SOD1 dual expression vectors and uses thereof

Abstract

To provide compositions and methods useful for inhibiting SOD1 expression in cells (e.g., cells of a subject).SOLUTION: In some embodiments, the disclosure describes isolated nucleic acids engineered to express an inhibitory nucleic acid targeting endogenous SOD1 and an mRNA encoding a reinforced SOD1 protein. In some embodiments, compositions and methods described in the disclosure are useful for treating Amyotrophic Lateral Sclerosis (ALS) in a subject.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] Related Applications This application claims the benefit under 35 U.S.C. 119(e) of the filing date of U.S. Provisional Application No. 62 / 561,932, filed September 22, 2017, entitled "SOD1 Dual Expression Vector and Uses Thereof," the entire contents of which are incorporated herein by reference. [Background technology]

[0002] background Amyotrophic lateral sclerosis (ALS) is a progressive, generally fatal motor neuron disorder that sometimes co-occurs with frontotemporal dementia (FTD). ALS occurs in both sporadic (SALS) and familial (FALS) forms. Approximately 10% of cases are transmitted as an autosomal dominant trait. The FDA-approved treatment for ALS is riluzole, a compound that extends survival by approximately 10%. In general, studies demonstrating the benefits of SOD1 silencing in ALS cells and transgenic animals have not documented silencing of only the mutant allele. Rather, most studies demonstrate that silencing reduces the levels of both the mutant and wild-type SOD1 proteins. However, excessive silencing of SOD1 from both the mutant and wild-type alleles may be associated with undesirable biological outcomes as a result of reduced activity or function of the wild-type SOD1 protein. Summary of the Invention

[0003] overview Aspects of the present disclosure relate to compositions and methods for regulating cytosolic Cu / Zn superoxide dismutase (SOD1) expression in cells. Thus, in some embodiments, methods useful for treating ALS are provided. In some embodiments, the present disclosure provides synthetic nucleic acids (e.g., synthetic microRNAs) engineered to inhibit endogenous SOD1 expression in cells or subjects. In some embodiments, the present disclosure provides nucleic acids engineered to express exogenous SOD1 in cells or subjects. In some embodiments, such exogenous SOD1 is resistant to targeting by synthetic nucleic acids (e.g., synthetic microRNAs) that target endogenous SOD1. Thus, in some embodiments, the present disclosure provides compositions and methods for (1) linking the delivery of synthetic microRNAs that suppress the expression of endogenous cytosolic Cu / Zn superoxide dismutase (SOD1) activity to (2) a second construct that expresses exogenous SOD1 that is resistant to synthetic microRNAs (miRNAs).

[0004] The present disclosure is based in part on the compositions and methods described herein, which address the problem of loss of neuroprotective activity due to SOD1 dismutation by including anti-SOD1 miRNA, SOD1 cDNA expressed from RNA engineered to be resistant to anti-SOD1 miRNA in series.In some embodiments, the construct described by the present disclosure allows normal levels of SOD1 dismutation activity (for example, in cells or subjects to which the construct is administered) even when accompanied by complete silencing of both WT and mutant endogenous SOD1 alleles.

[0005] Thus, in some aspects, the present disclosure provides isolated nucleic acids comprising: a first region encoding one or more first miRNAs comprising nucleic acids having a sequence complementary to an endogenous mRNA of a subject that is sufficient to hybridize to the endogenous mRNA and inhibit expression of the endogenous mRNA, wherein the endogenous mRNA encodes an SOD1 protein; and a second region encoding an exogenous mRNA that encodes a wild-type SOD1 protein, wherein the one or more first miRNAs do not comprise nucleic acids having a sequence complementary to the exogenous mRNA that is sufficient to hybridize to the exogenous mRNA and inhibit expression of the exogenous mRNA. In some embodiments, the exogenous mRNA lacks a 5' untranslated region (5'UTR), lacks a 3' untranslated region (3'UTR), or lacks both a 5'UTR and a 3'UTR. In some embodiments, the exogenous mRNA encoding the SOD1 protein has one or more silent base pair mutations relative to the endogenous mRNA. In some embodiments, the exogenous mRNA comprises a nucleic acid sequence that is at least 95% identical to the endogenous mRNA.

[0006] In some embodiments, the wild-type SOD1 is encoded by the nucleic acid sequence set forth in SEQ ID NO: 7 (the enhanced SOD1 sequence). In some embodiments, the one or more first miRNAs target an untranslated region (e.g., a 5'UTR or 3'UTR) of a nucleic acid encoding an endogenous mRNA. In some embodiments, the one or more first miRNAs target a coding sequence of a nucleic acid encoding an endogenous mRNA. In some embodiments, the one or more first miRNAs hybridize to a nucleic acid comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the RNA encoded by the sequence set forth in SEQ ID NO: 3. In some embodiments, the one or more first miRNAs hybridize to a nucleic acid comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the RNA encoded by the sequence set forth in SEQ ID NO: 2.

[0007] In some embodiments, the one or more first miRNAs comprise or are encoded by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of the sequence set forth in SEQ ID NO: 4. In some embodiments, the one or more first miRNAs comprise or are encoded by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of the sequence set forth in SEQ ID NO: 3. In some embodiments, the miRNA further comprises a flanking region of miR-155 or a flanking region of miR-30. In some embodiments, the isolated nucleic acid further comprises a first promoter. In some embodiments, the first promoter is operably linked to the first region of the isolated nucleic acid described by the present disclosure. In some embodiments, the first promoter is an RNA polymerase III (pol III) promoter, such as an H1 promoter or a U6 promoter.

[0008] In some embodiments, the first promoter is an RNA polymerase II (pol II) promoter, such as the chicken beta actin (CBA) promoter or the endogenous SOD1 promoter (eg, SEQ ID NO: 16). In some embodiments, the isolated nucleic acid further comprises a second promoter. In some embodiments, the second promoter is operably linked to the second region of the isolated nucleic acid described by the present disclosure. In some embodiments, the second promoter is a pol II promoter, such as the chicken beta actin (CBA) promoter or the endogenous SOD1 promoter. In some embodiments, the isolated nucleic acid further comprises an enhancer sequence, such as a cytomegalovirus (CMV) enhancer.

[0009] In some embodiments, the first region is located within an untranslated region (e.g., a UTR) of the second region. In some embodiments, the first region is located within an intron of the isolated nucleic acid. In some embodiments, the first region is located 5' to the second region. In some embodiments, the isolated nucleic acid further comprises at least one adeno-associated virus (AAV) inverted terminal repeat (ITR). In some embodiments, the isolated nucleic acid comprises a full-length ITR and a mutant ITR. In some embodiments, the ITR flanks the first and second regions of the isolated nucleic acid described by the present disclosure. In some embodiments, the present disclosure provides a recombinant adeno-associated virus (rAAV) comprising an isolated nucleic acid and AAV capsid proteins described by the present disclosure.

[0010] In some embodiments, the rAAV targets CNS tissue, hi some embodiments, the rAAV targets neurons. In some embodiments, the capsid protein is an AAV9 capsid protein or an AAVrh.10 capsid protein. In some aspects, the present disclosure provides a composition comprising an isolated nucleic acid described by the present disclosure or an rAAV described by the present disclosure and a pharmaceutically acceptable excipient. In some aspects, the present disclosure provides methods for inhibiting SOD1 expression in a cell, comprising delivering an isolated nucleic acid described by the present disclosure or an rAAV described by the present disclosure to the cell.

[0011] In some embodiments, the cells comprise a nucleic acid sequence encoding a mutant SOD1 protein. In some aspects, the present disclosure provides methods for treating a subject having or suspected of having ALS, comprising administering to the subject an effective amount of an isolated nucleic acid described by the present disclosure, or an effective amount of an rAAV described by the present disclosure. In some embodiments, the subject comprises a nucleic acid sequence encoding a mutant SOD1 protein. In some embodiments, the subject is a mammalian subject, such as a human subject. Brief Description of the Drawings [Brief explanation of the drawings]

[0012] [Figure 1] Figure 1 shows a schematic diagram of the bicistronic dual-function vector construct design: the anti-Sod1 miRNA is expressed by the H1 promoter, and the miRNA-resistant SOD1 cDNA is expressed by the chicken beta-actin promoter and CMV enhancer (e.g., the CAG promoter). [Figure 2] Figure 2 shows a schematic diagram of the construct design of the single-promoter dual-function vector. Both the anti-Sod1 miRNA and the miRNA-resistant SOD1 cDNA are expressed by the chicken beta-actin promoter and CMV enhancer (e.g., the CAG promoter). The anti-Sod1 miR is located in an intron. [Figure 3] Figure 3 shows a schematic diagram of the bicistronic dual-function vector construct design. The anti-SOD1 miRNA is expressed by the H1 promoter, and the miRNA-resistant SOD1 cDNA is expressed by the chicken beta-actin promoter and CMV enhancer (e.g., the CAG promoter). The locus of the SOD1 cDNA containing the silent mutation relative to wild-type SOD1 is shown ("miR-SOD resistance target").

[0013] [Figure 4] Figure 4 shows a schematic diagram of the construct design of the single-promoter dual-function vector. Both the anti-Sod1 miRNA and the miRNA-resistant SOD1 cDNA are expressed by the chicken beta-actin promoter and CMV enhancer (e.g., the CAG promoter). The locus of the SOD1 cDNA containing a silent mutation relative to wild-type SOD1 is shown ("miR-SOD-resistant target"). The anti-Sod1 miR is located in an intron. [Figure 5] Figure 5 shows a schematic diagram of the construct design of a bicistronic, dual-function, self-complementary AAV vector. The anti-Sod1 miRNA is expressed by the H1 promoter, and the miRNA-resistant SOD1 cDNA is expressed by the chicken beta-actin promoter and CMV enhancer (e.g., the CAG promoter). The locus of the SOD1 cDNA containing a silent mutation relative to wild-type SOD1 is shown ("miR-SOD resistance target"). A mutant AAV inverted terminal repeat (ITR) is present at the 5' end of the construct, and the full-length AAV ITR is located at the 3' end.

