Nucleoside derivative and use thereof

Abstract

To provide a nucleoside derivative or a salt thereof, which can yield an oligonucleotide derivative or a salt thereof with high thermal stability when used as a component of a double-stranded nucleic acid such as double-stranded RNA.SOLUTION: Provided is a nucleoside derivative represented by formula (1), or a salt thereof. In the formula, R1 represents an alkoxy group, a hydrogen atom, or a halogen atom; R2 and R4 may be the same or different and each represent a hydrogen atom, a protecting group for a hydroxyl group, a phosphate group, a protected phosphate group, or -P(=O)nR5R6; R3 represents -(CH2)mNHR7; and B represents a purin-9-yl group, a 2-oxo-pyrimidin-1-yl group, a substituted purin-9-yl group, or a substituted 2-oxo-pyrimidin-1-yl group.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to nucleoside derivatives and uses thereof. [Background technology]

[0002] There are many known diseases, including cancer, that are thought to be related to gene mutations and abnormal gene expression. Nucleic acid drugs, such as siRNA and antisense nucleic acids, which suppress gene expression, are useful for such diseases and have excellent pharmaceutical potential. For example, siRNA is a double-stranded RNA, and when introduced into the cytoplasm, it interacts with proteins such as Argonaute2 (Ago2) to form a complex called RISC (RNA-induced silencing complex). After that, one of the double strands of siRNA is cleaved in RISC to become single-stranded, forming a mature RISC. At this time, the strand that is cleaved and removed outside of RISC is called the passenger strand, and the strand that remains in the mature RISC is called the guide strand. Then, the guide strand of the mature RISC recognizes the mRNA with a complementary sequence, and the expression of the target gene is suppressed by cleaving and decomposing it with the endonuclease activity of Ago2.

[0003] On the other hand, siRNA has problems such as difficulty in permeating cell membranes and susceptibility to degradation by nucleases. In addition, although siRNA has high target selectivity, it also has the problem of difficulty in selectively transporting it to target tissues. To solve these problems, delivery carriers such as lipid nanoparticles (LNPs) have been considered. In addition, attempts have been made to modify the sugar moiety (ribose) of nucleoside derivatives or their salts, which are components of RNA, by introducing an aminomethyl group into the sugar moiety (ribose) (Non-Patent Documents 1 to 4). However, previous attempts have shown that the delivery carriers have some shortcomings, and even modification of the sugar portion (ribose) of the nucleoside derivatives has not been able to provide sufficient cell membrane permeability, ribonuclease resistance, and target tissue delivery.

[0004] Therefore, a technique has been proposed for improving properties such as ribonuclease resistance and cell membrane permeability by introducing a basic substituent such as an amino group into the 4'-position of the sugar portion (ribose or deoxyribose) of a nucleoside derivative or a salt thereof (hereinafter sometimes abbreviated as "nucleoside derivative"), or by substituting a halogen atom for the 2'-position hydroxyl group (Patent Document 1). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2018 / 110678 [Non-patent literature]

[0006] [Non-Patent Document 1] HELVATICA CHIMICA ACTA Vol. 83 (2000) 128-151 [Non-Patent Document 2] The Journal of Organic Chemistry 2012, 77, 3233-3245 [Non-Patent Document 3] Bioorganic & Chemistry letters(1999)2667-2672 [Non-Patent Document 4] The Journal of Organic Chemistry 2013, 78, 9956-9962 Summary of the Invention [Problem to be solved by the invention]

[0007] In siRNA, the puckering of the sugar moiety (ribose or deoxyribose) of the nucleoside derivative, which is a component of double-stranded RNA, affects the formation of the double strand. Generally, there are N-type (C3'-endo) and S-type (C2'-endo) puckering of the sugar moiety, and the N-type sugar moiety has a high affinity for single-stranded RNA, while the S-type sugar moiety has a high affinity for single-stranded DNA. Therefore, by increasing the proportion of N-type sugar moieties, the thermal stability of the double-stranded RNA can be increased. However, when a basic substituent such as an amino group is introduced at the 4' position of the sugar moiety (ribose or deoxyribose), this substituent interacts with the group at the 2' position, which tends to bias the sugar moiety from N-type to S-type, which can reduce the thermal stability of the double-stranded RNA.

[0008] The present invention has been made to solve the above-mentioned problems, and an object of the present invention is to provide a nucleoside derivative or a salt thereof which, when used as a component of a double-stranded nucleic acid such as a double-stranded RNA, can give an oligonucleotide derivative or a salt thereof having high thermal stability. Another object of the present invention is to provide an oligonucleotide derivative or a salt thereof that has high thermal stability when formed into a double-stranded nucleic acid such as double-stranded RNA and has sufficient gene expression-inhibiting ability as a nucleic acid drug such as siRNA. [Means for solving the problem]

[0009] In order to solve the above problems, the inventors have conducted intensive research focusing on the structure of the sugar moiety (ribose or deoxyribose) of nucleoside derivatives, and as a result, have discovered that the proportion of N-type sugar moieties can be increased by introducing a basic substituent such as an aminoalkyl group via an oxygen atom into the 4' position of the sugar moiety, thereby completing the present invention.

[0010] That is, the present invention relates to a nucleoside derivative represented by the following formula (1) or a salt thereof.

[0011] [ka]

[0012] In the formula, R 1 represents an alkoxy group, a hydrogen atom or a halogen atom; R 2 and R 4 may be the same or different, and each represents a hydrogen atom, a protecting group for a hydroxyl group, a phosphate group, a protected phosphate group, or -P(=O) n R 5 R 6 (n represents 0 or 1, R 5 and R 6 may be the same or different and represent any one of a hydrogen atom, a hydroxyl group, a protected hydroxyl group, a mercapto group, a protected mercapto group, an alkoxy group, a cyanoalkoxy group, an amino group, and a substituted amino group, provided that when n is 1, R 5 and R 6 (Both cannot be hydrogen atoms), and R 3 is -(CH2) m NHR 7 (m represents an integer from 1 to 6, R 7 represents a hydrogen atom, an alkyl group, an alkenyl group, or a protecting group for an amino group), and B represents a purin-9-yl group, a 2-oxo-pyrimidin-1-yl group, a substituted purin-9-yl group, or a substituted 2-oxo-pyrimidin-1-yl group.

[0013] The present invention also relates to an oligonucleotide derivative or a salt thereof, which contains at least one partial structure represented by the following formula (2):

[0014] [ka]

[0015] In the formula, R 1 represents an alkoxy group, a hydrogen atom or a halogen atom; R 3 is -(CH2) m NHR 7 (m represents an integer from 1 to 6, R 7represents a hydrogen atom, an alkyl group, an alkenyl group, or a protecting group for an amino group), and B represents a purin-9-yl group, a 2-oxo-pyrimidin-1-yl group, a substituted purin-9-yl group, or a substituted 2-oxo-pyrimidin-1-yl group.

[0016] Furthermore, the present invention relates to an siRNA comprising the above-mentioned oligonucleotide derivative or a salt thereof as an active ingredient. Effect of the Invention

[0017] When the nucleoside derivative or a salt thereof of the present invention is used as a component of a double-stranded nucleic acid such as a double-stranded RNA, an oligonucleotide derivative or a salt thereof having high thermal stability can be obtained. Furthermore, the oligonucleotide derivative or a salt thereof of the present invention has high thermal stability when it forms a double-stranded nucleic acid such as double-stranded RNA, and can have sufficient gene expression-inhibiting ability as a nucleic acid drug such as siRNA. [Brief description of the drawings]

[0018] [Figure 1] 1 shows melting curves illustrating the evaluation results of the thermal stability of Duplexes 1 to 3 synthesized in the Examples. [Diagram 2] 1 shows melting curves showing the evaluation results of the thermal stability of siRNAs 1 to 7 synthesized in the Examples. [Diagram 3] 1 shows the results of evaluation of the RNA interference ability of siRNAs 1 to 7 synthesized in the examples. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] Hereinafter, preferred embodiments of the present invention will be described in detail, but the present invention should not be interpreted as being limited to these, and various modifications and improvements can be made based on the knowledge of those skilled in the art without departing from the gist of the present invention. The multiple components disclosed in this embodiment can be appropriately combined to form various inventions. For example, some components may be deleted from all the components shown in this embodiment, or components of different embodiments may be appropriately combined.

[0020] <Nucleoside derivatives or their salts> The nucleoside derivative and its salt according to the embodiment of the present invention have a basic substituent such as an aminoalkyl group bonded to the 4'-position of the sugar moiety (ribose or deoxyribose) via an oxygen atom. In this specification, the term "nucleoside derivative" includes a nucleotide derivative having a phosphate bonded to the 5'-position of the sugar moiety. By introducing a basic substituent such as an aminoalkyl group bonded via an oxygen atom to the 4'-position of the sugar moiety, it becomes possible to control the puckering of the sugar moiety by the stereoelectronic effect. Specifically, the group at the 4'-position of the sugar moiety interacts with the group at the 2'-position to suppress the deviation from N-type to S-type, and the proportion of N-type sugar moieties can be increased. Therefore, an oligonucleotide derivative having a structure derived from this nucleoside derivative or a salt thereof (hereinafter sometimes abbreviated as "oligonucleotide derivative") can improve the thermal stability of double-stranded nucleic acids such as double-stranded RNA. Therefore, when this oligonucleotide derivative is used in siRNA, the thermal stability of the double-stranded RNA of the siRNA can be improved, and the binding affinity with the target mRNA can be increased.

[0021] Furthermore, since the nucleoside derivative according to the embodiment of the present invention has a basic substituent such as an aminoalkyl group bonded to the 4' position of the sugar portion (ribose or deoxyribose) via an oxygen atom, an oligonucleotide derivative having a structure derived from this nucleoside derivative has a charge control ability to neutralize at least a portion of the negative charge caused by the phosphate group or the like possessed by the oligonucleotide derivative.

[0022] The nucleoside derivative according to the embodiment of the present invention can be represented by the following formula (1). This nucleoside derivative is a component of an oligonucleotide derivative and can be introduced into the structure of the oligonucleotide derivative by a method well known to those skilled in the art. In addition, this nucleoside derivative can improve the cell membrane permeability and ribonuclease resistance of the oligonucleotide derivative.

[0023] [ka]

[0024] [R 1 About R 1 R represents an alkoxy group, a hydrogen atom or a halogen atom. 1 When R is an alkoxy group, the oligonucleotide derivative is a ribonucleotide derivative. 1 When is a hydrogen atom or a halogen atom, the oligonucleotide derivative is a deoxyribonucleotide derivative.

[0025] (alkoxy group) The alkoxy group is not particularly limited, but may be a linear, branched, cyclic, or combination thereof, saturated alkyl ether group, or the like. The alkoxy group is preferably a lower alkoxy group. In this specification, the term "lower" means that the number of carbon atoms constituting the group is 10 or less, preferably 1 to 6, more preferably 1 to 5, even more preferably 1 to 4, and particularly preferably 1 to 3. The lower alkoxy group is preferably an alkoxy group having 1 to 4 carbon atoms, and more preferably an alkoxy group having 1 to 3 carbon atoms. Examples of the alkoxy group having 1 to 3 carbon atoms include a methoxy group, an ethoxy group, an n-propoxy group, a cyclopropoxy group, and a cyclopropylmethoxy group.

[0026] (Halogen atom) The halogen atom is not particularly limited, but a chlorine atom, an iodine atom, a fluorine atom, a bromine atom, etc. can be used. By bonding the halogen atom downward (α-position) to the carbon atom at the 2' position of ribose, the proportion of N-type ribose can be increased, and the thermal stability of double-stranded nucleic acids such as double-stranded RNA can be further improved by the synergistic effect with the substituent at the 4' position of ribose. When the halogen atom is bonded upward (β-position), the proportion of S-type ribose tends to be higher, and the effect of the substituent at the 4' position of ribose reduces the effect of suppressing bias toward S-type.

[0027] [R 2 and R 4 About R 2 and R 4 may be the same or different, and each represents a hydrogen atom, a protecting group for a hydroxyl group, a phosphate group, a protected phosphate group, or -P(=O) n R 5 R 6 (n represents 0 or 1, R 5 and R 6 may be the same or different and represent any one of a hydrogen atom, a hydroxyl group, a protected hydroxyl group, a mercapto group, a protected mercapto group, an alkoxy group, a cyanoalkoxy group, an amino group, and a substituted amino group, provided that when n is 1, R 5 and R 6 (Both cannot be hydrogen atoms).

[0028] (Hydroxyl protecting group) The protective group for the hydroxyl group is well known to those skilled in the art, and for example, those described in Protective Groups in Organic Synthesis (John Wiley and Sons, 2007 edition) can be used. Examples of the protective group for the hydroxyl group include an aliphatic acyl group, an aromatic acyl group, a lower alkoxymethyl group, an oxycarbonyl group which may have a substituent, a tetrahydropyranyl group which may have a substituent, a tetrathiopyranyl group which may have a substituent, a methyl group substituted with a total of 1 to 3 substituted or unsubstituted aryl groups (wherein the substituent in the substituted aryl means a lower alkyl, a lower alkoxy, a halogen atom, or a cyano group), and a silyl group. Among these, the protective group for the hydroxyl group is preferably an aliphatic acyl group, an aromatic acyl group, a methyl group substituted with a total of 1 to 3 substituted or unsubstituted aryl groups (wherein the substituent in the substituted aryl means a lower alkyl, a lower alkoxy, a halogen atom, or a cyano group), or a silyl group.

[0029] Examples of the aliphatic acyl group include an alkylcarbonyl group, a carboxyalkylcarbonyl group, a halogenoalkylcarbonyl group, and an alkoxylated alkylcarbonyl group. The alkyl group constituting the alkylcarbonyl group, carboxyalkylcarbonyl group, halogenoalkylcarbonyl group, and lower alkoxyalkylcarbonyl group is not particularly limited, and may be a saturated hydrocarbon group that is linear, branched, cyclic, or a combination thereof. The alkyl group is preferably a lower alkyl group. The carbon number of the lower alkyl group is preferably 1 to 6, more preferably 1 to 5, even more preferably 1 to 4, and particularly preferably 1 to 3. Examples of linear lower alkyl groups include methyl, ethyl, n-propyl, and n-butyl groups. Among these, methyl, ethyl, or n-propyl groups are preferred, methyl or ethyl groups are more preferred, and methyl groups are even more preferred. Examples of branched alkyl groups include isopropyl, isobutyl, s-butyl, and t-butyl groups. Among these, isopropyl is preferred. Examples of cyclic alkyl groups include cyclopropyl, cyclobutyl, and cyclopropylmethyl groups.

