RNAi agent for inhibiting the expression of superoxide dismutase 1 (SOD1), composition thereof, and method of use

JP2025522433A5Pending Publication Date: 2026-06-22ARROWHEAD PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
ARROWHEAD PHARMACEUTICALS INC
Filing Date
2023-06-14
Publication Date
2026-06-22

AI Technical Summary

Technical Problem

Current treatments for amyotrophic lateral sclerosis (ALS) associated with SOD1 gene mutations have limited effectiveness and are associated with adverse events, necessitating a safer and more effective method to inhibit SOD1 gene expression.

Method used

Development of RNA interference (RNAi) agents, such as chemically modified small interfering RNAs (siRNAs), specifically designed to target and inhibit SOD1 gene expression in central nervous system cells, using pharmacokinetic and pharmacodynamic modulators for efficient delivery.

Benefits of technology

The RNAi agents effectively reduce SOD1 expression, potentially slowing ALS progression with fewer adverse events and providing a safer therapeutic option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2023245060000001
    Figure 2023245060000001
  • Figure 2023245060000002
    Figure 2023245060000002
  • Figure 2023245060000003
    Figure 2023245060000003
Patent Text Reader

Abstract

An RNAi agent, a composition containing the RNAi agent, and a method for inhibiting the superoxide dismutase 1 (SOD1) gene are described. The SOD1 RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of the SOD1 gene. Pharmaceutical compositions containing one or more SOD1 RNAi agents, optionally together with one or more additional therapeutic agents, are also described. In vivo delivery of the described SOD1 RNAi agents to central nervous system (CNS) tissues results in inhibition of SOD1 gene expression and reduction of SOD1 activity, and can provide a therapeutic effect in the treatment of various diseases, including amyotrophic lateral sclerosis (ALS), to subjects including human subjects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 495,517, filed on April 11, 2023, and U.S. Provisional Patent Application No. 63 / 352,454, filed on June 15, 2022, and the entire contents of each of them are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application includes a sequence listing submitted in XML format, which is incorporated herein by reference in its entirety. The XML copy is named 30699WO_SEQLIST.xml, created on June 13, 2023, and has a size of 6499 kb.

[0003] Field of the Invention The present disclosure relates to RNA interference (RNAi) agents for inhibiting superoxide dismutase 1 ( "SOD1") gene expression, such as double - stranded RNAi agents, e.g., chemically modified small interfering RNAs (siRNAs), compositions containing SOD1 RNAi agents, and methods of using them.

Background Art

[0004] Background Superoxide dismutase 1 (SOD1) is a member of the superoxide dismutase family of free radical scavenging enzymes that protects against oxygen radical species generated during cell metabolism. All mammals have three isoforms of superoxide dismutase: Cu / ZnSOD (SOD1), mitochondrial MnSOD (SOD2), and extracellular Cu / ZnSOD (SOD3). SOD1 is very abundant, ubiquitously expressed, the dominant dismutase in the cytoplasm, and contributes to most of the cellular SOD activity (JD Crapo et al., Copper, zinc superoxide dismutase is primarily a cytosolic protein in human cells. Proc Natl Acad Sci U S A. 1992;89(21):10405-9). The 153 amino acid SOD1 protein functions as a homodimer that binds copper and zinc and catalyzes the conversion of peroxide radicals to hydrogen peroxide and oxygen in an asymmetric two-step process that utilizes an essential copper atom within the active site of the enzyme (JD Rothstein, TDP-43 in amyotrophic lateral sclerosis: pathophysiology or patho-babel? Ann Neurol. 2007;61(5):382-4.).In addition to being an antioxidant enzyme, human SOD1 protein activates nuclear gene transcription after exposure to oxidative stress (CK Tsang et al., Superoxide dismutase 1 acts as a nuclear transcription factor to regulate oxidative stress resistance. Nat Commun. 2014;5:3446.), is involved in the regulation of RNA metabolism (Z. Butti & SA Patten, RNA Dysregulation in Amyotrophic Lateral Sclerosis. Front Genet. 2018;9:712.; L Lu et al., Mutant Cu / Zn - superoxide dismutase associated with amyotrophic lateral sclerosis destabilizes vascular endothelial growth factor mRNA and downregulates its expression. J Neurosci. 2007;27(30):7929 - 38.), and has been reported to regulate the glucose - sensing pathway to suppress respiration (AR Reddi & VC Culotta, SOD1 integrates signals from oxygen and glucose to repress respiration. Cell. 2013;152(1 - 2):224 - 35.). In 1993, Rosen et al. identified SOD1 mutations associated with cases of lethal adult - onset neurodegeneration in familial amyotrophic lateral sclerosis (fALS) (DR Rosen et al., Mutations in Cu / Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature. 1993;362(6415):59 - 62.).

[0005] Amyotrophic lateral sclerosis (ALS) is a fatal motor neuron disease that causes progressive degeneration of upper and lower motor neurons in the primary motor cortex, brainstem, and spinal cord (A. Chio et al., Global epidemiology of amyotrophic lateral sclerosis: a systematic review of the published literature. Neuroepidemiology. 2013;41(2):118-30.; O. Hardiman et al., Amyotrophic lateral sclerosis. Nat Rev Dis Primers. 2017;3:17071.; N. Nowicka et al., Risk Factors and Emerging Therapies in Amyotrophic Lateral Sclerosis. Int J Mol Sci. 2019;20(11).). Degeneration and loss of motor neurons cause progressive weakness and atrophy of skeletal muscles, and it usually progresses to paralysis and death within 3 to 5 years (Hardiman 2017). Currently, available treatments for ALS have shown only limited effectiveness with modest improvement in outcomes. Approximately 15% - 20% of fALS is related to genetic causes and has a slightly younger age of onset (47 - 53 years) compared to sporadic ALS cases with a median age of onset of 58 - 63 years.Among genetically defined ALS cases, approximately 15% are associated with a group of dominant genetic mutations within the SOD1 gene, and to date, over 180 genetic variants of SOD1 have been identified in patients with ALS (O. Abel et al., ALSoD: A user-friendly online bioinformatics tool for amyotrophic lateral sclerosis genetics. Hum Mutat. 2012;33(9):1345-51.; RAA van der Spek et al., The project MinE databrowser: bringing large-scale whole-genome sequencing in ALS to researchers and the public. Amyotroph Lateral Scler Frontotemporal Degener. 2019;20(5-6):432-40.).

[0006] Although the exact disease-inducing mechanism of the SOD1 mutant group remains not fully understood, there is a consensus that there is a toxic gain of function leading to toxicity caused by the aggregation of mutant SOD1 in neurons. Overexpression of mutant SOD1 in mice or rats recapitulates an important aspect of human ALS, including loss of neuromuscular junction innervation and motor neuron cell death (LI Bruijn & DW Cleveland, Mechanisms of selective motor neuron death in ALS: insights from transgenic mouse models of motor neuron disease. Neuropathol Appl Neurobiol. 1996;22(5):373-87.; ME Gurney et al., Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science. 1994;264(5166):1772-5.). Loss of SOD1 ultimately leads to motor neuron dysfunction but not motor neuron cell death (PM Andersenet al., Phenotypic heterogeneity in motor neuron disease patients with CuZn-superoxide dismutase mutations in Scandinavia. Brain. 1997;120 (Pt 10):1723-37.; AG Reaume et al., Motor neurons in Cu / Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury. Nat Genet. 1996;13(1):43-7.).Furthermore, although the change in enzyme activity level was initially thought to be the basic pathogenesis mechanism, it was observed that the disease severity did not correlate with the level of dismutase activity (Andersen 1997; DW Cleveland et al., Toxic mutants in Charcot’s sclerosis. Nature. 1995;378(6555):342-3.). Rather, the major impact of the SOD1 mutant group in ALS is associated with protein aggregation and prion-like propagation of molecules with abnormal folded structures (M Berdynskiet al., SOD1 mutations associated with amyotrophic lateral sclerosis analysis of variant severity. Sci Rep. 2022;12(1):103.).

[0007] Considering the role of the gain-of-function of SOD1 toxicity, lowering SOD1 levels is predicted to be therapeutic in SOD1 ALS. Support for this hypothesis in SOD1 ALS patients is provided by the recently approved tofersen. Tofersen is an antisense oligonucleotide that degrades SOD1 messenger RNA (mRNA). In the 28-week randomized VALOR phase 3 trial, tofersen was associated with a decrease in the total concentration of SOD1 protein in cerebrospinal fluid (CSF) and a decrease in the concentration of neurofilament light chain (NfL) protein in plasma. These results are interpreted as suggesting that a decrease in SOD1 mRNA may slow the progression of the underlying disease. At week 52, in a pooled analysis of VALOR and its open-label extension trial, participants who started tofersen at the time of entry into VALOR and its open-label extension trial had a slightly lower ALSFRS-R score, percentage of predicted expiratory vital capacity measured slowly with exhalation, and hand-held dynamometry megascore compared to humans who started tofersen in the open-label extension trial 28 weeks later (T Miller et al., Phase 1-2 Trial of Antisense Oligonucleotide Tofersen for SOD1 ALS. N Engl J Med. 2020;383(2):109-19.).

[0008] However, 7 percent of tofersen recipients reported serious neurological adverse events (AEs) and a more limited efficacy of its invasive dosing regimen consisting of three bi-weekly and subsequent monthly doses via intrathecal (IT) injection requiring lumbar puncture. Thus, there remains a need for a therapeutic agent that can safely and more effectively inhibit SOD1 gene expression in ALS patients. SUMMARY OF THE INVENTION

[0009] Summary There is a need for novel RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers, or triggers), such as double-stranded RNAi agents like siRNA, that can selectively and efficiently inhibit the expression of the SOD1 gene, including for use as therapeutic agents or pharmaceuticals. Furthermore, there is a need for compositions of novel SOD1-specific RNAi agents for the treatment of diseases or disorders associated with mutant SOD1 gene expression and / or disorders that may be at least partially mediated through a decrease in SOD1 gene expression.

[0010] The nucleotide sequences and chemical modifications of the SOD1 RNAi agents disclosed herein, and their combinations with specific pharmacokinetic and pharmacodynamic (PK / PD) modulators suitable for selectively and efficiently delivering the SOD1 RNAi agents to relevant CNS cells in vivo, are different from those previously disclosed or known in the art. The SOD1 RNAi agents disclosed herein potently and efficiently inhibit the expression of the SOD1 gene.

[0011] Overall, the present disclosure features SOD1 gene-specific RNAi agents, compositions comprising SOD1 RNAi agents, and methods of inhibiting the expression of the SOD1 gene in vitro and / or in vivo using the SOD1 RNAi agents and compositions comprising SOD1 RNAi agents described herein. The SOD1 RNAi agents described herein can selectively and efficiently reduce the expression of the SOD1 gene, thereby reducing the expression of the SOD1 enzyme.

[0012] The SOD1 RNAi agents described can be used in methods for the curative treatment (including preventative or prophylactic treatment) of conditions and diseases, including but not limited to, various central nervous system diseases and neurodegenerative diseases (including ALS and Alzheimer's disease).

[0013] In one aspect, the present disclosure features an RNAi agent for inhibiting the expression of the SOD1 gene, which RNAi agent comprises a sense strand (also referred to as the passenger strand) and an antisense strand (also referred to as the guide strand). The sense strand and the antisense strand can be partially, substantially, or completely complementary to each other. The length of the sense strand of the RNAi agent described herein can each be 15 to 49 nucleotides in length. The length of the antisense strand of the RNAi agent described herein can each be 18 to 49 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 18 to 26 nucleotides in length. The sense strand and the antisense strand can be either of the same length or of different lengths. In some embodiments, the sense strand and the antisense strand are independently 21 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21 to 24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strand is independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strand is independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. In vivo and / or in vitro, when the RNAi agent described herein is delivered to cells expressing SOD1, such as endothelial cells, neurons, microglia, and astrocytes, it inhibits the expression of one or more SOD1 gene variants.

[0014] The SOD1 RNAi agent disclosed herein targets the human SOD1 gene (see, e.g., SEQ ID NO: 1). In some embodiments, the SOD1 RNAi agent disclosed herein targets a portion of the SOD1 gene having any of the sequences disclosed in Table 1.

[0015] In another aspect, the present disclosure features a composition comprising a pharmaceutical composition comprising one or more of the disclosed SOD1 RNAi agents that can selectively and efficiently reduce the expression of the SOD1 gene. Compositions comprising one or more of the SOD1 RNAi agents described herein can be administered to a subject, such as a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of symptoms and diseases associated with SOD1 protein or enzyme levels.

[0016] Examples of sense and antisense strands of SOD1 RNAi agents that can be used as SOD1 RNAi agents are shown in Tables 3, 4, 5, and 6. Examples of SOD1 RNAi agent double strands are shown in Tables 7A, 7B, 8, 9A, and 10. Examples of 19-nucleotide core stretch sequences that can consist of or be included in the sense and antisense strands of specific SOD1 RNAi agents disclosed herein are shown in Table 2.

[0017] In another aspect, the present disclosure features a method for delivering an SOD1 RNAi agent to neurons, astrocytes, microglia, and endothelial cells of a subject, such as a mammal, in vivo. Further described herein are compositions for use in such methods. In some embodiments, disclosed herein is a method for delivering an SOD1 RNAi agent to central nervous system cells (neurons, astrocytes, microglia, and endothelial cells) of a subject in vivo. In some embodiments, the subject is a human subject.

[0018] The methods disclosed herein include administering one or more SOD1 RNAi agents to a subject, such as a human or animal subject, by any suitable means known in the art. The pharmaceutical compositions disclosed herein comprising one or more SOD1 RNAi agents can be administered in many ways depending on whether local or systemic treatment is desired. Administration can be, for example, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implant device), and intrapleural administration, but is not limited thereto. In some embodiments, the pharmaceutical compositions described herein are administered by intrathecal injection or intracerebroventricular administration.

[0019] In some embodiments, it is desirable for the SOD1 RNAi agents described herein to inhibit the expression of the SOD1 gene in central nervous system cells.

[0020] One or more SOD1 RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, the SOD1 RNAi agent is delivered to a cell or tissue by covalently linking the RNAi agent to a targeting group or lipid moiety.

[0021] The PK / PD modulator can be linked to the 3' or 5' end of the sense or antisense strand of the SOD1 RNAi agent. In some embodiments, the PK / PD modulator is linked to the 3' or 5' end of the sense strand. In some embodiments, the PK / PD modulator is linked to the 5' end of the sense strand. In some embodiments, the PK / PD modulator is internally linked to the nucleotides of the sense and / or antisense strands of the RNAi agent. In some embodiments, the PK / PD modulator is linked to the RNAi agent via a linker.

[0022] In another aspect, the disclosure features compositions comprising one or more SOD1 RNAi agents having the double-stranded structures disclosed in Tables 7A, 7B, 8, 9A, and 10.

[0023] Provided is a method for curative (including preventive) treatment of a disease or disorder in which a decrease in SOD1 protein level can result in a therapeutic effect by using an SOD1 RNAi agent. The SOD1 RNAi agents disclosed herein can be used for treating various neurodegenerative diseases, including ALS and Alzheimer's disease. Such a method of treatment includes administration of an SOD1 RNAi agent to a human or animal having elevated levels above desirable levels or having a mutant SOD1 enzyme or SOD1 enzyme activity. Definitions

[0024] As used herein, the terms "oligonucleotide" and "polynucleotide" each independently mean a polymer of linked nucleosides, which may or may not be modified.

