Deinococcus grandis host-vector system

Abstract

To provide a Deinococcus grandis host-vector system allowing for stable introduction and maintenance of an expression plasmid for Deinococcus grandis.SOLUTION: The invention provides a host-vector system for Deinococcus grandis mainly comprising: a Deinococcus grandis host cell modified by removing endogenous plasmid pDEGR-3 or endogenous plasmid pDEGR-3 and an endogenous plasmid of 91,291 bp; a shuttle vector plasmid comprising a replication initiation region of the endogenous plasmid pDEGR-3 of Deinococcus grandis; and a shuttle vector plasmid comprising a replication initiation region derived from Deinococcus radiodurans Sark strain.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for the preparation of Deinococcus grandis ( Deinococcus grandis In particular, the present invention relates to the use of modified Deinococcus grandis for introducing a foreign plasmid. It also relates to a shuttle vector plasmid between Deinococcus grandis and Escherichia coli, an expression plasmid for a target gene using the shuttle vector plasmid, and a transformant incorporating the expression plasmid. [Background technology]

[0002] The radiation resistance of living organisms varies greatly depending on the species. To date, a group of bacteria that have extremely high resistance to radiation have been known, and they are called radioresistant bacteria. If genes that have the function of removing persistent or harmful substances or genes involved in the intracellular uptake of elements can be introduced into these radioresistant bacteria by genetic engineering techniques or highly expressed, it will be possible to remove persistent or harmful substances contained in waste contaminated with radionuclides, and to remove radionuclides from soil and rivers contaminated with radioactive substances. Therefore, transformation of radioresistant bacteria by genetic engineering techniques is very useful as a bioremediation technology related to the removal of radioactive substances.

[0003] The bacterium that has been most actively studied among radiation-resistant bacteria and for which genetic engineering techniques can be used is Deinococcus ( Deinococcus ) bacteria. It is known that the radiation resistance of Deinococcus bacteria is about 100 times that of Escherichia coli and about 1000 times that of human cells. Among the Deinococcus bacteria, Deinococcus radiodurans ( D. radioduransDeinococcus radiodurans is a mesophilic bacterium with an optimum growth temperature of 30°C, and usually takes the form of a tetrastranded bacterium. This bacterium is polyploid (4-10 genome copies per cell) and is known to have high natural transformation potential. The strong radiation resistance exhibited by Deinococcus bacteria is thought to be mainly due to their extremely high DNA repair ability.

[0004] To date, examples of bioremediation techniques using Deinococcus radiodurans include the expression of the toluene dioxygenase gene derived from Pseudomonas putida on the chromosome of Deinococcus radiodurans to convert refractory toluene into a more easily degradable substance (Non-Patent Document 1); the expression of the divalent mercury ion reduction gene derived from Escherichia coli on the chromosome of Deinococcus radiodurans to reduce divalent mercury ions to less toxic volatile metallic mercury (Non-Patent Document 2); and the precipitation of uranium from a uranyl nitrate solution by expressing the non-specific acid phosphatase gene derived from Salmonella enterica typhi or the alkaline phosphatase gene derived from Sphingomonas bacteria on a plasmid using Deinococcus radiodurans as a host (Non-Patent Documents 3, 4, and 5). There is an example in which an endoglucanase gene derived from Bacillus pumilus was expressed on a plasmid using Deinococcus radiodurans as a host for the purpose of contributing to the bioremediation of cellulosic waste in a radioactive environment (Non-Patent Document 6); an example in which a synthetic gene encoding a phytochelatin analog or a metallothionein gene derived from a Synechococcus bacterium was expressed on a plasmid using Deinococcus radiodurans as a host to improve the cadmium accumulation ability (Non-Patent Document 7); and an example in which a nickel / cobalt transporter gene derived from Rhodopseudomonas palustris or Novosphingobium aromaticivorans was expressed on a plasmid using Deinococcus radiodurans as a host to improve the efficiency of removing radioactive cobalt from radioactively contaminated water (Non-Patent Document 8). In addition, there is an example in which a divalent mercury ion reduction gene derived from Escherichia coli was expressed on a plasmid using Deinococcus diothermalis as a host, and divalent mercury ions were reduced to less toxic volatile metallic mercury (Non-Patent Document 9).

[0005] In relation to genetic engineering techniques for Deinococcus bacteria, Deinococcus radiodurans or Deinococcus geothermalis ( D. geothermalis) as a host, plasmid vectors for expressing foreign genes are limited to the Deinococcus radiodurans-Escherichia coli shuttle vector pI3, which was developed using the replicon of the Deinococcus radiodurans Sark strain-derived plasmid pUE10 and an E. coli vector, and its derived plasmids (Non-Patent Documents 10 and 11). However, there have been no examples of expressing foreign genes using plasmid vectors with replicons other than the pI3 system.

[0006] In addition, in the process of functional analysis of DNA repair genes in Deinococcus bacteria, it was found that pI3-based plasmids were able to repair DNA in Deinococcus desertii ( D.desert ) can also replicate (Non-Patent Document 12), but no research on bioremediation using Deinococcus desartii has been reported to date. In addition, plasmid vectors that can replicate in Deinococcus desartii are limited to pI3-based plasmids, and there have been no reports of transforming Deinococcus desartii with plasmid vectors that have replicons other than pI3-based.

[0007] In addition, the plasmid vector pZT15 and its derived plasmids have been developed to express genes using Deinococcus grandis as a host (see Patent Document 1 and Non-Patent Document 13), and there is an example of using a rodZ gene-deficient strain of Deinococcus grandis as a host to express the rodZ gene of Deinococcus grandis on a plasmid to create a complementation strain (Non-Patent Document 14), but there have been no reports of research on bioremediation using Deinococcus grandis to date. In addition, there have been no examples showing that plasmids with replicons other than pZT15-based plasmids can replicate in Deinococcus grandis.

[0008] The genome of the standard strain of Deinococcus grandis (ATCC43672) has been reported to have a 3,241,502 bp chromosome, a 389,567 bp plasmid (pDEGR-1), a 373,915 bp plasmid (pDEGR-2), a 91,291 bp plasmid (as none of the prior art documents describe the specific name of this plasmid, it is referred to as "pDEGR-PL" in this specification), and an 8,055 bp plasmid (pDEGR-3), and the genome sequence information of these plasmids is published in the DNA database (Non-Patent Document 15, Non-Patent Document 16). To date, there have been no examples of vectorization of these plasmids of Deinococcus grandis.

[0009] As mentioned above, Deinococcus bacteria are radioresistant bacteria with an extremely high DNA repair ability. Therefore, if DNA regions with the same base sequence exist on multiple plasmids, homologous recombination reactions between the plasmids occur frequently due to the action of homologous recombination repair proteins, making it extremely difficult to stably maintain multiple plasmids within the bacteria.

[0010] Another problem is that the size of DNA fragments that can be stably integrated into a plasmid vector is generally considered to be up to about 10 kbp. In other words, it is believed that expression plasmids incorporating large DNA fragments become unstable in host cells. Therefore, especially when transforming host cells with multiple genes, it is desirable to use multiple types of plasmid vectors so that the total size of genes to be integrated into one type of plasmid can be reduced. However, the repertoire of known plasmid vectors that can be used in Deinococcus grandis is not very large. In addition, as mentioned above, when multiple types of plasmid vectors are used, the homologous recombination reaction between them must also be suppressed. [Prior art documents] [Patent documents]

[0011] [Patent Document 1] Patent No. 3845697 specification

Non-licensed literature

[0012]

Non-licensed literature 1

Non-licensed Document 2

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

[0013] Therefore, an objective of the present invention is to provide a Deinococcus grandis host-vector system that can stably introduce and maintain an expression plasmid in Deinococcus grandis.

[0014] Another additional object of the present invention is to provide a Deinococcus grandis host-vector system capable of using multiple types of plasmid vectors. [Means for solving the problem]

[0015] In order to solve the above problems, the present inventors have realized that by using a modified Deinococcus grandis strain (ATCC43672) in which an endogenous plasmid has been removed (in this specification, when referring to a plasmid, the terms "removal" and "deletion" are used interchangeably), it is possible to prevent homologous recombination between the endogenous plasmid and an introduced expression plasmid, by using the modified Deinococcus grandis as a host cell. Thus, an attempt was made to remove pDEGR-3 as the endogenous plasmid, but it could not be removed by a typical plasmid removal method used by those skilled in the art (see, for example, Trevors, FEMS Microbiol. Rev., 32:149-157, 1986). Facing such technical difficulties, the present inventors have attempted to remove pDEGR-3 by finding a special method described below, and have succeeded in removing the endogenous plasmid.

[0016] The inventors also removed an endogenous plasmid with a size of 91,291 bp present in the standard strain of Deinococcus grandis. The endogenous plasmid pDEGR-PL was relatively easier to remove than pDEGR-3.

[0017] Furthermore, the present inventors have constructed a shuttle vector plasmid (in this specification, the terms "shuttle vector plasmid", "shuttle vector", "shuttle plasmid" and "plasmid vector" are used interchangeably unless otherwise specified) that can be utilized in the Deinococcus grandis host cells modified as described above. Specifically, since the endogenous plasmid pDEGR-3 has been removed from the modified Deinococcus grandis host cells of the present invention, a shuttle vector plasmid containing the replication origin region of said pDEGR-3 was constructed. Then, the present inventors have demonstrated that an expression plasmid based on said shuttle vector plasmid is stably maintained in the modified Deinococcus grandis host cells of the present invention.

