fixed to the surface of a solid support with which the reaction mixture is in contact. This solid support can be, by way of illustration, a plate, a biochip support, the inner surface of a microtube, the inner surface of a well in a multiwell plate, or even the surface of a bead, possibly magnetic. This solid support can be made of silicon, glass, metal, polymer, latex, or plastic.
[0080] In a particular embodiment, the surface of the solid support has functional groups by which the oligonucleotide used is immobilized. Advantageously, these functional groups are selected from among carboxylic groups, radical entities, alcohols, amines, amides, epoxies, or thiols. These groups are carried, either intrinsically or by functionalization, on the surface of the solid support. The oligonucleotide used may also have such functional groups, either intrinsically or by functionalization.
[0081] In a first embodiment of the present invention, the oligonucleotide can be directly immobilized on the surface of the solid support, whether functionalized or not. A solid support coated with a protein such as streptavidin is an example of direct immobilization in which the oligonucleotide used must be functionalized with biotin.
[0082] In a second embodiment of the present invention, the oligonucleotide can be indirectly immobilized on the surface of the solid support, whether functionalized or not. This indirect immobilization involves a spacer arm (or agent of The spacer arm is linked, on the one hand, to the surface of the solid support and, on the other hand, to an oligonucleotide as previously defined. Such a spacer arm is notably used to improve the accessibility of the oligonucleotide being used. Illustrative examples include silane reagents used for grafting onto glass, the complexation of thiol products onto gold surfaces, and the immobilization of probes in polymer matrices. For the indirect attachment of the oligonucleotide, such a spacer arm can take the form of a sequence comprising several thymine bases, particularly 10 thymine bases.
[0083] This indirect immobilization can also involve, as a spacer arm, a nucleotide sequence complementary to a portion of the nucleotide sequence of the control oligonucleotide and fixed to the surface of the solid support. Such a sequence allows the hybridization binding, typically stable at a temperature above the LAMP temperature, of the control oligonucleotide. A FIP primer or a BIP primer fixed to the surface of the support is a particular example of these complementary nucleotide sequences.
[0084] The bonds implemented during a direct or indirect immobilization can be any bonds known to a person skilled in the art and in particular covalent bonds, ionic bonds, hydrogen bonds, electrostatic interactions, hydrophobic interactions, Van der Waals bonds or adsorption.
[0085] By "reaction mixture" is meant a mixture containing all the elements necessary for a LAMP amplification as well as the control oligonucleotide as previously defined and the primers or sequences useful for its amplification and for the detection of this amplification and possibly a nucleotide sequence of interest.
[0086] The control oligonucleotide is present in the reaction mixture in an amount between 1 aM and 1 mM, and in particular between 100 aM and 1 pM. Specific examples of usable concentrations include 10 pM, 100 pM, 1 nM, or 10 nM. Advantageously, the control oligonucleotide is present in the solution used in step ii) at a concentration of 100 pM.
[0087] As previously stated, the reaction mixture used in the controlled LAMP amplification process comprises at most two primers for amplification and optionally a third sequence for detecting the amplification of the internal control. It is evident that this reaction mixture may contain other primers involved in the amplification of the nucleotide sequence of interest. Alternatively, the two primers used to amplify the control oligonucleotide and optionally the sequence for detecting this amplification may also be used for the amplification of the nucleotide sequence of interest and the detection of this amplification. This variant can be applied to the case where the distinction between amplification of the control oligonucleotide and detection of this amplification and those of the nucleotide sequence of interest is made spatially, i.e., by a controlled localization of one and / or the other, such as the fixation of the control oligonucleotide to the surface of a solid support described previously.
[0088] In a first embodiment, the reaction mixture comprises, as the only primers involved in the amplification of the control oligonucleotide and the detection of this amplification, the FIP and BIP primers as previously defined.