[0025] As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") means a chemical composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can sequence-specifically reduce or inhibit (e.g., reduce or inhibit under appropriate conditions) the translation of the messenger RNA (mRNA) transcript of a target mRNA. As used herein, an RNAi agent can act through the RNA interference mechanism (i.e., induce RNA interference through interaction with the RNA interference machinery (RNA-induced silencing complex or RISC) of mammalian cells) or by any alternative mechanism or pathway. When the term is used herein, an RNAi agent is thought to act primarily through the RNA interference mechanism, but the disclosed RNAi agents are not bound or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein are composed of a sense strand and an antisense strand and include, for example, small (or short) interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs), microRNAs (miRNAs), short hairpin RNAs (shRNAs), and dicer substrates, but are not limited thereto. The antisense strand of the RNAi agent described herein is at least partially complementary to the target mRNA (i.e., SOD1 mRNA). The RNAi agent can contain one or more modified nucleotides and / or one or more non-phosphodiester bonds.

[0026] As used herein, when referring to the expression of a given gene, the terms "silencing," "decreasing," "inhibiting," "downregulating," or "knocking down" mean that the expression of the gene, as measured at the level of the RNA transcribed from the gene or the polypeptide, protein, or protein subunit translated from the mRNA, in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is lower compared to another cell, group of cells, tissue, organ, or subject that has not received such administration when the cell, group of cells, tissue, organ, or subject has been administered an RNAi agent as described herein.

[0027] As used herein, the terms "array" and "nucleotide sequence" mean a sequence or order of nucleobases or nucleotides, written as a series of letters using standard nomenclature.

[0028] As used herein, "base", "nucleotide base" or "nucleobase" is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the major purine bases adenine and guanine, and the major pyrimidine bases cytosine, thymine and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, mixed bases, size-expanded bases, and fluorinated bases (see, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.

[0029] As used herein, and unless otherwise indicated, the term "complementary" is used to describe a first nucleic acid base or nucleotide sequence (e.g., the sense strand of an RNAi agent or a target mRNA) in relation to a second nucleic acid base or nucleotide sequence (e.g., the antisense strand of an RNAi agent or a single-stranded antisense oligonucleotide). It means that an oligonucleotide or polynucleotide containing the first nucleotide sequence hybridizes with an oligonucleotide containing the second nucleotide sequence (forming base pair hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions)) and forms a double-stranded or double helix structure under certain standard conditions. One of ordinary skill in the art would be able to select the set of conditions most suitable for the hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics as long as at least the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, a and Af as defined herein are complementary to U (or T) and identical to A for the purpose of determining identity or complementarity.

[0030] As used herein, "perfectly complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases of a continuous sequence of the first oligonucleotide will hybridize with the same number of bases of a continuous sequence of the second oligonucleotide. The continuous sequence may include all or a part of the first or second nucleotide sequence.

[0031] As used herein, "partially complementary" means that in a hybridized pair of nucleobases or nucleotide sequence molecules, at least 70% (but not all) of the bases of a continuous sequence of a first oligonucleotide hybridize to the same number of bases of a continuous sequence of a second oligonucleotide. The continuous sequence may include all or a portion of the first or second nucleotide sequence.

[0032] As used herein, "substantially complementary" means that in a hybridized pair of nucleobases or nucleotide sequence molecules, at least 85% (but not all) of the bases of a continuous sequence of a first oligonucleotide hybridize to the same number of bases of a continuous sequence of a second oligonucleotide. The continuous sequence may include all or a portion of the first or second nucleotide sequence.

[0033] As used herein, the terms "complementary", "fully complementary", "partially complementary" and "substantially complementary" are used in reference to the nucleotide base or nucleotide match between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of SOD1 mRNA.

[0034] As used herein, the terms "substantially identical" or "substantially the same" when applied to a nucleic acid sequence mean that a nucleotide sequence (or a portion of the nucleotide sequence) has at least about 85% or more sequence identity, for example, at least 90%, at least 95%, or at least 99% identity, as compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base appears in both sequences, obtaining the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially the same as those disclosed herein.

[0035] As used herein, the terms "treat", "treatment" and similar terms mean a method or step taken to effect a reduction or alleviation in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include prevention, management, prophylactic treatment, and / or inhibition or reduction in the number, severity and / or frequency of one or more symptoms of a disease in a subject.

[0036] As used herein, the phrase "introduce into a cell" when referring to an RNAi agent means delivering the RNAi agent into the cell such that it functions. The phrase "functional delivery" means delivering an RNAi agent into a cell in a manner that enables the RNAi agent to have its expected biological activity, for example, sequence-specific inhibition of gene expression.

[0037] Unless otherwise indicated, the following symbols used herein

Chemical formula

[0038] As used herein, the term "isomer" means compounds that have the same molecular formula but differ in the nature or sequence of the bonds between their atoms or in the arrangement of those atoms in space. Isomers that differ in the arrangement of those atoms in space are called "stereoisomers". Stereoisomers that are not mirror images of each other are called "diastereoisomers", and stereoisomers that are non-superimposable mirror images are called "enantiomers", or sometimes "optical isomers". A carbon atom bonded to four non-identical substituents is called a "chiral center".

[0039] As used herein, unless otherwise specified in a structure having a particular conformation, for each structure in which an asymmetric center is present and thus gives rise to enantiomers, diastereomers, or other stereoisomeric arrangements, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure forms and racemic forms. For example, the structures disclosed herein are intended to cover not only single stereoisomers but also mixtures of diastereomers.

[0040] As used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the scope of the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0041] One of ordinary skill in the art will readily understand and recognize that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein are intended to assume that certain functional groups such as OH, SH, or NH may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of the protonation state based on the environment (such as pH), as will be readily understood by one of ordinary skill in the art. Correspondingly, it should be understood that the compounds described herein having labile protons or basic atoms also represent the salt forms of the corresponding compounds. The compounds described herein can be in the form of free acids, free bases, or salts. It should be understood that the pharmaceutically acceptable salts of the compounds described herein are within the scope of the present invention.

[0042] As used herein, when referring to the connection between two compounds or molecules, the terms "linked" or "conjugated" mean that the two compounds or molecules are joined by a covalent bond. Unless otherwise specified, the terms "linked" and "conjugated" as used herein can mean the connection between a first compound and a second compound, regardless of the presence or absence of intervening atoms or groups of atoms.

[0043] As used herein, the term "comprising" is used herein to mean "including, but not limited to" and is used interchangeably with this phrase. The term "or" as used herein is used to mean "and / or" and is used interchangeably therewith, unless the context clearly indicates otherwise.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, this specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0045] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

[0046] DETAILED DESCRIPTION OF THE INVENTION RNAi Agent Described herein are RNAi agents (referred to herein as SOD1 RNAi agents or SOD1 RNAi triggers) for inhibiting the expression of the SOD1 gene. Each of the SOD1 RNAi agents disclosed herein comprises a sense strand and an antisense strand. The sense strand can be 15 to 49 nucleotides in length. The antisense strand can be 18 to 30 nucleotides in length. The sense strand and the antisense strand can be of the same length, or they can be of different lengths. In some embodiments, the sense strand and the antisense strand are each independently 18 to 27 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each 21 to 24 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each independently 19 to 21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, while the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 nucleotides in length. In some embodiments, the sense strands of the RNAi agents are each independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. In some embodiments, the antisense strands of the RNAi agents are each independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the double-stranded RNAi agent has a double-stranded length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length.

[0047] Examples of nucleotide sequences used to form SOD1 RNAi agents are shown in Tables 2, 3, 4, 5, 6, and 10. Examples of RNAi agent duplexes containing the sense and antisense strand sequences of Tables 2, 3, 4, 5, and 6 are shown in Tables 7A, 7B, 8, 9A, and 10.

[0048] In some embodiments, the region of complete, substantial, or partial complementarity between the sense and antisense strands is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not completely, substantially, or partially complementary).

[0049] The sense strand of the SOD1 RNAi agent described herein contains at least 15 contiguous nucleotides having at least 85% identity with a core stretch sequence of the same number of nucleotides of SOD1 mRNA (also referred to herein as the "core stretch" or "core sequence"). In some embodiments, the core stretch sequence of the sense strand is 100% (completely) complementary or at least about 85% (substantially) complementary to the core stretch sequence of the antisense strand, and thus the core stretch sequence of the sense strand is typically completely identical or at least about 85% identical to the nucleotide sequence of the same length present in the SOD1 mRNA target (which may also be referred to as the target sequence). In some embodiments, this core stretch of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this core stretch of the sense strand is 17 nucleotides in length. In some embodiments, this core stretch of the sense strand is 19 nucleotides in length.

[0050] The antisense strand of the SOD1 RNAi agent described herein comprises at least 16 contiguous nucleotides having at least 85% complementarity with a core stretch of the same number of nucleotides of SOD1 mRNA and a core stretch of the same number of nucleotides of the corresponding sense strand. In some embodiments, the core stretch of the antisense strand is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length (e.g., a target sequence) present in the SOD1 mRNA target. In some embodiments, the core stretch of this antisense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the core stretch of this antisense strand is 19 nucleotides in length. In some embodiments, the core stretch of this antisense strand is 17 nucleotides in length. The core stretch sequence of the sense strand may be the same length as or a different length from the corresponding antisense core sequence.

[0051] The sense and antisense strands of the SOD1 RNAi agent anneal to form a duplex. The sense and antisense strands of the SOD1 RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the core stretch sequence of the sense strand is at least 85% or 100% complementary to the antisense core stretch sequence. In some embodiments, the core stretch sequence of the sense strand is at least 85% or 100% complementary to the sequence of the corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides of the core stretch sequence of the antisense strand and contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides (i.e., the sense and antisense core stretch sequences of the SOD1 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that form at least 85% base pairs or 100% base pairs).

[0052] In some embodiments, the antisense strand of the SOD1 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the SOD1 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10 by 0, 1, 2, or 3 nucleotides.

[0053] In some embodiments, the sense strand and / or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3' end, 5' end, or both the 3' end and 5' end of the core stretch sequence. If additional nucleotides of the antisense strand are present, they may or may not be complementary to the corresponding sequence in the SOD1 mRNA. If additional nucleotides of the sense strand are present, they may or may not be identical to the corresponding sequence in the SOD1 mRNA. If additional nucleotides of the antisense strand are present, they may or may not be complementary to the additional nucleotides of the corresponding sense strand if present.

[0054] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the core stretch sequence of the sense strand and / or the core stretch sequence of the antisense strand. The extension nucleotides of the sense strand may or may not be complementary to the nucleotides of the corresponding antisense strand (either the core stretch sequence nucleotides or the extension nucleotides). Conversely, the extension nucleotides of the antisense strand may or may not be complementary to the nucleotides of the corresponding sense strand (either the core stretch sequence nucleotides or the extension nucleotides). In some embodiments, both the sense and antisense strands of the RNAi agent contain 3' and 5' extensions. In some embodiments, one or more 3' extension nucleotides of one strand base pair with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more 3' extension nucleotides of one strand do not base pair with one or more 5' extension nucleotides of the other strand. In some embodiments, the SOD1 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the (one or more) extension nucleotides are not paired and form an overhang. As used herein, an "overhang" means a stretch of one or more unpaired nucleotides located at either end of the sense or antisense strand that does not hybridize or form part of the duplex portion of the RNAi agents disclosed herein.

[0055] In some embodiments, the SOD1 RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the SOD1 RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, or 3 nucleotides in length. In some embodiments, one or more antisense strand extension nucleotides comprise nucleotides complementary to the corresponding SOD1 mRNA sequence. In some embodiments, one or more antisense strand extension nucleotides comprise nucleotides that are not complementary to the corresponding SOD1 mRNA sequence.

[0056] In some embodiments, the SOD1 RNAi agent comprises a sense strand having a 3' extension that is 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, the one or more sense strand extension nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to the nucleotides of the SOD1 mRNA sequence. In some embodiments, the 3' sense strand extension comprises, but is not limited to, one of the following sequences, or consists of: T, UT, TT, UU, UUT, TTT, or TTTT (listed 5' to 3' respectively).

[0057] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, the SOD1 RNAi agent comprises a sense strand having a 5' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, the one or more sense strand extension nucleotides comprise nucleotides corresponding to or identical to the nucleotides of the SOD1 mRNA sequence.

[0058] Examples of sequences used to form the SOD1 RNAi agent are shown in Tables 2, 3, 4, 5, 6, and 10. In some embodiments, the antisense strand of the SOD1 RNAi agent comprises the sequence of any of the sequences in Tables 2, 3, or 10. In certain embodiments, the antisense strand of the SOD1 RNAi agent comprises, or consists of, any one of the modified sequences in Table 3. In some embodiments, the antisense strand of the SOD1 RNAi agent comprises the sequence of nucleotides (5' end → 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Tables 2 or 3. In some embodiments, the sense strand of the SOD1 RNAi agent comprises the sequence of any of the sequences in Tables 2, 4, 5, or 6. In some embodiments, the sense strand of the SOD1 RNAi agent comprises the sequence of nucleotides (5' end → 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the sequences in Tables 2, 4, 5, or 6. In certain embodiments, the sense strand of the SOD1 RNAi agent comprises, or consists of, any one of the modified sequences in Tables 4, 5, 6, or 10.

[0059] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, both ends of the RNAi agent form blunt ends. In some embodiments, neither end of the RNAi agent is a blunt end. As used herein, "blunt end" means the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0060] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form frayed ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form non-complementary ends. In some embodiments, both ends of the RNAi agent form non-complementary ends. In some embodiments, neither end of the RNAi agent is a non-complementary end. As used herein, a non-complementary end means the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands form a base pair (i.e., do not form an overhang), but are not complementary (i.e., form a non-complementary base pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides may be in the sense strand or the antisense strand and form either a 3' or 5' overhang. In some embodiments, the RNAi agent contains blunt ends and non-complementary ends, blunt ends and 5' overhang ends, blunt ends and 3' overhang ends, non-complementary ends and 5' overhang ends, non-complementary ends and 3' overhang ends, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two non-complementary ends, or two blunt ends. Typically, the overhang, when present, is located at the 3' end of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0061] The SOD1 RNAi agents disclosed herein can also be composed of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand of the SOD1 RNAi agent are modified nucleotides. The SOD1 RNAi agents disclosed herein can further be composed of one or more modified internucleotide linkages, for example, one or more phosphorothioate linkages. In some embodiments, the SOD1 RNAi agent contains one or more modified nucleotides and one or more modified internucleotide linkages. In some embodiments, 2'-modified nucleotides are combined with modified internucleotide linkages.

[0062] In some embodiments, the SOD1 RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the SOD1 RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the SOD1 RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms well known in the art are within the scope of the invention disclosed herein. Modified nucleotide

[0063] Modified nucleotides, when used in various oligonucleotide constructs, can maintain the activity of the compounds in cells while simultaneously increasing the serum stability of these compounds and minimizing the potential to activate interferon activity in humans upon administration of the oligonucleotide constructs.