[0018] Furthermore, the present inventors have also constructed another shuttle vector plasmid that can be used in the modified Deinococcus grandis host cell of the present invention. Specifically, a shuttle vector plasmid was constructed that contains the pUE10 rep region, which is a replicon derived from the Deinococcus radiodurans Sark strain plasmid pUE10, and a replication origin other than the replication origin of the E. coli-derived plasmid used in the shuttle vector plasmid containing the replication origin of pDEGR-3. In this way, the possibility of homologous recombination between the shuttle vector plasmids was minimized, and both of the expression plasmids based on the two shuttle vector plasmids were stably maintained in the modified Deinococcus grandis host cell of the present invention. Thus, according to the first aspect of the present invention, the following method is provided. <1> 1. A method for transformation of Deinococcus grandis comprising: (1) curing the endogenous plasmid pDEGR-3 or the endogenous plasmid pDEGR-3 and the 91,291 bp endogenous plasmid pDEGR-PL from Deinococcus grandis to obtain a genetically modified microbial host cell; (2) Constructing the following shuttle vector plasmid: a. A shuttle vector plasmid containing the replication origin of pDEGR-3 deleted in (1) above and the replication origin of a plasmid derived from E. coli; b. a shuttle vector plasmid containing a replication origin of a plasmid derived from Deinococcus radiodurans Sark strain and a replication origin of a plasmid derived from Escherichia coli; or c. The shuttle vector plasmid of a) and the shuttle vector plasmid of b), wherein the two shuttle vector plasmids contain replication origins of plasmids derived from different Escherichia coli; (3) constructing the following expression plasmid: a'. an expression plasmid in which one or more genes of interest to be expressed in a host cell are inserted into the cloning site of the shuttle vector plasmid constructed in a above; b'. An expression plasmid in which one or more genes of interest for expression in a host cell are inserted into the cloning site of the shuttle vector plasmid constructed in b above; or c'. An expression plasmid in which one or more target genes to be expressed in a host cell are inserted into the cloning site of each of the shuttle vector plasmids constructed in c above, provided that the target genes inserted into each shuttle vector plasmid are different from each other; (4) introducing the expression plasmid constructed in (3) above into Escherichia coli and amplifying it; and (5) transforming the host cell of (1) above with the expression plasmid amplified in (4) above; The method comprising:

[0019] The first aspect of the present invention also includes the following preferred embodiments. <2> The replication origin region of pDEGR-3 contained in the shuttle vector plasmid of the above a corresponds to pDEGR-3 rep, which is a replicon derived from pDEGR-3. <1> How to. <3> The replication origin region of the plasmid derived from Deinococcus radiodurans Sark strain contained in the shuttle vector plasmid of the above b corresponds to pUE10 rep, which is a replicon derived from the plasmid pUE10 of Deinococcus radiodurans Sark strain. <1> How to. <4> The shuttle vector plasmid (2) further comprises an antibiotic resistance gene as a screening marker. <1> How to.

[0020] Furthermore, pZT15 and its derived plasmids are known as plasmid vectors that can be used for gene expression in Deinococcus grandis host cells (see Patent Document 1 and Non-Patent Document 13). The present inventors have demonstrated that the known plasmid vectors can stably coexist in the modified Deinococcus grandis host cells of the present invention without interfering with either of the two shuttle vector plasmids of the present invention. Thus, the first aspect of the present invention also includes the following embodiments. <5> moreover, (3') constructing an expression plasmid in which one or more target genes to be expressed in a host cell are inserted into a cloning site of a shuttle vector plasmid selected from the plasmids of the Deinococcus / Escherichia coli shuttle vector pZT15 series, the target genes being different from any of the target genes of a' to c' above, and the shuttle vector plasmid containing a replication origin of an E. coli-derived plasmid different from the replication origin of the E. coli-derived plasmids contained in a' to c' above; (4') introducing the expression plasmid constructed in (3') above into Escherichia coli and amplifying it; and (5') transforming the host cell of (1) above with the expression plasmid amplified in (4') above; Including the above <1> ~ <4> Either way. <6> The shuttle vector plasmid (3') further comprises an antibiotic resistance gene as a screening marker. <5> How to.

[0021] Further according to a second aspect of the present invention there is provided the following shuttle vector plasmid suitable for use in the method according to the first aspect of the present invention: <7> A shuttle vector plasmid containing the pDEGR-3 rep region, which is a replicon derived from the endogenous plasmid pDEGR-3 of Deinococcus grandis, the p15A ori region, which is a replicon derived from the E. coli vector pACYC184, and an antibiotic resistance gene as a screening marker. <8> The antibiotic resistance gene is the streptomycin resistance gene from the E. coli vector pGBM5. aad The above is a gene <7> Shuttle vector plasmid. <9> A shuttle vector plasmid containing the pUE10 rep region, which is a replicon derived from the Deinococcus radiodurans Sark strain plasmid pUE10, the pSC101 ori rep region, which is a replicon derived from the E. coli vector pSC101, and a second antibiotic resistance gene as a screening marker. <10> The second antibiotic resistance gene is a chloramphenicol resistance gene from the E. coli vector pcDNA3.1CAT. cat The above is a gene <9> Shuttle vector plasmid.

[0022] Further, according to a third aspect of the present invention, there is provided the following expression plasmid based on the shuttle vector plasmid according to the second aspect of the present invention: <11> the above <7> or <8> An expression plasmid in which one or more target genes are inserted into the cloning site of the shuttle vector plasmid for expression in a host cell. <12> the above <9> or <10> An expression plasmid in which one or more target genes are inserted into the cloning site of the shuttle vector plasmid for expression in a host cell.

[0023] Furthermore, according to a fourth aspect of the present invention, there is provided the following transformant obtainable by the method according to the first aspect of the present invention. <13> the above <11> The expression plasmid for <1> A transformant, wherein the genetically modified organism is introduced into a host cell of a recombinant microorganism. <14> the above <12> The expression plasmid for <1> A transformant, wherein the genetically modified organism is introduced into a host cell of a recombinant microorganism. <15> the above <11> Expression plasmids and <12> wherein each expression plasmid has a different target gene inserted therein, <1> A transformant in which two plasmids have been introduced into a genetically modified microbial host cell, thereby enabling the expression of different genes on the two plasmids. <16> the above <13> a transformant comprising the above-mentioned plasmid and a second expression plasmid further introduced therein, wherein the second expression plasmid comprises one or more second genes of interest inserted into a cloning site of a shuttle vector plasmid selected from the Deinococcus / Escherichia coli shuttle vector pZT15 series of plasmids, and the replication origin region of an E. coli-derived plasmid contained in the shuttle vector plasmid is not the p15A ori region, thereby enabling expression of different genes on two types of plasmids. <17> the above <14> a transformant comprising the above-mentioned plasmid and a second expression plasmid further introduced therein, wherein the second expression plasmid comprises one or more second genes of interest inserted into a cloning site of a shuttle vector plasmid selected from the Deinococcus / Escherichia coli shuttle vector pZT15 series plasmids, and the replication origin region of the E. coli-derived plasmid contained in the shuttle vector plasmid is not the pSC101 ori rep region, thereby enabling expression of different genes on two types of plasmids. <18> the above <15> a third expression plasmid is further introduced into the transformant of the above, wherein the third expression plasmid contains one or more third genes of interest inserted into a cloning site of a shuttle vector plasmid selected from the Deinococcus / Escherichia coli shuttle vector pZT15 series plasmids, and the replication origin region of an E. coli-derived plasmid contained in the shuttle vector plasmid is neither the p15A ori region nor the pSC101 ori rep region, thereby enabling expression of three different genes on plasmids. Effect of the Invention

[0024] According to the present invention, there is provided a Deinococcus grandis host-vector system capable of stably introducing and maintaining an expression plasmid in Deinococcus grandis. As an additional effect of the present invention, there is provided a Deinococcus grandis host-vector system capable of using multiple types of plasmid vectors. [Brief description of the drawings]