[0014] [Figure 6] Figure 6 shows a schematic diagram of the construct design of a bicistronic, dual-function, self-complementary AAV vector. The anti-Sod1 miRNA is expressed by the H1 promoter, and the miRNA-resistant SOD1 cDNA is expressed by the chicken beta-actin promoter and CMV enhancer (e.g., the CAG promoter). The locus of the SOD1 cDNA containing a silent mutation relative to wild-type SOD1 is shown ("miR-SOD-resistant target"). The SOD1 expression construct lacks the 3' UTR. A mutant AAV inverted terminal repeat (ITR) is present at the 5' end of the construct, and the full-length AAV ITR is located at the 3' end. [Figure 7] Figure 7 shows a schematic diagram of the construct design of a single-promoter dual-function AAV vector. Both the anti-Sod1 miRNA and the miRNA-resistant SOD1 cDNA are expressed by the chicken beta-actin promoter and CMV enhancer (e.g., the CAG promoter). The locus of the SOD1 cDNA containing a silent mutation relative to wild-type SOD1 is shown ("miR-SOD-resistant target"). The anti-Sod1 miR is located in an intron. The AAV ITRs are located at the 5' and 3' ends of the construct.

[0015] [Figure 8]Figure 8 shows a schematic diagram of the construct design of a single-promoter dual-function AAV vector. Both the anti-Sod1 miRNA and the miRNA-resistant SOD1 cDNA are expressed by the chicken beta-actin promoter and CMV enhancer (e.g., the CAG promoter). The locus of the SOD1 cDNA containing a silent mutation relative to wild-type SOD1 is shown ("miR-SOD-resistant target"). The SOD1 expression construct lacks the 3' UTR. The anti-Sod1 miR is located in an intron. The AAV ITRs are located at the 5' and 3' ends of the construct. [Figure 9] FIG. 9 shows a nucleic acid sequence alignment of the wild-type SOD1 coding sequence (SEQ ID NO: 1) with an example of an "enhanced" SOD1 coding sequence (SEQ ID NO: 7).

[0016] Detailed Description In some aspects, the present disclosure relates to compositions and methods for modulating the expression and / or activity of genes associated with amyotrophic lateral sclerosis (ALS) in a cell (e.g., a cell of a subject). For example, in some aspects, the present disclosure provides a composition (e.g., a dual-function vector) that simultaneously expresses, in a cell or a subject, (i) one or more synthetic nucleic acids (e.g., inhibitory RNAs such as miRNAs, siRNAs, and shRNAs) that inhibit genes associated with ALS and (ii) an exogenous gene associated with ALS that encodes a protein resistant to the synthetic nucleic acids. Examples of genes associated with ALS include, but are not limited to, C9Orf72, SOD1, FUS, TARDBP, SQSTM1, VCP, OPTN, PFN1, UBQLN2, DCTN1, ALS2, CHMP2B, FIG4, HNRNAP1, ATXN2, ANG, SPG11, VAPB, NEFH, CHCHD10, ERBB4, PRPH, MATR3, SETX, SIGMAR1, TBK1, TRPM7, TUBA4A, ANXA11, NEK1, SARM1, UN13A, MOBP, SCFD1, C21Orf2 and other described genes (for example, Renton et al. (2014) Nature Neuroscience 17(1):17-23).In some embodiments, the gene associated with ALS is a dominant negative gene associated with ALS (for example, a gene encoding a dominant negative gene product such as a protein associated with ALS).

[0017] Aspects of the present disclosure relate to compositions and methods for regulating cytosolic Cu / Zn superoxide dismutase (SOD1) expression in cells. Thus, in some embodiments, a method useful for treating ALS is provided. In some embodiments, the present disclosure provides a synthetic nucleic acid (e.g., synthetic microRNA) engineered to inhibit the expression of endogenous SOD1 in cells or subjects. In some embodiments, the present disclosure provides a nucleic acid engineered to express exogenous SOD1 in cells or subjects. In some embodiments, such exogenous SOD1 is resistant to targeting by synthetic nucleic acid (e.g., synthetic microRNA) that targets endogenous SOD1.

[0018] Aspects of the present disclosure relate to improved gene therapy compositions and related methods for treating ALS using recombinant adeno-associated virus (rAAV) vectors. In particular, rAAVs are provided that harbor engineered nucleic acids that express inhibitory nucleic acids that suppress ALS-related genes, such as SOD1. In some embodiments, the present disclosure utilizes recombinant AAVs (e.g., rAAV9, rAAV.Rh10, etc.) to deliver microRNAs to the CNS, thereby suppressing ALS genes, such as SOD1. In some aspects, the present disclosure relates to the discovery of dual-function vectors that can knock down endogenous SOD1 expression (e.g., wild-type SOD1 and mutant SOD1 expression) in a subject while expressing wild-type SOD1. Thus, in some embodiments, the constructs described by the present disclosure allow normal levels of SOD1 dismutation activity (e.g., in cells or subjects to which the constructs are administered) even when complete silencing of both WT and mutant endogenous SOD1 alleles occurs.

[0019] In some aspects, the present disclosure provides isolated nucleic acids comprising: a first region encoding one or more first miRNAs comprising nucleic acids having a sequence complementary to an endogenous mRNA of a subject that is sufficient to hybridize to the endogenous mRNA and inhibit expression of the endogenous mRNA, wherein the endogenous mRNA encodes an SOD1 protein; and a second region encoding an exogenous mRNA that encodes a wild-type SOD1 protein, wherein the one or more first miRNAs do not comprise nucleic acids having a sequence complementary to the exogenous mRNA that is sufficient to hybridize to the exogenous mRNA and inhibit expression of the exogenous mRNA.

[0020] SOD1 As used herein, "SOD1" refers to superoxide dismutase (SOD1), an enzyme encoded in humans by the SOD1 gene. Typically, SOD1 catalyzes the decomposition of superoxide into hydrogen peroxide and dioxygen, and functions to remove free radicals in the body. "Wild-type SOD1" refers to a gene product (e.g., a protein) encoded by the SOD1 gene that does not cause functional toxicity in cells or subjects (e.g., does not lead to or will not lead to the development of ALS). In some embodiments, the wild-type SOD1 gene encodes an mRNA transcript (e.g., a mature mRNA transcript) having the sequence set forth in NCBI accession number NM_000454.4. "Mutant SOD1" refers to a gene product (e.g., a protein) that contains one or more mutations (e.g., missense mutations, nonsense mutations, frameshift mutations, insertions, deletions, etc.) that result in a gene product (e.g., a protein) with altered function, such as a toxic gain of function. Generally, a nucleic acid encoding a mutant SOD1 gene product does not contain silent mutations relative to a nucleic acid encoding a wild-type SOD1 gene product.

[0021] Mutations in the gene encoding superoxide dismutase (SOD1), located on chromosome 21, have been linked to familial amyotrophic lateral sclerosis (AMLS). Superoxide dismutase (SOD1) is an enzyme encoded by the SOD1 gene. SOD1 binds copper and zinc ions and is one of three superoxide dismutases responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytosolic and mitochondrial intermembrane space protein that functions as a homodimer to convert naturally occurring but harmful superoxide radicals into molecular oxygen and hydrogen peroxide. Frequent SOD1 mutations that cause and contribute to ALS include A4V, H46R, and G93A. Additional SOD1 mutations have been described, for example, by Banci et al. (2008) PLoS ONE 3(2): e1677.

[0022] The present disclosure is based, in part, on the discovery that a nucleic acid construct that simultaneously inhibits endogenous SOD1 expression (e.g., suppresses endogenous wild-type and endogenous mutant SOD1) in a non-allele-specific manner and expresses an exogenous SOD1 protein (e.g., exogenous wild-type SOD1 or exogenous enhanced SOD1 protein) allows normal levels of SOD1 dismutation activity even when both WT and mutant endogenous SOD1 alleles are completely silenced. As used herein, "endogenous" refers to a gene (e.g., SOD1 gene) or a gene product (e.g., SOD1 protein) encoded by the cell's native DNA. "Exogenous" refers to a gene (e.g., a nucleic acid encoding an SOD1 protein, such as an SOD1 cDNA) or a gene product (e.g., an SOD1 protein, such as an enhanced SOD1 protein) derived from a source other than the cell's native DNA (e.g., non-naturally introduced into the cell).

[0023] In some embodiments, the exogenous SOD1 nucleic acid sequence encodes an enhanced SOD1 protein. As used herein, "enhanced SOD1" refers to a nucleic acid sequence that encodes an SOD1 protein that contains one or more silent mutations so that it encodes the same protein as an endogenous wild-type SOD1 protein but has a different primary nucleic acid (e.g., DNA) sequence. Without wishing to be bound by any particular theory, the "enhanced SOD1" mRNA transcript is not inhibited by certain inhibitory RNAs (e.g., miRNAs) that target endogenous SOD1 RNA transcripts (e.g., wild-type SOD1 and mutant SOD1 transcripts).

[0024] The number of silent mutations in an enhanced SOD1 nucleic acid sequence can vary. In some embodiments, the nucleic acid sequence encoding the enhanced SOD1 contains between about 1 and about 50 silent mutations (e.g., any integer between 1 and 50, inclusive) relative to the wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 coding sequence). In some embodiments, the nucleic acid sequence encoding the enhanced SOD1 contains at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 silent mutations relative to the wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 coding sequence). In some embodiments, one or more silent mutations in the nucleic acid sequence encoding the enhanced SOD1 are located in a seed region targeted by an inhibitory nucleic acid. In some embodiments, the seed region ranges in length from about 3 to about 25 contiguous nucleotides (e.g., any integer between 3 and 25, inclusive).

[0025] The nucleic acid (e.g., DNA) sequence identity between the nucleic acid encoding the exogenous (e.g., enhanced) SOD1 protein and the nucleic acid encoding the endogenous wild-type SOD1 protein can vary. In some embodiments, the nucleic acid sequence encoding the exogenous SOD1 protein is between about 99.9% and about 85% identical to the endogenous wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 DNA coding sequence). In some embodiments, the nucleic acid sequence encoding the exogenous SOD1 protein is about 99.9%, about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, about 90%, about 89%, about 88%, about 87%, about 86%, or about 85% identical to the endogenous wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 DNA coding sequence). In some embodiments, the nucleic acid sequence encodes an exogenous SOD1 protein having an amino acid sequence that is between about 99.9% and about 90% (e.g., about 99.9%, about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, or about 90%) identical to the endogenous wild-type SOD1 amino acid sequence (e.g., SEQ ID NO: 17).