[0064] In some embodiments, the SOD1 RNAi agent contains one or more modified nucleotides. As used herein, "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleotides, nucleotides containing modified nucleobases, bridged nucleic acids, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleic acid base analogs), locked nucleotides, 3'-O-methoxy (2' nucleoside internucleotide linkage) nucleotides, 2'-F-arabinonucleotides, 5'-methyl-2'-fluoronucleotides, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, vinyl phosphonate-containing nucleotides, and phosphonic acid cyclopropyl-containing nucleotides, but are not limited thereto. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position on the pentose ring) include 2'-O-methyl nucleotides (also referred to herein or in the art as 2'-methoxy nucleotides), 2'-fluoronucleotides (also referred to herein or in the art as 2'-deoxy-2'-fluoronucleotides), 2'-deoxynucleotides, 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (also referred to herein or in the art as 2'-MOE nucleotides), 2'-aminonucleotides, 2'-halonucleotides, and 2'-alkyl nucleotides, but are not limited thereto. Not necessarily all positions of a given compound need to be uniformly modified. Conversely, multiple modifications can also be incorporated into a single SOD1 RNAi agent, or even into only one of its nucleotides.The sense strand and the antisense strand of the SOD1 RNAi agent can be synthesized and / or modified by methods known in the art. Modifications at one nucleotide are independent of modifications at another nucleotide.

[0065] Modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine, and 7-methyladenine, 8-azaguanine, and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine, etc., including synthetic and natural nucleobases.

[0066] In some embodiments, the 5' and / or 3' end of the antisense strand can include abasic residues (Ab) (which may also be referred to as "abasic moieties" or "abasic nucleotides"). An abasic residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety (see, e.g., U.S. Patent No. 5,998,203). In some embodiments, the abasic residues can be located internally within the nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab can be added to the 3' end of the sense strand. In some embodiments, the abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0067] In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent in which four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides of both the sense and antisense strands are ribonucleotides (i.e., unmodified). As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides of the sense strand are unmodified ribonucleotides. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides of the antisense strand are unmodified ribonucleotides. In some embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides. The chemical structures of specific modified nucleotides are set forth in Table 11 herein. Modified nucleoside linkages

[0068] In some embodiments, one or more nucleotides of the SOD1 RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include phosphorothioate groups (represented herein as lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonate or 3'-alkylene phosphonate), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkyl-phosphonate, thionoalkylphosphotriester, morpholino linkage, boranophosphate having a normal 3'-5' linkage, 2'-5' linkage analog of boranophosphate, or boranophosphate having an inverse polarity where adjacent pairs of nucleoside units are linked from 3'-5' to 5'-3' or from 2-5' to 5'-2', but are not limited thereto. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include short-chain alkyl or cycloalkyl sugar linkages, mixed heteroatom and alkyl or cycloalkyl sugar linkages, or one or more short-chain heteroatom or heterocyclic sugar linkages, but are not limited thereto. In some embodiments, modified internucleoside backbones include siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamic acid backbones, methyleneimino and methylenehydrazino backbones, sulfonic acid and sulfonamide backbones, amide backbones, and other backbones containing a mixture of N, O, S, and CH2 components, but are not limited thereto.

[0069] In some embodiments, the sense strand of the SOD1 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of the SOD1 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can each independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of the SOD1 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the SOD1 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can each independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0070] In some embodiments, the sense strand of the SOD1 RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 3’ end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5’ end of the sense strand nucleotide sequence and another phosphorothioate linkage is at the 3’ end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5’ end of the sense strand and another phosphorothioate linkage is at the 3’ end of the sense strand. In some embodiments, the sense strand contains no phosphorothioate internucleoside linkages between nucleotides, but contains 1, 2, or 3 phosphorothioate linkages between both the 5’ and 3’ terminal nucleotides and an optionally present inverted abasic residue terminal cap. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0071] In some embodiments, the antisense strand of the SOD1 RNAi agent contains four phosphorothioate internucleotide linkages. In some embodiments, the four phosphorothioate internucleotide linkages are between nucleotides at positions 1 to 3 from the 5' end of the antisense strand, and between nucleotides at positions 19 to 21, 20 to 22, 21 to 23, 22 to 24, 23 to 25, or 24 to 26 from the 5' end. In some embodiments, the three phosphorothioate internucleotide linkages are located between positions 1 to 4 from the 5' end of the antisense strand, and the fourth phosphorothioate internucleotide linkage is located between positions 20 to 21 from the 5' end of the antisense strand. In some embodiments, the SOD1 RNAi agent contains at least three or four phosphorothioate internucleotide linkages in the antisense strand. Capping residue or moiety

[0072] In some embodiments, the sense strand can include one or more capping residues or moieties that may sometimes be referred to in the art as a "cap", "terminal cap", or "capping residue". As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more termini of the nucleotide sequence of an RNAi agent disclosed herein. Capping residues can, in some cases, confer certain beneficial properties to the RNAi agent, such as, for example, protection against exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic moiety") is added as a capping residue (see Table 11) (see, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art and include, for example, inverted abasic residues, and terminal C3H7 (propyl), C6H 13 (hexyl), or C 12 H 25It contains a carbon chain such as a (dodecyl) group. In some embodiments, the capping residue is present at either the 5'-end, 3'-end, or both the 5'- and 3'-ends of the sense strand. In some embodiments, the 5'-end and / or 3'-end of the sense strand can include a plurality of inverted abasic deoxyribose moieties as capping residues.

[0073] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3'-end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic moieties are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, by including one or more inverted abasic residues or inverted abasic moieties at or near the ends of the sense strand of the RNAi agent, enhancement of the activity or other desired properties of the RNAi agent becomes possible.

[0074] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues can be linked via a phosphate, phosphorothioate (e.g., denoted as (invAb) herein), or other internucleoside linkage. In some embodiments, by including one or more inverted abasic residues at or near the ends of the sense strand of the RNAi agent, enhancement of the activity or other desired properties of the RNAi agent becomes possible. In some embodiments, the inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3'-end of the antisense strand core stretch sequence or the 3'-end of the antisense strand sequence can include an inverted abasic residue. The chemical structure of the inverted abasic deoxyribose residue is shown in Table 11 below. SOD1 RNAi agent

[0075] The SOD1 RNAi agent disclosed in this specification is designed to target specific positions on the SOD1 gene (e.g., SEQ ID NO: 1 (NM_000454.5)). As defined herein, the antisense strand sequence is designed to target the SOD1 gene at a given position on the gene when the 5'-terminal nucleobase of the antisense strand is aligned with a position 21 nucleotides downstream (in the 3'-terminal direction) from the position on the gene when base-pairing with the gene. For example, as exemplified in Tables 1 and 2 of this specification, the antisense strand sequence designed to target the SOD1 gene at position 304 requires that the 5'-terminal nucleobase of the antisense strand be aligned with position 324 of the SOD1 gene when base-pairing with the gene.

[0076] As provided herein, the SOD1 RNAi agent does not require the nucleobase at the 1st position (5’→3’) of the antisense strand to be complementary to the gene, but there is a condition that at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene exists over a core stretch sequence of at least 16 consecutive nucleotides. For example, in the case of the SOD1 RNAi agent disclosed herein designed to target the 304th position of the SOD1 gene, the 5’-terminal nucleobase of the antisense strand of the SOD1 RNAi agent must align with the 324th position of the gene. However, the 5’-terminal nucleobase of the antisense strand may or may not be complementary to the 324th position of the SOD1 gene, and there is a condition that at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene transcript exists over a core stretch sequence of at least 16 consecutive nucleotides. In particular, as shown by the various examples disclosed herein, the specific binding portion of the gene by the antisense strand of the SOD1 RNAi agent (e.g., whether the SOD1 RNAi agent is designed to target the SOD1 gene at the 304th position, 264th position, 785th position, or some other position) is an important factor for the level of inhibition achieved by the SOD1 RNAi agent (see, for example, Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0077] In some embodiments, the SOD1 RNAi agents disclosed herein target the SOD1 gene at or near the positions of the SOD1 sequences shown in Table 1. In some embodiments, the antisense strand of the SOD1 RNAi agents disclosed herein comprises a core stretch sequence that is completely, substantially, or at least partially complementary to the target SOD1 19-mer sequence disclosed in Table 1.

[0078]

Table 1-1

Table 1-2

[0079] Homo sapiens superoxide dismutase (SOD1), GenBank NM_000454.5 (SEQ ID NO: 1), gene transcript (895 bases):

Chemical formula

[0080] In some embodiments, the SOD1 RNAi agent comprises an antisense strand, and the 19th position of the antisense strand (5’→3’) can form a base pair with the 1st position of the 19-mer target sequence disclosed in Table 1. In some embodiments, the SOD1 agent comprises an antisense strand, and the 1st position of the antisense strand (5’→3’) can form a base pair with the 19th position of the 19-mer target sequence disclosed in Table 1.

[0081] In some embodiments, the SOD1 agent comprises an antisense strand, and the 2nd position of the antisense strand (5’→3’) can form a base pair with the 18th position of the 19-mer target sequence disclosed in Table 1. In some embodiments, the SOD1 agent comprises an antisense strand, and the 2nd to 18th positions of the antisense strand (5’→3’) can form base pairs with the respective complementary bases located at the 18th to 2nd positions of the 19-mer target sequence disclosed in Table 1.

[0082] In the RNAi agents disclosed in this specification, the nucleotide at the 1st position of the antisense strand (5'-end → 3'-end) can be completely complementary to the SOD1 gene or non-complementary to the SOD1 gene. In some embodiments, the nucleotide at the 1st position of the antisense strand (5'-end → 3'-end) is U, A, or dT. In some embodiments, the nucleotide at the 1st position of the antisense strand (5'-end → 3'-end) forms an A:U or U:A base pair with the sense strand.

[0083] In some embodiments, the antisense strand of the SOD1 RNAi agent comprises the sequence of nucleotides 2 to 18 or 2 to 19 (5'-end → 3'-end) of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of the SOD1 RNAi comprises the sequence of nucleotides 1 to 17, 1 to 18, or 2 to 18 (5'-end → 3'-end) of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 6a.

[0084] In some embodiments, the SOD1 RNAi agent is composed of (i) an antisense strand comprising the sequence of nucleotides 2 to 18 or 2 to 19 (5'→3'-end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides 1 to 17 or 1 to 18 (5'-end → 3'-end) of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 6a.

[0085] In some embodiments, the SOD1 RNAi agent comprises the core 19-mer nucleotide sequence shown in Table 2 below.

[0086]

Table 2-1

Table 2-2

Table 2-3

Table 2-4

Table 2-5

Table 2-6

Table 2-7

Table 2-8

Table 2-9

[0087] The sense and antisense strands of the SOD1 RNAi agent comprising or consisting of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the sense and antisense strand sequences of the SOD1 RNAi agent comprising or consisting of any of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

[0088] In some embodiments, the antisense strand of the SOD1 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the SOD1 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0089] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any nucleobase (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases that are complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases that are not complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleobases as the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases that are different from the N nucleotides at the corresponding positions on the other strand.

[0090] The sense and antisense strands of specific modified SOD1 RNAi agents are shown in Tables 3, 4, 5, 6, 6a, and 10. The antisense strands of specific modified SOD1 RNAi agents, and their underlying unmodified nucleobase sequences, are shown in Table 3. The sense strands of specific modified SOD1 RNAi agents, and their underlying unmodified nucleobase sequences, are shown in Tables 4, 5, and 6. When forming the SOD1 RNAi agents, the nucleotides in each of the underlying base sequences listed in Tables 3, 4, 5, and 6, and Table 2 above, can each be modified nucleotides.

[0091] The SOD1 RNAi agents described herein are formed by annealing the antisense strands to the sense strands. The sense strands containing the sequences listed in Table 2, Table 4, Table 5, Table 6, or Table 6a can hybridize to any antisense strand containing the sequences listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides.

[0092] In some embodiments, the antisense strand of the SOD1 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0093] In some embodiments, the SOD1 RNAi agent comprises, or consists of, a duplex having the sense and antisense strand nucleobase sequences of any of the sequences in Table 2, Table 3, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0094] Examples of antisense strands containing modified nucleotides are shown in Table 3. Examples of sense strands containing modified nucleotides are shown in Tables 4, 5, and 6.

[0095] When used in Tables 3, 4, 5, 6, 6a, and 10, the following notation is used to indicate modified nucleotides, targeting groups, and linking groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Af = 2'-Fluoroadenosine-3'-phosphate Afs = 2'-Fluoroadenosine-3'-phosphorothioate Cf = 2'-Fluorocytidine-3'-phosphate Cfs = 2'-Fluorocytidine-3'-phosphorothioate Gf = 2'-Fluoroguanosine-3'-phosphate Gfs = 2'-Fluoroguanosine-3'-phosphorothioate Tf = 2'-Fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-Fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-Fluorouridine-3'-phosphate Ufs = 2'-Fluorouridine-3'-phosphorothioate dT = 2'-Deoxythymidine-3'-phosphate A UNA = 2',3'-seco-Adenosine-3'-phosphate A UNA s = 2',3'-seco-Adenosine-3'-phosphorothioate C UNA = 2',3'-seco-Cytidine-3'-phosphate C UNA s = 2',3'-seco-Cytidine-3'-phosphorothioate G UNA = 2',3'-seco-Guanosine-3'-phosphate G UNA s = 2',3'-seco-Guanosine-3'-phosphorothioate U UNA = 2',3'-seco-Uridine-3'-phosphate U UNA s = 2',3'-seco-Uridine-3'-phosphorothioate a_2N = See Table 11 a_2Ns = See Table 11 (invAb) = Inverted deoxyribonucleotide-5'-phosphate, see Table 11 (invAb)s = Inverted deoxyribonucleotide-5'-phosphorothioate, see Table 11 s = Phosphorothioate bond p = Terminal phosphate (as synthesized) vpdN = Vinylphosphonate deoxyribonucleotide cPrpa = 5'-Phosphonocyclopropyl-2'-O-methyladenosine-3'-phosphate (see Table 11) cPrpas = 5'-Phosphonocyclopropyl-2'-O-methyladenosine-3'-phosphorothioate (see Table 11) cPrpu = 5'-Phosphonocyclopropyl-2'-O-methyluridine-3'-phosphate (see Table 11) cPrpus = 5'-Phosphonocyclopropyl-2'-O-methyluridine-3'-phosphorothioate (see Table 11) (Alk-SS-C6) = See Table 11 (C6-SS-Alk) = See Table 11 (C6-SS-C6) = See Table 11 (6-SS-6) = See Table 11 (C6-SS-Alk-Me) = See Table 11 (NH2-C6) = See Table 11 (NH-C6) = See Table 11 (NH-C6)s = See Table 11 -L6-C6 = See Table 11 -L6-C6s = See Table 11 LP183rs = See Table 11 LP409s = See Table 11 cC16 = See Table 11 aC16 = See Table 11 gC16 = See Table 11 uC16 = See Table 11 ALNA = See Table 11 c16s = See Table 11 C22s = See Table 11 HO-C16s = See Table 11 (2C8C12)s = See Table 11 (2C6C10)s = Refer to Table 11 LP283 = Refer to Table 11 LP293 = Refer to Table 11 LP310 = Refer to Table 11 LP383 = Refer to Table 11 LP395 = Refer to Table 11 LP395s = Refer to Table 11 LP396 = Refer to Table 11

[0096] As will be readily understood by those skilled in the art, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s", etc.), nucleotide monomers are linked to each other by 5'-3'-phosphodiester linkages when present in an oligonucleotide. As will be clearly understood by those skilled in the art, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages typically present in oligonucleotides. Further, those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the 3' position of each monomer instead of an in vitro phosphate moiety. In addition, in the embodiments disclosed herein, when viewing each strand as 5'→3', inverted abasic residues are inserted such that the 3' position of the deoxyribose is linked to the 3' end of the previous monomer on each strand (e.g., refer to Table 11). Moreover, as will be readily understood and recognized by those skilled in the art, while the chemical structure of phosphorothioate depicted herein typically shows an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., when the sulfur atom has a double bond and the anion is on the oxygen atom). Such understanding by those skilled in the art is used when describing the SOD1 RNAi agents and compositions of SOD1 RNAi agents disclosed herein, unless otherwise explicitly indicated herein.