[0025] [Figure 1] Figure 1 shows the agarose electrophoresis images of the plasmids extracted from colonies of the Deinococcus grandis standard strain (ATCC43672). Lanes 1 to 10 show the extracts from colonies obtained by culturing at 40°C, and lane 11 shows the extract from a control that was not cultured at 40°C. The 8,055 bp plasmid pDEGR-3 was observed in all lanes 1 to 11. [Diagram 2]Figure 2 shows the results of agarose gel electrophoresis to confirm the presence or absence of PCR amplification products derived from the DEIGR_400031, DEIGR_400086, and DEIGR_400127 genes present in the endogenous plasmid pDEGR-PL of Deinococcus grandis ATCC43672. In the plasmid map of pDEGR-PL in this figure, A indicates the PCR amplification site of the DEIGR_400031 gene region, B indicates the PCR amplification site of the DEIGR_400086 gene region, and C indicates the PCR amplification site of the DEIGR_400127 gene region. In the agarose gel electrophoresis image in this figure, M indicates a commercially available linear DNA molecular size marker. Lanes 1 to 5 show PCR results using genomic DNA prepared from Deinococcus grandis ATCC43672 that was not cultured at 40°C as a control, and lanes 6 to 10 show PCR results using genome DNA from colonies obtained after culture at 40°C as a template. Lanes 1 and 6 show PCR products from the glutamine synthetase gene region (723 bp) present in the chromosome, lanes 2 and 7 show PCR products from the DEIGR_400031 gene region (623 bp) present in the plasmid pDEGR-PL, lanes 3 and 8 show PCR products from the DEIGR_400086 gene region (659 bp) present in the plasmid pDEGR-PL, lanes 4 and 9 show PCR products from the DEIGR_400127 gene region (687 bp) present in the plasmid pDEGR-PL, and lanes 5 and 10 show PCR products from the DEIGR_500007 gene region (750 bp) present in the plasmid pDEGR-3. These results indicated that the plasmid pDEGR-PL was lost in Deinococcus grandis after culture at 40°C, but the plasmid pDEGR-3 was retained. [Diagram 3]Figure 3 shows an agarose gel electrophoresis image showing the results of deleting the plasmid pDEGR-3 from Deinococcus grandis (strain TY1), which was shown to have deleted the plasmid pDEGR-PL but retained the plasmid pDEGR-3. Lane 1 shows the plasmid extracted from Deinococcus grandis TY1 strain, lane 2 shows the plasmid extracted from Deinococcus grandis TY1Nluc strain, lanes 3 and 4 show the extracts from colonies obtained from the bacterial solution cultured at 40°C in TGY medium containing 5ng / μl novobiocin, and lanes 5 and 6 show the extracts from colonies obtained from the bacterial solution cultured at 40°C in TGY medium containing 5ng / μl rifampicin. In lane 1, the 8,055bp plasmid pDEGR-3 was observed, and in lane 2, the 8,961bp plasmid pDEGR-3Δ8LA containing Nluc and streptomycin resistance gene (aad) instead of the DEIGR_500008 gene was observed, whereas no plasmid was observed in lanes 3 to 6. These results indicate that Deinococcus grandis (TY3 strain) lacking the plasmid pDEGR-3 present in the TY1 strain was obtained. [Figure 4] Figure 4 shows the map of the shuttle vector pGRC5 containing the pDEGR replicon of Deinococcus grandis ATCC 43672. In Figure 4, pDEGR-3 rep is the replicon of the 8,055 bp plasmid of Deinococcus grandis ATCC 43672, p15A ori is the replicon derived from the E. coli vector pACYC184, katA-p is the catalase gene promoter of Deinococcus radiodurans, and aad is the streptomycin resistance gene derived from the E. coli vector pGBM5. [Diagram 5]Figure 5 shows a map of shuttle vector pRADN8 containing a replicon derived from Deinococcus radiodurans Sark strain plasmid pUE10. In Figure 5, pUE10 rep is the replicon derived from Deinococcus radiodurans Sark strain plasmid pUE10, pSC101 ori rep is the replicon derived from E. coli vector pSC101, katA-p is the catalase gene promoter of Deinococcus radiodurans, and cat is the chloramphenicol resistance gene derived from E. coli vector pcDNA3.1CAT. [Figure 6] Figure 6 shows the map of the shuttle vector pZT29H constructed based on pZT29, one of the plasmids of the Deinococcus / Escherichia coli shuttle vector pZT15 series. In Figure 6, pUE30 rep is the replicon derived from the plasmid pUE30 of Deinococcus radiopugnans ATCC19172, pUC19 ori is the replicon derived from the E. coli vector pUC19, katA-p is the catalase gene promoter of Deinococcus radiodurans, and hyg is the hygromycin resistance gene derived from the E. coli vector pDR2. [Figure 7]Figure 7 shows agarose gel electrophoresis images showing the retention of the shuttle vectors pGRC5, pRADN8, and pZT29H in transformants of Deinococcus grandis TY3 strain. Lane 1 is the plasmid pDERG-3 (8,055 bp) extracted from Deinococcus grandis TY1 strain, and lane 2 is the extract from Deinococcus grandis TY3 strain. Lane 3 shows a transformant into which pGRC5 (3,908 bp) was introduced, lane 4 shows a transformant into which pZT29H was introduced (bands are seen at the 4,601 bp position derived from the pZT29H monomer and the 9,202 bp position derived from the pZT29H dimer), lane 5 shows a transformant into which pRADN8 was introduced (bands are seen at the 6,046 bp position derived from the pRAND8 monomer and the 12,092 bp position derived from the pRAND8 dimer), lane 6 shows a transformant containing two types of plasmids, pGRC5 and pZT29H, lane 7 shows a transformant containing two types of plasmids, pZT29H and pRADN8, lane 8 shows a transformant containing two types of plasmids, pRADN8 and pGRC5, lane 9 shows a transformant containing three types of plasmids, pGRC5, pZT29H, and pRADN8, and lane M shows a commercially available supercoiled DNA size marker. The arrow indicates genomic DNA contaminating the plasmid extract. These results indicate that the plasmids pGRC5, pZT29H, and pRAND8 can coexist in the Deinococcus grandis TY3 strain. [Figure 8]Figure 8 shows agarose gel electrophoresis images confirming the size and distribution of plasmids in transformants of Deinococcus grandis TY3 strains that were transformed with the shrimp luciferase gene expression plasmids pGRC5GN, pZT29HGN, and pRADN8GN. Lane M shows a commercially available supercoiled DNA size marker, lane 1 shows a transformant transformed with pGRC5GN (4,545 bp), lane 2 shows a transformant transformed with pZT29HGN (5,250 bp), and lane 3 shows a transformant transformed with pRADN8GN (6,683 bp). The arrows indicate genomic DNA present in the plasmid extract. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0026] Deinococcus grandis host cells In the present invention, cells modified by removing (deleting) an endogenous plasmid from a wild-type strain of Deinococcus grandis are used as hosts for transformation. As used herein, the term "endogenous plasmid" refers to a plasmid present in a wild-type strain. As used herein, the term "wild-type strain" includes not only naturally occurring bacterial strains and bacterial strains isolated from the natural world, but also bacterial strains that have been subjected to any modification (whether genetic or non-genetic) other than the modification of the present invention. An example of a wild-type strain that can be used in the present invention is the standard strain of Deinococcus grandis (ATCC43672). This strain is available from the American Type Culture Collection.

[0027] The genome of the standard strain of Deinococcus grandis (ATCC43672) has been reported to have a 3,241,502 bp chromosome and four plasmids: a 389,567 bp plasmid (pDEGR-1), a 373,915 bp plasmid (pDEGR-2), a 91,291 bp plasmid, and an 8,055 bp plasmid (pDEGR-3), and the genome sequence information of these plasmids is published in the DNA database (Non-Patent Document 15: Satoh et al., Genome Announc., 4: e01631-15, 2016, and Non-Patent Document 16: Shibai et al., Microbiol. Resour. Announc., 8: e01226-19, 2019). In addition, since the 91,291 bp plasmid is not given a specific name in those literature and databases, this plasmid is referred to as "pDEGR-PL" in this specification. The sequence information of pDEGR-PL and pDEGR-3 is as follows:<https: / / www.ncbi.nlm.nih.gov / nuccore / BCMS01000006> and<https: / / www.ncbi.nlm.nih.gov / nuccore / BCMS01000007> It is registered as.

[0028] According to the present invention, two plasmids, pDEGR-3 or pDEGR-3 and pDEGR-PL, are removed from a wild-type strain of Deinococcus grandis.

[0029] Various methods are known for deleting plasmids from microorganisms (see Trevors, FEMS Microbiol. Rev., 32:149-157, 1986). The plasmid pDEGR-PL can be deleted by such known methods. For example, as described in the Examples below, the plasmid can be deleted by repeatedly culturing Deinococcus grandis ATCC 43672 at the permissive high temperature.

[0030] However, it was not easy to remove the other plasmid, pDEGR-3, and it could not be deleted by the same method as that for the plasmid pDEGR-PL. Therefore, as described in the Examples below, the present inventors applied a double selection pressure to the microorganism, that is, by inserting a marker gene into the plasmid pDEGR-3 and then repeatedly culturing it at a permissible high temperature, and succeeded in producing a strain from Deinococcus grandis in which the plasmid pDEGR-3 had been deleted.

[0031] The strain (TY3 strain) of Deinococcus grandis ATCC43672 in which the plasmids pDEGR-3 and pDEGR-PL have been deleted, produced as described above, has been internationally deposited under the Budapest Treaty with the National Patent Microorganisms Depositary (NPMD) of the National Institute of Technology and Evaluation on April 12, 2023, under the accession number NITE BP-03880.

[0032] Shuttle Vector Plasmid As mentioned above, Deinococcus bacteria have an extremely high DNA repair ability, so when DNA regions with the same base sequence exist on multiple plasmids, homologous recombination reactions between the plasmids occur frequently due to the action of a group of homologous recombination repair proteins. For this reason, when Deinococcus bacteria are used as hosts, it is extremely difficult to stably maintain multiple plasmids in the bacteria. Therefore, the present invention also provides a shuttle vector plasmid that can be stably maintained in the Deinococcus grandis host cell of the present invention. Specifically, the present inventors constructed a shuttle vector plasmid in which the replication origins of three types of E. coli-derived plasmids with different base sequences and the replication origins of three types of Deinococcus-derived plasmids with different base sequences are linked to avoid instability of the plasmid due to the homology of the base sequence.

[0033] One of the shuttle vector plasmids according to the present invention contains the replication origin of the endogenous plasmid pDEGR-3 of Deinococcus grandis. That is, since the host cell from which the plasmid pDEGR-3 has been removed from Deinococcus grandis is used in the present invention, the replication origin of the plasmid pDEGR-3 can be advantageously utilized. This shuttle vector plasmid can also be used in a host cell from which the plasmid pDEGR-3 and the plasmid pDEGR-PL have been removed from Deinococcus grandis. The replication origin of the endogenous plasmid pDEGR-3 of Deinococcus grandis in the shuttle vector plasmid according to the present invention can be a region corresponding to pDEGR-3 rep, which is a replicon derived from pDEGR-3.

[0034] The shuttle vector plasmid according to the present invention also contains a replication origin of an E. coli-derived plasmid. Such a replication origin may contain any replication origin sequence present in an E. coli-derived plasmid. Thus, a specific example of the shuttle vector plasmid according to the present invention is a shuttle plasmid containing a replicon (pDEGR-3 rep) derived from Deinococcus grandis ATCC43672 plasmid pDEGR-3 and a replicon (p15A ori) derived from E. coli vector pACYC184.

[0035] In one preferred embodiment of the present invention, an antibiotic resistance gene is added to the shuttle plasmid as a screening marker. This ensures the presence of the plasmid in the cells by adding an antibiotic to the culture medium, extraction and purification of the plasmid from the cells, and introduction of the plasmid into the cells by transformation. Non-limiting examples of such antibiotic resistance genes include a streptomycin resistance gene, a chloramphenicol resistance gene, a hygromycin resistance gene, a tetracycline resistance gene, an ampicillin resistance gene, and a puromycin resistance gene. Thus, preferred specific examples of the shuttle vector plasmid of the present invention include a replicon (pDEGR-3 rep) derived from Deinococcus grandis ATCC43672 plasmid pDEGR-3, a replicon (p15A ori) derived from E. coli vector pACYC184, and a streptomycin resistance gene (pGBM5) derived from E. coli plasmid pGBM5. aad ) can be mentioned as a shuttle plasmid.