[0026] inhibitory nucleic acid Aspects of the present disclosure relate to inhibitory nucleic acids that target SOD1 (e.g., endogenous SOD1). In some embodiments, the inhibitory nucleic acid is a nucleic acid that hybridizes to at least a portion of a target nucleic acid, such as an RNA, pre-mRNA, or mRNA, and inhibits its function or expression. In some embodiments, the inhibitory nucleic acid is single-stranded or double-stranded. In some embodiments, the inhibitory nucleic acid comprises or is encoded by the sequence set forth in SEQ ID NO:4:CTGCATGGATTCCATGTTCAT (miR-SOD-127). In some embodiments, the inhibitory nucleic acid comprises or is encoded by the sequence set forth in SEQ ID NO:3:CTGCATGGATTCCATGTTCAT (miR-SOD-127). In some embodiments, the inhibitory nucleic acid is a mature miRNA comprising SEQ ID NO:3 and SEQ ID NO:4. In some embodiments, SEQ ID NO:3 is the guide strand of the mature miRNA, and SEQ ID NO:4 is the passenger strand of the mature miRNA (e.g., miRNA * )

[0027] In some embodiments, the inhibitory nucleic acid is 5 to 30 bases in length (e.g., 10 to 30, 15 to 25, 19 to 22). The inhibitory nucleic acid can also be 10 to 50, or 5 to 50 bases in length. For example, the inhibitory nucleic acid can be any one of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases in length. In some embodiments, the inhibitory nucleic acid comprises or consists of a sequence of bases that is at least 80% or 90% complementary to at least 5, 10, 15, 20, 25, or 30 bases, or up to 30 or 40 bases, of the target nucleic acid, or comprises a sequence of bases with up to 6 mismatches over 10, 15, 20, 25, or 30 bases of the target nucleic acid.

[0028] In some embodiments, any one or more thymidine (T) or uridine (U) nucleotides in the sequences provided herein can be replaced with any other nucleotide suitable for base pairing with adenosine nucleotides (e.g., via Watson-Crick base pairing). For example, T can be replaced with U, and U can be replaced with T. In some embodiments, inhibitory nucleic acids are provided that inhibit the expression of genes in cells of the central nervous system. In some embodiments, the cells are neurons, astrocytes, or oligodendrocytes.

[0029] In some embodiments, the inhibitory nucleic acid is an miRNA. "MicroRNA" or "miRNA" is a small, non-coding RNA molecule that can mediate gene silencing after transcription or translation. Typically, miRNAs are transcribed as hairpin or stem-loop (e.g., self-complementary, single-stranded backbone) duplex structures, referred to as primary miRNAs (pri-miRNAs), which are enzymatically processed into pre-miRNAs (e.g., by Drosha, DGCR8, Pasha, etc.). The length of the pri-miRNA can vary. In some embodiments, the pri-miRNA ranges in length from about 100 to about 5,000 base pairs (e.g., about 100, about 200, about 500, about 1,000, about 1,200, about 1,500, about 1,800, or about 2,000 base pairs). In some embodiments, the pri-miRNA is greater than 200 base pairs in length (eg, 2500, 5000, 7000, or 9000 or more base pairs in length).

[0030] Pre-miRNAs, which are also characterized by a hairpin or stem-loop duplex structure, can also vary in length. In some embodiments, pre-miRNAs range in size from about 40 base pairs to about 500 base pairs. In some embodiments, pre-miRNAs range in size from about 50 to 100 base pairs. In some embodiments, pre-miRNAs range in size from about 50 to about 90 base pairs in length (e.g., about 50, about 52, about 54, about 56, about 58, about 60, about 62, about 64, about 66, about 68, about 70, about 72, about 74, about 76, about 78, about 80, about 82, about 84, about 86, about 88, or about 90 base pairs in length).

[0031] Generally, pre-miRNAs are exported to the cytoplasm and first processed by Dicer to produce incomplete miRNAs / miRNAs. * A duplex is generated, followed by the generation of a single-stranded mature miRNA molecule, which is subsequently loaded into the RNA-induced silencing complex (RISC). Typically, mature miRNA molecules range in size from about 19 to about 30 base pairs in length. In some embodiments, mature miRNA molecules are about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or 30 base pairs in length. In some embodiments, the isolated nucleic acids of the present disclosure comprise sequences encoding pri-miRNA, pre-miRNA, or mature miRNA that comprise or are encoded by the sequences set forth in SEQ ID NO:4 (miR-SOD-127) and / or SEQ ID NO:3.

[0032] In some aspects, the present disclosure provides isolated nucleic acids and vectors (e.g., rAAV vectors) encoding one or more artificial miRNAs. As used herein, "artificial miRNA" or "amiRNA" refers to an endogenous pri-miRNA or pre-miRNA (e.g., an miRNA backbone, which is a precursor miRNA that can generate a functional mature miRNA), and includes miRNAs and miRNAs. *The sequence (e.g., the passenger strand of an miRNA duplex) can be a corresponding amiRNA / amiRNA that directs highly efficient RNA silencing of targeted genes, as described, for example, in Eamens et al. (2014), Methods Mol. Biol. 1062:211-224. * The sequence is replaced by an artificial miRNA. For example, in some embodiments, the artificial miRNA comprises a miR-155 pri-miRNA backbone, in which the sequence encoding the mature SOD1-specific miRNA (for example, SEQ ID NO: 3 and / or 4; miR-SOD-127) is inserted instead of the sequence encoding the endogenous miR-155 mature miRNA. In some embodiments, the miRNA (for example, artificial miRNA) described by the present disclosure comprises a miR-155 backbone sequence, a miR-30 backbone sequence, a mir-64 backbone sequence, a miR-106 backbone, a miR-21 backbone, a miR-1 backbone, a miR-451 backbone, a miR-126 backbone, or a miR-122 backbone sequence. In some embodiments, the inhibitory nucleic acid is a microRNA comprising a targeting sequence with the adjacent region of miR-155 or miR-30.

[0033] It should be understood that in some embodiments, an isolated nucleic acid or vector (e.g., an rAAV vector) comprises a nucleic acid sequence encoding more than one (e.g., a plurality, such as 2, 3, 4, 5, or 10 or more) miRNAs. In some embodiments, each of the more than one miRNA targets (e.g., hybridizes or specifically binds to) the same target gene (e.g., an isolated nucleic acid encoding three unique miRNAs, each miRNA targeting the SOD1 gene). In some embodiments, each of the more than one miRNA targets (e.g., hybridizes or specifically binds to) a different target gene.

[0034] Isolated nucleic acids In some aspects, the present disclosure relates to an isolated nucleic acid comprising a first expression construct encoding a synthetic microRNA for inhibiting expression of endogenous SOD1 and a second expression construct expressing exogenous SOD1 that is resistant to the synthetic microRNA (miRNA).

[0035] A "nucleic acid" sequence refers to a DNA sequence or an RNA sequence. In some embodiments, the proteins and nucleic acids of the present disclosure are isolated. As used herein, the term "isolated" means artificially produced. As used herein with respect to nucleic acids, the term "isolated" means: (i) amplified in vitro, e.g., by polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, e.g., by cleavage and gel separation; or (iv) synthesized, e.g., by chemical synthesis. An isolated nucleic acid is one that can be readily manipulated by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector for which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences are disclosed is considered isolated, whereas a nucleic acid sequence existing in its natural state in its natural host is not. An isolated nucleic acid can be, but need not be, substantially purified. For example, a nucleic acid isolated within a cloning or expression vector is not pure in that it may comprise only a small percentage of the material in the cell in which it resides.However, such nucleic acids can be easily manipulated by standard techniques known to those skilled in the art, and therefore, as this term is used herein, are isolated.When used herein with respect to a protein or peptide, the term "isolated" refers to a protein or peptide that has been isolated from its natural environment or that has been artificially produced (for example, by chemical synthesis, recombinant DNA technology, etc.).

[0036] The isolated nucleic acid of the present disclosure typically includes one or more regions encoding one or more inhibitory RNAs that target the subject's endogenous mRNA (e.g., mRNA encoding endogenous wild-type SOD1 and / or endogenous mutant SOD1). The isolated nucleic acid also typically includes one or more regions encoding one or more exogenous mRNAs. The protein(s) encoded by the one or more exogenous mRNAs may or may not differ in sequence composition from the protein(s) encoded by the one or more endogenous mRNAs. For example, one or more endogenous mRNAs may encode wild-type and mutant forms of a particular protein, such as when a subject is heterozygous for a particular mutation and the exogenous mRNA can encode the wild-type mRNA of the same particular protein. In this case, the sequences of the exogenous mRNA and the endogenous mRNA encoding the wild-type protein typically differ sufficiently so that the exogenous mRNA is not targeted by one or more inhibitory RNAs. This can be achieved, for example, by introducing one or more silent mutations into the exogenous mRNA so that it encodes the same protein as the endogenous mRNA but has a different nucleic acid sequence. In this case, the exogenous mRNA can be referred to as "enhanced". Alternatively, an inhibitory RNA (for example, miRNA) can target the 5' and / or 3' untranslated region of the endogenous mRNA. These 5' and / or 3' regions can then be removed or replaced in the exogenous mRNA so that the exogenous mRNA is not targeted by one or more inhibitory RNAs.

[0037] In another example, one or more endogenous mRNAs may encode only mutant versions of a particular protein, such as when a subject is homozygous for a particular mutation, and the exogenous mRNA may encode the wild-type mRNA of the same particular protein. In this case, the sequence of the exogenous mRNA may be enriched as described above, or one or more inhibitory RNAs may be designed to distinguish the mutated endogenous mRNA from the exogenous mRNA. In some embodiments, the isolated nucleic acid typically includes a first region encoding one or more first inhibitory RNAs (e.g., miRNAs), which include nucleic acids having a sequence complementary to an endogenous mRNA of a subject that hybridizes to the endogenous mRNA and inhibits expression of the endogenous mRNA (e.g., endogenous SOD1 mRNA). The isolated nucleic acid also typically includes a second region encoding an exogenous mRNA (e.g., exogenous SOD1), where the protein encoded by the exogenous mRNA has an amino acid sequence at least 95% identical to the first protein, and the one or more first inhibitory RNAs do not include nucleic acids having a sequence complementary to the exogenous mRNA that hybridizes to the exogenous mRNA and inhibits expression of the exogenous mRNA. For example, the first region can be located in any suitable location. The first region can be located within the untranslated portion of the second region. The first region can be located in any untranslated portion of the nucleic acid, including, for example, an intron, a 5' or 3' untranslated region, etc.