[0030] Specific examples of the alkylcarbonyl group include a formyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a pentanoyl group, a pivaloyl group, a valeryl group, an isovaleryl group, an octanoyl group, a nonanoyl group, a decanoyl group, a 3-methylnonanoyl group, an 8-methylnonanoyl group, a 3-ethyloctanoyl group, a 3,7-dimethyloctanoyl group, an undecanoyl group, a dodecanoyl group, a tridecanoyl group, a tetradecanoyl group, a pentadecanoyl group, a hexadecanoyl group, a 1-methylpentadecanoyl group, a 14-methylpentadecanoyl group, a 13,13-dimethyltetradecanoyl group, a heptadecanoyl group, a 15-methylhexadecanoyl group, an octadecanoyl group, a 1-methylheptadecanoyl group, a nonadecanoyl group, an eicosanoyl group, and a henycosyl group. Among these, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a pentanoyl group or a pivaloyl group is preferred, and an acetyl group is more preferred.

[0031] The position of the carboxy group constituting the carboxyalkylcarbonyl group is not particularly limited and can be appropriately selected. Specific examples of the carboxyalkylcarbonyl group include a succinoyl group, a glutaroyl group, and an adipoyl group.

[0032] The position of the halogen constituting the halogenoalkylcarbonyl group is not particularly limited and can be appropriately selected. Specific examples of the halogenoalkylcarbonyl group include a chloroacetyl group, a dichloroacetyl group, a trichloroacetyl group, and a trifluoroacetyl group.

[0033] The position of the alkoxy group constituting the alkoxylated alkylcarbonyl is not particularly limited and can be appropriately selected. 1 A specific example of the alkoxylated alkylcarbonyl is a methoxyacetyl group.

[0034] Examples of the aromatic acyl group include an arylcarbonyl group, a halogenoarylcarbonyl group, an alkylated arylcarbonyl group, an alkoxylated arylcarbonyl group, a carboxylated arylcarbonyl group, a nitrated arylcarbonyl group, and an arylated arylcarbonyl group.

[0035] Specific examples of the arylcarbonyl group include a benzoyl group, an α-naphthoyl group, and a β-naphthoyl group, of which a benzoyl group is preferred. Specific examples of the halogenoarylcarbonyl group include a 2-bromobenzoyl group and a 4-chlorobenzoyl group. Specific examples of the alkylated arylcarbonyl group include a 2,4,6-trimethylbenzoyl group, a 4-toluoyl group, a 3-toluoyl group, and a 2-toluoyl group. Specific examples of the alkoxylated arylcarbonyl group include a 4-anisoyl group, a 3-anisoyl group, and a 2-anisoyl group. Specific examples of the carboxylated arylcarbonyl group include a 2-carboxybenzoyl group, a 3-carboxybenzoyl group, and a 4-carboxybenzoyl group. Specific examples of the nitrated arylcarbonyl group include a 4-nitrobenzoyl group, a 3-nitrobenzoyl group, and a 2-nitrobenzoyl group. Specific examples of arylated arylcarbonyl groups include 4-phenylbenzoyl groups.

[0036] Examples of lower alkoxymethyl groups include methoxymethyl, 1,1-dimethyl-1-methoxymethyl, ethoxymethyl, propoxymethyl, isopropoxymethyl, butoxymethyl, t-butoxymethyl, etc. Of these, methoxymethyl is preferred.

[0037] Examples of the oxycarbonyl group which may have a substituent include a lower alkoxycarbonyl group, a lower alkoxycarbonyl group substituted with a halogen or a silyl group, and an alkenyloxycarbonyl group. Specific examples of lower alkoxycarbonyl groups include a methoxycarbonyl group, an ethoxycarbonyl group, and a t-butoxycarbonylisobutoxycarbonyl group. Specific examples of lower alkoxycarbonyl groups substituted with halogen or silyl groups include 2,2-trichloroethoxycarbonyl, 2-(trimethylsilyl)ethoxycarbonyl and the like. Specific examples of the alkenyloxycarbonyl group include a vinyloxycarbonyl group.

[0038] Examples of the tetrahydropyranyl group which may have a substituent include a tetrahydropyran-2-yl group, a 3-bromotetrahydropyran-2-yl group, etc. Among these, a tetrahydropyran-2-yl group is preferred.

[0039] Examples of the tetrathiopyranyl group which may have a substituent include a tetrahydrothiopyran-2-yl group, a 4-methoxytetrahydrothiopyran-4-yl group, etc. Among these, a tetrahydrothiopyran-2-yl group is preferred.

[0040] Examples of the methyl group substituted with a total of 1 to 3 substituted or unsubstituted aryl groups include benzyl group, α-naphthylmethyl group, β-naphthylmethyl group, diphenylmethyl group, triphenylmethyl group, α-naphthyldiphenylmethyl group, 9-anthrylmethyl 4-methylbenzyl group, 2,4,6-trimethylbenzyl group, 3,4,5-trimethylbenzyl group, 4-methoxybenzyl group, 4-methoxyphenyldiphenylmethyl group, 4,4'-dimethoxytriphenylmethyl group, 4-chlorobenzyl group, 4-bromobenzyl group, 4-cyanobenzyl group, etc. Among these, benzyl group, triphenylmethyl group, 2,4,6-trimethylbenzyl group, 3,4,5-trimethylbenzyl group, 4-methoxybenzyl group, 4-methoxyphenyldiphenylmethyl group, and 4,4'-dimethoxytriphenylmethyl group are preferred.

[0041] Examples of the silyl group include a trimethylsilyl group, a triethylsilyl group, an isopropyldimethylsilyl group, a t-butyldimethylsilyl group, a methyldiisopropylsilyl group, a methyldi-t-butylsilyl group, a triisopropylsilyl group, a diphenylmethylsilyl group, a diphenylbutylsilyl group, a diphenylisopropylsilylphenyldiisopropylsilyl group, etc. Among these, a trimethylsilyl group, a t-butyldimethylsilyl group, a triisopropylsilyl group, and a diphenylmethylsilyl group are preferred, and a trimethylsilyl group, a t-butyldimethylsilyl group, and a diphenylmethylsilyl group are more preferred.

[0042] In this specification, the protecting group for a hydroxyl group may refer to a substituent that is cleaved and eliminated by either a chemical method (e.g., hydrogenolysis, hydrolysis, electrolysis, or photolysis) or a biological method (e.g., hydrolysis in the human body, induction by a microorganism, etc.). In particular, the protecting group for a hydroxyl group is preferably a substituent that is eliminated by hydrogenolysis or hydrolysis. In addition, a protected hydroxyl group can be said to be a hydroxyl group in which a hydrogen atom has been substituted with such a protecting group.

[0043] (protected phosphate group) Protective groups for the protected phosphate group are known to those skilled in the art and can be appropriately selected with reference to the above-mentioned references and explanations. Examples of protecting groups for phosphate groups include lower alkyl groups, lower alkyl groups substituted with a cyano group, ethyl groups substituted with a silyl group, lower alkyl groups substituted with a halogen, lower alkenyl groups, lower alkenyl groups substituted with a cyano group, cycloalkyl groups, aralkyl groups, aralkyl groups in which an aryl ring is substituted with a nitro group, aralkyl groups in which an aryl ring is substituted with a halogen, aryl groups substituted with a lower alkyl group, aryl groups substituted with a halogen, and aryl groups substituted with a nitro group.

[0044] As the lower alkyl group, those mentioned above can be used. Specific examples of the lower alkyl group substituted with a cyano group include a 2-cyanoethyl group, a 2-cyano-1,1-dimethylethyl group, etc. Among these, the 2-cyanoethyl group is preferred. Specific examples of the ethyl group substituted with a silyl group include a 2-methyldiphenylsilylethyl group, a 2-trimethylsilylethyl group, and a 2-triphenylsilylethyl group. Specific examples of the halogen-substituted lower alkyl group include a 2,2,2-trichloroethyl group, a 2,2,2-tribromoethyl group, a 2,2,2-trifluoroethyl group, a 2,2,2-trichloroethyl group, etc. Among these, the 2,2,2-trichloroethyl group is preferred.

[0045] Specific examples of lower alkenyl groups include ethenyl, 1-propenyl, 2-propenyl, 1-methyl-2-propenyl, 1-methyl-1-propenyl, 2-methyl-1-propenyl, 1-butenyl, and 2-butenyl groups. Specific examples of the lower alkenyl group substituted with a cyano group include a 2-cyanoethyl group, a 2-cyanopropyl group, and a 2-cyanobutenyl group. Specific examples of the cycloalkyl group include a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, and a cyclohexyl group.

[0046] Specific examples of the aralkyl group include benzyl group, α-naphthylmethyl group, β-naphthylmethyl group, indenylmethyl group, phenanthrenylmethyl group, anthracenylmethyl group, diphenylmethyl group, triphenylmethyl group, 1-phenethyl group, 2-phenethyl group, 1-naphthylethyl group, 2-naphthylethyl group, 1-phenylpropyl group, 2-phenylpropyl group, 3-phenylpropyl group, 1-naphthylpropyl group, 2-naphthylpropyl group, 3-naphthylpropyl group, 1-phenylbutyl group, 2-phenylbutyl group, 3-phenylbutyl group, 4-phenylbutyl group, etc. Among these, benzyl group, diphenylmethyl group, triphenylmethyl group, 1-phenethyl group or 2-phenethyl group is preferable, and benzyl group is more preferable. Specific examples of aralkyl groups in which an aryl ring is substituted with a nitro group include a 2-(4-nitrophenyl)ethyl group, a 0-nitrobenzyl group, a 4-nitrobenzyl group, a 2,4-dinitrobenzyl group, and a 4-chloro-2-nitrobenzyl group.

[0047] In this specification, the protecting group for a phosphate group may refer to a substituent that is cleaved and eliminated by either a chemical method (e.g., hydrogenolysis, hydrolysis, electrolysis, photolysis, etc.) or a biological method (e.g., hydrolysis in the human body, induction by a microorganism, etc.). In particular, the protecting group for a phosphate group is preferably a substituent that is eliminated by hydrogenolysis or hydrolysis.

[0048] (-P(=O) n R 5 R 6 ) -P(=O) n R 5 R 6 In the formula, n represents 0 or 1; R 5 and R 6 may be the same or different and represent any one of a hydrogen atom, a hydroxyl group, a protected hydroxyl group, a mercapto group, a protected mercapto group, an alkoxy group, a cyanoalkoxy group, an amino group, and a substituted amino group, provided that when n is 1, R 5 and R 6 cannot both be hydrogen atoms. As the protected hydroxyl group and alkoxy group, those mentioned above can be used.

[0049] Protective groups for the protected mercapto group are known to those skilled in the art and can be appropriately selected with reference to the above-mentioned references and explanations. Examples of the protective group for the mercapto group include the groups exemplified as the protective group for the hydroxyl group above (aliphatic acyl groups, aromatic acyl groups, etc.), as well as alkylthio groups, arylthio groups, etc. Among these, aliphatic acyl groups or aromatic acyl groups are preferred, and aromatic acyl groups such as benzoyl groups are more preferred.

[0050] Examples of the alkylthio group include saturated alkylthio groups which are linear, branched, cyclic, or a combination thereof. The alkyl group is preferably a lower alkylthio group. The number of carbon atoms in the lower alkylthio group is preferably 1 to 6, more preferably 1 to 5, even more preferably 1 to 4, and particularly preferably 1 to 3. Examples of the alkylthio group having 1 to 4 carbon atoms include a methylthio group, an ethiothio group, an n-propylthio group, an n-butylthio group, an isopropylthio group, an isobutylthio group, an s-butylthio group, a t-butylthio group, a cyclopropylthio group, a cyclobutylthio group, and a cyclopropylmethylthio group. Among these, a methylthio group, an ethiothio group, or a t-butylthio group is preferred. Examples of the arylthio group include a benzylthio group.

[0051] Examples of cyanoalkoxy groups include linear, branched, cyclic, or combinations thereof alkoxy groups having 1 to 5 carbon atoms (when counting without including the number of carbon atoms in the cyano group) substituted with a cyano group. Specific examples of cyanoalkoxy groups include cyanomethoxy, 2-cyanoethoxy, 3-cyanopropoxy, 4-cyanobutoxy, 3-cyano-2-methylpropoxy, and 1-cyanomethyl-1,1-dimethylmethoxy. Among these, the 2-cyanoethoxy group is preferred.

[0052] The substituent of the substituted amino group can be an alkoxy group, an alkylthio group, a cyanoalkoxy group, an alkyl group, etc. As these groups, those mentioned above can be used.

[0053] -P(=O) n R 5 R 6 Specific examples of the group include a phosphoramidite group, an H-phosphonate group, a phosphonyl group, etc. Among these, the phosphoramidite group is preferred.

[0054] -P(=O) n R 5 R 6 where n is 0 and R 5 and R 6 In particular, when at least one of the groups R 5 and R 6In the case of a phosphoramidite group in which one group is a substituted amino group and the other group is an alkoxy group or a cyanoalkoxy group, the reaction efficiency of the condensation reaction is good, which is preferable. In this case, the substituted amino group is preferably a diethylamino group, a diisopropylamino group, or a dimethylamino group, and more preferably a diisopropylamino group. In addition, the alkoxy group is preferably a methoxy group, and the cyanoalkoxy group is preferably a 2-cyanoethyl group. A particularly preferable example of the phosphoramidite group is -P(OC2H4CN)N(CH(CH3)2) or -P(OCH3)N(CH(CH3)2).

[0055] -P(=O) n R 5 R 6 where n is 1 and R 5 and R 6 When one of the groups is a hydrogen atom and the other is other than a hydrogen atom, it becomes an H-phosphonate group. In this case, the group other than a hydrogen atom is preferably a hydroxyl group, a methyl group, a methoxy group or a thiol group, and more preferably a hydroxyl group.

[0056] -P(=O) n R 5 R 6 where n is 1 and R 5 and R 6 When both are alkoxy groups, it becomes a phosphonyl group. In this case, the alkoxy groups may be the same or different. In addition, the alkoxy group is preferably a methoxy group or an ethoxy group. A specific example of a phosphonyl group is -P(=O)(OCH3)2.

[0057] Among the various groups mentioned above, R 2 is preferably a hydrogen atom, an acetyl group, a benzoyl group, a benzyl group, a p-methoxybenzyl group, a trimethylsilyl group, a tert-butyldiphenylsilyl group, -P(OC2H4CN)N(CH(CH3)2), -P(OCH3)N(CH(CH3)2), or a phosphonyl group. 4is preferably a hydrogen atom, an acetyl group, a benzoyl group, a benzyl group, a p-methoxybenzyl group, a dimethoxytrityl group, a monomethoxytrityl group, a tert-butyldiphenylsilyl group, or a trimethylsilyl group.