[0036] Another shuttle vector plasmid according to the present invention contains a replication origin of a plasmid derived from Deinococcus radiodurans Sark strain. An example of the replication origin of the plasmid derived from Deinococcus radiodurans Sark strain is a region corresponding to pUE10 rep, which is a replicon derived from Deinococcus radiodurans Sark strain plasmid pUE10. The present inventors have experimentally confirmed that the shuttle vector plasmid having such a replication origin can also be stably maintained in the Deinococcus grandis host cell of the present invention. More particularly, the present inventors have experimentally demonstrated that the shuttle vector plasmid can coexist with any of the other shuttle vectors of the present invention (i.e., vector plasmids having the replication origin of plasmid pDEGR-3 and / or plasmids of the Deinococcus / E. coli shuttle vector pZT15 series) in the Deinococcus grandis host cell of the present invention without interfering with each other. That is, although it is known that the replication origins of the three E. coli-derived plasmids used in the Examples of this specification can coexist in E. coli without interfering with each other, it was completely unknown whether the replication origins of the three Deinococcus-derived plasmids interfere with each other. In the present invention, it was surprising that three shuttle vector plasmids in which the replication origins of three Deinococcus-derived plasmids with different base sequences were linked together were able to express foreign genes in the Deinococcus grandis host cells of the present invention without interfering with each other.

[0037] The replication origin region of the E. coli-derived plasmid contained in the separate shuttle vector plasmid of the present invention may also contain any replication origin sequence present in the E. coli-derived plasmid. However, when one or more shuttle vector plasmids of the present invention are introduced into the Deinococcus grandis of the present invention, the replication origin regions of the E. coli-derived plasmids contained in each shuttle vector plasmid should be different from each other. Thus, a specific example of the separate shuttle vector plasmid of the present invention is a shuttle plasmid containing the pUE10 rep region, which is a replicon derived from the Deinococcus radiodurans Sark strain plasmid pUE10, and the pSC101 ori rep region, which is a replicon derived from the E. coli vector pSC101.

[0038] It is also preferable to add an antibiotic resistance gene as a screening marker to the separate shuttle vector plasmid of the present invention. However, when one or more shuttle vector plasmids of the present invention are introduced into Deinococcus grandis of the present invention, the antibiotic resistance genes contained in each shuttle vector plasmid should be different from each other. Therefore, specific examples of suitable separate shuttle vector plasmids of the present invention include the replicon (pUE10 rep) derived from Deinococcus radiodurans Sark strain plasmid pUE10, the replicon (pSC101 ori rep) derived from E. coli vector pSC101, and the chloramphenicol resistance gene (pUE10 rep) derived from E. coli vector pSC101. cat ) can be mentioned as a shuttle plasmid.

[0039] In relation to the above antibiotic resistance genes, each of the three shuttle vector plasmids described as examples in this specification (hereinafter referred to as "three shuttle vectors") uses a different antibiotic resistance gene as its screening marker. However, all of these antibiotic resistance genes contain the promoter ( katAIt should be noted that the expression of the three shuttle vectors is controlled by the promoter region (p). In other words, the promoter region has the same base sequence in the three shuttle vectors. However, the inventors have found from their long-term research experience with Deinococcus bacteria that if the size of the promoter region is less than 150 base pairs, homologous recombination does not occur in Deinococcus bacteria (unpublished). Therefore, the inventors could empirically predict that even if the three shuttle vectors coexist in the Deinococcus grandis host of the present invention, their stability is not affected by the base sequence homology provided by the catalase gene promoter. In the present invention, it has been confirmed once again that if the size of the overlapping region between the plasmids is less than 150 base pairs, homologous recombination does not occur in Deinococcus bacteria. However, if desired, different promoters can be used for each antibiotic resistance gene. Furthermore, it will be readily apparent to those skilled in the art that another shuttle vector plasmid according to the present invention, which contains the replication origin region of a plasmid derived from the Deinococcus radiodurans Sark strain, can also be used when a wild-type strain of Deinococcus grandis (e.g., ATCC43672 strain, etc.) is used as a host.

[0040] Other shuttle vector plasmids that may be suitably used in the Deinococcus grandis host of the present invention are shuttle vector plasmids selected from the Deinococcus / E. coli shuttle vector pZT15 series of plasmids. As used herein, the pZT15 series of plasmids refers to plasmids that are suitable for use in Deinococcus radiopugnans ( D. radiopugnans) It is defined as a shuttle vector plasmid that uses a pUE30 fragment involved in the replication of endogenous plasmid pUE30 derived from ATCC19172 strain as a replication origin in Deinococcus bacteria and has a replication origin of a plasmid derived from E. coli. Some of the pZT15-series plasmids are known and can be used in the present invention. Examples of pZT15-series plasmids include pZT15, pZT17, pZT23, pZT27, pZT29 and pZT90 described in the literature (see Japanese Patent No. 3845697 (Patent Document 1) and Satoh et al., Plasmid, 62:1-9, 2009 (Non-Patent Document 13)). Any of them can be used as the Deinococcus / E. coli shuttle vector pZT15-series plasmid of the present invention. In addition, their derivatives, typically shuttle vectors having an E. coli replication origin different from the E. coli replication origin used in the shuttle vector described in the literature and / or an antibiotic resistance gene different from the antibiotic resistance gene used in the shuttle vector described in the literature, can also be used in the present invention. Thus, the Deinococcus / E. coli shuttle vector pZT15 series plasmids of the present invention include shuttle vector plasmids having an E. coli replication origin different from the E. coli replication origin and / or an antibiotic resistance gene different from the antibiotic resistance gene contained in pZT15, pZT17, pZT23, pZT27, pZT29 and pZT90. It will be readily understood by those skilled in the art that other shuttle vector plasmids of the present invention selected from the Deinococcus / E. coli shuttle vector pZT15 series plasmids can also be used when a wild-type strain of Deinococcus grandis (e.g., ATCC43672 strain, etc.) is used as a host.

[0041] The shuttle vector plasmid of the present invention preferably has a multicloning site. The multicloning site may include restriction enzyme recognition sites such as EcoRV, HindIII, ClaI, SalI, XhoI, KpnI, BamHI, XbaI, SalI, PstI, SphI, HindIII, EcoRI and SacI. The shuttle vector plasmid of the present invention having such a multicloning site can be prepared by a method well known to those skilled in the art.

[0042] Expression plasmids The present invention uses an expression plasmid constructed by inserting one or more genes of interest into the cloning site of the shuttle vector plasmid of the present invention. As used herein, the term "gene of interest" refers to a gene encoding a protein to be expressed. The gene of interest may be a gene derived from an organism different from the host microorganism, or may be a gene derived from a microorganism of the same strain, species or genus as the host microorganism, the expression of which is desired to be enhanced in the host cell of the present invention.

[0043] The target gene can be inserted as an "expression cassette" into the cloning site of the shuttle vector plasmid of the present invention. As used herein, "expression cassette" refers to nucleotides containing a nucleic acid sequence that regulates transcription and translation operably linked to a nucleic acid to be expressed or a gene to be expressed. Typically, the expression cassette of the present invention contains a promoter sequence 5' upstream from the coding sequence, a terminator sequence 3' downstream, and optionally further conventional regulatory elements operably linked thereto, and in such a case, the nucleic acid to be expressed or the gene to be expressed is "expressibly introduced" into the host microorganism.

[0044] A promoter is defined as a DNA sequence that allows RNA polymerase to bind to DNA and initiate RNA synthesis, regardless of whether it is a constitutive promoter or a regulated promoter. A strong promoter is a promoter that initiates mRNA synthesis at a high frequency, and is preferably used in the present invention. A non-limiting example of a promoter that can be preferably used in the expression plasmid of the present invention is the promoter of Deinococcus radiodurans. groES The promoter of the gene and its function in overexpressing genes in Deinococcus radiodurans DR1261 , rpmB and dnaK Examples of promoters that can be suitably used in the expression plasmid of the present invention include promoters of genes (see Chen et al., Appl. Environ. Microbiol., 85: e01356-19, 2019). In addition, other promoters that can be suitably used in the expression plasmid of the present invention include pprA , ddrA , ddrB , gyrB Examples of promoters include those that exist upstream of genes and have an operator sequence nearby called a radiation-desiccation response motif (see Tanaka et al., Genetics, 168:21-33, 2004). By placing the gene to be expressed downstream of these promoters, it becomes possible to induce and regulate gene expression by adding ultraviolet light, mitomycin C, methyl methanesulfonate, ethidium bromide, etc. to the culture medium of the transformant (see Narasimha and Basu, J. Biosci., 46:10, 2021).

[0045] A plurality of genes can also be inserted into the shuttle vector plasmid of the present invention. A dual expression vector has already been developed in which high expression promoters are arranged at two locations and separate genes can be inserted downstream of each promoter (see Novy et al., inNovations, 15:2-6, 2002 and Murakami et al., PLOS ONE, 16:e0258553, 2021). By arranging high expression promoters at two or more locations in each shuttle vector plasmid of the present invention, it is possible to express a larger number of gene groups.

[0046] Amplification and transformation The expression plasmid of the present invention can be amplified in E. coli. Any E. coli strain used in ordinary molecular biology research can be used as a host cell for amplifying the expression plasmid of the present invention. For example, the E. coli host can be exemplified by, but is not limited to, E. coli K12 strain or strain derived from E. coli B strain.

[0047] To introduce the expression plasmid of the present invention into a host microbial cell, conventional transfection methods such as coprecipitation and electroporation can be used. Examples of these methods are described in Current Protocols in Molecular Biology, F. Ausubel et al., Publ. Wiley Interscience, New York, 1997, or Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[0048] The E. coli into which the expression plasmid of the present invention has been introduced as described above is cultured under conditions suitable for its growth. Suitable medium compositions, culture conditions, and culture times for transformants derived from various host microbial cells are known to those skilled in the art. The medium may be a natural, semi-synthetic, or synthetic medium containing one or more carbon sources, nitrogen sources, inorganic salts, vitamins, and optionally trace elements or vitamins and other trace components. The medium also contains an antibiotic corresponding to the screening marker (antibiotic resistance gene) contained in the expression plasmid to be amplified. The culture should be continued while maintaining suitable temperature, oxygen concentration, pH, and the like. The suitable culture temperature for E. coli is usually in the range of 25°C to 37°C. It is preferable to culture E. coli under shaking or stirring to ensure an appropriate oxygen concentration during growth. Those culture conditions can be easily set by those skilled in the art. The expression plasmid of the present invention can be recovered by selecting a strain having a desired expression plasmid from among transformant strains that are resistant to the antibiotic added to the medium.