[0038] The region (e.g., first region) containing the inhibitory nucleic acid can be located in any suitable location in the isolated nucleic acid, and can be located in any untranslated portion of the nucleic acid, including, for example, an intron, a 5' or 3' untranslated region, etc. In some cases, it may be desirable to position a region (e.g., a first region) upstream of the first codon of a nucleic acid sequence encoding a protein (such as a second region encoding an exogenous SOD1 protein coding sequence). For example, the region may be positioned between the first codon of the protein coding sequence and 2000 nucleotides upstream of the first codon. The region may be positioned between the first codon of the protein coding sequence and 1000 nucleotides upstream of the first codon. The region may be positioned between the first codon of the protein coding sequence and 500 nucleotides upstream of the first codon. The region may be positioned between the first codon of the protein coding sequence and 250 nucleotides upstream of the first codon. The region may be positioned between the first codon of the protein coding sequence and 150 nucleotides upstream of the first codon.

[0039] In some cases, it may be desirable to place a region (e.g., a region encoding an inhibitory nucleic acid, such as region 1) upstream of the poly-A tail of the region encoding the exogenous SOD1 protein. For example, the region may be located between the first base of the poly-A tail and 2,000 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 1,000 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 500 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 250 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 150 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 100 nucleotides upstream of the first base. The region may be located between the first base of the poly-A tail and 50 nucleotides upstream of the first base. In some embodiments, the region is located between the last nucleotide base of the promoter sequence and the first nucleotide base of the poly-A tail sequence.

[0040] In some cases, the region encoding the inhibitory nucleic acid (e.g., the first region) can be located downstream of the last base of the poly-A tail of the region encoding the exogenous SOD1 protein. The region can be between the last base of the poly-A tail and 2000 nucleotides downstream of the last base. The region can be between the last base of the poly-A tail and 1000 nucleotides downstream of the last base. The region can be between the last base of the poly-A tail and 500 nucleotides downstream of the last base. The region can be between the last base of the poly-A tail and 250 nucleotides downstream of the last base. The region can be between the last base of the poly-A tail and 150 nucleotides downstream of the last base. It should be understood that in cases where the isolated nucleic acid encodes more than one miRNA, each miRNA can be positioned in any suitable location within the construct. For example, a nucleic acid encoding a first miRNA can be positioned in an intron of the region encoding the exogenous SOD1 protein, and a nucleic acid sequence encoding a second miRNA can be positioned in another region (e.g., between the protein-coding sequence and the first base of the poly-A tail of the transgene).

[0041] In some embodiments, the isolated nucleic acid further comprises a nucleic acid sequence encoding one or more expression control sequences (e.g., promoters, etc.). Expression control sequences include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize mRNA in the cytoplasm; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and, if desired, sequences that enhance secretion of the encoded product. A large number of expression control sequences, including natural, constitutive, inducible, and / or tissue-specific promoters, are known in the art and may be utilized. "Promoter" refers to a DNA sequence recognized by the synthetic machinery of a cell, or introduced synthetic machinery, necessary to initiate the specific transcription of a gene. The phrases "operably positioned," "under control," or "under transcriptional control" mean that the promoter is in the correct location and orientation relative to the nucleic acid to control the initiation of RNA polymerase and expression of the gene.

[0042] For nucleic acids encoding proteins, a polyadenylation sequence is generally inserted after the transgene sequence and before the 3' AAV ITR sequence. The rAAV constructs useful in this disclosure may also contain an intron, desirably positioned between the promoter / enhancer sequence and the transgene. One possible intron sequence is derived from SV-40 and is referred to as the SV-40 T intron sequence. Another vector element that may be used is an internal ribosome entry site (IRES). IRES sequences are used to produce more than one polypeptide from a single gene transcript. IRES sequences may be used to produce proteins containing more than one polypeptide chain. The selection of these and other common vector elements is conventional, and many such sequences are available (see, e.g., Sambrook et al. and the references cited therein, e.g., pages 3.18-3.26 and 16.17-16.27, and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989). In some embodiments, the foot-and-mouth disease virus 2A sequence is included in the polyprotein; it is a small peptide (approximately 18 amino acids in length) that has been shown to mediate polyprotein cleavage (Ryan, MD et al., EMBO, 1994; 4: 928-933; Mattion, NM et al., J Virology, November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001; 8: 864-873; and Halpin, C et al., The Plant Journal, 1999; 4: 453-459).The cleavage activity of 2A sequences has previously been demonstrated in artificial systems, including plasmids and gene therapy vectors (AAV and retrovirus) (Ryan, MD et al., EMBO, 1994; 4: 928-933; Mattion, NM et al., J Virology, November 1996; pp. 8124-8127; Furler, S et al., Gene Therapy, 2001; pp. 864-873; and Halpin, C et al., The Plant Journal, 1999; pp. 453-459; de Felipe, P et al., Gene Therapy, 1999; pp. 6: 198-208; de Felipe, P et al., Human Gene Therapy, 2000; pp. 11: 1921-1931; and Klump, H et al., Gene Therapy, 2001;8:811-817).

[0043] Examples of constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter (e.g., the CBA promoter), the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter [Invitrogen]. In some embodiments, the promoter is an enhanced chicken β-actin promoter (CAG promoter). In some embodiments, the promoter is an H1 promoter or a U6 promoter.

[0044] Inducible promoters allow for the regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of particular physiological conditions, e.g., acute phase, a specific differentiation state of cells, or only in replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including, but not limited to, Invitrogen, Clontech, and Ariad. Many other systems have also been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by an exogenously supplied promoter include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995)), and the tetracycline-inducible system (Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1995)). (1998)), the RU486 inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)), and the rapamycin inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters that may be useful in this context are those that are regulated by specific physiological conditions, such as temperature, acute phase, a specific differentiation state of the cell, or in replicating cells only.

[0045] In another embodiment, the native promoter for SOD1 (e.g., SEQ ID NO: 16) will be used. When it is desired that the expression of the transgene mimic the native expression, the native promoter may be preferred. When the expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimulus, the native promoter may be used. In further embodiments, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, may also be used to mimic the native expression.

[0046] In some embodiments, the regulatory sequence confers tissue-specific gene expression. In some cases, the tissue-specific regulatory sequence binds to a tissue-specific transcription factor that induces transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: the liver-specific thiorexin-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synapsin-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, α-myosin heavy chain (a-MHC) promoter, or cardiac troponin T (cTnT) promoter.Other exemplary promoters include the beta-actin promoter, the hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); the alpha-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), the bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); the bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), the CD2 promoter (Hansal et al., J. Immunol., 161:1063-8 (1998)); the immunoglobulin heavy chain promoter; the T cell receptor alpha chain promoter; the neuronal, e.g., neuron-specific, enolase (NSE) promoter (Andersen et al. al., Cell. Mol. Neurobiol., 13:503-15 (1993)), the neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)), among others that will be apparent to those skilled in the art.

[0047] Embodiments of the present disclosure relate to isolated nucleic acids comprising more than one promoter (e.g., two, three, four, or five or more promoters). For example, in the context of a construct having a transgene comprising a first region encoding an inhibitory RNA (e.g., miRNA) and a second region encoding an exogenous SOD1 protein, it may be desirable to drive expression of the inhibitory RNA coding region using a first promoter sequence (e.g., a first promoter sequence operably linked to the inhibitory nucleic acid coding region) and to drive expression of the exogenous SOD1 coding region with a second promoter sequence (e.g., a second promoter sequence operably linked to the exogenous SOD1 coding region). Generally, the first promoter sequence and the second promoter sequence can be the same promoter sequence or different promoter sequences. In some embodiments, the first promoter sequence (e.g., a promoter driving expression of a protein coding region) is an RNA polymerase III (pol III) promoter sequence. Non-limiting examples of pol III promoter sequences include U6 and H1 promoter sequences. In some embodiments, the second promoter sequence (e.g., a promoter sequence driving expression of an exogenous SOD1 RNA) is an RNA polymerase II (pol II) promoter sequence. Non-limiting examples of pol II promoter sequences include chicken beta actin promoter (CBA), T7, T3, SP6, RSV, and cytomegalovirus promoter sequences. In some embodiments, a pol III promoter sequence drives expression of an inhibitory RNA (e.g., miRNA) coding region. In some embodiments, a pol II promoter sequence drives expression of a protein coding region. As further described below, the isolated nucleic acid may comprise an inverted terminal repeat (ITR) of an AAV serotype selected from the group consisting of AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11 and variants thereof.

[0048] Multicistronic constructs Some aspects of the invention provide multicistronic (eg, bicistronic) expression constructs containing two or more expression cassettes in various configurations. In different embodiments, multicistronic (e.g., bicistronic) expression constructs are provided in which the expression cassettes are arranged in different ways. For example, in some embodiments, multicistronic expression constructs are provided in which a first expression cassette is arranged adjacent to a second expression cassette. In some embodiments, multicistronic expression constructs are provided in which the first expression cassette comprises an intron and the second expression cassette is arranged within the intron of the first expression cassette. In some embodiments, the second expression cassette arranged within the intron of the first expression cassette comprises a promoter and a nucleic acid sequence encoding a gene product operably linked to the promoter.

[0049] In different embodiments, multicistronic (e.g., bicistronic) expression constructs are provided in which the expression cassettes are oriented in different ways. For example, in some embodiments, multicistronic expression constructs are provided in which a first expression cassette is in the same orientation as a second expression cassette. In some embodiments, multicistronic expression constructs are provided that include a first and second expression cassette in opposite orientations. The term "orientation" as used herein in connection with an expression cassette refers to the directional characteristics of a given cassette or structure. In some embodiments, the expression cassette contains a 5' promoter of the coding nucleic acid sequence, and transcription of the coding nucleic acid sequence proceeds from the 5' end to the 3' end of the sense strand, making this a directional cassette (e.g., 5'-promoter / (intron) / coding sequence-3'). Because virtually all expression cassettes are directional in this sense, those skilled in the art can easily determine the orientation of a given expression cassette relative to a second nucleic acid structure, such as a second expression cassette, a viral genome, or, if the cassette is contained in an AAV structure, relative to an AAV ITR.