[0058] [R 3 About R 3 is -(CH2) m NHR 7 Represents. m represents an integer of 1 to 6. That is, -(CH2) m The alkylene group represented by the formula (I) is a methylene group, an ethylene group, a propylene group, a butylene group, a pentylene group, or a hexylene group. m is preferably an integer of 2 to 5, more preferably an integer of 2 to 4, and further preferably an integer of 2 to 3. That is, -(CH2) m The alkylene group represented by the formula (I) is preferably an ethylene group, a propylene group, a butylene group or a pentylene group, more preferably an ethylene group, a propylene group or a butylene group, and even more preferably an ethylene group or a propylene group. By selecting such an alkylene group, the nuclease resistance and cell membrane permeability of the oligonucleotide derivative can be improved. R 7 represents a hydrogen atom, an alkyl group, an alkenyl group, or a protecting group for an amino group, among which a hydrogen atom is preferred. As the alkyl group and the alkenyl group, those mentioned above can be used.

[0059] (Amino group protecting group) Protective groups for amino groups are well known to those skilled in the art, and for example, those described in Protective Groups in Organic Synthesis (John Wiley and Sons, 2007 edition) can be used. Examples of the protecting group for an amino group include, in addition to the above-mentioned examples of the protecting group for a hydroxyl group, benzyl group, methylbenzyl group, chlorobenzyl group, dichlorobenzyl group, fluorobenzyl group, trifluoromethylbenzyl group, nitrobenzyl group, methoxyphenyl group, methoxymethyl (MOM) group, N-methylaminobenzyl group, N,N-dimethylaminobenzyl group, phenacyl group, acetyl group, trifluoroacetyl group, pivaloyl group, benzoyl group, phthalimido group, allyloxycarbonyl group, 2,2,2-trichloroethoxycarbonyl group, benzyloxycarbonyl group, t-butoxycarbonyl (Boc) group, 1-methyl-1-(4-biphenyl)ethoxycarbonyl (Bpoc) group, 9-fluorenylmethoxycarbonyl group, benzyloxymethyl (BOM) group, and 2-(trimethylsilyl)ethoxymethyl (SEM) group. Among these, a benzyl group, a methoxyphenyl group, an acetyl group, a trifluoroacetyl (TFA) group, a pivaloyl group, a benzoyl group, a t-butoxycarbonyl (Boc) group, a 1-methyl-1-(4-biphenyl)ethoxycarbonyl (Bpoc) group, a 9-fluorenylmethoxycarbonyl group, a benzyloxymethyl (BOM) group, or a 2-(trimethylsilyl)ethoxymethyl (SEM) group is preferred, and a benzyl group, a methoxyphenyl group, an acetyl group, a benzoyl group, or a benzyloxymethyl group is more preferred.

[0060] In this specification, the protecting group of an amino group may mean a substituent that is cleaved and eliminated by either a chemical method (e.g., hydrogenolysis, hydrolysis, electrolysis, photolysis, etc.) or a biological method (e.g., hydrolysis in the human body, induction by a microorganism, etc.). In particular, the protecting group of an amino group is preferably a substituent that is eliminated by hydrogenolysis or hydrolysis.

[0061] R 3By selecting a substituent having the above structure as R, it is possible to impart a charge imparting property to the nucleoside derivative and the oligonucleotide derivative having a structure derived from the nucleoside derivative, which is characterized by a change in charge depending on the surrounding pH environment. For example, it is cationic under acidic conditions, and the positive charge can be reduced to zero under neutral physiological conditions. With this charge adjustment ability, it is possible to dynamically change the charge of the nucleoside derivative or impart a desired charge when necessary by changing the pH environment. Therefore, with the nucleoside derivative having such a substituent, it is possible to adjust the charge of the oligonucleotide derivative in a manner different from the conventional manner or with a higher degree of freedom than the conventional manner. From the above, R 3 A nucleoside derivative in which is a substituent having the above structure is useful as a charge (positive charge) imparting agent or charge control agent for an oligonucleotide derivative.

[0062] [About B] B (base) represents a purin-9-yl group, a 2-oxo-pyrimidin-1-yl group, a substituted purin-9-yl group, or a substituted 2-oxo-pyrimidin-1-yl group. B may be a known natural base or an artificial base. Specific examples of B include 2,6-dichloropurin-9-yl, 2-oxo-pyrimidin-1-yl, 2-oxo-4-methoxy-pyrimidin-1-yl, 4-(1H-1,2,4-triazol-1-yl)-pyrimidin-1-yl, 2,6-dimethoxypurin-9-yl, 2-oxo-4-amino-pyrimidin-1-yl with a protected amino group, 2-amino-6-bromopurin-9-yl with a protected amino group, 2-amino-6-hydroxypurin-9-yl with a protected amino group, 2-amino-6-hydroxypurin-9-yl with a protected amino group and / or hydroxyl group, 2-amino-6-chloropurin-9-yl with a protected amino group, 6-aminopurin-9-yl with a protected amino group, and 4-amino-5-methyl-2-oxo-pyrimidin-1-yl with a protected amino group. The protecting groups for the hydroxyl and amino groups are as explained above.

[0063] Other specific examples of B include 6-aminopurin-9-yl (adenine), 2-amino-6-hydroxypurin-9-yl (guanidine), 2-oxo-4-amino-pyrimidin-1-yl (cytosine), 2-oxo-4-hydroxy-pyrimidin-1-yl (uracil), 2-oxo-4-hydroxy-5-methylpyrimidin-1-yl (thymine), 4-amino-5-methyl-2-oxo-pyrimidin-1-yl (methylcytosine), 2-oxo-4-hydroxy-5-methyl ... , 6-diaminopurin-9-yl, 6-amino-2-fluoropurin-9-yl, 6-mercaptopurin-9-yl, 4-amino-2-oxo-5-chloro-pyrimidin-1-yl, or 2-oxo-4-mercapto-pyrimidin-1-yl, 6-amino-2-methoxypurin-9-yl, 6-amino-2-chloropurin-9-yl, 2-amino-6-chloropurin-9-yl, 2-amino-6-bromopurin-9-yl, and the like.

[0064] The substituents in each of the substituted purin-9-yl group and the substituted 2-oxo-pyrimidin-1-yl group are any one of a hydroxyl group, a protected hydroxyl group, an alkoxy group, a mercapto group, a protected mercapto group, an alkylthio group, an amino group, a protected amino group, an amino group substituted with an alkyl group, an alkyl group, an alkoxymethyl group, a triazole group, and a halogen atom, or any combination of a plurality of these. These substituents are as described above.

[0065] Specific examples of the substituted purin-9-yl group include 6-aminopurin-9-yl, 2,6-diaminopurin-9-yl, 2-amino-6-chloropurin-9-yl, 2-amino-6-bromopurin-9-yl, 2-amino-6-hydroxypurin-9-yl, 6-amino-2-methoxypurin-9-yl, 6-amino-2-chloropurin-9-yl, 6-amino-2-fluoropurin-9-yl, 2,6-dimethoxypurin-9-yl, 2,6-dichloropurin-9-yl, 6-mercaptopurin-9-yl, etc. If the above-mentioned substituents contain an amino group or a hydroxyl group, preferred examples include substituents in which the amino group and / or the hydroxyl group is protected.

[0066] Specific examples of substituted 2-oxo-pyrimidin-1-yl groups include 2-oxo-4-amino-pyrimidin-1-yl, 1H-(1,2,4-triazol-1-yl)-pyrimidin-1-yl, 4-1H-1,4-amino-2-oxo-5-chloro-pyrimidin-1-yl, 2-oxo-4-methoxy-pyrimidin-1-yl, 2-oxo-4-mercapto-pyrimidin-1-yl, 2-oxo-4-hydroxy-pyrimidin-1-yl, 2-oxo-4-hydroxy-5-methylpyrimidin-1-yl, or 4-amino-5-methyl-2-oxo-pyrimidin-1-yl. Among these, 2-oxo-4-methoxy-pyrimidin-1-yl or 4-(1H-1,2,4-triazol-1-yl)-pyrimidin-1-yl is preferred. If the substituent contains an amino group or a hydroxyl group, it is preferable that these groups are protected.

[0067] The nucleoside derivative according to the embodiment of the present invention may be in the form of a salt. The salt form is not particularly limited, but is generally an acid addition salt. The salt form may be in the form of an intramolecular counter ion, or may be a base addition salt depending on the type of the substituent. As the salt, a pharma- ceutically acceptable salt is preferred. The types of acids and bases that form pharma- ceutically acceptable salts are well known to those skilled in the art, and can be referred to, for example, those described in J.Pharm.Sci., 1-19 (1977). For example, acid addition salts include mineral acid salts and organic acid salts. In addition, when one or more substituents contain an acidic moiety, they may be base addition salts.

[0068] Examples of mineral acid salts include hydrochlorides, hydrobromides, hydroiodides, nitrates, sulfates, hydrogen sulfates, phosphates, hydrogen phosphates, etc. Among these, hydrochlorides and phosphates are preferred. Examples of organic acid salts include acetate, trifluoroacetate, gluconate, lactate, salicylate, citrate, tartrate, ascorbate, succinate, maleate, fumarate, formate, benzoate, methanesulfonate, ethanesulfonate, p-toluenesulfonate, etc. Among these, acetate is preferred. Examples of base addition salts include alkali metal salts, alkaline earth metal salts, organic amine salts, and amino acid addition salts. Examples of alkali metal salts include sodium salts and potassium salts. Examples of alkaline earth metal salts include magnesium salts and calcium salts. Examples of organic amine salts include triethylamine salts, pyridine salts, procaine salts, picoline salts, dicyclohexylamine salts, diethanolamine salts, triethanolamine salts, and tris(hydroxymethyl)aminomethane salts. Examples of amino acid addition salts include arginine salts, lysine salts, ornithine salts, serine salts, glycine salts, aspartic acid salts, and glutamic acid salts.

[0069] The nucleoside derivative and its salt according to the embodiment of the present invention may exist as a hydrate or solvate, and these substances are also included in the scope of the present disclosure. The nucleoside derivative or its salt can be easily produced by those skilled in the art according to the synthesis examples described below or known methods.

[0070] The nucleoside derivative according to the embodiment of the present invention has a high content of N-type sugar moieties (ribose or deoxyribose), and therefore can improve the thermal stability of double-stranded nucleic acids such as double-stranded RNA by introducing it as at least a part of an oligonucleotide derivative. Therefore, when this oligonucleotide derivative is used in siRNA, the thermal stability of siRNA is improved and the binding affinity with the target mRNA can be increased. In addition, the nucleoside derivative according to the embodiment of the present invention can improve the nuclease resistance of single-stranded or double-stranded oligonucleotide derivatives and can improve the cell membrane permeability of mammalian cells and the like. That is, this nucleoside derivative itself is useful as a nuclease resistance improver and / or a cell membrane permeability imparting agent. In addition, this nucleoside derivative can provide an oligonucleotide derivative suitable for administration without using a carrier such as LNP for delivery, which has been used in conventional nucleic acid medicines. Furthermore, since the nucleoside derivative according to the embodiment of the present invention has a basic substituent at the 4'-position of the sugar moiety, it can also function as a charge regulator or positive charge imparting agent that can adjust the negative charge derived from a phosphate group or the like in an oligonucleotide derivative.

[0071] <Oligonucleotide derivatives and their salts> The oligonucleotide derivative or a salt thereof according to the embodiment of the present invention (hereinafter, sometimes abbreviated as "oligonucleotide derivative") contains at least one partial structure represented by the following formula (2). This partial structure can be obtained from the nucleoside derivative and its salt represented by the above formula (1).

[0072] [ka]

[0073] In formula (2), R 1 , R 3 and B are the same as those in formula (1). That is, R 1represents an alkoxy group, a hydrogen atom or a halogen atom; R 3 is -(CH2) m NHR 7 (m represents an integer from 1 to 6, R 7 represents a hydrogen atom, an alkyl group, an alkenyl group, or a protecting group for an amino group), and B represents a purin-9-yl group, a 2-oxo-pyrimidin-1-yl group, a substituted purin-9-yl group, or a substituted 2-oxo-pyrimidin-1-yl group.

[0074] The oligonucleotide derivative may contain one or more partial structures represented by formula (2). When a plurality of partial structures represented by formula (2) are contained, these partial structures may be the same or different from each other. In addition, the entire partial structure contained in the oligonucleotide derivative may be composed only of the partial structure represented by formula (2). By containing a plurality of partial structures represented by formula (2), cell membrane permeability and ribonuclease resistance can be reliably improved.

[0075] The position of the partial structure represented by formula (2) in the oligonucleotide derivative is not particularly limited, and can be, for example, either or both of the 5'-end side and the 3'-end side. Here, in this specification, the 5'-end side and the 3'-end side respectively mean a region of an appropriate number of units from each end of the polymer chain of the oligonucleotide derivative, and refer to, for example, a region consisting of structural units not exceeding 30% of the total structural units of the polymer chain. The ratio of the range from the above-mentioned end varies depending on the total length of the polymer chain, but can generally be 25% or less (for example, 20% or less, 10% or less, 5% or less, etc.). More specifically, the 5'-end side and the 3'-end side can typically be a region of 1 to 30 structural units (for example, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, etc.) from each end. The oligonucleotide derivative may contain one or more partial structures represented by formula (2) in any of these terminal regions. For example, the oligonucleotide derivative may contain a partial structure represented by formula (2) in either or both of the 5'-terminus and the first building block from the 3'-terminus.

[0076] In the oligonucleotide derivative according to the embodiment of the present invention, one or more partial structures represented by formula (2) may be included in the central portion, which is a portion other than the 5'-end side and the 3'-end side. By arranging the partial structure represented by formula (2) in the central portion, it becomes easier to improve and adjust ribonuclease resistance and cell membrane permeability, and it also becomes easier to adjust the charge of the entire oligonucleotide. In addition, by adopting such an arrangement, it also becomes easier to adjust the charge of the entire oligonucleotide.

[0077] The oligonucleotide derivative according to the embodiment of the present invention may contain a partial structure represented by formula (2) at either or both of the 5'-end side and the 3'-end side and at the center. For example, the oligonucleotide derivative according to the embodiment of the present invention may contain one or more partial structures represented by formula (2) at each of the 5'-end side, the 3'-end side and the center.

[0078] When two or more partial structures represented by formula (2) are included, their arrangement is not particularly limited, and they may be adjacent to each other or may be present apart. For example, when an oligonucleotide derivative includes three partial structures represented by formula (2), each partial structure can be arranged approximately evenly on the 5'-end side, the center, and the 3'-end side of the oligonucleotide derivative. Here, arranging the partial structures approximately evenly in each part of the oligonucleotide derivative does not mean that the same number of partial structures are arranged in each part of the oligonucleotide derivative, but means that at least one partial structure is arranged in each part of the oligonucleotide derivative. For example, when about 1 to 3 partial structures are arranged in each part of the oligonucleotide derivative, it can be said that they are approximately even. At least 6 partial structures can be included in the oligonucleotide derivative.