[0097] Specific examples of PK / PD modulators and linkers used in the SOD1 RNAi agents disclosed herein are included in the chemical structures shown in Table 11 below. The sense strand and / or the antisense strand can each have any of the PK / PD modulators or linkers listed herein conjugated to the 5' and / or 3' end of the sequence, and other targeting groups, PK / PD modulators, and linkers.

[0098]

Table 3-1

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

Table 3-7

[0099]

Table 4-1

Table 4-2

Table 4-3

Table 4-4

Table 4-5

Table 4-6

[0100]

Table 5-1

Table 5-2

Table 5-3

Table 5-4

Table 5-5

Table 5-6

Table 5-7

[0101]

Table 6-1

Table 6-2

Table 6-3

[0102]

Table 7-1

Table 7-2

[0103] The SOD1 RNAi agents disclosed in this specification are formed by annealing an antisense strand with a sense strand. The sense strand containing the sequences listed in Table 2, Table 4, Table 5, Table 6, or Table 6a can hybridize to any antisense strand containing the sequences listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides.

[0104] As shown in Table 5 above, certain ones of the nucleotide sequences of the exemplary SOD1 RNAi agents have been shown to further contain a reactive linking group at one or both of the 5' and 3' ends of the sense strand. For example, many of the sense strand sequences of the SOD1 RNAi agents shown in Table 5 above have an (NH2-C6) linking group at the 5' end of the nucleotide sequence. Other linking groups such as (6-SS-6) linking group or (C6-SS-C6) linking group can be present as well or alternatively in certain embodiments. Such reactive linking groups are arranged to facilitate the linking of targeting ligands, targeting groups, and / or PK / PD modulators to the SOD1 RNAi agents disclosed herein. The linking reaction or conjugation reaction is well known in the art and results in the formation of a covalent bond between two molecules or reactants. Conjugation reactions suitable for use within the scope of the invention herein include, but are not limited to, amide coupling reaction, Michael addition reaction, hydrazone formation reaction, Diels-Alder cycloaddition reaction, oxime ligation, and copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reaction.

[0105] In some embodiments, the targeting ligand is synthesized as an activated ester, such as a tetrafluorophenyl (TFP) ester that can be substituted with a reactive amino group (e.g., NH2-C6), and the targeting ligand can be attached to the SOD1 RNAi agent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide and can be conjugated to a propargyl or DBCO group, for example, via a copper(I) catalyst or a strain-promoted azide-alkyne cycloaddition reaction.

[0106] Furthermore, certain nucleotide sequences can be synthesized such that a dT nucleotide is at the 3' end of the sense strand, followed by a (3'→5') linker (e.g., C6-SS-C6). The linker can, in some embodiments, facilitate ligation to additional components, such as lipids and one or more targeting ligands. As described herein, first the disulfide bond of C6-SS-C6 is reduced, the dT is removed from the molecule, and then conjugation of the desired components can be facilitated. Thus, the terminal dT nucleotide is not part of the fully conjugated construct.

[0107] In some embodiments, the antisense strand of the SOD1 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 3 or Table 10 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the SOD1 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 4, Table 5, Table 6, Table 6a, or Table 10 by 0, 1, 2, or 3 nucleotides.

[0108] In some embodiments, the antisense strand of the SOD1 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the antisense strand of the SOD1 RNAi agent comprises the nucleotides (5' end → 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2, Table 3, or Table 10. In certain embodiments, the antisense strand of the SOD1 RNAi agent comprises, or consists of, any one of the modified sequences in Table 3 or Table 10.

[0109] In some embodiments, the sense strand of the SOD1 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the sense strand of the SOD1 RNAi agent comprises the nucleotides (5' end → 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10. In certain embodiments, the sense strand of the SOD1 RNAi agent comprises, or consists of, any one of the modified sequences in Table 3 or Table 10.

[0110] In the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5' end → 3') can be completely complementary to the SOD1 gene or non-complementary to the SOD1 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5' end → 3') is U, A, or dT (or a modified version of U, A, or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (5' end → 3') forms an A:U or U:A base pair with the sense strand.

[0111] In some embodiments, the antisense strand of the SOD1 RNAi agent comprises a sequence of nucleotides (5' end → 3') 2 to 18 or 2 to 19 of any of the antisense strand sequences in Table 2, Table 3, or Table 10. In some embodiments, the sense strand of the SOD1 RNAi comprises a sequence of nucleotides (5' end → 3') 1 to 17 or 1 to 18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0112] In some embodiments, the SOD1 RNAi agent comprises (i) an antisense strand comprising a sequence of nucleotides (5' end → 3') 2 to 18 or 2 to 19 of any of the antisense strand sequences in Table 2, Table 3, or Table 10, and (ii) a sense strand comprising a sequence of nucleotides (5' end → 3') 1 to 17 or 1 to 18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0113] A sense strand containing the sequence listed in Table 2 or Table 4 can hybridize to any antisense strand containing the sequence listed in Table 2 or Table 3, provided that the two sequences have a region of complementarity of at least 85% over a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides. In some embodiments, the SOD1 RNAi agent has a sense strand consisting of any of the modified sequences in Table 4, Table 5, Table 6, Table 6a, or Table 10, and an antisense strand consisting of any of the modified sequences in Table 3 or Table 10. Specific representative sequence pairs are exemplified by the duplex ID numbers shown in Tables 7A, 7B, 8, and 9A.

[0114] In some embodiments, the SOD1 RNAi agent comprises, consists of, or consists essentially of a double-strand represented by any one of the double-strand ID numbers presented herein. In some embodiments, the SOD1 RNAi agent consists of any one of the double-strand ID numbers presented herein. In some embodiments, the SOD1 RNAi agent comprises the sense strand and the antisense strand nucleotide sequences of any one of the double-strand ID numbers presented herein. In some embodiments, the SOD1 RNAi agent comprises the sense strand and the antisense strand nucleotide sequences of any one of the double-strand ID numbers presented herein, as well as targeting groups, linking groups, PK / PD modulators, and / or other non-nucleotide groups, wherein the targeting groups, linking groups, PK / PD modulators, and / or other non-nucleotide groups are covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, the SOD1 RNAi agent comprises the sense strand and the antisense strand modified nucleotide sequences of any one of the double-strand ID numbers presented herein. In some embodiments, the SOD1 RNAi agent comprises the sense strand and the antisense strand modified nucleotide sequences of any one of the double-strand ID numbers presented herein, as well as targeting groups, linking groups, and / or other non-nucleotide groups, wherein the targeting groups, linking groups, PK / PD modulators, and / or other non-nucleotide groups are covalently linked to the sense strand or the antisense strand.

[0115] In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any one of the antisense strand / sense strand double-strands of Table 2, 7A, 7B, 8, 9A, or 10, and comprises a PK / PD modulator. In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any one of the antisense strand / sense strand double-strands of Table 2, 7A, 7B, 8, 9A, or 10, and comprises one or more lipid moieties.

[0116] In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes of Table 2, 7A, 7B, 8, 9A, or 10, and comprises a lipid moiety. In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes of Table 2, 7A, 7B, 8, 9A, or 10, and comprises one or more lipid moieties.

[0117] In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense strand / sense strand duplexes of Tables 7A, 7B, 8, 9A, and 10.

[0118] In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense strand / sense strand duplexes of Tables 7A, 7B, 8, 9A, and 10, and comprises a lipid moiety.

[0119] In some embodiments, the SOD1 RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Tables 7A, 7B, 8, 9A, and 10.

[0120] [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5]

[0121] [Table 9-1]

Table 9-2

[0122]

Table 10-1

Table 10-2

Table 10-3

[0123]

Table 11-1

Table 11-2

Table 11-3

[0124]

Table 12-1

Table 12-2

Table 12-3

Table 12-4

[0125] In some embodiments, the SOD1 RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the SOD1 RNAi agent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, the SOD1 RNAi agent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt. The RNAi agents described herein, when delivered to cells expressing the SOD1 gene, inhibit or knockdown the expression of one or more SOD1 genes in vivo and / or in vitro. Targeting group, linking group, lipid PK / PD modulator, and delivery vehicle

[0126] In some embodiments, the SOD1 RNAi agent contains or is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, a linking group, a pharmacokinetics / pharmacodynamics (PK / PD) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide groups can enhance the targeting, delivery, or attachment of the RNAi agent. The non-nucleotide groups can be covalently linked to either the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the SOD1 RNAi agent contains non-nucleotide groups linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the SOD1 RNAi agent. The non-nucleotide group can be linked to the RNAi agent directly or indirectly via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0127] In some embodiments, the non-nucleotide group enhances the pharmacokinetics or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving the cell- or tissue-specific distribution and cellular uptake of the conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi agent.

[0128] The targeting group or targeting moiety enhances the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which it is attached, improving the cell-specific (including organ-specific in some cases) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. The targeting group may be monovalent, divalent, trivalent, tetravalent, or may have a higher valence for the target to which it is directed. Representative targeting groups include, but are not limited to, compounds having an affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics having an affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a PEG linker or, in some cases, a linker such as one, two, or three abasic and / or ribitol (abasic ribose) residues that can act as a linker.

[0129] The targeting group can be attached to either the 5' or 3' end of either the sense strand and / or the antisense strand disclosed in Tables 2, 3, 4, 5, 6, and 10, with or without a linker. The linker can be attached to either the 5' or 3' end of either the sense strand and / or the antisense strand disclosed in Tables 2, 3, 4, 5, 6, and 10, with or without a targeting group.

[0130] The SOD1 RNAi agents described herein can be synthesized to have a reactive group such as an amino group (also referred to herein as an amine) at the 5' end and / or the 3' end. The reactive group can later be used to attach the targeting moiety using methods typical in the art.

[0131] For example, in some embodiments, the SOD1 RNAi agents disclosed herein are synthesized to have an NH2-C6 group at the 5' end of the sense strand of the RNAi agent. Subsequently, the terminal amino group can be reacted to form a conjugate with, for example, a group containing a lipid moiety. In some embodiments, the SOD1 RNAi agents disclosed herein are synthesized to have one or more alkyne groups at the 5' end of the sense strand of the RNAi agent.

[0132] In some embodiments, the targeting group is linked to the SOD1 RNAi agent without using an additional linker. In some embodiments, the targeting group is designed to have an easily present linker to facilitate linkage to the SOD1 RNAi agent. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents can be linked to their respective targeting groups using the same linker. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.

[0133] In some embodiments, the linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group, a pharmacokinetic modulator, a delivery polymer, or a delivery vehicle. The linking group can be linked to the 3' and / or 5' end of the sense strand or the antisense strand of the RNAi agent. In some embodiments, the linking group is linked to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to, reactive groups such as C6-SS-C6, 6-SS-6, primary amines (e.g., NH2-C6) and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, groups functionalized with trialkynes, ribitol, and / or PEG groups. Examples of specific linking groups are shown in 11.

[0134] A linker or a linking group is a connection between two atoms that links a chemical group (such as an RNAi agent) or a segment of interest to another chemical group (such as a targeting group, a pharmacokinetic modulator, or a delivery polymer) or a segment of interest via one or more covalent bonds. Labile linkages include labile bonds. The linkage can optionally include a spacer that widens the distance between two bonded atoms. The spacer can further add flexibility and / or length to the linkage. Examples of spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and carbohydrates. Spacer groups are well known in the art, and the foregoing list is not meant to limit the scope of this specification. In some embodiments, the SOD1 RNAi agent is conjugated to a polyethylene glycol (PEG) moiety or a hydrophobic group having 12 or more carbon atoms such as a cholesterol or palmitoyl group.

[0135] In some embodiments, the SOD1 RNAi agent is linked to one or more lipid PK / PD moieties (also referred to herein as "lipid moieties" or "PK / PD modulators"). The lipid PK / PD moieties can enhance the pharmacodynamic or pharmacokinetic properties of the RNAi agent. In some embodiments, the lipid moiety can be conjugated to the linker at the 3' or 5' end of the sense or antisense strand of the RNAi agent described herein. In some embodiments, the lipid moiety can be linked at both the 3' and 5' ends of either the sense or antisense strand of the RNAi agent described herein.

[0136] In some embodiments, the lipid moiety can be conjugated to the SOD1 RNAi agent by reacting the SOD1 RNAi agent with an amine-containing linker, such as (NH2-C6) (see Table 11). In some embodiments, the amine-containing linker can be located at the 5' end of the sense strand or the antisense strand of the SOD1 RNAi agent. In some embodiments, the amine-containing linker can be located at the 3' end of the sense strand or the antisense strand of the RNAi agent.

[0137] In some embodiments, an RNAi agent containing an amine-containing linker, such as (NH2-C6) or (NH2-C6)s, may be reacted with a lipid containing an activated ester moiety. Examples of lipids having an activated ester moiety include LP183-p, LP283-p, LP293-p, LP304-p, LP310-p, LP383-p, LP395-p, and LP396-p shown in Table 11 below.

[0138] In some embodiments, the SOD1 RNAi agent can be conjugated to the lipid moiety using phosphoramidite synthesis. The synthesis of oligonucleotides using phosphoramidites is well known in the art. In some embodiments, the lipid moiety can be conjugated to the 5' end of the sense strand or the antisense strand of the SOD1 RNAi agent using phosphoramidite. In some embodiments, the lipid moiety can be conjugated to the 3' end of the sense strand or the antisense strand of the SOD1 RNAi agent using phosphoramidite. In some embodiments, phosphoramidites selected from (2C8C12)-p, (2C6C10)-p, LP429 phosphoramidite, HO-C16-p, C16-p, or C22-p, all of which are shown in Table 11 below, can be used to conjugate the lipid moiety to the SOD1 RNAi agent.

[0139] In some embodiments, the SOD1 RNAi agent may contain a lipid moiety on an internal nucleotide (i.e., not at the 3' or 5' terminal nucleotide). In some embodiments, the internal nucleotide may be linked at the 2' position of the ribose. In some embodiments, the SOD1 RNAi agent may include aC16, uC16, cC16, or gC16 as shown in Table 11 below.