[0050] For example, if a given nucleic acid construct contains two expression cassettes in the configuration 5'-promoter 1 / coding sequence 1---promoter 2 / coding sequence 2-3', [ka] The expression cassettes are in the same orientation, and the arrows indicate the direction of transcription of each of the cassettes. For another example, if a given nucleic acid construct contains a sense strand containing two expression cassettes in the configuration 5'-promoter1 / coding sequence1---coding sequence2 / promoter2-3', [ka] The expression cassettes are in opposite orientation to each other, and the direction of transcription of the expression cassettes is opposite, as indicated by the arrows. In this example, the strand shown includes promoter 2 and the antisense strand of coding sequence 2.

[0051] In another example, when an expression cassette is included in an AAV construct, the cassette can be either in the same orientation as the AAV ITRs (e.g., the structure shown in Figure 5) or in the opposite orientation. AAV ITRs are directional. For example, the mutant 5' ITR illustrated in Figure 5 would be in the same orientation as the H1 promoter / inhibitory RNA-encoding expression cassette, but in the opposite orientation from the 3' ITR if both the ITR and expression cassette were on the same nucleic acid strand.

[0052] rAAV vectors The isolated nucleic acid of the present invention may be a recombinant adeno-associated virus (AAV) vector (rAAV vector). In some embodiments, the isolated nucleic acid described by the present disclosure comprises a region (e.g., a first region) comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR) or a variant thereof. The isolated nucleic acid (e.g., a recombinant AAV vector) can be packaged into a capsid protein and administered to a subject and / or delivered to a selected target cell. A "recombinant AAV (rAAV) vector" typically comprises at least a transgene and its regulatory sequences, and 5' and 3' AAV inverted terminal repeat (ITR) sequences. The transgene may comprise one or more regions encoding one or more inhibitory RNAs (e.g., miRNAs), including nucleic acids targeting endogenous mRNAs of the subject, as disclosed elsewhere herein. The transgene may also comprise regions encoding, for example, proteins and / or expression control sequences (e.g., polyA tails), as described elsewhere in this disclosure.

[0053] Generally, ITR sequences are approximately 145 base pairs (bp) in length. Preferably, substantially the entire ITR-encoding sequence is used in the molecule, although some minor modifications of these sequences are acceptable. The ability to modify these ITR sequences is within the skill of the art. (See, for example, texts such as Sambrook et al., "Molecular Cloning. A Laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J. Virol., 70:520-532 (1996)). An example of such a molecule for use in the present invention is a "cis-acting" plasmid containing a transgene in which the selected transgene sequence and associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. AAV ITR sequences can be obtained from any known AAV, including currently identified mammalian AAV species. In some embodiments, the isolated nucleic acid (e.g., an rAAV vector) comprises at least one ITR having a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof. In some embodiments, the isolated nucleic acid comprises a region (e.g., a first region) encoding an AAV2 ITR.

[0054] In some embodiments, the isolated nucleic acid further comprises a region comprising a second AAV ITR (e.g., a second region, a third region, a fourth region, etc.). In some embodiments, the second AAV ITR has a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof. In some embodiments, the second ITR is a mutant ITR lacking a functional terminal resolution site (TRS). The term "lacking a terminal resolution site" can refer to an AAV ITR containing a mutation (e.g., a sense mutation, such as a nonsynonymous mutation or a missense mutation) that abolishes the function of the terminal resolution site (TRS) of the ITR, or a truncated AAV ITR lacking a nucleic acid sequence encoding a functional TRS (e.g., a ΔTRS ITR). Without wishing to be bound by any particular theory, rAAV vectors containing ITRs that lack functional TRSs generate self-complementary rAAV vectors, as described, for example, in McCarthy (2008) Molecular Therapy 16(10):1648-1656.

[0055] In addition to the key elements identified above for recombinant AAV vectors, the vector also contains conventional control elements operably linked to the transgene elements in a manner that allows its transcription, translation, and / or expression in cells transfected with the vector or infected with a virus produced according to the present invention. As used herein, "operably linked" sequences include both expression control sequences contiguous with the gene of interest and expression control sequences acting in trans or remotely to control the gene of interest. Expression control sequences include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency (i.e., Kozak consensus sequences); sequences that increase protein stability; and, if desired, sequences that enhance secretion of the encoded product. Many expression control sequences, including promoters that are natural, constitutive, inducible, and / or tissue-specific, are known in the art and can be utilized.

[0056] As used herein, a nucleic acid sequence (e.g., a coding sequence) and a regulatory sequence are said to be operably linked when they are covalently linked in such a way as to place the expression or transcription of the nucleic acid sequence under the influence or control of the regulatory sequence. When it is desired to translate the nucleic acid sequence into a functional protein, the introduction of a promoter in the 5' regulatory sequence results in transcription of the coding sequence, and the nature of the linkage between the two DNA sequences is said to be operably linked if it (1) does not result in the introduction of a frameshift mutation, (2) does not interfere with the ability of the promoter region to direct transcription of the coding sequence, or (3) does not interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region would be operably linked to a nucleic acid sequence if it is capable of effecting transcription of that DNA sequence and the resulting transcript can be translated into a desired protein or polypeptide. Similarly, two or more coding regions are operably linked when they are linked in such a way that their transcription from a common promoter results in the expression of two or more proteins translated in frame. In some embodiments, operably linked coding sequences result in a fusion protein.

[0057] Recombinant adeno-associated virus (rAAV) In some aspects, the present disclosure provides isolated AAV. As used herein with respect to AAV, the term "isolated" refers to an AAV that has been artificially produced or obtained. Isolated AAV may be produced using recombinant methods. Such AAV is referred to herein as "recombinant AAV." Recombinant AAV (rAAV) preferably has tissue-specific targeting capabilities so that the rAAV nuclease and / or transgene is specifically delivered to one or more predetermined tissue(s). The AAV capsid is an important factor in determining these tissue-specific targeting capabilities. Thus, rAAVs having capsids appropriate for the targeted tissue can be selected.

[0058] Methods for obtaining recombinant AAVs with desired capsid proteins are well known in the art. (See, e.g., US2003 / 0138772, the contents of which are incorporated herein by reference in their entirety.) Typically, the methods involve culturing host cells containing a nucleic acid sequence encoding the AAV capsid protein; a functional rep gene; a recombinant AAV vector composed of AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to allow packaging of the recombinant AAV vector into the AAV capsid protein. In some embodiments, the capsid protein is a structural protein encoded by the cap gene of AAV. AAV contains three capsid proteins, virion proteins 1 to 3 (designated VP1, VP2, and VP3), all of which are transcribed from a single cap gene via alternative splicing. In some embodiments, the molecular weights of VP1, VP2, and VP3 are approximately 87 kDa, approximately 72 kDa, and approximately 62 kDa, respectively. In some embodiments, upon translation, the capsid protein forms a 60-mer spherical protein shell around the viral genome. In some embodiments, the function of the capsid protein is to protect the viral genome, deliver the genome, and interact with the host. In some aspects, the capsid protein delivers the viral genome to the host in a tissue-specific manner.

[0059] In some embodiments, the AAV capsid protein is of an AAV serotype selected from the group consisting of AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAVrh8, AAV9, AAV10, AAVrh.10, AAV AAV.PHB, and any variants thereof. In some embodiments, the AAV capsid protein is of a serotype derived from a non-human primate, such as the AAVrh10 serotype. In some embodiments, the AAV capsid protein is of the AAV9 serotype.

[0060] Components to be cultured in a host cell for packaging the rAAV vector into an AAV capsid can be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., recombinant AAV vector, rep sequence, cap sequence, and / or helper functions) can be provided by a stable host cell that has been engineered to contain one or more of the required components using methods known to those skilled in the art. Most preferably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may also be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the discussion of regulatory elements suitable for use with transgenes. In another alternative, the selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, stable host cells can be generated that are derived from 293 cells (which contain E1 helper functions under the control of a constitutive promoter), but contain the rep and / or cap proteins under the control of an inducible promoter. Additional stable host cells can be generated by one skilled in the art.

[0061] In some embodiments, the present disclosure relates to a host cell comprising a nucleic acid comprising a sequence encoding an inhibitory nucleic acid that targets endogenous SOD1 and a sequence encoding an exogenous protein (e.g., an exogenous SOD1 protein, optionally an "enhanced" exogenous SOD1 protein). In some embodiments, the present disclosure relates to a composition comprising the host cell described above. In some embodiments, the composition comprising the host cell further comprises a cryopreservative.

[0062] The recombinant AAV vector, rep sequence, cap sequence, and helper functions required to produce the rAAV of the present disclosure can be delivered to a packaging host cell using any suitable genetic elements (vector). The selected genetic elements can be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of the present disclosure are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for producing rAAV virions are well known, and the selection of a suitable method does not impose a limitation on the present disclosure. See, e.g., K. Fisher et al., J. Virol., 70:520-532 (1993) and U.S. Patent No. 5,478,745.

[0063] In some embodiments, recombinant AAV can be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650). Typically, recombinant AAV is produced by transfecting a host cell with a recombinant AAV vector (including a transgene) to be packaged into an AAV particle, an AAV helper function vector, and an accessory function vector. The AAV helper function vector encodes "AAV helper function" sequences (i.e., rep and cap) that function in trans for more productive AAV replication and encapsidation. Preferably, the AAV helper function vector promotes efficient AAV vector production without producing any detectable wild-type AAV virions (i.e., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use with the present disclosure include pHLP19, described in U.S. Pat. No. 6,001,650, and the pRep6cap6 vector, described in U.S. Pat. No. 6,156,303, both of which are incorporated herein by reference in their entireties. Accessory function vectors encode nucleotide sequences for non-AAV-derived viral and / or cellular functions (i.e., "accessory functions") on which AAV depends for replication. Accessory functions include those functions required for AAV replication, including, but not limited to, those moieties involved in activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based accessory functions can be derived from any known helper virus, such as adenovirus, herpesvirus (other than herpes simplex virus type 1), and vaccinia virus.

[0064] In some aspects, the present disclosure provides transfected host cells. The term "transfection" is used to refer to the uptake of foreign DNA by a cell; a cell is "transfected" when foreign DNA is introduced inside the cell membrane. Numerous transfection techniques are generally known in the art. See, for example, Graham et al. (1973) Virology, 52:456; Sambrook et al. (1989) Molecular Cloning, laboratory manual, Cold Spring Harbor Laboratories, New York; Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier; and Chu et al. (1981) Gene 13:197. Such techniques can be used to introduce one or more foreign nucleic acids, such as nucleotide integration vectors and other nucleic acid molecules, into suitable host cells.