[0049] The recovered expression plasmid can be used to transform the modified Deinococcus grandis host cell of the present invention. Conventional transfection methods, such as the co-precipitation method and electroporation described above, can also be used to introduce the expression plasmid of the present invention into the Deinococcus grandis host cell.

[0050] Application of transformants An example of the application of the Deinococcus grandis transformant according to the present invention includes the realization of bioremediation related to the removal of radioactive substances by utilizing the radiation resistance of the host. In particular, according to the present invention, it is possible to express a plurality of bioremediation-related foreign genes in Deinococcus grandis. For example, it is possible to express a plurality of bioremediation-related foreign genes (e.g., a toluene dioxygenase gene derived from Pseudomonas putida, a divalent mercury ion reduction gene derived from Escherichia coli, a non-specific acid phosphatase gene derived from Salmonella enterica typhi, an alkaline phosphatase gene derived from Sphingomonas bacteria, an endoglucanase gene derived from Bacillus pumilus, a metallothionein gene derived from Synechococcus bacteria, and a nickel / cobalt transporter gene derived from Rhodopseudomonas palustris or Novosphingobium aromaticivorans) in Deinococcus grandis, and it is possible to realize bioremediation related to the removal of radioactive substances by utilizing the radiation resistance of the host.

[0051] The application of the Deinococcus grandis transformant according to the present invention does not necessarily have to be related to the radioresistance property of the Deinococcus bacteria, and therefore other examples of the application of the Deinococcus grandis transformant according to the present invention may include the application of the Deinococcus bacteria to other bioremediation methods, or the use of the bacteria as a genetic resource for other industrial purposes. To date, it has been reported that Deinococcus bacteria have the ability to produce deinoxanthin, an antioxidant with a high ability to remove reactive oxygen species (Lemee et al., Tetrahydron, 53:919-926, 1997), to degrade polycyclic aromatic hydrocarbons, which are urban air pollutants (Waight et al., J. Gen. Microbiol., 53:265-272, 2007), to degrade ethyl acetate, a marine pollutant (Kongpol et al., FEMS Microbiol. Lett., 286:227-235, 2008), to produce polyamines that are effective in extending healthy lifespan (Hamana et al., Journal of Extremophile Microbiology, 8:59-68, 2009), and to degrade dibutyl phthalate, an endocrine disruptor (Liao et al., al., Chemosphere, 78: 342-346, 2010), the ability to produce quorum quenching enzymes that can be used to prevent food spoilage, prevent bacterial infection, and bioremediation (Kelia et al., Open Microbiol. J., 5: 1-3, 2011), the ability to degrade malachite green, which is prohibited for use in aquatic animals (Lv et al., Bioresour. Technol., 144: 275-280, 2013), the ability to degrade 17β-estradiol, an endocrine disrupting substance (Xiong et al., 3 Biotech, 8: 433, 2018), the ability to alleviate heavy metal toxicity in rice (Dai et al., Environ. Pollut., 284: 117-127, 2021), and the ability to reduce arsenic (V) ions, which are highly harmful to the human body, thereby reducing their toxicity (Zhang et al. al., Environ. Pollut., 312:120040, 2022).

[0052] The above-mentioned production of the antioxidant deinoxanthin, which has a high active oxygen scavenging effect; decomposition of polycyclic aromatic hydrocarbons, which are urban air pollutants; decomposition of ethyl acetate, which is a marine pollutant; production of polyamines that are highly effective in extending healthy lifespan; decomposition of dibutyl phthalate, which is an endocrine disruptor; production of quorum quenching enzymes that can be used to prevent food spoilage, prevent bacterial infection, and bioremediation; decomposition of malachite green, which is prohibited for use in aquatic animals; decomposition of 17β-estradiol, which is an endocrine disruptor; mitigation of heavy metal toxicity in rice; and reduction of toxicity by reduction of arsenic (V) ions, which are highly harmful to the human body. By introducing a group of genes derived from Deinococcus bacteria related to the above into the expression plasmid of the present invention and transforming Deinococcus grandis, a host with enhanced harmful substance decomposition ability and useful substance production ability can be efficiently produced, so that in addition to the bioremediation field, it is expected to contribute to the manufacturing field of anti-aging related cosmetics and health foods (see, for example, International Publication No. WO2022 / 050559).

[0053] In particular, since the expression of useful traits such as the ability to degrade harmful substances and the ability to produce useful substances often involves multiple types of genes, by introducing a group of genes derived from Deinococcus bacteria involved in the expression of these useful traits into the expression plasmid of the present invention and transforming Deinococcus grandis, it is possible to efficiently produce a host with enhanced ability to degrade harmful substances and produce useful substances.

[0054] The present invention will be further illustrated by the following examples, which are not intended to limit the invention. EXAMPLES

[0055] Example 1: Construction of a plasmid-deleted strain of Deinococcus grandis, TY1 Deinococcus grandis ATCC43672 obtained from the American Type Culture Collection was cultured in TGY medium (0.5% bactotryptone, 0.3% yeast extract, 0.1% glucose) at 40°C for 48 hours with shaking, and the resulting culture solution was inoculated onto TGY agar medium (0.5% bactotryptone, 0.3% yeast extract, 0.1% glucose, 1.5% bacto agar) and cultured at 30°C for 48 hours. Ten colonies were randomly picked from the TGY agar medium, inoculated into 1 ml of TGY medium, and cultured at 30°C for 24 hours. Glycerol was added to the culture solution to prepare a glycerol stock, which was stored at -80°C.

[0056] A small amount of the glycerol stock was inoculated into 4 ml of TGYM medium (TGY medium + 70 μM manganese chloride), and the cells were cultured at 30°C for 24 hours, from which the plasmid was extracted using a standard method (see Non-Patent Document 13). As a control, the plasmid was also extracted in the same manner from Deinococcus grandis ATCC43672 that had been cultured at 30°C but not at 40°C. Analysis was performed by agarose gel electrophoresis to confirm whether the plasmid pDEGR-3 was retained in the cells.

[0057] The agarose electrophoretic images of the extracted plasmids are shown in Figure 1. In Figure 1, lanes 1 to 10 show the extracts derived from colonies obtained after incubation at 40°C, and lane 11 shows the extract from the control that was not incubated at 40°C. The 8,055 bp plasmid pDEGR-3 was observed in all lanes 1 to 11.

[0058] Glycerol stocks from colonies obtained after culturing at 40°C were inoculated into 4 ml of TGY medium, and genomic DNA was extracted from the cells cultured at 30°C for 24 hours using the FastDNA SPIN Kit (MP Biomedicals). As a control, genomic DNA was also extracted from Deinococcus grandis ATCC43672 that had not been cultured at 40°C in the same manner. PCR was performed using the extracted genomic DNA as a template and Tks Gflex DNA polymerase (Takara Bio), and the presence or absence of PCR amplification products derived from the glutamine synthetase gene present in the chromosome of Deinococcus grandis ATCC43672, the DEIGR_400031 gene, the DEIGR_400086 gene, and the DEIGR_400127 gene present in the plasmid pDEGR-PL, and the DEIGR_500007 gene present in the plasmid pDEGR-3 was confirmed by agarose gel electrophoresis.

[0059] The primers used in the PCR amplification are as follows (SEQ ID NOs: 1 to 10). The primers were selected from the DNA database: Genome sequence of Deinococcus grandis (https: / / www.ncbi.nlm.nih.gov / nuccore / BCMS01000001), (https: / / www.ncbi.nlm.nih.gov / nuccore / BCMS01000006), and (https: / / www.ncbi.nlm.nih.gov / nuccore / BCMS01000007), It was designed with reference to the above.

[0060] Forward primer for glutamine synthetase gene fragment (DEIGR_102181vF: SEQ ID NO: 1) CAGCAGCCCGGCGTTCATCATGCGT

[0061] Reverse primer for glutamine synthetase gene fragment (DEIGR_102181vR: SEQ ID NO: 2) ATGCGCAGCAGGTCCTGGTGCTCGT

[0062] Forward primer for DEIGR_400031 gene fragment (DEIGR_400031vF: SEQ ID NO: 3) CTCAACCTCAAGCAGGAAGCCG

[0063] Reverse primer for DEIGR_400031 gene fragment (DEIGR_400031vR: SEQ ID NO: 4) TTGTTCCCGTCGCCGTTCTTC

[0064] Forward primer for DEIGR_400086 gene fragment (DEIGR_400086vF: SEQ ID NO: 5) ATGACGGGCTGACCGGCGATGCTCT

[0065] Reverse primer for DEIGR_400086 gene fragment (DEIGR_400086vR: SEQ ID NO: 6) AGTTGCGCCGGCTCTCACGTGGACTT

[0066] Forward primer for DEIGR_400127 gene fragment (DEIGR_400127vF: SEQ ID NO: 7) CTCACGCAGCCGAACGCGGAGGTCAA

[0067] Reverse primer for DEIGR_400127 gene fragment (DEIGR_400127vR: SEQ ID NO: 8) CGTGGCCTGCATCAGTGCCCGCAGT

[0068] Forward primer for DEIGR_500007 gene fragment (DEIGR_500008vF: SEQ ID NO: 9) TAGGCTGTCCGCGTGTCCGC

[0069] Reverse primer for DEIGR_500007 gene fragment (DEIGR_500008vR: SEQ ID NO: 10) CTAGTGCCCCAGCTCCGGGAC

[0070] The results are shown in Figure 2. In the plasmid map of pDEGR-PL, A indicates the PCR amplification site of the DEIGR_400031 gene region, B indicates the PCR amplification site of the DEIGR_400086 gene region, and C indicates the PCR amplification site of the DEIGR_400127 gene region. In the agarose electrophoresis image in Figure 2, M indicates a commercially available linear DNA molecular size marker. Lanes 1 to 5 show PCR reactions performed using genomic DNA prepared from Deinococcus grandis ATCC43672 that had not been cultured at 40°C as a control, and lanes 6 to 10 show PCR reactions performed using the genome derived from colonies obtained after culture at 40°C as a template. Lanes 1 and 6 show the PCR product of the glutamine synthetase gene region (723 bp) present in the chromosome, lanes 2 and 7 show the PCR product of the DEIGR_400031 gene region (623 bp) present in the plasmid pDEGR-PL, lanes 3 and 8 show the PCR product of the DEIGR_400086 gene region (659 bp) present in the plasmid pDEGR-PL, lanes 4 and 9 show the PCR product of the DEIGR_400127 gene region (687 bp) present in the plasmid pDEGR-PL, and lanes 5 and 10 show the PCR product of the DEIGR_500007 gene region (750 bp) present in the plasmid pDEGR-3. The PCR products in lanes 2 to 4, which were confirmed to be amplified in the control, were not seen at all in lanes 7 to 9. These results indicated that the plasmid pDEGR-PL was deleted in Deinococcus grandis after culture at 40°C, but the plasmid pDEGR-3 was retained; this strain was named Deinococcus grandis TY1.