[0089] In a second embodiment, the reaction mixture comprises, as the only primers involved in the amplification of the control oligonucleotide and the detection of this amplification, the FIP and BIP primers as previously defined, one of the two being labeled, at its 5' or 3' end, with a first fluorochrome, and a third nucleotide sequence labeled with a second fluorochrome. This third nucleotide sequence is partially complementary to the nucleotide sequence at the end of the FIP or BIP primer labeled with the first fluorochrome.One of the two fluorochromes between the first and second is an emitting (or "reporter") fluorochrome, such as 6-carboxyfluorescein (6-FAM), tetrachlorofluorescein (TET), hexachlorofluorescein (HEX), cyanine 3 (Cy3), or cyanine 5 (Cy5), and the other is a suppressing (or "quencher") fluorochrome, such as 6-carboxytetramethylrhodamine (TAMRA), BHQ1 (for "Black Hole Quencher 1"), BHQ2, or BHQ3. When stimulated, the emitting fluorochrome transfers its energy to the neighboring suppressing fluorochrome via the principle of FRET (for "Fluorescence Resonance Energy Transfer"), which dissipates this energy as heat. During LAMP amplification, the emitting fluorochrome is then released from the environment of the suppressing fluorochrome, thus allowing fluorescence emission.In a particular example of this second form of implementation, the reaction mixture comprises a FIP primer, a BIP primer whose 5' end is labeled with an emitting fluorochrome, and a third nucleotide sequence having, at its 3' end, a B1 portion (whose nucleotide sequence is complementary to the nucleotide sequence of the B portion present at the 5' end of BIP) and a suppressor fluorochrome.
[0090] Typically, the reaction mixture used includes a suitable buffer, such as, for example, a phosphate buffer or a Tris buffer; deoxyribonucleoside (dNTPs), such as an equimolar mixture of dATP, dCTP, dGTP, and dTTP; salts such as magnesium salts like MgSO4 and MgCl2; and salts of Manganese such as MnCl2, potassium salts such as KCl, and / or ammonium salts; detergents such as Tween® 20, betaine, and an enzyme catalyzing LAMP amplification. Such an enzyme is a polymerase exhibiting high strand displacement activity in addition to replication activity. Specific examples of such enzymes include: Bst DNA polymerase and its variants such as, for example, Bst2.0 DNA polymerase and Bst3.0 DNA polymerase; Bsm DNA polymerase; Bca (exo-) DNA polymerase; Klenow fragment of DNA polymerase I; Vent DNA polymerase; Vent(Exo-) DNA polymerase (exonuclease activity-free Vent DNA polymerase); DeepVent DNA polymerase; DeepVent(Exo-) DNA polymerase (DeepVent DNA polymerase without exonuclease activity); 29 phage DNA polymerase; MS-2 phage DNA polymerase; Z-Taq DNA polymerase (Takara Shuzo), and KOD DNA polymerase (TOYOBO).
[0091] The reaction mixture may further include elements useful for the detection and quantification of the amplification product of the control oligonucleotide or of the nucleotide sequence of interest possibly present in the reaction mixture such as, for example, calcein, an intercalating dye such as, for example, propidium iodide, SYTO 9, SYBR green and EvaGreen.
[0092] The term "nucleotide sequence" used herein is equivalent to the following terms and expressions: "nucleic acid," "polynucleotide," "nucleotide molecule," "polynucleotide sequence," and "oligonucleotide sequence." For the purposes of this invention, "nucleotide sequence" means a chromosome; a gene; a regulatory polynucleotide; DNA, single-stranded or double-stranded, genomic, chromosomal, chloroplast, plasmid, mitochondrial, recombinant, or complementary; a total RNA; a messenger RNA; a ribosomal RNA (or ribozyme); a transfer RNA; a microRNA; a small interfering RNA; an aptamer sequence; a peptide nucleic acid; a locked nucleic acid (or LNA); a morpholino; an oligonucleotide with a double stem structure loops a portion or fragment of these.
[0093] In a first embodiment, the nucleotide sequence of interest may be the target analyte that one seeks to detect and possibly quantify via the controlled amplification process according to the invention.
[0094] In a second embodiment, the nucleotide sequence of interest may be a sequence that allows the target analyte to be detected and possibly quantified indirectly. This embodiment is particularly applicable when the target analyte is not nucleotide in nature or does not include a nucleotide sequence. Thus, the target analyte to be detected may be chosen from the group constituted by a a molecule of environmental interest such as a pesticide; a molecule of biological interest; a molecule of pharmacological interest; a toxin; a carbohydrate such as glucose; a lipid such as cholesterol; a peptide; an antigen; an epitope; a protein; a glycoprotein; an enzyme; an enzyme substrate; a nuclear or membrane receptor; an agonist or antagonist of a nuclear or membrane receptor; a hormone; a polyclonal or monoclonal antibody; an antibody fragment such as a Fab, F(ab')2, Fv, scFv fragment or a hypervariable domain (or CDR for "Complementarity Determining Region"); ions such as mercury or lead ions; a eukaryotic cell; a prokaryotic cell and a virus.