[0079] As described above, by disposing the partial structure represented by formula (2) generally uniformly or dispersedly, it is possible to improve the charge controllability as well as the ribonuclease resistance and cell membrane permeability. From the viewpoint of the effect of improving these properties, it is preferable that two or more partial structures represented by formula (2) are disposed in the center of the oligonucleotide derivative.

[0080] Since the sugar portion of the partial structure represented by formula (2) is derived from ribose or deoxyribose, the oligonucleotide derivative is an oligoribonucleotide derivative, an oligodeoxyribonucleotide derivative, or a chimera of a ribonucleotide derivative and a deoxyribonucleotide derivative.

[0081] The oligonucleotide derivatives according to the embodiments of the present invention may themselves be in single-stranded form, but may also be in the form of oligoribonucleotide derivatives, oligodeoxyribonucleotide derivatives, and hybrids of two of the oligodeoxyribonucleotide derivatives / ribonucleotide derivatives (chimeric strands), i.e., double-stranded form.

[0082] The oligonucleotide derivative according to the embodiment of the present invention may contain a partial structure other than the partial structure represented by formula (2) (hereinafter referred to as "other partial structures"). Examples of the other partial structures include natural or known nucleotide derivatives and partial structures corresponding to nucleotide derivatives. The partial structure represented by formula (2) and the other partial structures may be bonded to each other, for example, by a phosphodiester bond, a phosphomonoester bond, a thiophosphate bond, or the like.

[0083] In the oligonucleotide derivative according to the embodiment of the present invention, the total number of the partial structure represented by formula (2) and other partial structures is preferably 2 or more, more preferably 8 or more, and even more preferably 15 or more. On the other hand, the upper limit of the total number of these partial structures is not particularly limited, but is generally 100 or less (e.g., 80 or less, 60 or less, 50 or less, 40 or less, 30 or less, or 20 or less).

[0084] The oligonucleotide derivative according to the embodiment of the present invention may have one or more asymmetric centers or may have stereoisomers in other partial structures, and any mixture or racemate of stereoisomers is included in the scope of the present invention. Also, the oligonucleotide derivative may exist as a tautomer.

[0085] The oligonucleotide derivative according to the embodiment of the present invention can be used as a substitute for a ribonucleotide derivative by including uracil (U), which is a base in RNA, as the base B in the partial structure represented by formula (2).

[0086] The oligonucleotide derivative according to the embodiment of the present invention may be in the form of a salt. The salt form is not particularly limited, but is preferably a pharma-ceutically acceptable salt. The salt can be the same as the salt of the nucleoside derivative described above. Furthermore, the oligonucleotide derivatives and salts thereof according to the embodiments of the present invention may be in the form of hydrates or solvates, which are also included within the scope of the present invention.

[0087] The oligonucleotide derivative according to the embodiment of the present invention has a high content of N-type sugar moieties (ribose or deoxyribose), and therefore can improve the thermal stability of double-stranded nucleic acids such as double-stranded RNA. Therefore, this oligonucleotide derivative can be used in siRNA. When this oligonucleotide derivative is used in siRNA, the thermal stability of siRNA can be improved and the binding affinity with the target mRNA can be increased. Therefore, the target mRNA can be efficiently degraded, and the information on the target mRNA can be made difficult to be translated into a specific protein by ribosomes.

[0088] The oligonucleotide derivative according to the embodiment of the present invention has a specific N-containing group at the 4' position of the sugar moiety (ribose or deoxyribose) via oxygen, and therefore can adjust the net charge amount of RNA while maintaining RNA functions in the living body such as RNA interference ability. In addition, this oligonucleotide derivative can enhance lipophilicity (van der Waals intermolecular forces) and reduce the degree of decrease in dsRNA melting temperature, thereby suppressing the decrease in thermal stability. Therefore, this oligonucleotide derivative can improve ribonuclease resistance and cell membrane permeability. In addition, the oligonucleotide derivative according to the embodiment of the present invention has a basic substituent at the 4' position of the sugar moiety, and therefore can neutralize negative charges due to phosphate groups and the like, and can adjust the overall charge. Therefore, the oligonucleotide derivative according to the embodiment of the present invention can be incorporated as a component of miRNA or as a component of aptamer RNA, and can be used while taking advantage of the effects of improving ribonuclease resistance and cell membrane permeability.In addition, the oligonucleotide derivative according to the embodiment of the present invention can be linked to other compounds to form a conjugate.Furthermore, the oligonucleotide derivative according to the embodiment of the present invention can be used as a component of ribozyme, RNA chip, and other reagents.

[0089] From the above, the oligonucleotide derivative according to the embodiment of the present invention is expected to be more useful than natural nucleotides as a component of various nucleic acid drugs, such as antitumor drugs and antiviral drugs, which inhibit gene activity to treat diseases, by taking advantage of characteristics not found in natural nucleotides. Examples of nucleic acid drugs include siRNA, antisense nucleic acid, miRNA, aptamer, decoy, etc. In addition, the oligonucleotide derivative according to the embodiment of the present invention is also useful as a raw material or intermediate for nucleic acid drugs. In addition, those skilled in the art can easily evaluate the charge controllability, ribonuclease resistance, cell membrane permeability and charge control ability of the oligonucleotide derivatives according to the embodiments of the present invention, as well as the biological activities of various RNAs containing these oligonucleotide derivatives, by appropriately referring to the examples described below or methods well known to those skilled in the art at the time of filing this application.

[0090] <Production of nucleoside derivatives and oligonucleotide derivatives> The nucleoside derivatives and oligonucleotide derivatives according to the embodiment of the present invention can be easily synthesized by those skilled in the art based on the specific synthesis examples described below or on the synthesis techniques for nucleoside derivatives and oligonucleotide derivatives known at the time of filing of this application. For example, the synthesis scheme of the nucleoside derivative can be designed based on the descriptions in Bioorganic & Medical Chemistry 11(2003)211-2226, Bioorganic & Chemistry letters(1999)2667-2672, The Journal of Organic Chemistry 2013, 78, 9956-9962, HELVATICA CHIMICA ACTA Vol. 83 (2000) 128-151, Bioorganic & Medical Chemistry 11(2003)211-2226, Bioorganic & Chemistry letters(1999)2667-2672, etc.

[0091] In addition, an oligonucleotide derivative having a partial structure represented by formula (2) can be easily produced by using a nucleoside derivative represented by formula (1) as an amidite agent or the like. That is, an oligonucleotide derivative having a partial structure represented by formula (2) can be synthesized using a nucleoside derivative represented by formula (1) with a known DNA synthesizer. The oligonucleotide derivative thus obtained can be purified using a column, and the purity of the product can be analyzed by reversed-phase HPLC or MALDI-TOF-MS. The method of converting an oligonucleotide derivative into an acid addition salt is well known to those skilled in the art. EXAMPLES

[0092] The embodiments of the present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples in any way.

[0093] <Synthesis of nucleoside derivatives (amidites)> (1) 2'-OMe-4'-aminoethoxyuridine According to the following scheme, 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminoethoxyl-2'-O-methyl-3'-[2-cyanoethyl-N,N-bis(1-methylethyl)-phosphoramidite]-uridine (compound 12) was synthesized using uridine (compound 1) as a starting material.

[0094] [ka]

[0095] Synthesis of 2,2'-O-cyclouridine (compound 2) Under an Ar atmosphere, diphenyl carbonate ((PhO)2CO, 4.82 g, 22.5 mmol) was dissolved in DMF (5.5 mL), uridine (5.0 g, 20.5 mmol) was further added, and the mixture was heated to 80°C. Sodium hydrogen carbonate (NaHCO3, 0.07 g, 0.82 mmol) was then added, and the mixture was heated to 120°C and stirred for 3 hours. Compound 2 (3.70 g, 16.4 mmol, 80% yield) was obtained by filtration under reduced pressure. 1 H NMR(400MHz,DMSO-d6)δ:3.15-3.21(m,1H),3.25-3.30(m,1H),4.05-4.08(m,1H),4.38(s,1H),4.98(t,J=5.0Hz,1 H),5.19(d,J=5.9Hz,1H),5.83(d,J=7.3Hz,1H),5.87(d,J=4.1Hz,1H),6.30(d,J=5.5Hz,1H),7.83(d,J=7.3Hz,1H)

[0096] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-2,2'-O-cyclouridine (compound 3) Compound 2 (2.29 g, 10.1 mmol) was dissolved in pyridine (22 mL) under an Ar atmosphere, and 4,4'-dimethoxytriphenylmethyl chloride (DMTrCl, 3.94 g, 11.6 mmol) was added and stirred at room temperature overnight. The product was then extracted with ethyl acetate and water, and the organic layer was washed with a saturated aqueous solution of sodium bicarbonate and a saturated aqueous solution of sodium chloride, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:methanol = 8:1 (v / v)) to obtain compound 3 (4.81 g, 9.09 mmol, yield 90%). 1 H NMR(400MHz,DMSO-d6)δ:2.99-3.18(m,2H),3.69(s,6H),4.29-4.36(m,1H),4.42-4.46(m,1H),5.2 0-5.25(m,1H),5.92(d,J=7.5Hz,1H),6.07(d,J=5.7Hz,1H),6.98-6.97(m,4H),6.99-7.10(m,10H)

[0097] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-2'-O-methyl (compound 4) Compound 3 (6.76 g, 12.8 mmol) was dissolved in DMF (100 mL) under an Ar atmosphere, and Mg(OCH3)2 (6.62 g, 76.7 mmol) was added and stirred at 100 ° C for 2 hours. The product was then extracted with ethyl acetate and saturated aqueous sodium bicarbonate, and the organic layer was washed with saturated aqueous sodium bicarbonate and saturated aqueous sodium chloride, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 5 (v / v)) to obtain compound 4 (5.43 g, 9.67 mmol, yield 76%). 1 H NMR(500MHz,CDCl3)δ:2.57(d,J=9.2Hz,1H),3.51-3.59(m,2H),3.65(s,3H),3.80(s,8H),4.49(d,J=8.0Hz,1H),4.46-4.49(m,1H),5.25(dd,J =2.3,8.1Hz,1H),5.96(s,1H),6.84(d,J=8.6Hz,4H),7.24(s,1H),7.26-7.34(m,6H),7.38(d,J=7.5Hz,2H),8.05(d,J=8.0Hz,1H),8.44(s,1H)

[0098] Synthesis of 2'-O-methyl-uridine (compound 5) Compound 4 (2.94 g, 5.25 mmol) was dissolved in 80% acetic acid (50 mL) under an Ar atmosphere, stirred at room temperature for 1 hour, and then the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:methanol = 1:5 (v / v)) to obtain compound 5 (1.22 g, 4.71 mmol, yield 90%). 1H NMR(400MHz,DMSO-d6)δ:3.52(s,1H),3.46-3.53(m,1H),3.60-3.65(m,1H),3.78(t,J=5.0Hz,1H),3.85(dd,J=3.2,8.0Hz,1H)4.1 1(dd,J=5.0,10.5Hz,1H),5.16(s,1H),5.17(s,1H),5.65(d,J=8.2Hz,1H),5.85(d,J=5.0,1H),7.93(d,J=8.2Hz,1H),11.4(s,1H)

[0099] Synthesis of 5'-iodo-2'-deoxy-2'-O-methyl-uridine (compound 6) Compound 5 (0.93 g, 3.61 mmol) was dissolved in acetonitrile (CH3CN, 68 mL) under an Ar atmosphere, pyridine (3.75 mL), iodine (1.09 g, 4.33 mmol), and triphenylphosphine (PPh3, 1.23 g, 4.69 mmol) were added, and the mixture was stirred at room temperature for 72 hours, after which the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:methanol = 10:1 (v / v)) to obtain compound 6 (1.22 g, 3.49 mmol, yield 97%). 1 H NMR(500MHz,CDCl3)δ:3.46(dd,J=4.6,11.5Hz,1H),3.60(s,3H),3.63(d,J=3.4Hz,1H),3.69-3.72(m,1H),3.85(dd,J=2 .9,6.3Hz,1H),5.79(dd,J=2.3,8.0Hz,1H),5.91(d,J=2.9Hz,1H),7.45-7.48(m,1H),7.67(d,J=8.0Hz,2H),8.90(s,1H)

[0100] Synthesis of 4',5'-didehydro-2',5'-dideoxy-2'-O-methyl-uridine (compound 7) Compound 6 (1.29 g, 3.49 mmol) was dissolved in THF (20 mL) under an Ar atmosphere, DBU (3.12 mL, 20.9 mmol) was added, and the mixture was stirred at room temperature overnight, after which the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:methanol = 10:1 (v / v)) to obtain compound 7 (0.47 g, 1.96 mmol, yield 56%). 1 H NMR(500MHz,CDCl3)δ:3.15(s,1H),3.59(s,3H),3.88(dd,J=1.2,5.5Hz,1H),4.46(t,J=2.0Hz,1H),4.57(s,1H),4.65(t,J=2.0Hz,1H) ,5.78(d,J=8.1Hz,1H),6.02(s,1H),7.17(d,J=8.6Hz,1H),5.91(d,J=2.9Hz,1H),7.45-7.48(m,1H),7.67(d,J=8.0Hz,2H),8.90(s,1H)

[0101] Synthesis of 4',5'-didehydro-2',5'-dideoxy-3'-O-[(1,1-dimethylethyl)diphenylsilyl]-2'-O-methyl-uridine (compound 8) Compound 7 (0.47 g, 1.96 mmol) was dissolved in dichloromethane (CHCl, 5 mL) under an Ar atmosphere, tert-butyldimethylchlorosilane (TBDMSCl, 0.55 g, 3.65 mmol) and imidazole (0.34 g, 4.9 mmol) were added, and the mixture was stirred at room temperature for 3 hours, after which ethanol was added to quench the mixture. The product was then extracted with ethyl acetate and a saturated aqueous solution of sodium bicarbonate, and the organic layer was washed with a saturated aqueous solution of sodium bicarbonate and a saturated aqueous solution of sodium chloride, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=2:1 (v / v)) to obtain compound 8 (0.57 g, 1.60 mmol, yield 81%). 1H NMR(400MHz,CDCl3)δ:0.14(s,6H),0.93(s,9H),3.51(s,1H),3.79-3.81(m,1H),4.33-4.44(m,1H),4.56-4.58( m,1H),4.61-4.62(m,1H),5.78(dd,J=2.3,8.2Hz,1H),6.08(d,J=3.6Hz,1H),7.18(d,J=8.2Hz,1H),8.59(s,1H)