[0065] "Host cell" refers to any cell that harbors or is capable of harboring a substance of interest. Often, host cells are mammalian cells. Host cells may be used as recipients of AAV helper constructs, AAV minigene plasmids, accessory function vectors, or other transfer DNA involved in the production of recombinant AAV. The term encompasses the progeny of the original transfected cell. Thus, as used herein, "host cell" may also refer to a cell transfected with an exogenous DNA sequence. It is understood that the progeny of a single parent cell may not be completely identical in morphology or in genomic or total DNA complement to the original parent due to natural, accidental, or deliberate mutations. As used herein, the term "cell line" refers to a population of cells capable of continuous or sustained growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes occur in the karyotype during the storage or transfer of such clonal populations. Thus, cells derived from the cell line may not be exactly identical to the ancestral cell or culture, and the cell line referred to encompasses such variants. As used herein, the term "recombinant cell" refers to a cell into which an exogenous DNA segment has been introduced, such as a DNA segment that leads to the transcription of a biologically active polypeptide or the production of a biologically active nucleic acid, such as RNA.

[0066] As used herein, the term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., that is capable of replicating and transferring gene sequences between cells when associated with the proper control elements. Thus, the term encompasses cloning and expression vehicles as well as viral vectors. In some embodiments, useful vectors are those in which a nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the cellular or introduced synthetic machinery required to initiate the specific transcription of a gene. In the phrases "under control" or "under transcriptional control," "operably positioned" means that the promoter is in the correct location and orientation with respect to the nucleic acid that controls the initiation of RNA polymerase and the expression of the gene. The term "expression vector or construct" refers to any type of genetic construct containing a nucleic acid from which part or all of a nucleic acid encoding sequence can be transcribed. In some embodiments, expression includes transcription of a nucleic acid, e.g., to produce a biologically active polypeptide product or functional RNA (e.g., a guide RNA) from the nucleic acid, e.g., the transcribed gene. The above methods for packaging a recombinant vector into an AAV capsid desired to produce an rAAV of the present disclosure are not intended to be limiting, and other suitable methods will be apparent to those of skill in the art.

[0067] Mode of administration The isolated nucleic acid and rAAV of the present disclosure can be delivered to cells or subjects in compositions according to any suitable method known in the art.For example, rAAV, preferably suspended in a physiologically compatible carrier (i.e., composition), can be administered to subjects, i.e., host animals such as humans, mice, rats, cats, dogs, sheep, rabbits, horses, cows, goats, pigs, guinea pigs, hamsters, chickens, turkeys, or non-human primates (for example, macaques).In some embodiments, host animals do not include humans.

[0068] Delivery of rAAV to a mammalian subject can be, for example, by intramuscular injection or by administration into the mammalian subject's bloodstream. Administration into the bloodstream can be by injection into a vein, artery, or any other vascular conduit. In some embodiments, rAAV is administered into the bloodstream by isolated limb perfusion, a technique well known in the surgical field, which essentially allows one skilled in the art to isolate a limb from the systemic circulation before administering rAAV virions. A variant of the isolated limb perfusion technique described in U.S. Pat. No. 6,177,403 can also be used by one skilled in the art to administer virions to the vasculature of an isolated limb to potentially enhance transduction of muscle cells or tissues. Furthermore, in certain instances, it may be desirable to deliver virions to the CNS of a subject. "CNS" refers to all cells and tissues of the vertebrate brain and spinal cord. Thus, this term includes, but is not limited to, neurons, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage, etc. Recombinant AAV can be delivered directly to the CNS or brain using neurosurgical techniques known in the art, such as stereotactic injection, using a needle, catheter, or related device, for example, by injection into the ventricular region, as well as the striatum (e.g., the caudate nucleus or striatal putamen), the spinal cord and neuromuscular junction, or the cerebellar lobule (see, for example, Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000). In some embodiments, the rAAV described in the present disclosure is administered by intravenous injection. In some embodiments, the rAAV is administered by intracerebral injection. In some embodiments, rAAV is administered by intrathecal injection. In some embodiments, rAAV is administered by intrastriatal injection. In some embodiments, rAAV is delivered by intracranial injection. In some embodiments, rAAV is delivered by cisternal injection.In some embodiments, the rAAV is delivered by lateral ventricle injection.

[0069] Aspects of the present disclosure relate to compositions comprising a recombinant AAV comprising a nucleic acid encoding a capsid protein and a transgene, wherein the transgene comprises a nucleic acid sequence encoding one or more miRNAs. In some embodiments, each miRNA comprises or is encoded by a sequence set forth in SEQ ID NO: 3 and / or 4 (miR-SOD-127). In some embodiments, each miRNA comprises or is encoded by a sequence set forth in SEQ ID NO: 5 and / or 6. In some embodiments, the nucleic acid further comprises AAV ITRs. In some embodiments, the rAAV comprises an rAAV vector represented by a sequence set forth in any one of SEQ ID NOs: 8-15 (AAV vector sequence), or a portion thereof. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, compositions of the present disclosure may include rAAV alone or in combination with one or more other viruses (e.g., a second rAAV encoding one or more different transgenes). In some embodiments, a composition includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAVs (each carrying one or more different transgenes).

[0070] Suitable carriers can be easily selected by those skilled in the art, taking into account the indications for which rAAV is intended. For example, one suitable carrier includes saline, which may be formulated with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of a carrier is not a limitation of the present disclosure. Optionally, the compositions of the present disclosure may contain other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers, in addition to the rAAV and carrier(s). Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0071] rAAV is administered in an amount sufficient to transfect the cells of desired tissue without excessive adverse effects, and to provide a sufficient level of gene transfer and expression.Conventional and pharmaceutically acceptable administration routes include, but are not limited to, direct delivery to selected organs (for example, intraportal delivery to the liver), oral, inhalation (including nasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, and other parenteral administration routes.Administration routes can also be combined if desired. The dose of rAAV virions required to achieve a particular "therapeutic effect," e.g., a dose unit in genome copies per kilogram of body weight (GC / kg), will vary based on several factors, including, but not limited to: the route of administration of the rAAV virions, the gene or RNA expression level required to achieve the therapeutic effect, the particular disease or disorder being treated, and the gene or RNA product stability. One of skill in the art can readily determine the rAAV virion dose range for treating a patient with a particular disease or disorder based on the foregoing factors as well as other factors well known in the art.

[0072] The effective amount of rAAV is sufficient to target infection of animals and target desired tissues.In some embodiments, the effective amount of rAAV is sufficient to produce a stable somatic gene transfer animal model.The effective amount mainly depends on factors such as the species, age, weight, health status and tissue to be targeted of the subject, and therefore may vary between animals and tissues.For example, the effective amount of rAAV is generally about 10 9 ~1016 The range is from about 1 ml to about 100 ml of solution containing genome copies. In some cases, about 10 11 ~10 13 Dosage between 10 and 20 copies of the rAAV genome is appropriate. 12 or 10 13 rAAV genome copies are effective in targeting CNS tissues, and in some cases, stable transgenic animals are produced by multiple doses of rAAV.

[0073] In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar day (e.g., 24 hours). In some embodiments, a dose of rAAV is administered to a subject no more than once per 2, 3, 4, 5, 6, or 7 calendar days. In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar week (e.g., 7 calendar days). In some embodiments, a dose of rAAV is administered to a subject no more than every other week (e.g., once every 2 calendar weeks). In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar month (e.g., once every 30 calendar days). In some embodiments, a dose of rAAV is administered to a subject no more than once every 6 calendar months. In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar year (e.g., 365 days or 366 days in a leap year).

[0074] In some embodiments, the rAAV composition specifically comprises rAAV at a high concentration (e.g., at a concentration of 10 13 The rAAV is formulated to reduce aggregation of AAV particles in compositions present at concentrations of 0.01 GC / ml or greater. Methods for reducing rAAV aggregation are well known in the art and may include, for example, adding detergents, adjusting pH, adjusting salt concentrations, etc. (See, e.g., Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the entire contents of which are incorporated herein by reference.) The formulation of pharmaceutically acceptable excipient and carrier solutions is well known to those skilled in the art, as is the development of suitable dosing and treatment regimens for use with the specific compositions described herein in various treatment regimens.

[0075] Typically, these preparations may contain at least about 0.1% or more of active compound, but the percentage of active ingredient(s) may of course vary, and may conveniently be between about 1 or 2% and about 70% or 80% or more by weight or volume of the total preparation. Of course, the amount of active compound in each therapeutically useful composition may be adjusted so that a suitable dosage is obtained in any unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, administration route, product shelf life, and other pharmacological considerations will be taken into account by those skilled in the art when preparing such pharmaceutical preparations. In light of this, various dosages and treatment regimens may be desired. In certain situations, it may be desirable to deliver rAAV-based therapeutic constructs as a suitably formulated pharmaceutical composition as disclosed herein subcutaneously, intrapancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, or by inhalation. In some embodiments, rAAV can be delivered using the administration modes described in U.S. Patent Nos. 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety). In some embodiments, the preferred administration mode is by portal vein injection.

[0076] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In most cases, the form is sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0077] For administration of injectable aqueous solutions, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, sterile aqueous media that can be used will be known to those skilled in the art. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermic injection fluid or injected at the proposed injection site (see, e.g., "Remington's Pharmaceutical Sciences," 15th Edition, pp. 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.

[0078] Sterile injectable solutions are prepared by incorporating the required amount of active rAAV into an appropriate solvent with various other ingredients listed herein (if required), followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle containing the basic dispersion medium and the required other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient, plus any desired additional ingredients, from a previously sterile-filtered solution thereof.

[0079] The rAAV compositions disclosed herein may also be formulated in neutral or salt forms. Pharmaceutically acceptable salts include acid addition salts (formed with the protein's free amino groups) and acid addition salts formed with inorganic acids such as, for example, hydrochloric or phosphoric acid, or organic acids such as acetic, oxalic, tartaric, or mandelic acid. Salts formed with free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and organic bases such as isopropylamine, trimethylamine, histidine, or procaine. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are conveniently administered in a variety of dosage forms, such as injectable solutions and drug-release capsules.