[0095] In this second embodiment, the nucleotide sequence of interest has at least one entity capable of binding, directly or indirectly, to the target analyte. For this embodiment, it is possible to use, as the nucleotide sequence of interest, an oligonucleotide with a double stem-loop structure as described in patent applications EP 3878971 and EP 22195865.5 [9,10].
[0096] It should be noted that, in the first and second embodiments, a target analyte can be defined as a small molecule, i.e., a molecule whose molecular weight is less than or equal to 10,000 daltons, and in particular less than or equal to 8,000 daltons. This small molecule can belong to any of the elements in the lists of analytes above.
[0097] In the controlled LAMP amplification process according to the invention, the coamplification step is carried out for a period of time and at a temperature sufficient for the production of an amplification product from the control oligonucleotide and the nucleotide sequence of interest, if present. Advantageously, this step is performed under isothermal conditions, and in particular at a temperature between 15°C and 90°C, more specifically between 50°C and 80°C, and more particularly around 65°C (i.e., 65°C ± 5°C). The duration of this coamplification step according to the invention is between 1 min and 120 min, specifically between 3 min and 90 min, and more particularly between 5 min and 60 min.
[0098] In the controlled LAMP amplification process according to the invention, this control is achieved by detecting the amplification products of the control oligonucleotide. This detection can be performed simultaneously with or after the LAMP amplification.
[0099] This detection of the amplification products of said oligonucleotide can be carried out:
[0100] - by measuring fluorescence,
[0101] - by detecting by-products of the amplification reaction such as, for example, pyrophosphate crystals, or
[0102] - by measuring the variation in pH.
[0103] It is evident that this detection must not interfere with the detection of the products amplification of the nucleotide sequence of interest.
[0104] When the control oligonucleotide is in solution, detection can be done by following the release of fluorescence from one of the fluorophores carried by the FIP primer, the BIP primer or the third nucleotide sequence as previously defined.
[0105] The distinction can also be made via the fixation of the control oligonucleotide at the level of a first zone of the surface of the solid support, the nucleotide sequence of interest and / or the target analyte being able, for their part, to be in solution or fixed, directly or indirectly, at the level of a second zone of the surface of the solid support, distinct from the first zone.
[0106] In this case, detection can be achieved by detecting planar crystals by naked-eye imaging, via a turbidimeter or by lensless imaging
[11] .
[0107] In this case, detection can also be carried out by fluorescence measurement when calcein or a fluorescent intercalating dye or a probe labeled with a fluorochrome and recognizing the amplification product is present in the reaction mixture.
[0108] In this case, detection can also be carried out by measuring the variation of pH, for example, by colorimetry, by electrochemistry or via a pH probe, in order to monitor the acidification of the reaction mixture during LAMP amplification.
[0109] The different variants envisaged when the control oligonucleotide is fixed on a solid support also apply to the case where the amplification of the control oligonucleotide is sufficiently slow, i.e. greater than 30 minutes, so as not to interfere with the amplification of the nucleotide sequence of interest.
[0110] The present invention also relates to a kit for checking the quality of a LAMP amplification consisting of a control oligonucleotide as previously defined and at most two primers for its amplification and the possible third nucleotide sequence for the detection of this amplification as previously defined.
[0111] In other words, the present invention relates to:
[0112] - a kit for checking the quality of a LAMP amplification consisting of an oligonucleotide control nucleotide as previously defined and the FIP and BIP primers and
[0113] - a kit for checking the quality of a LAMP amplification consisting of an oligonucleotide cleotide as previously defined, the primers FIP and BIP, one of the two being marked, at its 5' or 3' end, by a first fluorochrome, and a third nucleotide sequence marked by a second fluorochrome.
[0114] Other features and advantages of the present invention will become apparent to the person skilled in the art upon reading the following examples given by way of illustration and not limitation, with reference to the attached figures. Brief description of the drawings
[0115] [Fig-1] presents an example of amplification curves of sequence 1 (double stem loop oligonucleotide of formula (III)) for concentrations of 1 nM, 100 pM and 10 pM.
[0116] [Fig.2] presents an example of amplification curves of sequence 3 (linear oligonucleotide of formula (II)) for concentrations of 1 nM, 100 pM and 10 pM.