[0140] Any of the nucleotide sequences of the SOD1 RNAi agents listed in Tables 2, 3, 4, 5, 6, and 10, whether modified or unmodified, can contain (one or more) 3' and / or 5' targeting groups, (one or more) linking groups, and / or a lipid PK / PD modulator. Any of the sequences of the SOD1 RNAi agents listed in Tables 3, 4, 5, 6, and 10, or otherwise described herein, that contain a 3' or 5' targeting group, a linking group, and / or a lipid PK / PD moiety, can alternatively not contain a 3' or 5' targeting group, a linking group, or a lipid PK / PD moiety, or can contain different 3' or 5' targeting groups, linking groups, or lipid PK / PD moieties including, but not limited to, those depicted in Table 11. Any of the SOD1 RNAi agent duplexes listed in Tables 7A, 7B, 8, 9, and 10, whether modified or unmodified, can further include a targeting group, a linking group, or a PK / PD moiety including, but not limited to, those depicted in Table 11, and the targeting group, linking group, or PK / PD moiety can be attached to the 3' or 5' end of either the sense or antisense strand of the SOD1 RNAi agent duplex.

[0141] Examples of specific modified nucleotides, capping moieties, lipid moieties, and linking groups are shown in Table 11.

[0142]

Table 13-1

Table 13-2

Table 13-3

Table 13-4

Table 13-5

Table 13-6

Table 13-7

Table 13-8

Table 13-9

Table 13-10

Table 13-11

Table 13-12

Table 13-13

Table 13-14

Table 13-15

Table 13-16

Table 13-17

Table 13-18

Table 13-19

Table 13-20

Table 13-21

[0143] Alternatively, other linking groups known in the art can also be used. In many cases, the linking group can be commercially available or incorporated into commercially available nucleotide phosphoramidites (see, for example, International Patent Application Publication No. 2019 / 161213, which is incorporated herein by reference in its entirety).

[0144] In some embodiments, the SOD1 RNAi agent is delivered without being conjugated to a targeting ligand or a pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as “naked” or “naked RNAi agent”).

[0145] In some embodiments, the SOD1 RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate delivery of the SOD1 RNAi agent to selected cells or tissues in vivo, such as epithelial cells. In some embodiments, the SOD1 RNAi agent is conjugated to a lipid moiety.

[0146] In some embodiments, the delivery vehicle can be used to deliver the RNAi agent to cells or tissues. The delivery vehicle is a compound that improves the delivery of the RNAi agent to cells or tissues. The delivery vehicle can include, or consist of, but is not limited to, polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLP), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines.

[0147] In some embodiments, the RNAi agent can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art for nucleic acid delivery. The RNAi agent can also be chemically conjugated to targeting groups, lipids (including but not limited to cholesteryl and cholesteryl derivatives), encapsulated in nanoparticles, liposomes, micelles, by iontophoresis, or by other delivery vehicles or delivery systems available in the art such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors (e.g., see International Publication Nos. WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference) to polymers or DPCs. In some embodiments, the RNAi agent can be conjugated to an antibody having an affinity for CNS cells. In some embodiments, the RNAi agent can be linked to a targeting ligand having an affinity for CNS cells or receptors present on CNS cells. Pharmaceutical Compositions and Formulations

[0148] The SOD1 RNAi agents disclosed herein can be formulated as a pharmaceutical composition or formulation (also referred to as a pharmaceutical preparation or drug product). In some embodiments, the pharmaceutical composition comprises at least one SOD1 RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of SOD1 mRNA in target cells, cell populations, tissues, or organisms. The pharmaceutical composition can be used to treat a subject having a disease, disorder, or condition that would benefit from a decrease in the level of the target mRNA or inhibition of the expression of the target gene. The pharmaceutical composition can be used to treat a subject at risk of developing a disease or disorder that would benefit from a decrease in the level of the target mRNA or inhibition of the expression of the target gene. In one embodiment, the method of the invention comprises administering to a subject in need thereof an SOD1 RNAi agent linked to a PK / PD modulator described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) can be added to the pharmaceutical composition comprising the SOD1 RNAi agent, thereby forming a pharmaceutical preparation or drug product suitable for in vivo delivery to a subject, including a human.

[0149] The pharmaceutical compositions and methods comprising an SOD1 RNAi agent disclosed herein decrease the level of a target mRNA in a cell, cell population, tissue, organ, or subject, such as by administering to the subject a therapeutically effective amount of the SOD1 RNAi agent described herein, thereby inhibiting the expression of SOD1 mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed as having a disease or disorder that can be mediated, at least in part, by a decrease in SOD1 expression. In some embodiments, the subject has been previously diagnosed as suffering from one or more neurodegenerative diseases such as ALS or Alzheimer's disease. In some embodiments, the neurodegenerative disease is ALS.

[0150] In some embodiments, the subject has been previously diagnosed as suffering from a neurodegenerative disease.

[0151] Embodiments of the present disclosure include pharmaceutical compositions for delivering an SOD1 RNAi agent to CNS cells in vivo. Such pharmaceutical compositions can include, for example, an SOD1 RNAi agent conjugated to a lipid moiety.

[0152] In some embodiments, a pharmaceutical composition comprising the described SOD1 RNAi agent is used to treat or manage clinical symptoms in a subject who would benefit from inhibition of SOD1 expression. In some embodiments, a therapeutically effective amount or a prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, any administration of the disclosed SOD1 RNAi agent can be used to reduce the number, severity, and / or frequency of symptoms of a disease in a subject.

[0153] In some embodiments, the described SOD1 RNAi agent is optionally used in combination with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent can be another SOD1 RNAi agent (e.g., an SOD1 RNAi agent targeting a different sequence within the SOD1 gene). In some embodiments, the second therapeutic agent can be an RNAi agent targeting the SOD1 gene. The additional therapeutic agent can also be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. The SOD1 RNAi agent can form a pharmaceutical composition in combination with one or more excipients, with or without one or more additional therapeutic agents.

[0154] A pharmaceutical composition comprising the described SOD1 RNAi agent can be used to treat at least one symptom of a disease or disorder in a subject who would benefit from a decrease or inhibition of SOD1 mRNA expression. In some embodiments, a subject is administered a therapeutically effective amount of a pharmaceutical composition comprising one or more SOD1 RNAi agents, whereby the symptoms are treated. In other embodiments, a subject is administered a prophylactically effective amount of one or more SOD1 RNAi agents, whereby at least one symptom is prevented or inhibited.

[0155] In some embodiments, one or more of the described SOD1 RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0156] The route of administration is a route that brings the SOD1 RNAi agent into contact with the body. Generally, methods for administering drugs, oligonucleotides, and nucleic acids, including the CNS, for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The SOD1 RNAi agents disclosed herein can be administered via any suitable route in a formulation appropriately adapted to the particular route. Thus, in some embodiments, the pharmaceutical compositions described herein are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration. In some embodiments, the pharmaceutical composition can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intracerebroventricularly, intraarticularly, intravitreally, or intraperitoneally, or topically.

[0157] Pharmaceutical compositions containing the SOD1 RNAi agents described herein can be delivered to cells, groups of cells, tissues, or subjects using oligonucleotide delivery techniques known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical application), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes (including intracranial (e.g., intracerebroventricular, parenchymal, and intrathecal)), intracerebroventricular, intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical surface (including buccal and sublingual) administration. In some embodiments, the composition is administered by inhalation, intranasal administration, oropharyngeal aspiration, or intratracheal administration. For example, in some embodiments, it is desirable for the SOD1 RNAi agents described herein to inhibit the expression of the SOD1 gene in the CNS.

[0158] In some embodiments, the pharmaceutical compositions described herein include one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0159] As used herein, a pharmaceutical composition includes a pharmacologically effective amount of at least one described therapeutic compound and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., SOD1 RNAi agent) intentionally included in a drug delivery system. An excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. Excipients can act to a) assist in the processing of the drug delivery system during manufacture, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) aid in the identification of the product, and / or d) enhance other optional attributes of the overall safety and effectiveness of the delivery of the API during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.

[0160] Excipients include, but are not limited to, absorption enhancers, anti-adhesives, anti-foaming agents, antioxidants, binders, buffers, carriers, coating agents, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavorants, flow enhancers, humectants, lubricants, oils, polymers, preservatives, physiological saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

[0161] Suitable pharmaceutical compositions for use by injection include sterile aqueous solutions (where water-soluble), dispersions, and sterile powders for the immediate preparation of sterile injection solutions or dispersions. In the case of intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). They should be stable under the conditions of manufacture and storage and should be protected against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by the use of coatings such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it will be preferable to include in the composition isotonic agents such as sugars, polyalcohols such as mannitol and sorbitol, and sodium chloride. Sustained absorption of the injectable composition can be brought about by including in the composition agents that delay absorption, such as aluminum monostearate and gelatin.

[0162] Sterile injection solutions can be prepared by incorporating the active compound in the required amount into a suitable solvent with one or a combination of the ingredients enumerated above and, if necessary, subsequently filtering the solution sterile. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injection solutions, the methods of preparation include vacuum drying and freeze-drying, from which powders of the active ingredient and any additional desired ingredients are obtained from a previously sterile-filtered solution.

[0163] Formulations suitable for intra-articular administration can be in the form of sterile aqueous formulations of the drug, which can be in the form of microcrystalline suspensions, for example, aqueous microcrystalline suspensions. Liposomal formulations or biodegradable polymer systems can also be used to deliver the drug for both intra-articular and ophthalmic administration.

[0164] The active compound can be prepared using a carrier that will protect the compound from rapid elimination from the body, such as a controlled release formulation including an implant and a microencapsulated delivery system. Biodegradable and biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811.

[0165] The SOD1 RNAi agent can be formulated into a composition in unit dosage form so as to be easy to administer and have a uniform dosage. The unit dosage form means a physically discrete unit suitable as a single dosage for the subject to be treated, and each unit contains a predetermined amount of the active compound calculated to produce the desired therapeutic effect in association with the necessary pharmaceutical carrier. The specification of the unit dosage form of the present disclosure is determined by and directly depends on the unique properties of the active compound and the therapeutic effect to be achieved, as well as the limitations inherent in the art of formulating such active compounds for the treatment of individuals.

[0166] The pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, anti-itch agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). It is also contemplated that cells, tissues, or isolated organs that express or contain the RNAi agent as defined herein can be used as a "pharmaceutical composition". As used herein, "pharmacologically effective amount", "therapeutically effective amount", or simply "effective amount" means the amount of the RNAi agent to produce a pharmacological, therapeutic, or prophylactic result.

[0167] In some embodiments, the SOD1 RNAi agent pharmaceutical composition may contain salts such as sodium chloride, calcium chloride, magnesium chloride, potassium chloride, disodium hydrogen phosphate, sodium dihydrogen phosphate, or combinations thereof.

[0168] In some embodiments, the methods disclosed herein further include administering a second therapeutic agent or treatment in addition to administering the RNAi agents disclosed herein. In some embodiments, the second therapeutic agent is another SOD1 RNAi agent (e.g., an SOD1 RNAi agent targeting a different sequence within the SOD1 target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0169] In some embodiments, compositions are described herein that include a combination or cocktail of at least two SOD1 RNAi agents having different sequences. In some embodiments, two or more SOD1 RNAi agents are each separately and independently linked to a lipid.

[0170] Compositions for delivering an SOD1 RNAi agent to central nervous system (CNS) cells are described herein. Further, compositions for in vivo delivery of an SOD1 RNAi agent to cells including neurons, astrocytes, microglia, and endothelial cells are described herein in their entirety.

[0171] Generally, the effective amount of the SOD1 RNAi agent disclosed herein will be in the range of a dosage of about 0.0001 to about 20 mg / kg body weight, for example, a dosage of about 0.001 to about 5 mg / kg body weight. In some embodiments, the effective amount of the SOD1 RNAi agent will be in the range of a dosage of about 0.01 mg / kg to about 3.0 mg / kg body weight. In some embodiments, the effective amount of the SOD1 RNAi agent will be in the range of a dosage of about 0.03 mg / kg to about 2.0 mg / kg body weight. In some embodiments, the effective amount of the SOD1 RNAi agent will be in the range of about 0.01 to about 1.0 mg / kg. In some embodiments, the effective amount of the SOD1 RNAi agent will be in the range of about 0.50 to about 1.0 mg / kg. In some embodiments, a fixed dosage of the SOD1 RNAi agent is administered to the subject. In some embodiments, the dosage administered to a human subject is about 1.0 mg to about 750 mg. In some embodiments, the dosage of the SOD1 RNAi agent administered to the subject is about 10 mg to about 450 mg. In some embodiments, the dosage of the SOD1 RNAi agent administered to the subject is about 25 mg to about 450 mg. In some embodiments, the dosage of the SOD1 RNAi agent administered to the subject is about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, or about 450 mg. The amount administered will also likely depend on variables such as the overall health of the patient, the relative biological efficacy of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. Also, it should be understood that the initial dosage administered can be increased above the upper limit levels in order to rapidly achieve the desired blood or tissue levels, or the initial dosage can be less than the optimal dosage. In some embodiments, the administration is performed daily. In some embodiments, the administration is performed weekly. In further embodiments, the administration is performed once every two weeks, once every three weeks, once a month, or once a quarter (i.e., once every three months).

[0172] For the treatment of a disease or for the formation of a pharmaceutical or composition for treating a disease, the pharmaceutical composition described herein comprising an SOD1 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to, a second RNAi agent, small molecule drug, antibody, antibody fragment, peptide, and / or aptamer.

[0173] The described SOD1 RNAi agent can be packaged in a kit, container, pack, or dispenser when added to a pharmaceutically acceptable excipient or adjuvant. Methods of Treatment and Inhibition of SOD1 Gene Expression

[0174] The SOD1 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) suffering from a disease or disorder that would benefit from administration of an RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from a decrease in the expression and / or inhibition of SOD1 mRNA and / or a decrease in SOD1 enzyme levels.

[0175] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) suffering from a disease or disorder that would benefit from a decrease in mutant SOD1 enzyme levels, including, but not limited to, ALS and Alzheimer's disease. Treatment of the subject can include curative and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more of the described SOD1 RNAi agents. The subject can be a human, patient, or human patient. The subject can be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein can be to a human or an animal.

[0176] It is known that mutant SOD1 activity promotes neurodegenerative disorders. In some embodiments, the described SOD1 RNAi agents are used to treat at least one symptom mediated, at least in part, by a decrease in mutant SOD1 enzyme levels in a subject. The subject is administered a therapeutically effective amount of any one or more of the described SOD1 RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting at least one symptom.

[0177] In certain embodiments, the present disclosure provides a method for the treatment of a disease, disorder, condition, or pathological state mediated, at least in part, by SOD1 gene expression in a patient in need thereof, the method comprising administering to the patient any of the SOD1 RNAi agents described herein.

[0178] In some embodiments, the SOD1 RNAi agent is used to treat or manage a clinical symptom or pathological condition in a subject, the clinical symptom or pathological condition being mediated, at least in part, by a decrease in SOD1 gene expression. The subject is administered a therapeutically effective amount of one or more of the SOD1 RNAi agents or SOD1 RNAi agent-containing compositions described herein. In some embodiments, the method of the invention comprises administering a composition comprising the SOD1 RNAi agent described herein to a subject to be treated.

[0179] In a further aspect, the present disclosure provides a method for treating (including prophylactic treatment) a disease or symptom that can be addressed by a decrease in SOD1 protein and / or enzyme levels, the method comprising administering to a subject in need thereof an SOD1 RNAi agent comprising an antisense strand comprising any of the sequences of Table 2, Table 3, or Table 10. Further, compositions for use in such methods are described herein.