[0102] Synthesis of 4'-C-trifluoroacetylaminoethoxyl-3'-O-[(1,1-dimethylethyl)diphenylsilyl]-2'-O-methyl (Compound 9) Compound 8 (0.14 g, 0.40 mmol) was dissolved in dichloromethane (CHCl, 2.8 mL) under an Ar atmosphere, acetone (2.8 mL) and saturated aqueous sodium bicarbonate (2.8 mL) were added, and an aqueous solution (2.8 mL) of oxone (0.18 g, 1.20 mmol) was added at 0° C., followed by stirring at room temperature for 3 hours. The product was then extracted with chloroform and saturated aqueous sodium bicarbonate, and the organic layer was washed with saturated aqueous sodium bicarbonate and saturated aqueous sodium chloride, then dried over sodium sulfate, and the solvent was removed under reduced pressure to obtain a crude product. Next, the crude product was dissolved in diethyl ether (3 mL) under an Ar atmosphere, and 1.0 M zinc chloride (0.48 mmol, 0.48 mL) and [2-(2,2,2-trifluoroacetide)ethoxy]methyl acetate (0.63 g, 4.0 mmol) were added at -40°C. The mixture was stirred at room temperature for 12 hours, quenched with saturated aqueous sodium bicarbonate solution, and filtered through Celite. The product was extracted from the filtrate with ethyl acetate and saturated aqueous sodium bicarbonate solution, the organic layer was washed with water and saturated aqueous sodium chloride solution, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 1:1 (v / v)) to obtain compound 9 (0.15 g, 0.28 mmol, yield 69%). 1H NMR(500MHz,DMSO-d6)δ:0.10(d,J=13.1,6H),0.89(s,1H),3.3(s,3H)3.4 2-3.46(m,1H),3.49-3.53(m,1H),3.69-3.73(m,2H),3.91(t,J=5.7,1H),4 .42(d,J=6.3Hz,1H),5.39(t,J=5.5Hz,1H),5.70(dd,J=8,1.8Hz,1H),6.06 (d,J=5.7Hz,1H),7.82(d,J=8.0Hz,1H),9.21(t,J=5.1Hz,1H),11.4(s,1H)

[0103] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminoethoxyl-3'-O-[(1,1-dimethylethyl)diphenylsilyl]-2'-O-methyl-uridine (compound 10) Compound 9 (0.25 g, 0.48 mmol) was dissolved in pyridine (3 mL) under an Ar atmosphere, and 4,4'-dimethoxytriphenylmethyl chloride (DMTrCl, 0.25 g, 0.72 mmol) was added at 0°C and stirred at room temperature overnight. The product was then extracted with chloroform and a saturated aqueous solution of sodium bicarbonate, and the organic layer was washed with a saturated aqueous solution of sodium bicarbonate and a saturated aqueous solution of sodium chloride, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:methanol = 3:1 (v / v)) to obtain compound 10 (0.35 g, 0.42 mmol, yield 89%). 1H NMR(500MHz,CDCl3)δ:0.01(s,6H),0.81(s,9H),3.17(d,J=5.15Hz,6H),3.30(s,3H), 3.56-3.58(m,1H),3.66-3.74(m,1H),3.90(dd,J=6.3,3.4Hz,1H),4.45(d,J=6.3Hz,1 H),5.28(d,J=8.0Hz,1H),5.97(d,J=3.4Hz,1H),6.90(dd,J=6.9,1.8Hz,4H),7.21-7. 24(m,5H),7.32-7.35(m,4H),7.77(d,J=8.6Hz,1H),9.11(t,J=5.5Hz,1H),11.5(s,1H)

[0104] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminoethoxyl-2'-O-methyl-uridine (compound 11) Compound 10 (0.25 g, 0.30 mmol) was dissolved in THF (1.47 mL) under an Ar atmosphere, and 1 M tetrabutylammonium fluoride (TBAF, 0.47 mL) was added and stirred at room temperature for 3 hours. The solvent was then removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=1:1 (v / v)) to obtain compound 11 (0.21 g, 0.29 mmol, 97%). 1 H NMR(500MHz,CDCl3)δ:2.84(d,J=12.0Hz,1H),3.24(dd,J=10.3,13.8Hz,1H),3 .45-3.51(m,3H),3.65(s,3H),3.74(d,J=6.3Hz,2H),3.8(s,5H),4.63(dd,J=6. 9,5.9Hz,1H),5.17(d,J=8.6Hz,1H),5.93(s,1H),6.85(d,J=9.2Hz,4H),7.13( s,1H),7.23-7.27(m,4H),7.29-7.35(m,5H),7.93(d,J=3.5Hz,1H),8.26(s,1H)

[0105] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminoethoxyl-2'-O-methyl-3'-[2-cyanoethyl-N,N-bis(1-methylethyl)-phosphoramidite]-uridine (Compound 12) Compound 11 (0.27 g, 0.38 mmol) was dissolved in chloroform (2.7 mL) under an Ar atmosphere, and N,N-diisopropylethylamine (DIPEA, 0.33 mL, 1.905 mmol) and 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite (CEP-Cl, 0.17 mL, 0.76 mmol) were added and stirred at room temperature for 1 hour. The product was extracted with chloroform and saturated aqueous sodium bicarbonate, washed with saturated aqueous sodium chloride, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 2:3 (v / v)) to obtain compound 12 (0.14 g, 0.15 mmol, yield 40%). 31 P NMR(162MHz,CDCl3)δ:151.59,151.80

[0106] (2) 2'-OMe-4'-aminopropoxyuridine According to the following scheme, 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropoxyl-2'-O-methyl-3'-[2-cyanoethyl-N,N-bis(1-methylethyl)-phosphoramidite]-uridine (compound 16) was synthesized using the uridine (compound 8) obtained above.

[0107] [ka]

[0108] Synthesis of 4'-C-trifluoroacetylaminopropoxyl-3'-O-[(1,1-dimethylethyl)diphenylsilyl]-2'-O-methyl (Compound 13) Compound 8 (0.35 g, 0.99 mmol) was dissolved in dichloromethane (7.0 mL) under an Ar atmosphere, acetone (7.0 mL) and saturated aqueous sodium bicarbonate solution (7.0 mL) were added, and an aqueous solution (6.9 mL) of oxone (0.45 g, 2.97 mmol) was added at 0° C., followed by stirring at room temperature for 3 hours. The product was then extracted with chloroform and saturated aqueous sodium bicarbonate solution, and the organic layer was washed with saturated aqueous sodium bicarbonate solution and saturated aqueous sodium chloride solution, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure to obtain a crude product. Next, the crude product was dissolved in diethyl ether (Et2O, 8mL) under an Ar atmosphere, and 1.0M zinc chloride (ZnCl2, 0.16mmol, 0.16mL) and [2-(2,2,2-trifluoroacetate)propoxy]methyl acetate (1.69g, 1.19mmol) were added at -40°C, and the mixture was stirred at room temperature for 12 hours, quenched with saturated aqueous sodium bicarbonate solution, and filtered through Celite. The product was extracted from the filtrate with ethyl acetate and saturated aqueous sodium bicarbonate solution, the organic layer was washed with water and saturated sodium chloride, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 1:1 (v / v)) to obtain compound 13 (0.22g, 0.41mmol, yield 42%).

[0109] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropoxyl-3'-O-[(1,1-dimethylethyl)diphenylsilyl]-2'-O-methyl-uridine (compound 14) Compound 13 (0.22 g, 0.41 mmol) was dissolved in pyridine (2.5 mL) under an Ar atmosphere, and 4,4'-dimethoxytriphenylmethyl chloride (DMTrCl, 0.21 g, 0.62 mmol) and N,N-dimethyl-4-aminopyridine (DMAP, 0.05 g, 0.41 mmol) were added at 0°C and stirred at room temperature overnight. The product was then extracted with chloroform and saturated sodium bicarbonate, the organic layer was washed with saturated sodium bicarbonate and saturated sodium chloride, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 1:1 (v / v)) to obtain compound 14 (0.24 g, 0.28 mmol, yield 68%).

[0110] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropoxyl-2'-O-methyl-uridine (compound 15) Compound 14 (0.11 g, 0.13 mmol) was dissolved in THF (0.74 mL) under an Ar atmosphere, and 1 M tetrabutylammonium fluoride (TBAF, 0.23 mL) was added and stirred at room temperature for 3 hours. The solvent was then removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=1:2 (v / v)) to obtain compound 15 (0.09 g, 0.13 mmol, yield 97%).

[0111] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropoxyl-2'-O-methyl-3'-[2-cyanoethyl-N,N-bis(1-methylethyl)-phosphoramidite]-uridine (Compound 16) Compound 15 (0.27 g, 0.38 mmol) was dissolved in chloroform (2.7 mL) under an Ar atmosphere, and N,N-diisopropylethylamine (DIPEA, 0.33 mL, 1.86 mmol) and 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite (CEP-Cl, 0.17 mL, 0.75 mmol) were added and stirred at room temperature for 1 hour. The product was extracted with chloroform and saturated aqueous sodium bicarbonate, washed with saturated aqueous sodium chloride, then dried over sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 2:3 (v / v)) to obtain compound 16 (0.15 g, 0.17 mmol, yield 44%). 31 P NMR(162MHz,CDCl3)δ:152.29,152.72

[0112] (3) 2'-OMe-4'-aminopropyluridine 2'-OMe-4'-aminopropyluridine was synthesized by the method described in International Publication No. 2018 / 110678. Specifically, 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroaminopropyl-2'-O-methyl-3'-[2-cyanoethyl-N,N-bis(1-methylethyl)-phosphoramidite]-uridine (compound 27) was synthesized according to the following scheme.

[0113] [ka]

[0114] Synthesis of 5-O-[(1,1-dimethylethyl)diphenylsilyl]-4-C-azidopropyl 3-O-benzyl-1,2-O-(1-methylethylidene)-α-D-ribofuranose (compound 18) Sodium azide (NaN3, 6.59 g, 101 mmol) was added to a dimethylformamide (DMF) solution (90 mL) of 5-O-[(1,1-dimethylethyl)diphenylsilyl]-4-C-[[(4-methylphenyl)sulfonyl]oxy]propyl-3-O-benzyl-1,2-O-(1-methylethylidene)-α-D-ribofuranose (compound 17, 8.82 g, 12.1 mmol) under an Ar atmosphere, and the mixture was stirred at 60°C overnight. The ethyl acetate solution of the reaction mixture was washed with saturated saline. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 15:1 (v / v)) to obtain compound 18 (5.98 g, 9.94 mmol, yield 82%). 1 H NMR(400MHz,CDCl3)δ:0.98(s,9H,TBDPS),1.36(s,3H,CH3),1.35-1.41(m,1H,4-(C)-CH),1.5-1.57(m,1H,4-(C)-CH),1.62( s,3H,CH3),1.73-1.78(m,1H,4-(C-CH2)-CH),2.09-2.13(m,1H,4-(C-CH2)-CH),3.18-3.23(m,2H,4-(C-CH2-CH2)-CH2),3.41 (d,J=11.0Hz,1H,5-H),3.65(d,J=11.0Hz,1H,5-H),4.30(d,J=5.48Hz,1H,3-H),4.59(d,J=12.4Hz,1H,Bn),4.67(dd,J=5.52H z and 3.64Hz,1H,2-H),4.82(d,J=12.4Hz,1H,Bn),5.79(d,J=3.68Hz,1H,1-H),7.30-7.46(m,10H,TBDPS),7.59-7.64(m,5H,Bn)

[0115] Synthesis of 5-O-[(1,1-dimethylethyl)diphenylsilyl]-4-C-azidopropyl-3-O-benzyl-1,2-di-O-acetyl-α-D-ribofuranose (compound 19) Compound 18 (0.40 g, 0.665 mmol) was dissolved in 50% acetic acid (5.70 mL) and heated to reflux at 120 ° C for 1 hour. The reaction mixture was dried by azeotropy with ethanol, pyridine (1.43 mL, 17.7 mmol) and acetic anhydride (Ac2O, 0.95 mL, 10.2 mmol) were added, and the mixture was stirred at room temperature overnight under Ar atmosphere. The reaction mixture was cooled in an ice bath, poured into cold water, and extracted with ethyl acetate. The organic layer was washed with saturated sodium bicarbonate water and saturated saline. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 5: 1 (v / v)) to obtain compound 19 (0.314 g, 0.486 mmol, yield 74%). 1 H NMR(400MHz,CDCl3)δ:1.06(s,9H,TBDPS),1.10-1.14(m,1H,4-(C)-CH),1.54-1.58(m,1H,4-(C)-CH),1.74-1.7 7(m,1H,4-(C-CH2)-CH),1.82(s,3H,CH3),1.84-1.90(m,1H,4-(C-CH2)-CH),2.10(s,3H,CH3),3.19-3.23(m,2H ,4-(C-CH2-CH2)-CH2),3.59(dd,J=10.6Hz and 13.3Hz,2H,5-H2),4.38(d,J=5.52Hz,1H,3-H),4.54(d,J=11.4Hz, 1H,Bn),4.60(d,J=11.4Hz,1H,Bn),5.36(d,J=5.48Hz,1H,2-H),6.13(s,1H,1-H),7.27-7.64(m,15H,Bn and TBDPS)

[0116] Synthesis of 5-O-[(1,1-dimethylethyl)diphenylsilyl]-4'-C-azidopropyl-3'-O-benzyl-2'-O-acetyluridine (compound 20) Compound 19 (2.76 g, 4.27 mmol) in acetonitrile (MeCN, 28 mL) was added with uracil (0.957 g, 8.54 mmol) and N,O-bis(trimethylsilyl)acetamide (BSA, 11.1 mL, 34.2 mmol) under Ar atmosphere, and heated to reflux at 95 ° C for 1 hour. This was cooled to 0 ° C, and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 1.55 mL, 8.54 mmol) was carefully added dropwise. After heating to reflux at 95 ° C for 15 minutes again, it was cooled in an ice bath and saturated sodium bicarbonate water was added. The reaction mixture was extracted with chloroform, and the organic layer was washed with saturated sodium bicarbonate water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=2:1 (v / v)) to obtain compound 20 (2.27 g, 3.26 mmol, yield 76%). 1 H NMR(400MHz,CDCl3)δ:1.09(s,9H,TBDPS),1.45-1.51(m,2H,4'-(C)-CH2),1.64-1.69(m,1H,4'-(C-CH2)-CH),1.82 -1.89(m,1H,4'-(C-CH2)-CH),2.11(s,3H,CH3),3.18-3.24(m,2H,4'-(C-CH2-CH2)-CH2),3.56(d,J=11.4Hz,1H,5' -H), 3.84 (d, J = 10.9 Hz, 1H, 5'-H), 4.39-4.44 (m, 2H, 3'-H and Bn), 4.61 (d, J = 11.0 Hz, 1H, Bn), 5.32-5.48 (m, 2H, 2'-H and 6-H), 6.18 (d, J = 5.04 Hz, 1H, 1'-H), 7.28-7.57 (m, 15H, Bn and TBDPS), 7.67 (d, J = 8.24 Hz, 1H, 5-H), 8.66 (s, 1H, 3-NH