[0117] [Fig.3] presents an example of amplification curves of sequence 5 (single-stem loop oligonucleotide of formula (V)) for concentrations of 1 nM, 100 pM and 10 pM.
[0118] [Fig.4] shows the amplification curves of sequence 1 with primers 1 (line solid) and with primers 2 (dotted line). Fluorescence (arbitrary unit) as a function of time.
[0119] [Fig.5] shows the amplification curves of sequence 2 with primers 1 (line dotted line) and with primers 2 (solid line). Fluorescence (arbitrary unit) as a function of time.
[0120] [Fig.6] presents the amplification curves of sequence 1 in the presence of its primers (solid line), or of only one of the primers (circle and cross) or of no primer (triangle).
[0121] DETAILED DESCRIPTION OF PARTICULAR EMBODIMENTS
[0122] 1. Materials and Methods.
[0123] Table 1 below describes the nucleotide sequence of the various control oligonucleotides according to the invention as well as the FIP and BIP primers used for their amplification.
[0124] One possible embodiment of the internal control proposed herein consists of preparing oligonucleotide solutions with, for example, the sequences described in Table 1 below, at different concentrations chosen according to the desired amplification efficiency (concentrated for speed) and amplifying them according to the 2-primer LAMP amplification protocol as described in [9,10].
[0125] This protocol consists of adding 2 pL of oligonucleotide solution diluted in a buffer containing, for example, PBS and MgCl2 with 18 pL of LAMP reaction mix comprising:
[0126] A commercial Master Mix containing an enzyme catalyzing amplification (e.g., NEB Warm Start LAMP kit), with typical final concentrations of IX, 0.75X, or 0.5X. A fluorescent intercalant such as Eva Green is added at final concentrations between 2X and IX (typically 0.25X), and FIP and BIP primers at concentrations between 0.1 and 5 pM (typically 2.4 pM).
[0127] [Tables] Conception 1 Séquence 1 (Formule (HID 5'- GGnGGTGTGGTTGGI 1111111 11CGGATCCAAGACGCGGTTTA TCGTGCAGTACGCCAACCTTTCTCAATAAACCGCGTCTTGGATCC GTGACATCTCTGAGTTATATCTTTCCCCCCCTCACTGACCCTCCTT CGGGGGAAAGATATAACTCAGAGATG-3' (SEQ fD NO: 1 in the attached list of sequences) Sequence 3 (Formule (HJ) 5'- CGGCAGTACGCCAACC1 HC i CAATAAACCGCGTCTTGGATCCGC ATCTCTGAGTTATATCTTTCCCCCCCTCACTGACCCTCCTTC-3' (SEQ ID NO: 2 in the attached list of sequences) Sequence 4 (Formule OV» 5' CGTGCAGTACGCCAACCmCTCAATAAACCGCGTCTTGGATCCG CATCTCTGAGTTATATCTTTCCCCCCCTCACTGACCCTCCnCGGG GGAAAGATATAACTCAGAGATG-3' (SEQ ID NO: 3 in the sequence list in the annex) Sequence 5 (Formula (V)) 5'- CGGATCCAAGACGCGGTnATCGTGCAGTACGCCAACC: 1 ICiCA ataaaccgcgtcttggatccgtgacatctctgagttatatctttœ CCCCCTCACTGACCCTCCTTC-3' (SEQ ID NO: 4 in the sequence list in the annex) F IPI 5J- CGGATCCAAGACGCGGTTTATCGTGCAGTACGCCAACt i 1 ICICA -3' (SEQ ID NO: 5 in the sequence list in the annex) BIP1 5"-CATCTCTGAGTTATATCTTTCCCCCGMGGAGGGTCAGTGAG (SEQ ID NO: 6 in the attached sequence list) Design 2 Sequence 2 (Formula (HO) 5'- GGTTGGTGTGGTTGG1 11 1 1 1 1 1 HAGAGCAGCAGAAGTGGCAC AGGTGATTGTGAAGAAGAAGAGAGTGTGCCACTTCTGCTGCTCTTTT ATCAACCTGAAGAAGCAGGGCAGTGAGGACAATCAGTTCTTGC TCnCTTCAGGTTGA-3' (SEQ ID NO: 7 in the attached sequence list) FIP2 5'- AGAGCAGCAGAAGTGGCAGAGGTGATTGTGAAGAAGAAGAG-3' (SEQ ID NO: 8 in the attached sequence list) BIP2 5'-TCAACCTGMGAAGAGCAAGAACTGATTGTCCTCACTGCC-3' (SEQ ID NO: 9 in the (List of sequences in the appendix)
[0128] Table 1: Oligonucleotide sequences for designs 1 and 2
[0129] 2. Proof of the amplification of the proposed sequences.