[0180] The described SOD1 RNAi agent and / or composition containing the SOD1 RNAi agent can be used in a method for the curative treatment of diseases or conditions caused by an enhancement or increase in SOD1 protein and / or enzyme activity level. Such a method includes administration of the SOD1 RNAi agent described herein to a subject, such as a human or animal subject.

[0181] In another aspect, the present disclosure provides a method for the treatment (including prophylactic treatment) of a pathological condition (such as a disease state or disorder) at least partially mediated by SOD1 gene expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising an antisense strand containing any of the sequences of Table 2, Table 3, or Table 10.

[0182] In some embodiments, a method for inhibiting the expression of the SOD1 gene is disclosed herein, the method comprising administering to a cell an RNAi agent comprising an antisense strand containing any of the sequences of Table 2, Table 3, or Table 10.

[0183] In some embodiments, a method for the treatment (including prophylactic treatment) of a pathological condition at least partially mediated by SOD1 expression is disclosed herein, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand containing any of the sequences of Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0184] In some embodiments, a method for inhibiting the expression of the SOD1 gene is disclosed herein, the method comprising administering to a cell an RNAi agent comprising a sense strand containing any of the sequences of Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0185] In some embodiments, a method for the treatment (including prophylactic treatment) of a pathological condition mediated at least in part by SOD1 expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences of Table 4, Table 5, Table 6, Table 6a, or Table 10, and an antisense strand comprising any of the sequences of Table 3 or Table 10, is disclosed herein.

[0186] In some embodiments, a method for inhibiting the expression of the SOD1 gene, the method comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences of Table 4, Table 5, Table 6, Table 6a, or Table 10, and an antisense strand comprising any of the sequences of Table 3 or Table 10, is disclosed herein.

[0187] In some embodiments, a method for inhibiting the expression of the SOD1 gene, the method comprising administering to a subject an SOD1 RNAi agent comprising a sense strand consisting of a nucleobase sequence consisting of any of the sequences of Table 4, Table 5, Table 6, Table 6a, or Table 10, and an antisense strand consisting of a nucleobase sequence of any of the sequences of Table 3 or Table 10, is disclosed herein. In other embodiments, a method for inhibiting the expression of the SOD1 gene, the method comprising administering to a subject an SOD1 RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences of Table 4, Table 5, Table 6, Table 6a, or Table 10, and an antisense strand consisting of a modified sequence of any of the modified sequences of Table 3 or Table 10, is disclosed herein.

[0188] In some embodiments, a method for inhibiting the expression of the SOD1 gene in a cell, the method comprising administering one or more SOD1 RNAi agents comprising a double-stranded structure of one of the double-strands described in Tables 7A, 7B, 8, 9A, and 10, is disclosed herein.

[0189] In some embodiments, the SOD1 gene expression level and / or the mRNA level of the SOD1 gene in a particular CNS cell of a subject to which the described SOD1 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to a subject before administration of the SOD1 RNAi agent or a subject not administered the SOD1 RNAi agent. In some embodiments, the SOD1 protein and / or enzyme level or the circulating SOD1 enzyme level in a particular CNS cell of a subject to which the described SOD1 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to a subject before administration of the SOD1 RNAi agent or a subject not administered the SOD1 RNAi agent. The gene expression level, protein level, and / or mRNA level of the subject can be reduced in the cells, groups of cells, and / or tissues of the subject. In some embodiments, the SOD1 mRNA level in a particular CNS cell subject administered the described SOD1 RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to a subject before administration of the SOD1 RNAi agent or another subject not administered the SOD1 RNAi agent.

[0190] The reduction in gene expression, mRNA, and protein levels can be evaluated by any method known in the art. The reduction or decrease in the SOD1 protein and / or enzyme level is collectively referred to as a decrease, reduction, or inhibition of SOD1 gene expression. The examples described herein illustrate known methods for evaluating the inhibition of SOD1 gene expression, including, but not limited to, measuring the SOD1 enzyme level. Cells, Tissues, Organs, and Non-Human Organisms

[0191] Cells, tissues, organs, and non-human organisms containing at least one of the SOD1 RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is produced by delivering the RNAi agent to the cell, tissue, organ, or non-human organism. Further Exemplary Embodiments

[0192] Here, certain further exemplary embodiments of the disclosed technology are provided. These embodiments are merely exemplary and do not limit the scope of the present disclosure or the scope of the claims appended hereto.

[0193] Embodiment 1. An RNAi agent for inhibiting the expression of superoxide dismutase 1 (SOD1) gene, comprising: An antisense strand comprising at least 17 consecutive nucleotides that differ from any one of the sequences shown in Table 2 or Table 3 by 0 or 1 nucleotide; and A sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand, wherein the RNAi agent comprises the above.

[0194] Embodiment 2. The RNAi agent according to Embodiment 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences shown in Table 2 or Table 3.

[0195] Embodiment 3. The RNAi agent according to Embodiment 1 or Embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 consecutive nucleotides that differ from any one of the sequences shown in Table 2 or Table 4 by 0 or 1 nucleotide, and the sense strand has a region of at least 85% complementarity to the antisense strand over 17 consecutive nucleotides.

[0196] Embodiment 4. The RNAi agent according to any one of Embodiments 1-3, wherein at least one nucleotide of the SOD1 RNAi agent is a modified nucleotide or comprises a modified nucleoside linkage.

[0197] Embodiment 5. An RNAi agent according to any one of Embodiments 1 to 4, wherein all or substantially all of the nucleotides are modified nucleotides.

[0198] Embodiment 6. An RNAi agent according to any one of Embodiments 4 to 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2',3'-seco nucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2'-O-methyl nucleotide, inverted 2'-deoxy nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3'-O-methyl nucleotide.

[0199] Embodiment 7. The RNAi agent of Embodiment 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotide, 2'-fluoro nucleotide, or a combination thereof.

[0200] Embodiment 8. An RNAi agent according to any one of Embodiments 1 to 7, wherein the antisense strand contains the nucleotide sequence of any one of the modified sequences shown in Table 3.

[0201] Embodiment 9. An RNAi agent according to any one of Embodiments 1 to 8, wherein the sense strand contains the nucleotide sequence of any one of the modified sequences shown in Table 4.

[0202] Embodiment 10. The RNAi agent of Embodiment 1, wherein the antisense strand contains the nucleotide sequence of any one of the modified sequences shown in Table 3, and the sense strand contains the nucleotide sequence of any one of the modified sequences shown in Table 4.

[0203] Embodiment 11. An RNAi agent according to any one of Embodiments 1 to 10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

[0204] Embodiment 12. The RNAi agent of Embodiment 11, wherein the sense strand and the antisense strand each have a length of 18 to 27 nucleotides.

[0205] Embodiment 13. The RNAi agent of Embodiment 12, wherein the sense strand and the antisense strand each have a length of 18 to 24 nucleotides.

[0206] Embodiment 14. The RNAi agent of Embodiment 13, wherein the sense strand and the antisense strand each have a length of 21 nucleotides.

[0207] Embodiment 15. The RNAi agent of Embodiment 14, wherein the RNAi agent has two blunt ends.

[0208] Embodiment 16. The RNAi agent according to any one of Embodiments 1 to 15, wherein the sense strand contains one or two terminal caps.

[0209] Embodiment 17. The RNAi agent according to any one of Embodiments 1 to 16, wherein the sense strand contains one or two inverted deoxyribonucleotide residues.

[0210] Embodiment 18. The RNAi agent of Embodiment 1, wherein the RNAi agent is composed of a sense strand and an antisense strand that form a double strand having the structure of any one of Table 7A, Table 7B, Table 8, Table 9A, or Table 10.

[0211] Embodiment 19. The RNAi agent of Embodiment 18, wherein all or substantially all of the nucleotides are modified nucleotides.

[0212] Embodiment 20. The following nucleotide sequences (5’→3’): UGAUAGAGGAUUAAAGUGA (SEQ ID NO: 54); UAGGAUAACAGAUGAGUUA (SEQ ID NO: 59); UGAGAUCACAGAAUCUUCA (SEQ ID NO: 64); UGAUAGAGGAUUAAAGUGAGG (SEQ ID NO: 1084); UAGGAUAACAGAUGAGUUAAG (SEQ ID NO: 1090); or UGAGAUCACAGAAUCUUCAAC (SEQ ID NO: 1105), and an antisense strand consisting of a nucleotide sequence that differs by 0 or 1 nucleotide, an antisense strand consisting essentially of a nucleotide sequence that differs by 0 or 1 nucleotide, or an antisense strand containing a nucleotide sequence that differs by 0 or 1 nucleotide, the RNAi agent of Embodiment 1.

[0213] Embodiment 21. The sense strand has the following nucleotide sequence (5’→3’): UCACUUUAAUCCUCUAUCA (SEQ ID NO: 288); UAACUCAUCUGUUAUCCUA (SEQ ID NO: 293); GUUGAAGAUUCUGUGAUCU (SEQ ID NO: 298); CCUCACUUUAAUCCUCUAUCA (SEQ ID NO: 1151); CUUAACUCAUCUGUUAUCCUA (SEQ ID NO: 1157); or GUUGAAGAUUCUGUGAUCUCA (SEQ ID NO: 1172), and one of the following, consisting of a nucleotide sequence that differs by 0 or 1 nucleotide, consisting essentially of a nucleotide sequence that differs by 0 or 1 nucleotide, or containing a nucleotide sequence that differs by 0 or 1 nucleotide, the RNAi agent of Embodiment 20.

[0214] Embodiment 22. The RNAi agent of Embodiment 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides.

[0215] Embodiment 23. The following nucleotide sequence (5’→3’): cPrpusGfsasuagAfggAfuUfaAfaGfugagsg (SEQ ID NO: 578); cPrpusGfsasuagA UNA ggAfuUfaAfaGfugagsg (SEQ ID NO: 613); cPrpuAfgGfauaacagAfuGfaGfuuaassg (SEQ ID NO: 589); or cPrpusGfsaGfaucacagAfaUfcUfucasasc (SEQ ID NO: 646), and an antisense strand comprising a modified nucleotide sequence that differs by 0 or 1 nucleotide, an antisense strand consisting of a modified nucleotide sequence that differs by 0 or 1 nucleotide, or an antisense strand consisting essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide; wherein in the sequence, a, c, g, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpu represents 5'-phosphonate cyclopropyl-2'-O-methyluridine; s represents a phosphorothioate bond; A UNA represents 2',3'-seco-adenosine-3'-phosphate; and all or substantially all of the nucleotides of the sense strand are modified nucleotides, the RNAi agent of Embodiment 1.

[0216] Embodiment 24. The sense strand has the following nucleotide sequence (5'→3'): ccucacuuUfAfAfuccucuauca (SEQ ID NO: 685); cuuaacucAfUfCfuguuauccua (SEQ ID NO: 691); or guugaagaUfuCfuGfugaucuca (SEQ ID NO: 771), and comprises a modified nucleotide sequence that differs by 0 or 1 nucleotide, consists of a modified nucleotide sequence that differs by 0 or 1 nucleotide, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide; In the array, a, c, g, i, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; s represents a phosphorothioate bond; and all or substantially all of the nucleotides of the antisense strand are modified nucleotides, the RNAi agent of Embodiment 1.

[0217] Embodiment 25. The RNAi agent according to any one of Embodiments 20 to 24, wherein the sense strand further comprises a reverse abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both ends.

[0218] Embodiment 26. The RNAi agent according to any one of Embodiments 1 to 25, wherein the RNAi agent is linked to a lipid moiety.

[0219] Embodiment 27. The lipid moiety is as follows:

Table 14-1

Table 14-2

Table 14-3

Table 14-4

Table 14-5

Table 14-6

Table 14-7

Table 14-8

Chemical formula

[0220] Embodiment 28. The RNAi agent according to Embodiment 26 or Embodiment 27, wherein the lipid moiety is conjugated to the sense strand.

[0221] Embodiment 29. The RNAi agent according to Embodiment 28, wherein the lipid moiety is conjugated to the 5'-end of the sense strand.

[0222] Embodiment 30. A composition comprising the RNAi agent according to any one of Embodiments 1 to 29, further comprising a pharmaceutically acceptable excipient.

[0223] Embodiment 31. The composition according to Embodiment 30, further comprising a second RNAi agent capable of inhibiting the expression of superoxide dismutase 1 gene expression.

[0224] Embodiment 32. The composition according to any one of Embodiments 30 to 31, further comprising one or more additional therapeutic agents.

[0225] Embodiment 33. The composition according to any one of Embodiments 30 to 32, wherein the RNAi agent is a sodium salt.

[0226] Embodiment 34. The composition according to any one of Embodiments 30 to 33, wherein the pharmaceutically acceptable excipient is water for injection.

[0227] Embodiment 35. The composition according to any one of Embodiments 30 to 33, wherein the pharmaceutically acceptable excipient is buffered physiological saline.

[0228] Embodiment 36. A composition according to any one of Embodiments 30 to 35, wherein the pharmaceutically acceptable excipient contains sodium chloride, calcium chloride, magnesium chloride, potassium chloride, disodium hydrogen phosphate, sodium dihydrogen phosphate, or a combination thereof.

[0229] Embodiment 37. A method for inhibiting the expression of the SOD1 gene in a cell, the method comprising introducing an effective amount of the RNAi agent according to any one of Embodiments 1 to 29 or the composition according to any one of Embodiments 30 to 36 into the cell.

[0230] Embodiment 38. The method of Embodiment 37, wherein the cell is present in a subject.

[0231] Embodiment 39. The method of Embodiment 38, wherein the subject is a human subject.

[0232] Embodiment 40. Any one method of Embodiments 37 to 39, wherein the expression of the superoxide dismutase 1 (SOD1) gene is inhibited by at least about 30% after administration of the RNAi agent.

[0233] Embodiment 41. A method for treating one or more symptoms or diseases associated with an increase or elevation in the level of mutant SOD1 activity, the method comprising administering a therapeutically effective amount of the composition according to any one of Embodiments 30 to 36 to a human subject in need thereof.

[0234] Embodiment 42. The method of Embodiment 39, wherein the disease is a neurodegenerative disease.

[0235] Embodiment 43. The method of Embodiment 40, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or Alzheimer's disease.

[0236] Embodiment 44. The method of Embodiment 41, wherein the disease is ALS.

[0237] Embodiment 45. The method of Embodiment 42, wherein the disease is SOD1-related familial ALS.

[0238] Embodiment 46. The method according to any one of Embodiments 37 to 45, wherein the RNAi agent is administered at a dosage of about 0.01 mg / kg to about 5.0 mg / kg per body weight of the subject.

[0239] Embodiment 47. The method according to any one of Embodiments 37 to 46, wherein the RNAi agent is administered at a dosage of about 0.03 mg / kg to about 2.0 mg / kg per body weight of the subject.

[0240] Embodiment 48. The method according to any one of Embodiments 37 to 45, wherein the RNAi agent is administered at a fixed dosage of about 25 mg to about 450 mg.

[0241] Embodiment 49. The method according to Embodiment 48, wherein the RNAi agent is administered at a dosage of about 25 mg, about 50 mg, about 150 mg, or about 450 mg.