[0117] Synthesis of 5-O-[(1,1-dimethylethyl)diphenylsilyl]-4'-C-azidopropyl-3'-O-benzyluridine (compound 21) Compound 20 (1.57 g, 2.24 mmol) was added with aqueous ammonia (16 mL) and methanol (MeOH, 16 mL) and stirred at room temperature overnight. Ethanol was added to the reaction mixture and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=2:1 (v / v)) to obtain compound 21 (1.44 g, 2.19 mmol, yield 98%). 1 H NMR(400MHz,CDCl3)δ:1.09(s,9H,TBDPS),1.37-1.41(m,1H,4'-(C)-CH),1.51-1.55(m,1H,4'-(C)-CH),1.61-1.68(m,1H,4'-(C-CH2)-CH),1. 85-1.89(m,1H,4'-(C-CH2)-CH),3.13-3.19(m,2H,4'-(C-CH2-CH2)-CH2),3.55(d,J=11.0Hz,1H,5'-H),3.60(d,J=7.80Hz,1H,2'-OH),3.78(d ,J=11.0Hz,1H,5'-H),4.19(d,J=5.96Hz,1H,3'-H),4.29(dd,J=5.96Hz and 12.36Hz,1H,2'-H),4.59(d,J=11.4Hz,1H,Bn),4.74(d,J=11.5Hz,1H ,Bn),5.39(d,J=8.24Hz,1H,6-H),5.94(d,J=5.52Hz,1H,1'-H),7.34-7.60(m,15H,Bn and TBDPS),7.69(d,J=7.80Hz,1H,5-H),9.37(s,1H,3-NH)

[0118] Synthesis of 5-O-[(1,1-dimethylethyl)diphenylsilyl]-4'-C-azidopropyl-3'-O-benzyl-2'-O-methyl-uridine (compound 22) To a solution (53 mL) of compound 21 (5.33 g, 8.10 mmol) in tetrahydrofuran, 60% sodium hydride (NaH, 0.972 g, 24.3 mmol) was added in an ice bath under an Ar atmosphere, and the mixture was stirred at 0°C for 10 minutes. To this, iodomethane (CHI, 3.02 mL, 48.6 mmol) was carefully added dropwise, and the mixture was stirred at 0°C for 8 hours under a light-shielded condition. The reaction mixture was extracted with ethyl acetate, and the organic layer was washed with saturated saline. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=3:1 (v / v)) to obtain compound 22 (4.00 g, 5.98 mmol, yield 74%). 1 H NMR(400MHz,CDCl3)δ:1.08(s,9H,TBDPS),1.39-1.46(m,1H,4'-(C)-CH),1.52-1.60(m,1H,4'-(C)-CH),1.65-1.70(m,1H,4'-(C-CH) 2)-CH),1.97-2.05(m,1H,4'-(C-CH2)-CH),3.19-3.26(m,2H,4'-(C-CH2-CH2)-CH2),3.51(s,3H,2'-OCH3),3.68(d,J=11.5Hz,1H,5 '-H),3.74(m,1H,2'-H),3.95(d,J=11.5Hz,1H,5'-H),4.35(d,J=4.60Hz,1H,3'-H),4.52(d,J=11.5Hz,1H,Bn),4.73(d,J=11.9Hz,1 H,Bn),5.12(d,J=8.24Hz,1H,6-H),6.09(s,1H,1'-H),7.35-7.63(m,15H,Bn and TBDPS),7.78(d,J=8.24Hz,1H,5-H),9.04(s,1H,3-NH)

[0119] Synthesis of 5-O-[(1,1-dimethylethyl)diphenylsilyl]-4'-C-azidopropyl-2'-O-methyl-uridine (compound 23) 60 mL of a dichloromethane (DCM) solution of compound 22 (4.00 g, 5.98 mmol) was cooled to -78 °C under an Ar atmosphere, and 1 M boron trichloride (BCl3) dichloromethane solution (35.9 mL, 35.9 mmol) was added and stirred for 3 hours. The temperature was then raised to -30 °C and the mixture was stirred for 3 hours. Dichloromethane-methanol (1:1 (v / v), 100 mL) was added to the reaction mixture and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 1:1 (v / v)) to obtain compound 23 (2.99 g, 5.16 mmol, yield 86%). 1 H NMR(600MHz,CDCl3)δ:1.11(s,9H,TBDPS),1.49-1.56(m,2H,4'-(C)-CH2),1.58-1.64(m,1H,4'-(C-CH2)-CH),1.76-1.8 0(m,1H,4'-(C-CH2)-CH),2.74(d,J=5.52Hz,1H,3'-OH),3.21-3.25(m,2H,4'-(C-CH2-CH2)-CH2),3.52(s,3H,2'-OCH3) ,3.70(d,J=11.0Hz,1H,5'-H),3.88(d,J=11.0Hz,1H,5'-H),3.93(m,1H,2'-H),4.49(t,J=5.46Hz,1H,3'-H),5.31(d,J= 8.28Hz,1H,6-H),6.06(d,J=4.80Hz,1H,1'-H),7.41-7.66(m,10H,TBDPS),7.08(d,J=7.56Hz,1H,5-H),8.04(s,1H,3-NH)

[0120] Synthesis of 4'-C-azidopropyl-2'-O-methyl-uridine (compound 24) Compound 23 (2.99 g, 5.16 mmol) in tetrahydrofuran (THF) solution (30.0 mL) was added with 1 M tetrabutylammonium fluoride tetrahydrofuran (TBAF) solution (7.74 mL, 7.74 mmol) under Ar atmosphere and stirred at room temperature overnight. After that, the solvent was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (chloroform:methanol = 10:1 (v / v)) to obtain compound 24 (1.68 g, 4.94 mmol, yield 96%). 1 H NMR(600MHz,CDCl3)δ:1.55-1.67(m,4H,4'-(C)-CH2-CH2),3.27-3.29(m,2H,4'-(C-CH2-CH2)-C H2),3.32(s,3H,2'-OCH3),3.42-3.45(m,2H,5'-H2),3.98(dd,J=7.56Hz and 4.80Hz,1H,2'-H),4.1 6(t,J=5.46Hz,1H,3'-H),5.13(d,J=6.18Hz,1H,3'-OH),5.20(d,J=5.46Hz,1H,5'-OH),5.67(d, J=8.28Hz,1H,6-H),5.90(d,J=6.84Hz,1H,1'-H),7.89(d,J=8.22Hz,1H,5-H),11.34(s,1H,3-NH)

[0121] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-azidopropyl-2'-O-methyl-uridine (compound 25) To a pyridine solution (17 mL) of compound 24 (1.68 g, 4.94 mmol), 4,4'-dimethoxytrityl chloride (DMTrCl, 2.51 g, 7.41 mmol) was added under an Ar atmosphere, and the mixture was stirred at room temperature for 5 hours. The reaction mixture was extracted with ethyl acetate, and the organic layer was washed with saturated sodium bicarbonate water and saturated saline. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=1:1 (v / v)) to obtain compound 25 (3.12 g, 4.85 mmol, yield 98%). 1H NMR(400MHz,CDCl3)δ:1.38-1.44(m,1H,4'-(C)-CH),1.54-1.64(m,2H,4'-(C)-CH-CH),1.78-1.84(m,1H,4'-(C-C H2)-CH),2.77(d,J=6.44Hz,1H,3'-OH),3.17-3.22(m,2H,4'-(C-CH2-CH2)-CH2),3.34(s,2H,5'-H2),3.57(s,3H,2 '-OCH3),3.80(s,6H,DMTr),3.92(dd,J=4.12Hz and 5.96Hz, 1H,2'-H),4.60(t,J=5.96Hz,1H,3'-H),5.22(d,J=8.24 Hz,1H,6-H),6.02(d,J=4.12Hz,1H,1'-H),6.84-7.36(m,13H,DMTr),7.82(d,J=8.24Hz,1H,5-H),8.09(s,1H,3-NH)

[0122] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropyl-2'-O-methyl-uridine (compound 26) Triphenylphosphine (PPh3, 3.12g, 4.85mmol) and water (3.50mL, 194mmol) were added to a tetrahydrofuran (THF) solution (62.4mL) of compound 25 (3.12g, 4.85mmol) and stirred at 45°C for 20 hours. Tetrahydrofuran in the reaction mixture was distilled off under reduced pressure, and the mixture was made into a dichloromethane (DCM) solution (30mL). Ethyl trifluoroacetate (CF3COOEt, 1.74mL, 14.5mmol) and triethylamine (Et3N, 1.00mL, 7.28mmol) were added and stirred at room temperature for 24 hours. The reaction mixture was extracted with ethyl acetate, and the organic layer was washed with saturated saline. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=1:1 (v / v)) to quantitatively obtain compound 26. 1H NMR(400MHz,CDCl3)δ:1.40-1.45(m,1H,4'-(C)-CH),1.63-1.67(m,1H,4'-(C-CH2)-CH),1.72-1.78(m,1H,4'-(C-CH2)-CH),2. 88(d,J=4.56Hz,1H,3'-OH),3.25-3.28(m,2H,4'-(C-CH2-CH2)-CH2),3.30(d,J=10.5Hz,1H,5'-H),3.35(d,J=10.1Hz,1H,5'-H) ,3.54(s,3H,2'-OCH3),3.80(s,6H,DMTr),4.03(t,J=5.04Hz,1H,2'-H),4.54(t,J=5.04Hz,1H,3'-H),5.26(d,J=8.24Hz,1H,6-H ),6.03(d,J=5.04Hz,1H,1'-H),6.66(m,1H,-NHCOCF3),6.84-7.55(m,13H,DMTr),7.74(d,J=8.24Hz,1H,5-H),8.17(s,1H,3-NH)

[0123] Synthesis of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroaminopropyl-2'-O-methyl-3'-[2-cyanoethyl-N,N-bis(1-methylethyl)-phosphoramidite]-uridine (compound 27) Compound 26 (1.55 g, 2.17 mmol) in tetrahydrofuran (THF) solution (15 mL) was added with N,N-diisopropylethylamine (DIPEA, 1.90 mL, 10.9 mmol) and 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite (CEP-Cl, 0.97 mL, 4.34 mmol) under Ar atmosphere and stirred at room temperature for 1 hour. The reaction mixture was extracted with ethyl acetate, and the organic layer was washed with saturated sodium bicarbonate water and saturated saline. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate = 1:1 (v / v)) to obtain compound 27 (1.57 g, 1.71 mmol, yield 79%). 31 P NMR(243MHz,CDCl3)δ:150.57,151.44

[0124] (4) 4'-Aminoethoxythymidine According to the following scheme, 4'-C-α-trifluoroacetylaminoethoxy-3'-O-[2-cyanoethoxy(diisopropylamino)phosphino]-5'-O-[bis(4-methoxyphenyl)phenylmethyl]-3'-O-tert-butyldimethylsilyl-thymidine (compound 32) was synthesized using compound 28 as a starting material.

[0125] [ka]

[0126] Synthesis of 4'-C-α-trifluoroacetylaminoethoxy-3'-O-tert-butyldimethylsilyl-thymidine (compound 29) Compound 28 (1.54 g, 4.56 mmol) was dissolved in dichloromethane (32 mL), and acetone (32 mL) and saturated aqueous sodium bicarbonate (32 mL) were added in an ice bath. A solution of potassium peroxymonosulfate (Oxone [trademark], 2.0842 g, 13.68 mmol) dissolved in distilled water (32 mL) was then added dropwise. After stirring in an ice bath for 0.5 hours, the product was extracted from the reaction solution using chloroform and saturated aqueous sodium bicarbonate, the organic layer was washed with saturated aqueous sodium chloride, and water was removed with sodium sulfate. The solvent was then removed under reduced pressure to obtain a crude product. Next, under an Ar atmosphere, the crude product was dissolved in tetrahydrofuran (THF, 7 mL), and zinc chloride (0.6283 g, 4.56 mmol) was added at -40°C, followed by dropwise addition of a solution of aminoethanol TFA (3.5872 g, 22.8 mmol) dissolved in THF (2 mL). Note that "aminoethanol TFA" means aminoethanol in which the amino group is protected with a trifluoroacetyl group. The mixture was then returned to room temperature and stirred, and quenched with a saturated aqueous solution of sodium bicarbonate after 20.5 hours. The precipitated salt was removed by filtration through Celite, and the compound was extracted from the filtrate using ethyl acetate and a saturated aqueous solution of sodium bicarbonate. The organic layer was washed with a saturated aqueous solution of sodium chloride, and then water was removed with sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (hexane / ethyl acetate = 1:1 (v / v)) to obtain compound 29 (0.9302 g, yield 39%). 1 H-NMR(400MHz,CDCl3)δ:8.30(s,1H),7.22(d,J=0.9Hz,1H),6.97(d,J=22.4Hz,1H),6.1 4(dd,J=7.3,5.0Hz,1H),4.67(t,J=7.3Hz,1H),3.94-3.89(m,1H),3.82-3.76(m,2H),3. 70(dd,J=11.4,6.9Hz,1H),3.62-3.56(m,1H),3.53-3.46(m,1H),2.49-2.36(m,2H),2.3 2(dd,J=6.9,4.6Hz,1H),1.93(d,J=0.9Hz,3H),0.90(s,9H),0.11(s,3H),-0.002(s,3H)

[0127] Synthesis of 4'-C-α-trifluoroacetylaminoethoxy-5'-O-[bis(4-methoxyphenyl)phenylmethyl]-3'-O-tert-butyldimethylsilyl-thymidine (compound 30) Under an Ar atmosphere, compound 29 (1.1481 g, 2.24 mmol) was dissolved in pyridine (11.5 mL), 4,4'-dimethoxytriphenylmethyl chloride (DMTrCl, 0.8749 g, 2.58 mmol) was added, and the mixture was stirred at room temperature for 24 hours. The solvent was then removed under reduced pressure, and the residue was purified by silica gel column chromatography (hexane / ethyl acetate = 1:1 (v / v)) to obtain compound 30 (1.7707 g, yield 97%). 1 H-NMR(400MHz, CDCl3)δ:8.08(s,1H),7.34-7.20(m,10H),6.83(dd,J=9.3,2.5Hz ,4H),6.69(brs,1H),6.33(dd,J=7.3,4.6Hz,1H),4.76(t,J=7.3Hz,1H),3.80(s,6 H),3.64-3.47(m,4H),3.46-3.32(m,1H),3.17(d,J=9.6Hz,1H),2.52-2.40(m,1H) ,2.39-2.25(m,1H),1.37(d,J=0.9Hz,3H),0.81(s,9H),0.02(s,3H),-0.05(s,3H)