[0071] Example 2: Construction of the plasmid-deleted strain TY3 of Deinococcus grandis To facilitate screening of the pDEGR-3 deletion mutant of the Deinococcus grandis TY1 strain, we constructed a Deinococcus grandis strain in which the DEIGR_500008 gene in pDEGR-3 was replaced with the luciferase gene from Deutzia gracilis and the streptomycin resistance gene.

[0072] First, we used the genomic DNA of Deinococcus grandis ATCC43672 as a template to identify the DNA damage response repressor. DdrO A 263 bp promoter fragment of the gene was PCR amplified. Next, a 564 bp luciferase gene fragment from P. niger was PCR amplified using the pNL1.1[Nluc] vector (Promega) as a template. The 263 bp PCR fragment was treated with the restriction enzymes KpnI and NcoI, and the 564 bp PCR fragment was treated with the restriction enzymes NcoI and XhoI. These were then ligated to the KpnI and XhoI sites of the streptomycin resistance gene supply plasmid pKatAAD2 (see Satoh et al., Microbiology, 152:3217-3226, 2006) to construct the plasmid pRNKAAD.

[0073] Next, the genomic DNA of Deinococcus grandis ATCC43672 was used as a template to PCR-amplified fragments of 769 bp upstream of the DEIGR_500008 gene and 770 bp downstream of the DEIGR_500008 gene. The resulting fragments were mixed and treated with restriction enzymes EcoRI, KpnI, PstI, and HindIII. In addition, Nluc and streptomycin resistance genes ( aadA 3,025 bp fragment containing the pUC19 insert was PCR amplified using primers that amplify the pUC19 insert, and the amplified fragment was treated with KpnI and PstI. These three restriction enzyme treated fragments were ligated to the EcoRI and HindIII sites of the plasmid pUC19 to construct the plasmid pΔ500008LA. Furthermore, a fragment PCR amplified using primers that amplify the pUC19 insert using the plasmid pΔ500008LA as a template was used to transform Deinococcus grandis ATCC43672 by the method described in Non-Patent Document 13, and a streptomycin-resistant colony was obtained and named the TY1Nluc strain.

[0074] The primers used for PCR amplification are as follows (SEQ ID NOs: 11 to 20). The primers were selected from the DNA database: - The genome sequence of Deinococcus grandis (https: / / www.ncbi.nlm.nih.gov / nuccore / BCMS01000007), The nucleotide sequence of pNL1.1[Nluc] (https: / / www.ncbi.nlm.nih.gov / nuccore / JQ437370.1), and - The nucleotide sequence of pUC19 (https: / / www.ncbi.nlm.nih.gov / nuccore / 6691170), The design was based on the above. The underlines indicate restriction enzyme digestion sites.

[0075] DNA damage response repressors DdrO Forward primer for the promoter region of the gene (ddrO-RDRM5Kpn: SEQ ID NO: 11) ATCA GGTACC TCTGCTGTGGGCGAATCCTTCTTG

[0076] DNA damage response repressors DdrO Reverse primer for the promoter region of the gene (ddrO-RDRM3Nco: SEQ ID NO: 12) CGTA CCATGG TTCACCTCCTCGGCTGCG

[0077] Forward primer for luciferase gene fragment from Pleurotus niger (Nluc-5Nco: SEQ ID NO: 13) GCCA CCATGG TCTTCACACTCGAAGATTTCGTTGG

[0078] Reverse primer for luciferase gene fragment from Polyporus niger (Nluc-3Xho: SEQ ID NO: 14) GCTA CTCGAG CGGCCGGCCGCCCC

[0079] Forward primer for the upstream region of the DEIGR_500008 gene (DEIGR_500008-Eco5F: SEQ ID NO: 15) A.T.G.C. GATTC TAGGCTGTCCGCGTGTCCGC

[0080] Reverse primer for the upstream region of the DEIGR_500008 gene (DEIGR_500008-Kpn5R: SEQ ID NO: 16) CGAT GGTACC TAGTGCCCCAGCTCCGGGAC

[0081] Forward primer for the downstream region of the DEIGR_500008 gene (DEIGR_500008-Pst3F: SEQ ID NO: 17) A.T.G.C. CTGCAG CCGCCTCAGATGACCTGCTGA

[0082] Reverse primer for the downstream region of the DEIGR_500008 gene (DEIGR_500008-Hin3R: SEQ ID NO: 18) CTAC AAGCT AGCCGCCAACAACACTCATTCC

[0083] Forward primer for amplifying the insert of pUC19 (pKat-FP: SEQ ID NO: 19) CGACGGCCAGTGAATTCGAGC

[0084] Primer for amplifying the insert of pUC19 Reverse primer (pKat-RP: SEQ ID NO: 20) CAGCTATGACCATGATTACGCCAAGC

[0085] In addition to culturing at high temperatures, a method using drugs is known to delete plasmids in microorganisms (see Trevors, FEMS Microbiol. Rev., 32:149-157, 1986). Based on this, the TY1Nluc strain was cultured in TGY medium supplemented with 5 ng / μl novobiocin or 5 ng / μl rifampicin at 40°C for 48 hours with shaking, and the bacterial solution was diluted 100-fold, inoculated again into TGY medium supplemented with 5 ng / μl novobiocin or 5 ng / μl rifampicin, and cultured at 40°C for 72 hours with shaking. This culture was inoculated onto TGY agar medium and cultured stationarily at 30°C for 48 hours. Two colonies that were non-luciferase-producing and streptomycin-sensitive and grew on TGY agar medium were picked, inoculated into 1 ml of TGY medium, and cultured at 30°C for 24 hours. Glycerol stocks were prepared by adding glycerol to the culture solution and stored at -80°C.

[0086] Plasmids were extracted from Deinococcus grandis by the same procedure as in Example 1, and whether or not the plasmids were retained in the bacterial cells was confirmed by agarose gel electrophoresis. The results are shown in Figure 3. In this figure, lane 1 shows the plasmid extracted from Deinococcus grandis TY1 strain, lane 2 shows the plasmid extracted from Deinococcus grandis TY1Nluc strain, lanes 3 and 4 show the extracts derived from colonies obtained from bacterial liquids cultured at 40°C in TGY medium containing 5 ng / μl novobiocin, and lanes 5 and 6 show the extracts derived from colonies obtained from bacterial liquids cultured at 40°C in TGY medium containing 5 ng / μl rifampicin. Lane 1 shows the 8,055 bp plasmid pDEGR-3, and lane 2 shows the plasmid containing Nluc and the streptomycin resistance gene ( aad), whereas no plasmid was observed in lanes 3 to 6. These results indicated that the resulting Deinococcus grandis strain lacked the pDEGR-3 plasmid present in the TY1 strain, and was designated Deinococcus grandis strain TY3.

[0087] Example 3: Construction of Deinococcus grandis-Escherichia coli shuttle vector pGRC5 A 933-bp fragment containing the replicon was amplified by PCR using the E. coli vector pACYC184 as a template and treated with the restriction enzymes SphI and KpnI. In addition, the streptomycin resistance gene ( aad ) was inserted into the catalase gene promoter of Deinococcus radiodurans ( katA The plasmid pKatAAD2, which can express β-KatAAD2 (-p), was digested with SphI and KpnI to obtain a 981 bp DNA fragment. These DNA fragments were ligated to construct the plasmid pKatAAD2L.

[0088] Next, a 2022 bp fragment containing a replicon (pDEGR-3 rep) was amplified by PCR using the 8,055 bp plasmid pDEGR-3 from Deinococcus grandis ATCC43672 as a template and then treated with KpnI. This fragment was ligated into the KpnI site of the plasmid pKatAAD2L to construct the plasmid pGRC5. The map of the shuttle vector pGRC5 is shown in Figure 4. In Figure 4, pDEGR-3 rep is the replicon of the 8,055 bp plasmid from Deinococcus grandis ATCC43672, p15A ori is the replicon derived from the E. coli vector pACYC184, katA-p is the catalase gene promoter from Deinococcus radiodurans, and aad is the streptomycin resistance gene derived from the E. coli vector pGBM5.

[0089] The primers used for PCR amplification are as follows (SEQ ID NOs: 21 to 24). The primers were selected from the DNA database: The nucleotide sequence of pACYC184 (https: / / www.ncbi.nlm.nih.gov / nuccore / X06403), and - The genome sequence of Deinococcus grandis (https: / / www.ncbi.nlm.nih.gov / nuccore / BCMS01000007), The design was based on the above. The underlines indicate restriction enzyme digestion sites.