[0080] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an allergic or similar adverse reaction when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like may be used for the introduction of the compositions of the present disclosure into suitable host cells. In particular, transgenes delivered by rAAV vectors may be formulated for delivery encapsulated in either lipid particles, liposomes, vesicles, nanospheres, or nanoparticles, or the like.

[0081] Such formulations may be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids or rAAV constructs disclosed herein. The formation and use of liposomes are generally known to those skilled in the art. Recently, liposomes with improved serum stability and circulation half-time have been developed (U.S. Patent No. 5,741,516). Furthermore, various methods for the preparation of liposomes and liposome-like preparations as potential drug carriers have been described (U.S. Patent Nos. 5,567,434; 5,552,157; ​​5,565,213; 5,738,868 and 5,795,587). Liposomes have been used successfully with numerous cell types that are typically resistant to transfection by other procedures. In addition, liposomes are not subject to the DNA length constraints typical of viral-based delivery systems. Liposomes have been effectively used to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors, and allosteric effectors into a variety of cultured cell lines and animals. Additionally, several successful clinical trials examining the efficacy of liposome-mediated drug delivery have been completed.

[0082] Liposomes are formed from phospholipids dispersed in an aqueous medium, spontaneously forming multilamellar concentric bilayer vesicles (also called multilamellar vesicles (MLVs)). MLVs generally have diameters ranging from 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters ranging from 200 to 500 angstroms, which contain an aqueous solution in their core. Alternatively, nanocapsule formulations of rAAV may be used. Nanocapsules can generally encapsulate substances stably and reproducibly. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (approximately 0.1 μm in size) should be designed using polymers that can be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.

[0083] In addition to the delivery methods described above, the following techniques are also contemplated as alternative methods for delivering rAAV compositions to a host. Sonophoresis (i.e., ultrasound) is used and described in U.S. Patent No. 5,656,016 as a device for increasing the rate and effectiveness of drug penetration into and through the circulatory system. Other contemplated drug delivery options are intraosseous injection (U.S. Patent No. 5,779,708), microchip devices (U.S. Patent No. 5,797,898), ophthalmic formulations (Bourlais et al., 1998), transdermal matrices (U.S. Patent Nos. 5,770,219 and 5,783,208), and feedback-controlled delivery (U.S. Patent No. 5,697,899).

[0084] How to use Provided herein is a method for inhibiting the expression of genes such as SOD1 associated with FTD and / or ALS.In some embodiments, the method described by the present disclosure is useful for treating subjects who have or are suspected of having ALS and / or FTD.As used herein, "treat" or "treating" refers to (a) preventing or delaying the onset of neurodegenerative disease (such as ALS / FTD for example); (b) reducing the severity of ALS / FTD; (c) reducing or preventing the onset of the symptoms characteristic of ALS / FTD; and / or (d) preventing the worsening of the symptoms characteristic of ALS / FTD.

[0085] In some embodiments, methods are provided for inhibiting endogenous SOD1 protein expression in a subject (e.g., in the subject's central nervous system (CNS)). In some embodiments, the methods include administering to the subject (e.g., administering to the subject's CNS) an isolated nucleic acid or rAAV engineered to express an inhibitory nucleic acid targeting endogenous SOD1 mRNA and an exogenous SOD1 mRNA transcript that is resistant to the inhibitory nucleic acid. In some embodiments, the subject has or is suspected of having FTD or ALS (e.g., identified, e.g., by diagnostic DNA testing, as having an SOD1 gene with one or more mutations that result in a toxic gain of function and / or exhibiting one or more signs or symptoms of ALS). In some embodiments, the methods include administering to the subject an effective amount of a recombinant adeno-associated virus (rAAV) harboring a nucleic acid engineered to express an inhibitory nucleic acid targeting endogenous SOD1 mRNA in the subject's cells. In some embodiments, the inhibitory nucleic acid comprises or is encoded by the sequence set forth in SEQ ID NO: 3 (GACGTACCTAAGGTACAAGTA) and / or 4 (miR-SOD-127). In some embodiments, the inhibitory nucleic acid comprises or is encoded by the sequence set forth in SEQ ID NO: 5 and / or 6.

[0086] In some embodiments, a method for inhibiting SOD1 expression in a cell is provided. In some embodiments, the method comprises delivering the isolated nucleic acid or rAAV described by the present disclosure into a cell, wherein the inhibitory RNA is an miRNA that comprises or is encoded by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the sequence set forth in SEQ ID NO: 3 (GACGTACCTAAGGTACAAGTA) and / or 4 (CTGCATGGATTCCATGTTCAT) or the complementary sequence thereof.

[0087] In accordance with the above, certain methods provided herein include administering to a subject an effective amount of a recombinant adeno-associated virus (rAAV) harboring any of the recombinant nucleic acids disclosed herein. Generally, an "effective amount" of rAAV refers to an amount sufficient to induce a desired biological response. In some embodiments, an effective amount refers to an amount of rAAV effective to transduce cells or tissues ex vivo. In other embodiments, an effective amount refers to an amount effective for direct administration of rAAV to a subject. As will be understood by those skilled in the art, the effective amount of a recombinant AAV of the present invention will vary depending on factors such as the desired biological endpoint, the pharmacokinetics of the expression product, the condition being treated, the mode of administration, and the subject. Typically, the rAAV is administered with a pharmaceutically acceptable carrier, as described elsewhere in this disclosure.

[0088] In some examples, after administration of rAAV, at least one clinical outcome parameter or biomarker associated with FTD or ALS (e.g., nuclear G4C2 RNA foci, RAN protein expression, etc.) is assessed in the subject. Typically, the clinical outcome parameter or biomarker assessed after administration of rAAV is compared with a clinical outcome parameter or biomarker determined at a time point before administration of rAAV to determine the efficacy of rAAV. In many cases, an improvement in the clinical outcome parameter or biomarker after administration of rAAV indicates the efficacy of rAAV. Any suitable clinical outcome parameter or biomarker can be used. Typically, the clinical outcome parameter or biomarker indicates one or more symptoms of FTD or ALS. For example, in some embodiments, the clinical outcome parameter or biomarker can be endogenous SOD1 expression, memory loss, or the presence or absence of movement disorders such as unsteadiness, rigidity, retardation, spasticity, muscle weakness or difficulty swallowing, speech and language difficulties, muscle spasms (fasciculations) and cramps (including in the hands and feet).

[0089] Kits and Related Compositions In some embodiments, the recombinant nucleic acids, compositions, rAAV vectors, rAAVs, etc. described herein can be assembled into pharmaceutical, diagnostic, or research kits to facilitate their use in therapeutic, diagnostic, or research applications. The kits can include one or more containers housing the components of the present invention and instructions for use. Specifically, such kits can include one or more agents described herein and instructions explaining the intended use and proper use of these agents. In some embodiments, the agents in the kits can be in pharmaceutical formulations and dosages suitable for a particular use and method of administration. Kits for research purposes can include components in concentrations or amounts appropriate for performing various experiments.

[0090] Kits can be designed to facilitate researchers' use of the methods described herein and can take many forms. Each component of the kit can be provided in liquid form (e.g., a solution) or solid form (e.g., a dry powder), where applicable. In some cases, some of the components can be configurable or otherwise processable (e.g., into an active form), for example, by the addition of a suitable solvent or other species (e.g., water or cell culture medium), which may or may not be provided with the kit. As used herein, "instructions" can define instructional and / or promotional components and typically include written instructions on or associated with the packaging of the invention. Instructions can also include any oral or electronic instructions provided in any format that clearly identifies the user to the instructions, such as audiovisual (e.g., videotape, DVD, etc.), internet, and / or web-based communications, etc., such that the user clearly recognizes that the instructions are to be associated with the kit. Written instructions can be in a format prescribed by a government agency regulating the manufacture, use, or sale of pharmaceutical or biological products, and the instructions can also reflect agency approval of the manufacture, use, or sale for animal administration.

[0091] The kit may contain any one or more components described herein in one or more containers. As an example, in one embodiment, the kit may include instructions for mixing one or more components of the kit and / or for isolating, mixing, and applying a sample to a subject. The kit may include a container containing a drug described herein. The drug may be in liquid, gel, or solid (powder) form. The drug may be prepared sterilely, packaged in a syringe, and shipped refrigerated. Alternatively, it may be contained in a vial or other container for storage. A second container may contain another drug that is prepared sterilely. Alternatively, the kit may contain an active agent that is premixed and shipped in a syringe, vial, tube, or other container. The kit may contain one or more or all of the components needed to administer the drug to a subject, such as a syringe, topical application device, or IV needle tubing and bag. Exemplary embodiments of the present invention will be described in more detail by the following examples. These embodiments are illustrative of the present invention, and those skilled in the art will recognize that they are not limited to the exemplary embodiments.

[0092] example Example 1 This example describes a dual expression gene therapy vector that delivers (1) a first construct engineered to express a synthetic microRNA that suppresses expression of endogenous cytosolic Cu / Zn superoxide dismutase (SOD1) activity, linked to (2) a second construct engineered to express wild-type SOD1 that is resistant to the synthetic microRNA.

[0093] The rationale for linking AAVrh10-anti-SOD1-miRNA-mediated SOD1 silencing with synthetic microRNA-resistant WT SOD1 expression is based on two factors. First, the dismutation activity of the SOD1 protein has neuroprotective properties. Second, tissues (specifically, motor neurons) from ALS cases in which SOD1 is suppressed are abnormal because they express both wild-type (WT) and mutant SOD1. Indeed, when SOD1 silencing studies are initiated after the onset of disease, motor neurons (and some non-neuronal cells) are already observed to be clearly pathological. In this situation, eliminating the SOD1 dismutation activity conferred by WT SOD1 molecules (and potentially from some mutant SOD1 proteins) would also eliminate any potential neuroprotective effects conferred by that activity. Thus, the net effect on cells reflects the balance of two opposing factors: (a) silencing of the mutant protein and its neurotoxicity versus (b) elimination of the neuroprotective effects of SOD1 dismutation activity. Despite the concomitant reduction in mutant protein levels in diseased motor neurons, the net effect may further impair target cell viability. Consistent with this finding, mice lacking intrinsic SOD1 activity do not develop fulminant ALS during normal development, but their motor neurons are highly susceptible to superimposed injury. Facial nerve injury in these SOD1-negative mice results in much more extensive facial nerve loss than in WT mice. Furthermore, these SOD1-negative mice have been observed to develop a slowly progressive, delayed-onset motor neuropathy later in life.