[0128] Synthesis of 4'-C-α-trifluoroacetylaminoethoxy-5'-O-[bis(4-methoxyphenyl)phenylmethyl]-thymidine (compound 31) Compound 30 (1.77 g, 2.17 mmol) was dissolved in THF (22 mL) under an Ar atmosphere, 1 M tetrabutylammonium fluoride (TBAF, 3.26 mL) was added, and the mixture was stirred at room temperature for 0.5 hours. The solvent was then removed under reduced pressure, and the residue was purified by silica gel column chromatography (hexane / ethyl acetate = 1:2 (v / v)) to obtain compound 31 (1.3391 g, yield 88%). 1H-NMR(400MHz,CDCl3)δ:7.31-7.21(m,11H),6.84(dd,J=8.9,1.1Hz,4H),6.31(dd,J=6.9,5.0Hz,1H),4.68(t,J=7.3Hz,1H ),3.86-3.68(m,6H),3.76-3.73(m,1H),3.62-3.40(m,4H),3.32(d,J=10.1Hz,1H),2.50-2.32(m,2H),1.49(d,J=0.9Hz,3H)

[0129] Synthesis of 4'-C-α-trifluoroacetylaminoethoxy-3'-O-[2-cyanoethoxy(diisopropylamino)phosphino]-5'-O-[bis(4-methoxyphenyl)phenylmethyl]-3'-O-tert-butyldimethylsilyl-thymidine (compound 32) Under Ar atmosphere, compound 31 (0.751 g, 1.07 mmol) was dissolved in dichloromethane (7.5 mL), N,N-diisopropylethylamine (1.00 mL, 5.37 mmol) and 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite (CEP-Cl, 0.50 mL, 2.15 mmol) were added, and the mixture was stirred at room temperature for 0.5 hours. Next, the product was extracted from the reaction solution using chloroform and saturated aqueous sodium bicarbonate, and the organic layer was washed with saturated aqueous sodium chloride, and then water was removed with sodium sulfate. The solvent was then removed under reduced pressure, and the residue was purified by silica gel column chromatography (hexane / ethyl acetate = 2:3 (v / v)) to obtain compound 32 (0.678 g, 0.753 mmol, yield 75%). 31 P-NMR(162MHz,CDCl3)δ:150.6,149.6

[0130] <Synthesis of solid support> (1) 2'-OMe-4'-aminoethoxyuridine-loaded CPG carrier To a pyridine solution of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminoethoxyl-2'-O-methyl-uridine (compound 11), N,N-dimethyl-4-aminopyridine (DMAP) and succinic anhydride were added under an Ar atmosphere and stirred at room temperature. The reaction mixture was extracted with ethyl acetate, and the organic layer was washed with saturated sodium bicarbonate water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. Dimethylformamide was added to the residue to dissolve it, and then a hole-controlled glass (CPG) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) were added and shaken. CPG was filtered off with a filter, washed with pyridine, and then DMAP, pyridine, and acetic anhydride were added under an Ar atmosphere and allowed to stand. The CPG was filtered off, washed with pyridine, ethanol and acetonitrile, and then dried to obtain a CPG carrier carrying 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminoethoxyl-2'-O-methyl-uridine.

[0131] (2) 2'-OMe-4'-aminopropoxyuridine-loaded CPG carrier To a pyridine solution of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropoxyl-2'-O-methyl-uridine (compound 15), N,N-dimethyl-4-aminopyridine (DMAP) and succinic anhydride were added under an Ar atmosphere and stirred at room temperature. The reaction mixture was extracted with ethyl acetate, and the organic layer was washed with saturated sodium bicarbonate water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. Dimethylformamide was added to the residue to dissolve it, and then hole-controlled glass (CPG) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) were added and shaken. CPG was filtered off with a filter and washed with pyridine, and then DMAP, pyridine, and acetic anhydride were added under an Ar atmosphere and allowed to stand. The CPG was filtered off, washed with pyridine, ethanol and acetonitrile, and then dried to obtain a CPG carrier carrying 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropoxyl-2'-O-methyl-uridine.

[0132] (3) 2'-OMe-4'-aminopropyluridine-loaded CPG carrier To a pyridine solution (1.4 mL) of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropyl-2'-O-methyl-uridine (compound 26: 0.142 g, 0.20 mmol), N,N-dimethyl-4-aminopyridine (DMAP, 48.9 mg, 0.40 mmol) and succinic anhydride (80.1 mg, 0.80 mmol) were added under an Ar atmosphere and stirred at room temperature for 24 hours. The reaction mixture was extracted with ethyl acetate, and the organic layer was washed with saturated sodium bicarbonate water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was dissolved in dimethylformamide (2.0 mL), and a hole-opening glass (CPG, 0.373 g) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC, 38.3 mg, 0.20 mmol) were added and the mixture was shaken for 4 days. The CPG was filtered off and washed with pyridine, and then DMAP (0.183 g), pyridine (13.5 mL) and acetic anhydride (1.5 mL) were added under an Ar atmosphere and allowed to stand for 16 hours. The CPG was filtered off, washed with pyridine, ethanol and acetonitrile, and then dried to obtain 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropyl-2'-O-methyl-uridine-loaded CPG carrier (activity: 35.8 μmol / g).

[0133] (4) 4'-aminoethoxythymidine-loaded CPG carrier To a pyridine solution of 4'-C-α-trifluoroacetylaminoethoxy-5'-O-[bis(4-methoxyphenyl)phenylmethyl]-thymidine (compound 31), N,N-dimethyl-4-aminopyridine (DMAP) and succinic anhydride were added under an Ar atmosphere and stirred at room temperature. The reaction mixture was extracted with ethyl acetate, and the organic layer was washed with saturated sodium bicarbonate water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. Dimethylformamide was added to the residue to dissolve it, and then a hole-controlled glass (CPG) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) were added and shaken. CPG was filtered off with a filter, washed with pyridine, and then DMAP, pyridine, and acetic anhydride were added under an Ar atmosphere and allowed to stand. The CPG was filtered off, washed with pyridine, ethanol and acetonitrile, and then dried to obtain a CPG carrier carrying 4'-C-α-trifluoroacetylaminoethoxy-5'-O-[bis(4-methoxyphenyl)phenylmethyl]-thymidine.

[0134] <Synthesis of oligonucleotide derivatives> (1) Synthesis of oligonucleotide derivatives (11mer and 21mer) Using the nucleoside derivatives (amidites) and solid-phase support (1) to (3) synthesized above, oligonucleotide derivatives (11mer and 21mer) were synthesized by a nucleic acid automatic synthesizer using the phosphoramidite method. At this time, the amidites were diluted with acetonitrile to 0.1 to 0.15M. After the synthesis was completed, the product (CPG resin) was transferred to a sampling tube, acetonitrile and diethylamine (9:1 (v / v), 1.0 mL) were added, and the mixture was stirred for 5 minutes, after which the supernatant was removed and the mixture was washed twice with acetonitrile (1.0 mL). Next, ammonia water and methylamine (1:1 (v / v), 1.0 mL) were added, and the mixture was left to stand at 65°C for 10 minutes. Next, after the solution was returned to room temperature, the supernatant was transferred to a 1.5 mL tube, washed twice with ethanol and water (3:1 (v / v), 1.0 mL), dried under reduced pressure, dissolved in DMSO (100 μL), triethylamine (TEA)·3HF (125 mL) was added, stirred, and left at 65°C for 90 minutes. Next, this solution was made up to 10 mL with 0.1 M triethylamine-acetate buffer (TEAA) and passed through an equilibrated Sep-Pac tC18 reverse phase column for adsorption. After washing the column with sterile water, it was eluted with acetonitrile and water (1:1 (v / v), 3 mL), dried under reduced pressure to obtain a crude product. The crude product was dissolved in loading solution (1×TBE in 90% formamide) (200 μL) and purified by 20% PAGE (500 V, 20 mA). Next, 0.1M triethylamine-acetic acid buffer and 1mM ethylenediaminetetraacetic acid (EDTA) aqueous solution (10mL) were added and shaken overnight. After shaking, the filtrate was passed through an equilibrated Sep-Pac tC18 reversed phase column and adsorbed onto the column. The column was washed with sterile water to remove salts, and eluted with acetonitrile-water (1:1 (v / v), 3mL) and dried under reduced pressure. The oligonucleotide derivative obtained as described above was mixed with 3 μL of sterile water and 3 μL of matrix solution (60 pmol equivalent), dried on a plate, and then the molecular weight was measured by MALDI-TOF / MS to confirm that it had the specified sequence.

[0135] (2) Synthesis of oligonucleotide derivatives (16mer) Using the nucleoside derivative (amidite) and solid support synthesized above (4), an oligonucleotide derivative (16mer) was synthesized by a nucleic acid automatic synthesizer using the phosphoramidite method. At this time, the amidite was diluted with acetonitrile to 0.1M. After the synthesis was completed, the synthesized product (CPG resin) was transferred to a sampling tube, acetonitrile and diethylamine (9:1 (v / v), 1.0mL) were added, and the mixture was stirred for 5 minutes, after which the supernatant was removed and the mixture was washed twice with acetonitrile (1.0mL). Next, when synthesizing DNA oligonucleotides, 28% ammonia water (1mL) was added and the mixture was left at 55°C for 12 hours, and when synthesizing RNA oligonucleotides, 28% ammonia water (500μL) and 40% methylamine water (500μL) were added and the mixture was left at 65°C for 10 minutes. Next, after the solution was returned to room temperature, the supernatant was transferred to a 1.5 mL tube, and washed twice with water (1.0 mL) when synthesizing DNA oligonucleotides, or with ethanol and water (1:3 (v / v), 1.0 mL) when synthesizing RNA oligonucleotides, and then dried under reduced pressure. Next, the dried product was dissolved in DMSO (100 μL), triethylamine (TEA)·3HF (125 mL) was added, stirred, and allowed to stand at 65°C for 90 minutes. Next, this solution was made up to 10 mL with 0.1 M triethylamine-acetate buffer (TEAA), and passed through an equilibrated Sep-Pac tC18 reverse phase column for adsorption. After washing the column with sterile water, it was eluted with acetonitrile and water (1:1 (v / v), 3 mL), and dried under reduced pressure to obtain a crude product. The crude product was dissolved in loading solution (1×TBE in 90% formamide) (200 μL) and purified by 20% PAGE (500 V, 20 mA). Next, 0.1 M triethylamine-acetate buffer and 1 mM ethylenediaminetetraacetic acid (EDTA) aqueous solution (20 mL) were added and shaken overnight. After shaking, the filtrate was passed through an equilibrated Sep-Pac tC18 reversed phase column and adsorbed onto the column. The column was washed with sterile water to remove salts, eluted with acetonitrile-water (1:1 (v / v), 3 mL), and dried under reduced pressure. The oligonucleotide derivative obtained as described above was mixed with 3 μL of sterile water and 3 μL of matrix solution (60 pmol equivalent), dried on a plate, and then the molecular weight was measured by MALDI-TOF / MS to confirm that it had the specified sequence.

[0136] The details of the "0.1 M triethylamine-acetate buffer (TEAA)," "20% PAGE," "1 mM ethylenediaminetetraacetic acid (EDTA) aqueous solution," and "matrix solution" used in the synthesis of the oligonucleotide derivatives are as follows: "0.1 M triethylamine-acetate buffer (TEAA)" was prepared by diluting 2N triethylamine-acetate buffer (114.38 mL of acetic acid, 277.6 mL of triethylamine, and the resulting solution was adjusted to 1000 mL with water, and the pH was adjusted to 7.0) by 20-fold. "20% PAGE" was prepared as follows. 40% acrylamide solution (40mL), urea (33.6g), and 10xTBE ​​buffer (8mL) were dissolved, and water was added to make 80mL. Ammonium persulfate (55mg) was added to this solution and dissolved, and TEMED (N,N,N',N'-tetramethylethylenediamine, 40μL) was added and shaken, and the mixture was poured between two glass plates fixed with a 1.5mm spacer in between, and left to stand for more than 1 hour to solidify. 1xTBE buffer was used as the electrophoresis buffer. The 40% acrylamide solution was prepared by dissolving acrylamide (190g) and N,N'-bisacrylamide (10g) in water to make 500mL. The TBE buffer was prepared by dissolving tris(hydroxymethyl)aminomethane (109 g), boric acid (55 g), and EDTA·2Na (7.43 g) in water to a final volume of 1000 mL. The "1 mM ethylenediaminetetraacetic acid (EDTA) aqueous solution" was prepared by diluting 0.1 M EDTA aqueous solution (EDTA·4Na (1.80 g) in water to 40 mL) 100-fold. The matrix solution was prepared by dissolving 3-hydroxypicolinic acid (3-HPA, 4.85 mg) and diammonium hydrogen citrate (0.8 mg) in 50% acetonitrile (50 μL). + Or K + was added to inhibit adhesion.

[0137] <Synthesis of double-stranded RNA (11mer)> Double-stranded RNA was synthesized by adding equimolar amounts of each strand (oligonucleotide derivative) to a PBS buffer solution, heating at 90°C for 5 minutes, and then slowly cooling to room temperature.

[0138] (1)Duplex 1 Sense strand (5' to 3') UUCUUCUUCUU (SEQ ID NO: 1) Antisense strand (5' to 3') AAGAAGAAGAA (SEQ ID NO: 2)

[0139] (2)Duplex 2 Sense strand (5' to 3') UUCUUCU Ap UCUU (SEQ ID NO: 1) Antisense strand (5' to 3') AAGAAGAAGAA (SEQ ID NO: 2) Here, U Ap represents a partial structure having an aminopropyl group at the 4'-position of ribose (a partial structure derived from 2'-OMe-4'-aminopropyluridine).

[0140] (3)Duplex 3 Sense strand (5' to 3') UUCUUCU Aetx UCUU (SEQ ID NO: 1) Antisense strand (5' to 3') AAGAAGAAGAA (SEQ ID NO: 2) Here, U Aetxrepresents a partial structure having an aminoethoxy group at the 4'-position of ribose (a partial structure derived from 2'-OMe-4'-aminoethoxyuridine).

[0141] (Evaluation of thermal stability) 200 μL of Tm phosphate buffer was added to 600 pmol of the double-stranded RNA obtained above to prepare a sample with a concentration of 3 μmol / L. The sample was heated at 100°C for 3 minutes, then left to stand for more than 1 hour to return to room temperature. 160 μL of the sample was transferred to a dedicated cell, and the absorbance at 260 nm associated with dissociation into single strands was measured while changing the temperature from 5°C to 80°C (0.5°C / min). The 50% melting temperature (Tm) was calculated from the sigmoid curve obtained by plotting temperature on the horizontal axis and absorbance on the vertical axis. The results are shown in Table 1. Table 1 also shows the difference (ΔTm) between the Tm of each duplex and the Tm of Duplex 1, which is the evaluation standard. The melting curve plot is shown in Figure 1.