[0090] Forward primer for the replicon derived from E. coli vector pACYC184 (p15A-FP_Sph: SEQ ID NO: 21) GACT GCATGC GCGCTAGCGGAGTGTATACTGG

[0091] Reverse primer for the replicon derived from E. coli vector pACYC184 (p15A-RP_Kpn: SEQ ID NO: 22) T.G.C.A. GGTACC ACAACTTATATCGTATGGGGCTGAC

[0092] Forward primer for the replicon of the 8,055 bp plasmid pDEGR-3 of Deinococcus grandis ATCC43672 (DEGR3F1Kpn: SEQ ID NO: 23) AGCTT GGTACC ACTTTGACGATCTTGGGGGAATGAG

[0093] Reverse primer for the replicon of the 8,055 bp plasmid pDEGR-3 of Deinococcus grandis ATCC43672 (DEGR3R1Kpn: SEQ ID NO: 24) ACGT GGTACC ATGATGACCACCCGGCTCATG

[0094] Example 4: Construction of Deinococcus grandis-Escherichia coli shuttle vector pRADN8 A 3,164 bp fragment containing the replicon (pUE10 rep) derived from the Deinococcus radiodurans Sark strain plasmid pUE10 was amplified by PCR using the shuttle vector pRADN1 (Ohba et al., Gene, 363:133-141, 2005) derived from the Deinococcus radiodurans-Escherichia coli shuttle vector pI3 as a template, and then treated with the restriction enzymes XhoI and EcoRV. In addition, the chloramphenicol resistance gene ( cat ) was inserted into the catalase gene promoter of Deinococcus radiodurans ( katA A plasmid pKatCAT5 (see Non-Patent Document 13) capable of expressing the ribozyme-dependent cleavage gene (R-p) was treated with XhoI and EcoRV. These fragments were ligated to construct a plasmid pRADN7.

[0095] Next, a 1,997 bp fragment containing a replicon (pSC101 ori rep) was amplified by PCR using the E. coli vector pGBM5 as a template, and then digested with restriction enzymes XhoI and HindIII. Plasmid pRADN7 was also digested with XhoI and HindIII to obtain a 4,063 bp DNA fragment. These DNA fragments were ligated to construct plasmid pRADN8. The map of shuttle vector pRADN8 is shown in Figure 5. In Figure 5, pUE10 rep is the replicon derived from Deinococcus radiodurans Sark strain plasmid pUE10, pSC101 ori rep is the replicon derived from E. coli vector pSC101, katA-p is the catalase gene promoter of Deinococcus radiodurans, and cat is the chloramphenicol resistance gene derived from E. coli vector pcDNA3.1CAT.

[0096] The primers used for PCR amplification are as follows (SEQ ID NOs: 25 to 28). The primers were selected from the DNA database: The sequence of vector pI3 (https: / / www.ncbi.nlm.nih.gov / nuccore / AF206717), and - The nucleotide sequence of plasmid pSC101 (https: / / www.ncbi.nlm.nih.gov / nuccore / NC_002056.1), The design was based on the above. The underlines indicate restriction enzyme digestion sites.

[0097] Forward primer for the replicon derived from Deinococcus radiodurans Sark strain plasmid pUE10 (pRADN1-Xho-F2: SEQ ID NO: 25) A.T.G.C. CTCGAG CCAGTTCTCGCGTGTCAGCCGA

[0098] Reverse primer for the replicon derived from Deinococcus radiodurans Sark strain plasmid pUE10 (pRADN1-EcoRV-R: SEQ ID NO: 26) GCAT GATATC CGATTCGACCTGCAGGCATGC

[0099] Forward primer for the replicon derived from E. coli vector pSC101 (pGBM5-HindIII-F: SEQ ID NO: 27) GCAT AAGCT GACTCTAGAGGATCCCCGGG

[0100] Reverse primer for the replicon derived from E. coli vector pSC101 (pGBM5-XhoI-R: SEQ ID NO: 28) A.T.G.C. CTCGAG ATGTAACGGTGAACAGTTGTTCTAC

[0101] Example 5: Construction of Deinococcus grandis-Escherichia coli shuttle vector pZT29H A 2,109 bp DNA fragment obtained by treating the shuttle vector pZT29 described in Non-Patent Document 13, which is one of the pZT15 shuttle vectors described in Patent Document 1, with the restriction enzyme KpnI was ligated to a 2,492 bp DNA fragment obtained by treating the hygromycin resistance gene supply plasmid pKatHPH described in Murakami et al., PLOS ONE, 16: e0258553, 2021 with KpnI to construct the shuttle vector pZT29H. The map of the shuttle vector pZT29H is shown in FIG. 6. In FIG. 6, pUE30 rep represents the replicon derived from the plasmid pUE30 of Deinococcus radiopugnans ATCC19172, pUC19 ori represents the replicon derived from the E. coli vector pUC19, katA-p represents the catalase gene promoter of Deinococcus radiodurans, and hyg represents the hygromycin resistance gene derived from the E. coli vector pDR2.

[0102] Example 6: Creation of Deinococcus grandis transformants using Deinococcus grandis-Escherichia coli shuttle vectors The shuttle vector pGRC5 constructed in Example 3, the shuttle vector pRADN8 constructed in Example 4, and the shuttle vector pZT29H constructed in Example 5 were introduced into the Deinococcus grandis TY3 strain prepared in Example 2 to obtain transformants. Streptomycin was used as a selection marker when obtaining transformants into which pGRC5 was introduced, chloramphenicol was used when obtaining transformants into which pRADN8 was introduced, and hygromycin was used when obtaining transformants into which pZT29H was introduced. Next, by the same procedure as in Example 1, plasmids were extracted from the transformants of Deinococcus grandis, and it was confirmed by agarose gel electrophoresis whether the plasmids were retained in the cells.

[0103] The results are shown in Figure 7. In this figure, lane 1 is the plasmid pDERG-3 (8,055 bp) extracted from Deinococcus grandis strain TY1, lane 2 is the extract from Deinococcus grandis strain TY3. Lane 3 is a transformant with pGRC5 (3,908 bp), lane 4 is a transformant with pZT29H (4,601 bp), lane 5 is a transformant with pRADN8 (6,046 bp), lane 6 is a transformant containing two types of plasmids pGRC5 and pZT29H simultaneously, lane 7 is a transformant containing two types of plasmids pZT29H and pRADN8 simultaneously, lane 8 is a transformant containing two types of plasmids pRADN8 and pGRC5 simultaneously, lane 9 is a transformant containing three types of plasmids pGRC5, pZT29H, and pRADN8 simultaneously, and lane M is a commercially available supercoiled DNA size marker. The arrows indicate genomic DNA mixed in the plasmid extract.

[0104] In lanes 3, 6, and 9, a band was observed at 3,908 bp derived from pGRC5, indicating that pGRC5 exists only as a monomer in D. grandis TY3. In lane 4, a band was observed at 4,601 bp derived from the pZT29H monomer and a band was observed at 9,202 bp derived from the pZT29H dimer. In lane 5, a band was observed at 6,046 bp derived from the pRAND8 monomer and a band was observed at 12,092 bp derived from the pRAND8 dimer. Comparing lanes 3, 4, 6, and 9, there was no significant difference in the abundance of plasmid pGRC5 between the transformants containing only plasmid pGRC5 and those containing other plasmids pGRC5 and pZT29H. Similarly, comparing lanes 4, 6, 7, and 9, there was no significant difference in the abundance of plasmid pZT29H between the transformants containing plasmid pZT29H alone and those containing other plasmids pGRC5 and pRAND8. On the other hand, comparing lanes 5, 7, 8, and 9, the transformants containing other plasmids pGRC5 and pZT29H together contained more plasmid pRAND8 as dimers than as monomers than the transformants containing plasmid pRAND8 alone. In lane 8, multiple bands were observed at a lower mobility than the position where genomic DNA was electrophoresed, which was probably due to the formation of multimers of pRADN8 in the transformants containing plasmids pRADN8 and pGRC5. These results indicate that plasmids pGRC5, pZT29H, and pRAND8 can coexist in Deinococcus grandis TY3.

[0105] Example 7: Construction of a Plasmid Expressing Ophiopogon luciferase Gene The shuttle plasmid pZT90 described in Non-Patent Document 13 is a plasmid for the transcription factor 10 of Deinococcus radiodurans. groES It is an expression vector with a promoter sequence. groESA 152 bp fragment containing the promoter region was amplified by PCR and then treated with restriction enzymes KpnI and NcoI. This DNA fragment was inserted into the KpnI-NcoI site of the plasmid pRNKAAD constructed in Example 2 to construct pGNKAAD.

[0106] Deinococcus radiodurans was transformed with plasmid pGNKAAD as a template. groES The promoter and the Pale Ophiopogon luciferase gene were PCR-amplified using the primers of SEQ ID NOs: 31 and 32 to obtain a 669-bp DNA fragment, which was then treated with the restriction enzymes BamHI and PstI and inserted into the restriction enzyme BamHI-PstI site of the shuttle vector pGRC5 constructed in Example 3 to construct the luciferase gene expression plasmid pGRC5GN.

[0107] Deinococcus radiodurans was transformed with plasmid pGNKAAD as a template. groES The promoter and the Pale Ophiopogon luciferase gene were PCR-amplified using the primers of SEQ ID NOs: 33 and 34 to obtain a 667-bp DNA fragment, which was then treated with the restriction enzymes SalI and HindIII and inserted into the restriction enzyme SalI-HindIII site of the shuttle vector pRADN8 constructed in Example 4 to construct the luciferase gene expression plasmid pRADN8GN.

[0108] Deinococcus radiodurans was transformed with plasmid pGNKAAD as a template. groES The promoter and the Pale Ophiopogon luciferase gene were PCR-amplified using the primers of sequence numbers 31 and 35 to obtain a 669-bp DNA fragment, which was then treated with the restriction enzymes BamHI and XbaI and inserted into the restriction enzyme BamHI-XbaI site of the shuttle vector pZT29H constructed in Example 5 to construct the luciferase gene expression plasmid pZT29HGN.

[0109] The primers used for PCR amplification are as follows (SEQ ID NOs: 29 to 35). The genome sequence of Deinococcus radiodurans (https: / / www.ncbi.nlm.nih.gov / nuccore / NZ_CP038663.1), and - The base sequence of pNL1.1[Nluc] (https: / / www.ncbi.nlm.nih.gov / nuccore / JQ437370.1), The design was based on the above. The underlines indicate restriction enzyme digestion sites.