[0130] Different concentrations of oligonucleotides (1 nM, 100 pM, 10 pM) are contacted with the amplification mix described above, and the fluorescence is monitored by function of time (intercalating) in order to monitor the formation of amplicons. Figures [1] to 3 respectively represent the amplification curves for sequences 1, 3 and 5 as defined in Table 1 for different oligonucleotide concentrations in solution, thus validating the functionality of these sequences.
[0131] 3. Proof of the selectivity of the proposed sequences.
[0132] In order to prove the selectivity of the proposed sequences, two sequences (sequences 1 and 2) are designed, each comprising its specific primers (FIP1 and BIP1, on the one hand, and FIP2 and BIP2, on the other). These two sequences are brought into contact with various primers to test the selectivity of the amplification.
[0133] Sequence 1 is amplified only in the presence of its specific primers, i.e., FIP1 and BIP1 ([Fig. 4]), and similarly for sequence 2, which is amplified only in the presence of its specific primers, i.e., FIP2 and BIP2 ([Fig. 5]). This demonstrates the selectivity of the primers with respect to their sequence and thus validates the use of these designs to achieve internal control in solution that will not produce non-specific amplification with respect to other primers present in solution. This proves the robustness of the proposed sequences for use in solutions containing other analytes or oligonucleotide sequences.
[0134] 4. Proof of the specificity of the proposed sequences.
[0135] To demonstrate the specificity of the test, sequence 1 is amplified with all, one, or none of the associated primers. If only one or no primer is present, no amplification is observed ([Fig. 6]). This confirms the selectivity of the amplification of the designed sequence with respect to the associated primers. References
[0136] [1] US Patent 6,410,278 published on June 25, 2002.
[0137] [2] Thompson & Lei, 2020, “Mini review: Recent progress in RT-LAMP enabled COVID-19 detection”, Sensors and Actuators Reports, vol. 2, Art. No. 1.
[0138] [3] Abdullah AL-maskri et al, 2020, “Reverse transcription-based loop-mediated isothermal amplification strategy for real-time miRNA detection with phosphoro-thioated probes”, Analytica Chimica Acta, vol. 1126, pages 1-6.
[0139] [4] Gines et al, 2019, “Emerging isothermal amplification technologies for microRNA biosensing: Applications to liquid biopsies », Molecular Aspects of Medicine, vol. 72, page 100832.
[0140] [5] Aubret et al, 2022, « Development of an Innovative Quantification Assay Based on Aptamer Sandwich and Isothermal Dumbbell Exponential Amplification », Anal. Chem., vol. 94, pages 3376-3385.
[0141] [6] Bail et al, 2016, « Quenching of Unincorporated Amplification Signal Reporters in Reverse-Transcription Loop-Mediated Isothermal Amplification Enabling Bright, Single-Step, Closed-Tube, and Multiplexed Détection of RNA Viruses », Anal. Chem., vol. 88, pages 3562-3568.
[0142] [7] Tanner et al, 2012, « Simultaneous multiple target détection in real-time loop- mediated isothermal amplification », BioTechniques, vol. 53, pages 81-89.
[0143] [8] Quyen et al, 2022, « Multiplex détection of pathogens using solid-phase loop- mediated isothermal amplification on a supercritical angle fluorescence array for point-of-care applications”, ACS Sensors, vol. 7, pages 3343-3351.
[0144] [9] Patent application EP 3878971 published on September 15, 2021.
[0145]
[10] Patent application EP 22195865.5 filed on September 15, 2022.
[0146]
[11] Patent application EP 3363913 published on August 22, 2018.