[0142] [Table 1]

[0143] As shown in Table 1, compared with Duplex 1 (positive control), U Ap The Tm of Duplex 2, which introduced U, decreased by 3.4°C. Aetx It was confirmed that Duplex 3, into which was introduced, had a Tm decrease of only 0.6°C and had the same thermal stability as Duplex 1.

[0144] <Synthesis of double-stranded RNA / DNA (16mer)> Double-stranded RNA / DNA was synthesized by adding equimolar amounts of each strand (oligonucleotide derivative) to a PBS buffer solution, heating at 90°C for 5 minutes, and then slowly cooling to room temperature.

[0145] (1)Duplex 4 Sense strand (5' to 3') TCTTTCTCTTTCCCTT (SEQ ID NO: 3) Antisense strand (5' to 3' direction) AAGGGAAAGAGAAAGA (SEQ ID NO: 4)

[0146] (2) Duplex 5 Sense strand (5' to 3' direction) TCTTTCT Aetx CTTTCCCTT (SEQ ID NO: 3) Antisense strand (5' to 3' direction) AAGGGAAAGAGAAAGA (SEQ ID NO: 4) Here, T Aetx represents a partial structure having an aminoethoxy group at the 4'-position of ribose (a partial structure derived from 4'-aminoethoxythymidine). (Evaluation of thermal stability) To 600 pmol of the double-stranded RNA / DNA obtained above, 200 μL of a phosphate buffer for Tm was added to prepare a sample adjusted to 3 μmol / L, which was heated at 100°C for 3 minutes and then allowed to stand for 1 hour or more to return to room temperature. 160 μL of the sample was transferred to a dedicated cell, and while changing the temperature from 5°C to 70°C (0.5°C / min), the absorbance at 260 nm associated with dissociation into single strands was measured. The 50% melting temperature (Tm) was calculated from the sigmoid curve obtained by plotting temperature on the horizontal axis and absorbance on the vertical axis. The results are shown in Table 1. Also, in Table 1, the difference (ΔTm) in Tm of each Duplex with respect to the Tm of Duplex 1, which is the evaluation criterion, is also shown.

[0147]

Table 2

[0148] As shown in Table 2, compared with Duplex 4 (positive control), Duplex 5 into which T Aetx was introduced had only a 0.8°C decrease in Tm and was confirmed to have thermal stability equivalent to that of Duplex 4.

[0149] <Synthesis of siRNA (21mer)> siRNA was synthesized by adding equimolar amounts of each strand (oligonucleotide derivative) to PBS buffer, heating at 90°C for 5 minutes, and then slowly cooling to room temperature.

[0150] (1) siRNA 1 Sense strand (5' to 3') GGCCUUUCACUACUAAUACUU (SEQ ID NO: 5) Antisense strand (5' to 3') GUAGGAGUAGUGAAAGGCCTT (SEQ ID NO: 6)

[0151] (2) siRNA 2 Sense strand (5' to 3') GGCCUUUCACUACUAAU Ap ACUU (SEQ ID NO:5) Antisense strand (5' to 3') GUAGGAGUAGUGAAAGGCCTT (SEQ ID NO: 6)

[0152] (3) siRNA 3 Sense strand (5' to 3') GGCCUUUCACU Ap ACUAAUACUU (SEQ ID NO:5) Antisense strand (5' to 3') GUAGGAGUAGUGAAAGGCCTT (SEQ ID NO: 6)

[0153] (4) siRNA 4 Sense strand (5' to 3') GGCCUUU Ap CACUACUAAUACUU (SEQ ID NO:5) Antisense strand (5' to 3') GUAGGAGUAGUGAAAGGCCTT (SEQ ID NO: 6)

[0154] (5) siRNA 5 Sense strand (5' to 3') GGCCUUUCACUACUAAU Aetx ACUU (SEQ ID NO:5) Antisense strand (5' to 3') GUAGGAGUAGUGAAAGGCCTT (SEQ ID NO: 6)

[0155] (6) siRNA 6 Sense strand (5' to 3') GGCCUUUCACU Aetx ACUAAUACUU (SEQ ID NO:5) Antisense strand (5' to 3') GUAGGAGUAGUGAAAGGCCTT (SEQ ID NO: 6)

[0156] (7) siRNA 7 Sense strand (5' to 3') GGCCUUU Aetx CACUACUAAUACUU (SEQ ID NO:5) Antisense strand (5' to 3') GUAGGAGUAGUGAAAGGCCTT (SEQ ID NO: 6)

[0157] (Evaluation of thermal stability) 200μL of Tm phosphate buffer was added to 600pmol of the siRNA obtained above to prepare a sample of 3μmol / L, which was then heated at 100℃ for 3 minutes, and then allowed to stand for 1 hour or more to return to room temperature. 160μL of the sample was transferred to a dedicated cell, and the absorbance at 260nm associated with dissociation into single strands was measured while changing the temperature from 5℃ to 80℃ (0.5℃ / min), and the 50% melting temperature (Tm) was calculated in the same manner as above. The results are shown in Table 3. Table 3 also shows the difference (ΔTm) between the Tm of each siRNA and the Tm of siRNA 1, which is the evaluation standard. The melting curve plot is shown in Figure 2.

[0158] [Table 3]

[0159] As shown in Table 3, compared with siRNA 1 (positive control), U ApThe Tm of siRNA 2 to 4, which contained U Aetx It was confirmed that siRNAs 5 to 7, into which siRNA was introduced, showed a decrease in Tm of only 0.5°C and had thermal stability equivalent to that of siRNA 1.

[0160] (Evaluation of sugar puckering) To verify whether sugar puckering affects the thermal stability of the double strand, we synthesized monomers of 2'-OMe-4'-aminoethoxyuridine, 2'-OMe-4'-aminopropoxyuridine, and 2'-OMe-4'-aminopropyluridine, and measured the 1H NMR of the monomers. 1’-2’ The sugar puckering (proportion of N-type) was calculated by introducing this value into the following formula [1]. C3'-endo (N-type abundance ratio) [%] = 100-(J 1’-2’ ×10) [1] The above evaluation results are shown in Table 4.

[0161] [Table 4]

[0162] As shown in Table 4, 2'-OMe-4'-aminoethoxyuridine had a higher proportion of N-type than 2'-OMe-4'-aminopropyluridine. Therefore, it is considered that increasing the proportion of N-type improves the thermal stability of the double strand.

[0163] The monomers synthesized in the above evaluations were synthesized as follows. <Synthesis of Monomer> (1) Monomeric 2'-OMe-4'-aminoethoxyuridine A monomer was synthesized by replacing the -O-C2H4-NH-TFA group at the 4' position of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminoethoxyl-2'-O-methyl-uridine (compound 11) with a -O-C2H4-NH2 group. Specifically, the monomer was synthesized according to the following scheme. A 1M tetrabutylammonium fluoride tetrahydrofuran solution (TBAF, 0.43 mL, 0.43 mmol) was added to a tetrahydrofuran solution (1.35 mL) of compound 11 (0.15 g, 0.28 mmol) under an Ar atmosphere, and the mixture was stirred at room temperature for 4 hours. Next, ammonia water (1 mL, 26 mmol) was added to the reaction mixture, and the mixture was incubated at 55°C for 4 hours to obtain a monomer.

[0164] [ka]

[0165] (2) Monomeric 2'-OMe-4'-aminopropyluridine A monomer was synthesized by replacing the -C3H6-NH-TFA group at the 4' position of 5'-O-[bis(4-methoxyphenyl)phenylmethyl]-4'-C-trifluoroacetylaminopropyl-2'-O-methyl-uridine (compound 26) with a -C3H6-NH2 group. Specifically, the monomer was synthesized according to the following scheme.

[0166] [ka]

[0167] (Evaluation of RNA interference activity) The RNA interference ability was evaluated using the siRNAs 1 to 7 synthesized above. The RNA interference ability of the siRNAs was evaluated using a dual luciferase reporter assay. HeLa cells (Firefly luciferase and Renilla luciferase stable expression strain) were cultured at 8.0 × 10 3The cells / mL were prepared, and 100 μL was placed in each of the 96 well plates and cultured for 24 hours. Each strand of the synthesized siRNA was dissolved in TE buffer (10 μL), heated at 95 ° C for 3 minutes, and then left to stand for 1 hour or more to return to room temperature. Each amount of siRNA obtained in this way, each amount of medium (OPTI-MEM), and 1.5 μL of lipofectamin RNAiMAX (transfection reagent) were mixed to a total amount of 50 μL, and 10 μL was placed in each of the 96 well plates that had absorbed the medium, and after incubation in a CO2 incubator at 37 ° C for 20 minutes, 50 μL of medium was added and the plate was cultured in a CO2 incubator at 37 ° C for 24 hours. After 24 hours, the medium was absorbed and frozen. siRNA was evaluated at two concentrations, 1 nM and 10 nM.

[0168] Luciferase luminescence was measured by adding 24 μL of Dual glo substrate (substrate for Firefly luciferase) after thawing, leaving it for 5 minutes, and then transferring 23 μL of the sample to a 96-well plate for luminescence measurement, and measuring Firefly luciferase. Then, 23 μL of Stop and glo substrate (substrate for Renilla luciferase) was added, left for 10 minutes, and Renilla luciferase was measured. The luminescence measurement value of Renilla luciferase was divided by the value of Firefly luciferase, and compared using % of control. Luminescenser JNR II was used for luciferase measurement. The results are shown in Figure 3.

[0169] As shown in Figure 3, U Aetx siRNAs 5 to 7, which were introduced with U Ap As with siRNAs 2 to 4, which contained siRNA 1, the gene expression suppression ability was comparable to that of siRNA 1 (positive control).

[0170] As can be seen from the above results, the nucleoside derivative or its salt of the present invention can provide an oligonucleotide derivative or its salt having high thermal stability when used as a component of double-stranded RNA, etc. Furthermore, the oligonucleotide derivative or its salt of the present invention has high thermal stability when formed into double-stranded RNA, and can have sufficient gene expression suppression ability as a nucleic acid drug such as siRNA.

[0171] Therefore, the present invention can have the following aspects.

[0172] <1> A nucleoside derivative represented by the following formula (1) or a salt thereof:

[0173] [ka]

[0174] In the formula, R 1 represents an alkoxy group, a hydrogen atom or a halogen atom; R 2 and R 4 may be the same or different, and each represents a hydrogen atom, a protecting group for a hydroxyl group, a phosphate group, a protected phosphate group, or -P(=O) n R 5 R 6 (n represents 0 or 1, R 5 and R 6 may be the same or different and represent any one of a hydrogen atom, a hydroxyl group, a protected hydroxyl group, a mercapto group, a protected mercapto group, an alkoxy group, a cyanoalkoxy group, an amino group, and a substituted amino group, provided that when n is 1, R 5 and R 6 (Both cannot be hydrogen atoms), and R 3 is -(CH2) m NHR 7 (m represents an integer from 1 to 6, R 7 represents a hydrogen atom, an alkyl group, an alkenyl group, or a protecting group for an amino group), and B represents a purin-9-yl group, a 2-oxo-pyrimidin-1-yl group, a substituted purin-9-yl group, or a substituted 2-oxo-pyrimidin-1-yl group.

[0175] <2> R 7 represents a hydrogen atom, <1> 2. The nucleoside derivative or a salt thereof according to claim 1.

[0176] <3> m represents an integer from 2 to 4; <1> or <2> 2. The nucleoside derivative or a salt thereof according to claim 1.

[0177] <4> R 1 represents an alkoxy group having 1 to 3 carbon atoms; <1> ~ <3> 10. The nucleoside derivative or a salt thereof according to claim 9,

[0178] <5> An oligonucleotide derivative or a salt thereof, comprising at least one partial structure represented by the following formula (2):

[0179] [ka]

[0180] In the formula, R 1 represents an alkoxy group, a hydrogen atom or a halogen atom; R 3 is -(CH2) m NHR 7 (m represents an integer from 1 to 6, R 7 represents a hydrogen atom, an alkyl group, an alkenyl group, or a protecting group for an amino group), and B represents a purin-9-yl group, a 2-oxo-pyrimidin-1-yl group, a substituted purin-9-yl group, or a substituted 2-oxo-pyrimidin-1-yl group.

[0181] <6> R 7 represents a hydrogen atom, <5> 2. The oligonucleotide derivative or a salt thereof according to claim 1.

[0182] <7> m represents an integer from 2 to 4; <5> or <6> 2. The oligonucleotide derivative or a salt thereof according to claim 1.

[0183] <8> R 1represents an alkoxy group having 1 to 3 carbon atoms; <5> ~ <7> 10. The oligonucleotide derivative or a salt thereof according to any one of the above items.

[0184] <9> <5> ~ <8> 1. An siRNA comprising, as an active ingredient, the oligonucleotide derivative or a salt thereof according to any one of the above items. [Sequence List Free Text]

[0185] SEQ ID NO: 1: Sense strand RNA of Duplexes 1 to 3 synthesized in the Examples SEQ ID NO: 2: Antisense strand RNA of Duplexes 1 to 3 synthesized in the Examples SEQ ID NO: 3: Sense strand DNA of Duplex 4 to 5 synthesized in the examples SEQ ID NO: 4: Antisense strand RNA of Duplex 4 to 5 synthesized in the examples SEQ ID NO: 5: Sense strand RNA of siRNAs 1 to 7 synthesized in the examples SEQ ID NO: 6: Antisense strand DNA of siRNAs 1 to 7 synthesized in the Examples

Claims

[Claim 1] A nucleoside derivative represented by the following formula (1) or a salt thereof: 【Chemistry 1】 In the formula, R 1 represents an alkoxy group, a hydrogen atom or a halogen atom; R 2 and R 4 may be the same or different, and each represents a hydrogen atom, a protecting group for a hydroxyl group, a phosphate group, a protected phosphate group, or -P(=O) n R 5 R 6 (n represents 0 or 1, R 5 and R 6 may be the same or different and represent any one of a hydrogen atom, a hydroxyl group, a protected hydroxyl group, a mercapto group, a protected mercapto group, an alkoxy group, a cyanoalkoxy group, an amino group, and a substituted amino group, provided that when n is 1, R 5 and R 6 and R cannot both be hydrogen atoms. 3 is -(CH 2 ) m NHR 7 (m represents an integer of 1 to 6, R 7 represents a hydrogen atom, an alkyl group, an alkenyl group, or a protecting group for an amino group), and B represents a purin-9-yl group, a 2-oxo-pyrimidin-1-yl group, a substituted purin-9-yl group, or a substituted 2-oxo-pyrimidin-1-yl group.

Images