[0110] Plasmid pZT90 groES Forward primer for the promoter region (groEp-Kpn-F: SEQ ID NO: 29) CGAC GGTACC GATTGTCAGCTTCGGTCA

[0111] Plasmid pZT90 groES Reverse primer for the promoter region (groEp-Nco-R: SEQ ID NO: 30) CTTA CCATGG GGGGTCCTCCTGTGAGTGAGATG

[0112] Deinococcus radiodurans groES Forward primer (GN-BamF: SEQ ID NO: 31) for linking the promoter and the Ophiopogon luciferase gene to the plasmid pGRC5 or pZT29H AGCTT GGATCC ATTGTCAGCTTCGGTCAGTTGACAT

[0113] Deinococcus radiodurans groES Reverse primer (GN-PstR: SEQ ID NO: 32) for linking the promoter and Ophiopogon luciferase gene to the plasmid pGRC5 CTAG CTGCAG TTACGCCAGAATGCGTTCGCA

[0114] Deinococcus radiodurans groESForward primer (GN-SalF: SEQ ID NO: 33) for linking the promoter and Ophiopogon luciferase gene to the plasmid pRADN8 AGCTT GTC GAC ATTGTCAGCTTCGGTCAGTTGACAT

[0115] Deinococcus radiodurans groES Reverse primer (GN-HinR: SEQ ID NO: 34) for linking the promoter and Ophiopogon luciferase gene to the plasmid pRADN8 CTAG AAGCT ACGCCAGAATGCGTTCGCA

[0116] Deinococcus radiodurans groES Reverse primer (GN-XbaR: SEQ ID NO: 35) for linking the promoter and Ophiopogon luciferase gene to the plasmid pZT29H CTAG TCTAG TTACGCCAGAATGCGTTCGCA

[0117] Example 8: Relative Plasmid Copy Number Measurement The shrimp luciferase gene expression plasmids pGRC5GN, pZT29HGN, and pRADN8GN constructed in Example 7 were introduced into the Deinococcus grandis TY3 strain in the same manner as in Example 6 to obtain transformants. Next, plasmids were extracted from the Deinococcus grandis transformants, and the size and state of existence of the plasmids were confirmed by agarose gel electrophoresis. The results are shown in FIG. 8. In FIG. 8, lane M shows a commercially available supercoiled DNA size marker, lane 1 shows a transformant into which pGRC5GN (4,545 bp) was introduced, lane 2 shows a transformant into which pZT29HGN (5,250 bp) was introduced, and lane 3 shows a transformant into which pRADN8GN (6,683 bp) was introduced. The arrows indicate genomic DNA mixed in the plasmid extract.

[0118] In lane 1, a band at 4,545 bp derived from pGRC5GN was observed, indicating that the plasmid carrying the pDEGR-3 replicon exists only as a monomer in Deinococcus grandis TY3, similar to the results for pGRC5 shown in Example 6. In lane 2, bands at 5,250 bp derived from the pZT29HGN monomer and at 10,500 bp derived from the pZT29H dimer were observed. In lane 3, a band at 6,683 bp derived from the pRADN8GN monomer, as well as a large band indicating a multimeric structure of the plasmid, were observed.

[0119] To compare the expression levels of the B. grandis luciferase gene contained in the three types of transformants into which expression plasmids were introduced, the luciferase activity of the transformants (relative light emission / absorbance at 600 nm of the transformant culture solution) was measured using the Nano-Glo Luciferase Assay System (Promega). As a result, the luciferase activity of the transformant into which pGRC5GN was introduced was 8,886 ± 152, that of the transformant into which pZT29HGN was introduced was 12,706 ± 86, and that of the transformant into which pRADN8GN was introduced was 2,792 ± 106, and these values ​​were considered to be proportional to the fluorescence intensity of the band of the expression plasmid shown in Figure 8. These results demonstrated gene expression in the Deinococcus grandis TY3 strain of the three types of expression plasmids containing the B. grandis luciferase gene. [Industrial Applicability]

[0120] The present invention can be used in the environmental industry, such as bioremediation, and in the cosmetics and health food manufacturing fields. [Accession number]

[0121] Deinococcus grandis TY3 strain ( Deinococcus grandisTY3) has been deposited internationally under the Budapest Treaty on April 12, 2023 at the National Patent Microorganisms Depositary (NPMD) of the National Institute of Technology and Evaluation, located at Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan, 292-0818, under the accession number NITE BP-03880.

Claims

1. 1. A method for transformation of Deinococcus grandis comprising: (1) removing the endogenous plasmid pDEGR-3 or the endogenous plasmid pDEGR-3 and the 91,291 bp endogenous plasmid pDEGR-PL from Deinococcus grandis to obtain a genetically modified microbial host cell; (2) Constructing the following shuttle vector plasmid: a. a shuttle vector plasmid containing the replication origin of pDEGR-3 deleted in (1) above and the replication origin of a plasmid derived from E. coli; b. A shuttle vector plasmid containing a replication origin of a plasmid derived from Deinococcus radiodurans Sark strain and a replication origin of a plasmid derived from Escherichia coli; or c. The shuttle vector plasmid of a) and the shuttle vector plasmid of b), wherein the two shuttle vector plasmids contain replication origins of plasmids derived from different Escherichia coli; (3) Constructing the following expression plasmid: a'. an expression plasmid in which one or more target genes to be expressed in a host cell are inserted into the cloning site of the shuttle vector plasmid constructed in the above a; b'. An expression plasmid in which one or more genes of interest for expression in a host cell are inserted into the cloning site of the shuttle vector plasmid constructed in b above; or c'. An expression plasmid in which one or more target genes to be expressed in a host cell are inserted into the cloning site of each of the shuttle vector plasmids constructed in c above, provided that the target genes inserted into each shuttle vector plasmid are different from each other; (4) introducing the expression plasmid constructed in (3) above into Escherichia coli and amplifying it; and (5) transforming the host cell of (1) above with the expression plasmid amplified in (4) above; The method comprising:

2. The method according to claim 1, wherein the replication origin region of pDEGR-3 contained in the shuttle vector plasmid of (a) corresponds to pDEGR-3 rep, which is a replicon derived from pDEGR-3.

3. The method according to claim 1, wherein the replication origin of a plasmid derived from the Deinococcus radiodurans Sark strain contained in the shuttle vector plasmid (b) corresponds to pUE10 rep, which is a replicon derived from the Deinococcus radiodurans Sark strain plasmid pUE10.

4. The method of claim 1, wherein the shuttle vector plasmid (2) further comprises an antibiotic resistance gene as a screening marker.

5. moreover, (3') constructing an expression plasmid in which one or more target genes to be expressed in a host cell are inserted into a cloning site of a shuttle vector plasmid selected from the Deinococcus / Escherichia coli shuttle vector pZT15 series plasmids, with the proviso that the target genes are different from any of the target genes of a' to c' above, and the shuttle vector plasmid contains a replication origin of an E. coli-derived plasmid different from the replication origin of the E. coli-derived plasmid contained in a' to c' above; (4') introducing the expression plasmid constructed in (3') above into Escherichia coli and amplifying it; and (5') transforming the host cell of (1) above with the expression plasmid amplified in (4') above; The method of claim 1 , comprising:

6. The method of claim 5, wherein the (3') shuttle vector plasmid further comprises an antibiotic resistance gene as a screening marker.

7. A shuttle vector plasmid comprising the pDEGR-3 rep region, which is a replicon derived from the endogenous plasmid pDEGR-3 of Deinococcus grandis, the p15A ori region, which is a replicon derived from the E. coli vector pACYC184, and an antibiotic resistance gene as a screening marker.

8. 8. The shuttle vector plasmid of claim 7, wherein the antibiotic resistance gene is the aad gene, which is a streptomycin resistance gene from the E. coli vector pGBM5.

9. A shuttle vector plasmid comprising the pUE10 rep region, which is a replicon derived from the Deinococcus radiodurans Sark strain plasmid pUE10, the pSC101 ori rep region, which is a replicon derived from the E. coli vector pSC101, and a second antibiotic resistance gene as a screening marker.

10. 10. The shuttle vector plasmid of claim 9, wherein the second antibiotic resistance gene is the cat gene, a chloramphenicol resistance gene from the E. coli vector pcDNA3.1CAT.

11. 9. An expression plasmid comprising one or more target genes inserted into the cloning site of the shuttle vector plasmid according to claim 7 or 8 for expression in a host cell.

12. 11. An expression plasmid comprising one or more target genes inserted into the cloning site of the shuttle vector plasmid according to claim 9 or 10 for expression in a host cell.

13. A transformant, comprising the expression plasmid according to claim 11 introduced into the genetically modified microbial host cell according to claim 1.

14. A transformant, comprising the expression plasmid according to claim 12 introduced into the genetically modified microbial host cell according to claim 1.

15. A transformant in which an expression plasmid according to claim 11 and an expression plasmid according to claim 12, each of which has a different target gene inserted therein, are introduced into a genetically modified microbial host cell according to claim 1, thereby enabling expression of different genes on the two types of plasmids.

16. 14. A transformant according to claim 13, further comprising a second expression plasmid, wherein the second expression plasmid comprises a second one or more target genes inserted into a cloning site of a shuttle vector plasmid selected from the Deinococcus / Escherichia coli shuttle vector pZT15 series plasmids, and the replication origin region of an Escherichia coli-derived plasmid contained in the shuttle vector plasmid is not the p15A ori region, thereby enabling expression of different genes on two types of plasmids.

17. 15. A transformant according to claim 14, further comprising a second expression plasmid, the second expression plasmid comprising one or more second target genes inserted into a cloning site of a shuttle vector plasmid selected from the Deinococcus / Escherichia coli shuttle vector pZT15 series plasmids, and the replication origin region of an Escherichia coli-derived plasmid contained in the shuttle vector plasmid is not the pSC101 ori rep region, thereby enabling expression of different genes on two types of plasmids.

18. 16. A transformant according to claim 15, further comprising a third expression plasmid, the third expression plasmid comprising one or more third target genes inserted into a cloning site of a shuttle vector plasmid selected from the Deinococcus / Escherichia coli shuttle vector pZT15 series plasmids, and the replication origin region of an Escherichia coli-derived plasmid contained in the shuttle vector plasmid is neither the p15A ori region nor the pSC101 ori rep region, thereby enabling expression of three different genes on the plasmids.

Images