[0242] Embodiment 50. The method according to any one of Embodiments 37 to 49, wherein the RNAi agent is administered in two or more administrations.

[0243] Embodiment 51. Use of an RNAi agent according to any one of Embodiments 1 to 29 for the treatment of a disease, disorder, or condition mediated at least in part by mutant SOD1 activity and / or SOD1 gene expression.

[0244] Embodiment 52. Use of a composition according to any one of Embodiments 30 to 36 for the treatment of a disease, disorder, or condition mediated at least in part by superoxide dismutase 1 (SOD1) activity and / or superoxide dismutase 1 (SOD1) gene expression.

[0245] Embodiment 53. Use of a composition according to any one of Embodiments 30 to 36 for the manufacture of a medicament for the treatment of a disease, disorder, or condition mediated at least in part by superoxide dismutase 1 (SOD1) and / or superoxide dismutase 1 (SOD1) gene expression.

[0246] Use according to any one of Embodiments 51 to 53, wherein the disease is a neurodegenerative disease.

[0247] A method for producing an RNAi agent according to any one of Embodiments 1 to 29, comprising annealing the sense strand and the antisense strand to form a double-stranded ribonucleic acid molecule.

[0248] The method according to Embodiment 55, wherein the sense strand contains a lipid moiety.

[0249] The method according to Embodiment 55, comprising conjugating the lipid moiety to the sense strand.

Examples

[0250] Example 1. Synthesis of SOD1 RNAi agent

[0251] The SOD1 RNAi agent double strand disclosed in this specification was synthesized as follows:

[0252] A. Synthesis The sense strand and the antisense strand of the SOD1 RNAi agent were synthesized according to the phosphoramidite technology on a solid phase used for oligonucleotide synthesis. Depending on the scale, MerMade96E (registered trademark) (Bioautomation), MerMadel2 (registered trademark) (Bioautomation), or OP Pilot100 (GE Healthcare) was used. The synthesis was carried out on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used included the following: (5'-O-dimethoxytrityl-N 6-(Benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(Acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5'-O-dimethoxytrityl-N 2 -(Isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. 2'-Deoxy-2'-fluoro-phosphoramidite had the same protecting groups as 2'-O-methyl RNA amidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia). Inverted deoxy base (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N 6-(Benzoyl)-2’,3’-seco-adenosine, 2’-benzoyl-3’-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5’-(4,4’-dimethoxytrityl)-N-acetyl-2’,3’-seco-cytidine, 2’-benzoyl-3’-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5’-(4,4’-dimethoxytrityl)-N-isobutyryl-2’,3’-seco-guanosine, 2’-benzoyl-3’-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5’-(4,4’-dimethoxy-trityl)-2’,3’-seco-uridine, 2’-benzoyl-3’-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. TFA amino-link phosphoramidite was also purchased commercially (ThermoFisher). Linker L6 was purchased from BroadPharm as propargyl-PEG5-NHS (catalog number BP-20907) and coupled to the NH2-C6 group of the amino-link phosphoramidite using standard coupling conditions to form -L6-C6-. Linker Alk-cyHex was similarly purchased commercially (alkyne phosphoramidite, 5’-end) from Lumiprobe as a propargyl-containing compound phosphoramidite compound to form linker -Alk-cyHex-. In both cases, phosphorothioate linkages were introduced as specified using the conditions described herein. Cyclopropylphosphonic acid phosphoramidite was synthesized according to International Patent Application Publication No. 2017 / 214112 (see also Altenhofer et. al., Chem. Communications (Royal Soc. Chem.), 57(55): 6808-6811 (July 2021)).

[0253] The trialquin-containing phosphoramidite was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while the other amidite was dissolved in anhydrous acetonitrile (50 mM), and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. The coupling times were 10 minutes (RNA), 90 seconds (2’O-Me), and 60 seconds (2’F). To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0254] Alternatively, the trialkyne moiety was introduced after synthesis (see Section E below). In this route, the sense strand was functionalized with 5’ and / or 3’ terminal nucleotides containing a primary amine. The TFA amino-link phosphoramidite was dissolved in anhydrous acetonitrile (50 mM), and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. The coupling times were 10 minutes (RNA), 90 seconds (2’O-Me), and 60 seconds (2’F). To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0255] B. Cleavage and Deprotection of the Oligomer Bound to the Support After completion of the solid-phase synthesis, the dried solid support was treated at 30 °C for 1.5 hours with a 1:1 volume solution of 40 wt% methylamine in water and 28% - 31% ammonium hydroxide solution (Aldrich). The solution was evaporated, and the solid residue was dissolved in water (see below).

[0256] C. Purification The crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% acetonitrile, and buffer B was the same as buffer A with 1.5 M sodium chloride added. The UV trace at 260 nm was recorded. The appropriate fractions were pooled and size-exclusion HPLC was performed using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 fine and a running buffer of 100 mM ammonium bicarbonate, pH 6.7, 20% acetonitrile or filtered water. Alternatively, the pooled fractions were desalted and exchanged into an appropriate buffer or solvent system via tangential flow filtration.

[0257] D. Annealing The complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1× PBS (phosphate-buffered saline, 1×, Corning, Cellgro) to form the RNAi agent. Some of the RNAi agent was lyophilized and stored at -15 to -25 °C. The concentration of the double-stranded product was determined by measuring the absorbance of the solution in 1× PBS using a UV-Vis spectrometer. The concentration of the double-stranded product was then calculated by multiplying the absorbance of the solution at 260 nm by the conversion factor (0.050 mg / (mL-cm)) and the dilution factor.

[0258] E. Lipid Synthesis

[0259] If the lipids described herein are not included in Example 1E, the compounds should be considered to be either commercially available or readily obtainable by contracting with the manufacturer of standard commercial products. For example, LP395p and LP396p were purchased commercially.

[0260] Synthesis of LP-183 Phosphoramidite

Chemical Structure

[0261] To a solution of Compound 2 (2.00 g) in DCM, TEA (2.27 mL) was added followed by dropwise addition of Compound 1 (4.931 g) at room temperature. The mixture was then stirred at room temperature for 2 hours. The mixture was then filtered. The white solid was dried overnight. The product, 4.267 g, 74% was obtained as a white solid. LC-MS: calculated [M+H] 356.35, found 356.63.

Chemical formula

[0262] To a mixture of Compound 1 (2.54 g) in 120 mL of DCM, Compound 3 (0.61 g) was added followed by dropwise addition of Compound 2 (5.37 g) at room temperature. The mixture was then stirred at room temperature overnight. 5 mL of TEA was added, followed by addition of celite. After removing the solvent in vacuo, the residue was loaded onto a 40 g column by dry method. The product was purified using a gradient from hexane (2% TEA) to 50% EtOAc (2% TEA) in hexane (2% TEA). The product is a white waxy solid, yield 3.462 g, 87%. LC-MS: calculated [M+H] 556.46, found 556.64.

[0263] Synthesis of LP-183r-p

Chemical formula

[0264] To a solution of Compound 1 (312 mg) in 10 mL of DCM, Compound 2 (299 mg) and EDC (498 mg) were added at room temperature. The reaction mixture was stirred at room temperature for 1 hour. After removing the solvent in vacuo, the residue was loaded onto a 12 g column in dry state. Hexane to EtOAc was used as the mobile phase. The product is a clear oil, 408 mg, 75% yield. LC-MS: calculated [M+H] 230.10, found 230.34.

Chemical formula

[0265] To a solution of compound 1 (408 mg) in 20 mL of DCM, compound 2 (516 mg) and TEA (0.745 mL) were added at room temperature. The reaction mixture was stirred overnight at room temperature. After removing the solvent in vacuo, the residue was recrystallized from MeOH. The product was a white solid, 555 mg, in 88% yield. LC-MS: calculated [M+H] 356.35, found 356.45.

Chemical formula

[0266] To a mixture of compound 1 (200 mg) in 10 mL of DCM, compound 3 (33.2 mg) was added dropwise at room temperature, followed by dropwise addition of compound 2 (339 mg). The mixture was then stirred overnight at room temperature. 1 mL of TEA was added, followed by some Celite®. After removing the solvent in vacuo, the residue was loaded dry onto a 4 g column. Hexane (2% TEA) to 50% EtOAc (2% TEA) in hexane (2% TEA) was used as the gradient mobile phase. The product was a white waxy solid, 95 mg, in 30% yield. LC-MS: calculated [M+H] 556.46, found 556.82.

[0267] Synthesis of LP232-p

Chemical formula

[0268] Palmitoyl chloride (100 mg) was stirred in a solution of cis-4-(boc-amino)cyclohexylamine (0.0819 g) in 5 mL of DCM. After stirring the suspension overnight, water was added and the organics were extracted with DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness and the crude product was then purified by column (from hexane to EtOAc). The product was 52 mg, 31%.

Chemical formula

[0269] To 1 (0.0520 g), 2 mL of dioxane:HCl (4N) was added until the boc deprotection was complete. After removing the solvent in vacuo, the residue was stirred in a solution of 2 (0.0316 g), DIPEA (0.0445 g) and COMU (0.0620 g) in 5 mL of DCM. After stirring the suspension overnight, water was added and the organics were extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness and then the crude product was purified by column (from DCM to 20% MeOH in DCM). The product was 45 mg, 65%.

Chemical formula

[0270] To 1 (0.0449 g), 2 mL of dioxane:HCl (4N) was added until the OtBu deprotection was complete. After removing the solvent in vacuo, the residue was stirred in a solution of 2 (0.0217 g), DIPEA (0.039 mL) and COMU (0.0425 g) in 5 mL of DCM. After stirring the suspension overnight, water was added and the organics were extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness and then the crude product was purified by column (from DCM to 20% MeOH in DCM). The product was 30 mg, 58%.

[0271] Synthesis of LP233-p

Chemical formula

[0272] Palmitic acid 1 (0.100 g) was stirred in a solution of 2 (0.0693 g), COMU (0.166 g) and DIPEA (0.16 mL) in 5 mL of DCM. After stirring the suspension overnight (heating at 40 °C), water was added and the organics were extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness and then the crude product was purified by column (from hexane to EtOAc). The product was 96 mg, 69%.

Chemical formula

[0273] To 1 (0.0955 g), 2 mL of dioxane:HCl (4N) was added until the boc deprotection was complete. After removing the solvent in vacuo, the residue was stirred in a solution of 2 (0.0581 g), DIPEA (0.11 mL) and COMU (0.114 g) in 5 mL of DCM. After stirring the suspension overnight, water was added and the organics were extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness and then the crude product was purified by column (from DCM to 20% MeOH in DCM). The product was 68 mg, 54%.

Chemical formula

[0274] To 1 (0.068 g), 2 mL of dioxane:HCl (4N) was added until the otBu deprotection was complete. After removing the solvent in vacuo, the residue was stirred in a solution of tetrafluorophenol (0.021 g), DIPEA (0.059 mL), and COMU (0.064 g) in 5 mL of DCM. After stirring the suspension overnight, water was added and the organics were extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness and then the crude product was purified by column (from DCM to 20% MeOH in DCM). The product was 22 mg, 28%.

[0275] Synthesis of LP242-p [Chemistry]

[0276] Palmitic acid (0.100 g) was stirred in a solution of tBu-3,9-diazaspiro[5,5]undecane-3-carboxylate HCl (0.073 g), COMU (0.166 g), and DIPEA (0.16 mL) in 5 mL of DCM. After the suspension was stirred overnight (heated at 40 °C), water was added, and the organics were extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness, and then the crude product was purified by flash chromatography. [Chemistry]

[0277] 1 (0.017 g) was treated with HCl:dioxane, and after 1 hour, the crude reaction was dried in vacuo. To this, a solution of 2 (0.0095 g), COMU (0.0186 g), and DIPEA (0.0134 g) in 5 mL of DCM was added. After the suspension was stirred, water was added, and the organics were extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness, and then the crude product was purified by flash chromatography. [Chemistry]

[0278] To 1 (0.121 g), 2 mL of dioxane:HCl (4 N) was added until the otBu deprotection was complete. After the solvent was removed in vacuo, crude 1 was stirred in a solution of tetrafluorophenol (0.0585 g), DIPEA (0.11 mL), and COMU (0.115 g) in 5 mL of DCM. After the suspension was stirred overnight, water was added, and the organics were extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness, and then the crude product was purified by flash chromatography.

[0279] Synthesis of LP243-p [Chemical formula]

[0280] Palmitic acid (0.100 g) was stirred in a solution of tBu-3,9-diazaspiro[5.5]undecane-3-carboxylate HCl (0.0732 g), COMU (0.166 g), and DIPEA (0.161 mL) in 5 mL of DCM. After stirring the suspension overnight (heating at 40 °C), water was added, and the organic matter was extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness, and then the crude product was purified by flash chromatography. [Chemical formula]

[0281] 1 (0.0200 g) was treated with HCl:dioxane, and after 1 hour, the crude reaction was dried in vacuo. To this was added a solution of 2 (0.0119 g), COMU (0.0232 g), and DIPEA (0.022 mL) in 5 mL of DCM. After stirring the suspension, water was added, and the organic matter was extracted using DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness, and then the crude product was purified by flash chromatography. [Chemical formula]

[0282] To 1 (0.121 g), 2 mL of dioxane:HCl (4N) was added until the otBu deprotection group was complete. After removing the solvent in vacuo, crude 1 was stirred in a solution of tetrafluorophenol (0.0363 g), DIPEA (0.104 mL) and COMU (0.112 g) in 5 mL of DCM. After stirring the suspension overnight, water was added and the organics were extracted with DCM and dried over Na2SO4. After filtration, the solvent was concentrated to dryness and the crude product was then purified by flash chromatography.

[0283] Synthesis of LP245-p

Chemical Structure

[0284] To a mixture of 1 (2.08 g) and 2 (1.98 g) in 50 mL of toluene, TEA was added at room temperature. The reaction mixture was stirred at 90 °C overnight. After cooling to room temperature, EtOAc and water were added for workup. Purification was by 40 g column. A gradient from hexane to 30% EtOAc in hexane was used for purification. The product was a pale yellow oil, 1388 mg, 51%. LC-MS: calculated [M+H] 339.21, found 339.62.

Chemical Structure

[0285] To a mixture of 1 (0.241 g) in MeOH / THF (4 mL / 4 mL), 1 N NaOH (6 mL) was added at room temperature. The reaction mixture was stirred at 60 °C for 1 h. After removing the organic solvents in vacuo, 1 N HCl was added to adjust the mixture to pH ~1. Then, NaHCO3 was added to adjust the pH between 7 - 8. DCM was added for workup. After removing DCM in vacuo, the residue was placed under high vacuum for 2 h. The residue was diluted with DCM, and then DIPEA (0.248 mL), COMU (0.336 g), and 2 (0.166 g) were added. The reaction mixture was stirred at room temperature for 2 h (sitrred). The reaction mixture was washed with 1 N HCl, NaHCO3, and brine. Purification was by a 12 g column. A gradient from hexane to EtOAc was used for purification. The product was a brown oil, 285 mg, 74%. LC-MS: calcd [M+H] 540.34, found 541.07.

Chem.