[0094] The dual expression gene construct described in the present disclosure addresses the problem of loss of neuroprotective activity from SOD1 dismutation. The arrangement of gene expression cassettes in the construct of the present disclosure allows normal levels of SOD1 dismutation activity (for example, expression of WT SOD1) even when accompanied by complete silencing of both WT and mutant endogenous SOD1 alleles. Thus, the net effect of the construct described herein is a reduction in the level of mutant SOD1 protein (but not WT SOD1 protein), which is beneficial to SOD1-mediated ALS.

[0095] The dual expression construct of the present disclosure is constructed as follows: an AAV construct is created that expresses both an artificial miRNA targeting SOD1 and an SOD1 cDNA with silent base pair modifications that make it resistant to the artificial miRNA. This construct simultaneously enables silencing of mutant SOD1 and enhanced expression of wild-type SOD1 from a single AAV vector. In some embodiments, the construct is bicistronic, as shown in FIG. 1, where the construct has two promoters, for example, anti-SOD1 expression is driven by the H1 promoter and SOD1 cDNA expression is driven by the CBA promoter. Anti-SOD1-miR expression can also be driven by another Pol III promoter, such as the U6 promoter, or a Pol II promoter that restricts miRNA expression to specific cell or organ types. The second part of the construct typically has a Pol II promoter (e.g., CBA in FIG. 1) that expresses the miRNA-resistant SOD1 cDNA. This second promoter can be the endogenous SOD1 promoter or another promoter such as the synapsin promoter if it is desired to restrict expression of the SOD1 cDNA to a particular cell population.

[0096] In some embodiments, the dual-function vector is a single Pol II promoter (e.g., CBA) that expresses both the artificial miR and the miR-resistant cDNA, as shown in Figure 2. In this embodiment, the anti-SOD1-miR can be expressed from an intron within the SOD1 cDNA expression cassette, or alternatively, as part of the 3' UTR (or 5' UTR) of the mIR-resistant SOD1 cDNA expression cassette. Additional non-limiting examples of dual-function vector constructs are shown in Figures 3-8 and set forth in SEQ ID NOS: 8-15. Figure 9 shows a nucleic acid sequence alignment of the wild-type SOD1 coding sequence (SEQ ID NO: 1) with an example of an "enhanced" SOD1 coding sequence (SEQ ID NO: 7).

[0097] array >Human SOD1 coding sequence (NCBI reference NM_000454.4) (SEQ ID NO: 1) [ka]

[0098] >SOD1 miR target sequence 5'-3'; note that in some embodiments, "T" is replaced with "U" (SEQ ID NO: 2) [ka]

[0099] >SOD1 miR mature miRNA 3'-5'; note that in some embodiments, "T" is replaced with "U" (SEQ ID NO: 3) [ka]

[0100] >SOD-miR-127 mature miRNA 5'-3'; note that in some embodiments, "T" is replaced with "U" (SEQ ID NO: 4) [ka]

[0101] >miR-SOD1 5'-3' strand (SEQ ID NO: 5); note that in some embodiments, "T" is replaced with "U" [ka]

[0102] >miR-SOD1 3'-5' strand (SEQ ID NO: 6); note that in some embodiments, "T" is replaced with "U" [ka]

[0103] >Enhanced SOD1 coding sequence (SEQ ID NO: 7); silent base pair mutations (bold) compared to wild-type SOD1 coding sequence [ka]

[0104] >Dicistronic H1-miR and CB-Sod1 sequence (SEQ ID NO: 8) [ka] [ka] [ka]

[0105] >CB-anti-Sod1 miR and miRNA-resistant Sod1 sequence (SEQ ID NO: 9) [ka] [ka]

[0106] >Bicistronic H1-SOD1-miR-CB-SOD1 sequence (SEQ ID NO: 10); miR-resistant SOD1 target (bold); SOD1 coding sequence (lowercase) [ka]

[0107] >Sequence of CB-miR-CB-SOD1 (SEQ ID NO: 11); miR-resistant SOD1 target (bold); SOD1 coding sequence (lowercase) [ka] [ka]

[0108] >Self-complementary sequence of H1-SOD1-miR-CB-SOD1 (with 3'UTR) (SEQ ID NO: 12); AAV ITR (bold) [ka] [ka]

[0109] >Self-complementary sequence of H1-SOD1-miR-CB-SOD1 (without 3'UTR) (SEQ ID NO: 13); AAV ITR (bold) [ka] [ka]

[0110] >Sequence of single-stranded CB-miR-CB-SOD1 (with 3'UTR) (SEQ ID NO: 14); AAV ITR (bold) [ka] [ka]

[0111] >Sequence of single-stranded CB-miR-CB-SOD1 (with 3'UTR) (SEQ ID NO: 15); AAV ITR (bold) [ka] [ka]

[0112] >SOD1 promoter insert sequence (SEQ ID NO: 16) [ka] [ka]

[0113] >Wild-type SOD1 amino acid sequence; NCBI reference sequence NP_000445.1 (SEQ ID NO: 17) [ka]

Claims

1. below: (a) a first region encoding one or more first miRNAs comprising a nucleic acid having sufficient sequence complementary to an endogenous mRNA of a subject to hybridize to and inhibit expression of said endogenous mRNA, wherein said endogenous mRNA encodes an SOD1 protein; and (b) a second region encoding an exogenous mRNA encoding a wild-type SOD1 protein; 1. An isolated nucleic acid comprising: The isolated nucleic acid, wherein the one or more first miRNAs do not include nucleic acids having a sequence complementary enough to hybridize to the exogenous mRNA and inhibit expression of the exogenous mRNA.

2. 2. The isolated nucleic acid of claim 1, wherein the exogenous mRNA lacks a 5' untranslated region (5'UTR), a 3' untranslated region (3'UTR), or both a 5'UTR and a 3'UTR.

3. The isolated nucleic acid of claim 1 or 2, wherein the exogenous mRNA encoding the SOD1 protein has one or more silent base pair mutations relative to the endogenous mRNA, and optionally wherein the exogenous mRNA comprises a nucleic acid sequence that is at least 95% identical to the endogenous mRNA.

4. The isolated nucleic acid of any one of claims 1 to 3, wherein the wild-type SOD1 protein is encoded by a sequence comprising the sequence set forth in SEQ ID NO: 7 (enhanced SOD1).

5. The isolated nucleic acid of any one of claims 1 to 4, wherein the one or more first miRNAs target an untranslated region (e.g., 5'UTR or 3'UTR) of a nucleic acid encoding an endogenous mRNA.

6. 5. The isolated nucleic acid of claim 1, wherein the one or more first miRNAs target a coding sequence of a nucleic acid that encodes an endogenous mRNA.

7. The isolated nucleic acid of claim 6, wherein the one or more first miRNAs hybridize to a nucleic acid comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of an RNA encoded by the sequence set forth in SEQ ID NO:

2.

8. 8. The isolated nucleic acid of claim 6 or 7, wherein the one or more first miRNAs are encoded by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of a sequence comprising the sequence set forth in SEQ ID NO: 3 and / or 4.

9. 9. The isolated nucleic acid of claim 8, wherein the one or more first miRNAs further comprise a flanking region of miR-155 or miR-30.

10. The isolated nucleic acid of any one of claims 1 to 9, further comprising a first promoter.

11. 11. The isolated nucleic acid of claim 10, wherein the first promoter is operably linked to the first region.

12. 12. The isolated nucleic acid of claim 10 or 11, wherein the first promoter is an RNA polymerase III (pol III) promoter, optionally wherein the pol III promoter is an H1 promoter or a U6 promoter.

13. 12. The isolated nucleic acid of claim 10 or 11, wherein the first promoter is an RNA polymerase II (pol II) promoter, optionally wherein the pol II promoter is a chicken beta actin (CBA) promoter or an endogenous SOD1 promoter (e.g., SEQ ID NO: 16).

14. 14. The isolated nucleic acid of any one of claims 10 to 13, further comprising a second promoter, wherein the second promoter is operably linked to the second region.

15. 15. The isolated nucleic acid of claim 14, wherein the second promoter is a pol II promoter, optionally wherein the pol II promoter is a chicken beta actin (CBA) promoter or an endogenous SOD1 promoter.

16. 16. The isolated nucleic acid of any one of claims 1 to 15, further comprising an enhancer sequence, optionally wherein the enhancer is a cytomegalovirus (CMV) enhancer.

17. The isolated nucleic acid of any one of claims 1 to 15, wherein the first region is located within an untranslated region (e.g., a UTR) of the second region.

18. 18. The isolated nucleic acid of claim 17, wherein the first region is located within an intron of the isolated nucleic acid.

19. 19. The isolated nucleic acid of any one of claims 1 to 18, wherein the first region is located 5' to the second region.

20. 20. The isolated nucleic acid of any one of claims 1 to 19, further comprising at least one adeno-associated virus (AAV) inverted terminal repeat (ITR).

21. 21. The isolated nucleic acid of claim 20, comprising a full-length ITR and a mutant ITR, wherein the ITR flanks the first and second regions.

22. below: (i) an isolated nucleic acid according to any one of claims 1 to 21; and (ii) AAV capsid protein Recombinant adeno-associated virus (rAAV), comprising:

23. 23. The rAAV of claim 22, which targets CNS tissue, and optionally targets neurons.

24. 24. The rAAV of claim 21 or 23, wherein the capsid protein is an AAV9 capsid protein or an AAVrh.10 capsid protein.

25. A composition comprising an isolated nucleic acid according to any one of claims 1 to 21 or an rAAV according to any one of claims 22 to 24, and a pharmaceutically acceptable excipient.

26. A method for inhibiting SOD1 expression in a cell, comprising delivering an isolated nucleic acid according to any one of claims 1 to 21 or an rAAV according to any one of claims 22 to 24 to the cell.

27. 27. The method of claim 26, wherein the cell comprises a nucleic acid sequence encoding a mutant SOD1 protein.

28. A method for treating a subject having or suspected of having ALS, comprising administering to the subject an effective amount of an isolated nucleic acid of any one of claims 1 to 21, or an effective amount of an rAAV of any one of claims 22 to 24.

29. 29. The method of claim 28, wherein the subject comprises a nucleic acid sequence encoding a mutant SOD1 protein.

30. 30. The method of claim 28 or 29, wherein the subject is a mammalian subject, optionally a human subject.

Images