Claims
Demands
1. A method for controlling the quality of loop-mediated isothermal amplification of a reaction mixture containing an internal control and optionally at least one nucleotide sequence of interest, said method comprising a) loop-mediated isothermal co-amplification of said internal control and of said nucleotide sequence of interest possibly present in said reaction mixture and b) quality control of loop-mediated isothermal amplification by detecting the amplification product of said internal control, characterized in that said internal control is in the form of an oligonucleotide of formula (I): (Flc)m-F2-(F0')n-Fl-(Int)p-Blc-(B0')q-B2c-(Bl)r (I) in which m, n, p, q and r, whether identical or different, are equal to 0 or 1, portion F2 comprises 8 to 30 nucleotides, portion Fl comprises 10 to 35 nucleotides, The int separating portion Fl and portion B is, when p equals 0, a covalent bond and, when p equals 1, a portion comprising at least one nucleotide, portion B comprises 10 to 35 nucleotides, portion B2c comprises 8 to 35 nucleotides, Fie represents, when m is equal to 0, the 5' end of portion F2 and, when m is equal to 1, a portion whose nucleotide sequence is complementary to the nucleotide sequence of portion Fl, F0' represents, when n is equal to 0, a covalent bond linking portions F2 and Fl and, when n is equal to 1, a portion comprising at least one nucleotide, B0' represents, when q equals 0, a covalent bond linking portions B1 and B2c and, when q equals 1, a portion comprising at least one nucleotide, and B1 represents, when r is equal to 0, the 3' end of portion B2c and, when r is equal to 1, a portion whose nucleotide sequence is complementary to the nucleotide sequence of portion B, and in that said reaction mixture contains at most two primers useful for loop-mediated isothermal amplification of said internal control and possibly another nucleotide sequence for the detection of the amplification of said internal control.
2. Control method according to claim 1, characterized in that said oligonucleotide corresponds to the formula (II) below: 5'-F2-Fl-(Int)p-Blc-B2c-3' (II) with p and the portions F2, Fl, Int, Blc and B2c as defined in claim 1.
3. Control method according to claim 1, characterized in that said oligonucleotide corresponds to the formula (III) below: 5' -F 1C-F2-F0'-F 1 -(Int)pB lc-B0'-B2c-B 1 -3' (III) with p and the portions Fie, F2, FO', Fl, Int, Blc, B0', B2c and B1 as defined in claim 1.
4. Control method according to claim 1, characterized in that said oligonucleotide corresponds to the formula (IV) below: 5'-F2-F0'-Fl-(Int)p-Blc-B0'-B2c-B1-3' (IV) with p and the portions F2, FO', Fl, Int, Blc, B0', B2c and B1 as defined in claim 1.
5. Control method according to claim 1, characterized in that said oligonucleotide corresponds to the formula (V) below: 5' -F 1C-F2-F0'-F 1 -(Int)pB lc-B0'-B2c-3' (V) with p and the portions Fie, F2, FO', Fl, Int, Blc, B0' and B2c as defined in claim 1.
6. A control method according to any one of claims 1 to 5, characterized in that said oligonucleotide is in solution in the reaction mixture.
7. A control method according to any one of claims 1 to 5, characterized in that said oligonucleotide is immobilized at the surface of a solid support with which the reaction mixture is in contact.
8. Control method according to claim 7, characterized in that this immobilization is indirect and involves, as a spacer arm, a nucleotide sequence complementary to a part of the nucleotide sequence of said oligonucleotide and fixed to the surface of the support.
9. A control method according to any one of claims 1 to 8, characterized in that said reaction mixture comprises, as the only primers involved in the amplification and detection of the amplification of said oligonucleotide, the primers FIP and BIP.
10. A control method according to any one of claims 1 to 8, characterized in that said reaction mixture comprises, as only primers involved in the amplification and detection of the amplification of said oligonucleotide, the primers FIP and BIP, one of the two being marked, at its 5' or 3' end, by a first fluorochrome, and a third nucleotide sequence marked by a second fluorochrome.
11. A control method according to any one of claims 1 to 10, characterized in that the detection of the amplification products of said oligonucleotide is done: - by measuring fluorescence, - by detecting by-products of the amplification reaction such as, for example, pyrophosphate crystals, or - by measuring the pH variation.
12. Kit for checking the quality of a LAMP amplification consisting of an oligonucleotide as defined in any one of claims 1 to 5 and the primers FIP and BIP.
13. Kit for checking the quality of a LAMP amplification consisting of an oligonucleotide as defined in any one of claims 1 to 5, the primers FIP and BIP, one of the two being marked, at its 5' or 3' end, by a first fluorochrome, and a third nucleotide sequence marked by a second fluorochrome.