[0286] To a mixture of 1 (0.0740 g) and Pd / C in EtOAc, H2 (1 atm) was added at room temperature. The reaction mixture was stirred at room temperature for 4 h. The reaction mixture was filtered through a Celite® pad. After removing EtOAc in vacuo, the residue was placed under high vacuum for 1 h. The residue was dissolved in 3 mL of DCM, and then 2 (0.166 mL) and TEA (0.115 mL) were added at room temperature. The mixture was stirred at room temperature for 2 h. Water was added for workup. Purification was by a 12 g column. A gradient from DCM to 20% MeOH in DCM was used for purification. The product was a clear oil, 43 mg, 37%. LC-MS: calcd [M+H] 836.71, found 837.68.

Chem.

[0287] A solution of 1 (0.0430 g) in 4N HCl / dioxane (3 mL) was stirred overnight at room temperature. After removing the solvent in vacuo, the residue was placed under high vacuum for 3 hours. The residue was dissolved in 3 mL of DMF, and then DIPEA (0.027 g), COMU (0.0660 g) and 2 (0.017 g) were added. The mixture was stirred at room temperature for 2 hours. After removing the solvent in vacuo, the residue was loaded onto a 4 g column. A gradient of DCM to 20% MeOH in DCM was used for purification. The product was a pale yellow oil, 34 mg, 37%. LC-MS: calculated [M+H] 928.64, found 929.59.

[0288] Synthesis of LP249-p [Chemical formula]

[0289] To a mixture of 1 (0.0600 g) and 2 (0.161 mL) in 4 mL of DCM, TEA (0.111 mL) was added at room temperature. The reaction mixture was stirred at room temperature for 2 hours. Water was added for work-up. Purification was by a 4 g column. A gradient of hexane to EtOAc was used for purification. The product was a white solid, 74 mg, 60%. LC-MS: calculated [M+H] 465.41, found 465.91. [Chemical formula]

[0290] To a solution of 1 (0.0740 g) in DCM, TFA (50% of DCM) was added at room temperature. The reaction mixture was stirred at room temperature for 0.5 h. The solvent was removed in vacuo, and then the residue was placed under high vacuum for 2 h. The residue was dissolved in DMF, and then 2 (0.0420 g), DIPEA (0.084 mL), and COMU (0.102 g) were added at room temperature. The mixture was stirred at room temperature for 2 h. The solvent was removed in vacuo. Purification was by a 12 g column. A gradient of 20% MeOH in DCM from DCM was used for purification. The product was a white solid, 56 mg, 58%. LC-MS: calculated [M+H] 609.48, found 610.29.

Chemical formula

[0291] A solution of 1 (0.0560 g) in 4N HCl / dioxane (3 mL) was stirred at room temperature overnight. After the solvent was removed in vacuo, the residue was placed under high vacuum for 3 h. The residue was dissolved in 2 mL of DMF, and then DIPEA (0.048 mL), COMU (0.118 g), and 2 (0.031 g) were added. The mixture was stirred at room temperature for 2 h. After the solvent was removed in vacuo, the residue was loaded onto a 4 g column. A gradient of 20% MeOH in DCM from DCM was used for purification. The product was an off-white solid, 16 mg, 25%. LC-MS: calculated [M+H] 701.42, found 702.20.

[0292] Synthesis of LP257-p

Chemical formula

[0293] To a solution of 1 (0.100 g) in 3 mL of DCM, 2 (0.331 mL) and TEA (0.304 mL) were added at room temperature. The reaction mixture was stirred at room temperature for 1 hour. It was diluted with EtOAc and then the mixture was washed with 1 N HCl, NaHCO3, and brine. After removing the solvent in vacuo, the residue was loaded onto a 4 g column. A gradient from hexane to EtOAc was used for purification. The product was a white solid, 134 mg, 58%. LC-MS: calcd [M+H] 422.36, found 422.79.

Chem.

[0294] A solution of 1 (0.134 g) in 4N HCl / dioxane (8 mL) was stirred at room temperature overnight. After removing the solvent in vacuo, the residue was placed under high vacuum for 3 hours. The product was a white solid, 118 mg, and it was used in the next step without further purification. LC-MS: calcd [M+H] 366.30, found 366.62.

Chem.

[0295] To a solution of 1 (0.0490 g) in 3 mL of DMF, COMU (0.086 g), DIPEA (0.047 mL) and 2 (0.045 g) were added at room temperature. The mixture was stirred at room temperature for 1 hour. The reaction mixture was diluted with EtOAc and then washed with 1 N HCl, NaHCO3, and brine. After removing the solvent in vacuo, the residue was loaded onto a 4 g column. A gradient from hexane to EtOAc was used for purification. The product was a white solid, 23 mg, 33%. LC-MS: calcd [M+H] 514.29, found 514.79.

[0296] Synthesis of LP259-p

Chem.

[0297] To a solution of 1 (0.100 g) in 3 mL of DCM, 2 (0.366 mL) and TEA (0.337 mL) were added at room temperature. The reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was loaded onto a 12 g column. Hexane to EtOAc gradient was used for purification. The product was a white solid, 183 mg, 82%. LC-MS: calcd [M+H] 368.32, found 368.60.

Chemical Structure

[0298] Synthesis of LP260-p

Chemical Structure

[0299] To a solution of 1 (0.100 g) in DDC, 2 (0.354 mL) and TEA (0.326 mL) were added at room temperature. The reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was loaded onto a 12 g column. Hexane to EtOAc gradient was used for purification. The product was a white solid, 208 mg, 87%. LC-MS: calcd [M+H] 410.36, found 410.73.

Chem.

[0300] A solution of 1 (0.208 g) in 4N HCl / dioxane (8 mL) was stirred at room temperature overnight. After removing the solvent in vacuo, the residue was placed under high vacuum for 3 hours. The product was a white solid, 179 mg, and it was used in the next step without further purification. LC-MS: calcd [M+H] 354.30, found 354.65.

Chem.

[0301] Synthesis of LP262-p

Chem.

[0302] A solution of 1 (0.0220 g), 2 (0.100 g) and DIPEA (0.017 mL) in 2 mL of DMF was added with COMU (0.0240 g) at room temperature. The mixture was stirred at room temperature for 2 hours. The reaction mixture was diluted with DCM. Then it was washed with 1 N HCl, saturated NaHCO3 and brine. Purification was performed on a 4 g column. A gradient of 20% MeOH in DCM from DCM was used for purification. The product was a transparent solid, 77 mg, 65%. LC-MS: calculated value [M+2H] +H2O: 1294.76, measured value 1295.29; calculated value [M+3H] +H2O: 869.51, measured value 869.45; calculated value [M+4H]: 638.88, measured value 638.54.

Chemical formula

[0303] A solution of 1 (0.077 g) in DMF / piperidine (0.8 mL / 0.2 mL) was stirred at room temperature for 1 hour. After removing the solvent in vacuo, the residue was placed under high vacuum for 3 hours. The residue was dissolved in 3 mL of DMF, and then 2 (0.016 g) and TEA (0.013 mL) were added at room temperature. The reaction was stirred at room temperature for 1.5 hours. After removing the solvent in vacuo, the residue was loaded onto a 4 g column. A gradient of 20% MeOH in DCM from DCM was used for purification. The product was a white solid, 61 mg, 78%. LC-MS: calculated value [M+2H] +H2O: 1302.84, measured value 1303.81; calculated value [M+4H]: 642.92, measured value 642.62.

Chemical formula

[0304] A solution of 1 (0.0610 g) in 4N HCl / dioxane (5 mL) was stirred overnight at room temperature. After removing the solvent in vacuo, the residue was placed under high vacuum for 3 hours. The residue was dissolved in 3 mL of DMF, and then COMU (0.0152 g), DIPEA (0.009 mL) and 2 (0.0060 g) were added at room temperature. The reaction mixture was stirred at room temperature for 1.5 hours. After removing the solvent in vacuo, the residue was loaded onto a 4 g column. Purification was carried out using a gradient of 20% MeOH in DCM from DCM. The product was a white solid, 13 mg, 21%. LC-MS: calculated [M+2H] +H2O: 1348.80, found 1348.94; calculated [M+3H] +H2O: 905.54, found 905.09.

[0305] Synthesis of LP269-p

Chemical formula

[0306] To a solution of 1 (88.6 mg, 0.500 mmol, 1.0 eqv) and 2 (93.7 mg, 0.600 mmol, 1.20 eqv) in 20 mL of DCM, TEA (0.418 mL, 3.000 mmol, 6.0 eqv) was added under ambient conditions. The reaction mixture was stirred at room temperature for 3 hours, followed by the addition of COMU (257 mg, 0.600 mmol, 1.20 eqv), and then 4-nitrophenol (166.1 mg, 1.000 mmol, 2.0 eqv). The reaction mixture was stirred overnight at room temperature. The reaction mixture was washed with 1N HCl and then brine. The mixture was then dried over Na2SO4 and concentrated. The residue was purified by CombiFlash® using a gradient of Hex 0 - 100% from EA with silica gel as the stationary phase. 72 mg of the product was obtained (19% yield).

[0307] Synthesis of LP273-p

Chemical formula

[0308] To a solution of Compound 1 (0.200 g), NEt3 (0.255 mL), and COMU (0.261 g) in DCM, 2 (0.152 g) was added under ambient conditions. The reaction mixture was stirred until complete conversion was observed by LC-MS. For separation, the reaction mixture was concentrated as such. The residue was purified by CombiFlash® with DCM liquid filling into a 12 g column using a gradient from hexane to 100% EtOAc, and there, the product was eluted with 28% B. The product was concentrated under vacuum to give a clear and pale yellow oil. MS m / z: calculated [M+H]+ 477.23 m / z, found 477.52 m / z.

[0309] Synthesis of LP274-p

Chemical formula

[0310] To a solution of EPA1 (60.5 mg, 0.200 mmol, 1 eqv) and 2 (36.5 mg, 0.220 mmol, 1.10 eqv) in 20 mL of DCM, COMU (94.2 mg, 0.220 mmol, 1.10 eqv) was added under ambient conditions, then TEA (0.084 mL, 0.600 mmol, 3.0 eqv) was added. The reaction mixture was stirred until complete conversion was observed by LC-MS. The reaction mixture was washed with 1 N HCl and then with brine. Then, the mixture was dried using Na2SO4 and concentrated. The reaction mixture was purified by CombiFlash® using silica gel as the stationary phase with a gradient from EA to 0 - 50% Hex. 69 mg of the product was obtained (76% yield).

[0311] Synthesis of LP283-p

Chemical formula

[0312] To a solution of Compound 1 (49 mg), NEt3 (0.068 mL), and COMU (76.8 mg) in DMF, Compound 2 (29.8 mg) was added under ambient conditions. The reaction mixture was stirred until complete conversion was observed by LC-MS. Since conversion could not be clearly observed by LC-MS, instead, the reaction mixture was stirred for 30 minutes until the bright yellow (before addition of Compound 2) changed to honey orange color, and it was observed that almost all the materials were dissolved. The reaction mixture was washed with water, extracted with DCM, dried over Na2SO4, filtered, and concentrated under vacuum. The residue was purified by CombiFlash® by dry loading onto a 12 g column with a gradient of hexane to 100% EtOAc in DCM, and there, the product was eluted with 31% B. The product was concentrated under vacuum to give a white solid residue, which was confirmed by 1H NMR in CDCl3.

[0313] Synthesis of LP286-p

Chemical formula

[0314] To a solution of 1 (78.5 mg, 0.200 mmol, 1 eqv) and 2 (36.5 mg, 0.220 mmol, 1.10 eqv) in 20 mL of DCM, COMU (94.2 mg, 0.220 mmol, 1.10 eqv) was added under ambient conditions, then TEA (0.084 mL, 0.600 mmol, 3.0 eqv) was added. The reaction mixture was stirred until complete conversion was observed by LC-MS. The reaction mixture was washed with 1N HCl and then with brine. The mixture was dried over Na2SO4 and concentrated. The reaction mixture was purified by CombiFlash® using silica gel as the stationary phase with a gradient of EA to 0 - 50% Hex. 69 mg of the product was obtained (57% yield).

[0315] Synthesis of LP287-p

Chemical formula

[0316] To a solution of 1 (43.3 mg, 0.200 mmol, 1 eqv) and 2 (36.5 mg, 0.220 mmol, 1.10 eqv) in 20 mL of DCM, COMU (94.2 mg, 0.220 mmol, 1.10 eqv) was added under ambient conditions, followed by TEA (0.084 mL, 0.600 mmol, 3.0 eqv). The reaction mixture was stirred until complete conversion was observed by LC-MS. The reaction mixture was washed with 1 N HCl and then with brine. The mixture was dried over Na2SO4 and concentrated. The reaction mixture was purified by CombiFlash® using silica gel as the stationary phase with a gradient of EA to Hex 0 - 50%. 52 mg of the product was obtained (71% yield).

[0317] Synthesis of LP290-p

Chemical formula

[0318] To a solution of compound 1 (0.0540 g), NEt3 (0.075 mL), and COMU (0.084 g) in DMF, 2 (0.0327 g) was added under ambient conditions. The reaction mixture was stirred for 30 minutes until the bright yellow (before addition of 2) changed to honey orange, and it was observed that almost all the materials were dissolved. The reaction mixture was washed with water, extracted with DCM, dried over Na2SO4, filtered, and concentrated under vacuum. The residue was purified by CombiFlash® by DCM liquid filling into a 12 g column using a gradient of hexane to 100% EtOAc, and there, the product was eluted with 31% B. The product was concentrated under vacuum to give a white solid residue and was confirmed by 1H NMR in CDCl3. LC-MS: calculated [M + H]+ 428.14 m / z, found 428.46 m / z.

[0319] Synthesis of LP293-p

Chemical formula

[0320] To a solution of Compound 1 (73 mg), NEt3 (0.112 mL), and COMU (126 mg) in DMF, Compound 2 (48.9 mg) was added under ambient conditions. The reaction mixture was stirred until complete conversion was observed by LC-MS. Since conversion could not be clearly observed by LC-MS, instead, the reaction mixture was stirred for 30 minutes until the bright yellow (before addition of Compound 2) changed to honey orange, and it was observed that most of all the materials had dissolved. The reaction mixture was then washed with water, extracted with DCM, dried over Na2SO4, filtered, and concentrated under vacuum. The residue was purified by CombiFlash® by dry loading of DCM onto a 12 g column using a gradient from hexane to 100% EtOAc, and there, the product was eluted with 30% B. The product was concentrated under vacuum to give a white solid residue, which was confirmed by 1H NMR in CDCl3.

[0321] Synthesis of LP296-p [Chemical formula]

[0322] To a solution of compound 1 (0.0344 g), NEt3 (0.0117 g), and COMU (0.0182 g) in DCM, 2 (0.0071 g) was added under ambient conditions. The reaction mixture was stirred for 30 minutes until the bright yellow (before addition of 2) changed to honey orange, and it was observed that almost all the materials were dissolved. The reaction mixture was concentrated as such for separation. The residue was purified by CombiFlash® by DCM liquid filling into a 4 g column using 20% MeOH / DCM in DCM (from 0% B to 20% B, 40% B, 50% B, and then 100% B), and there, the product was eluted with 23% B. The product was concentrated under vacuum to give a clear and colorless oil, and was confirmed by 1H NMR in CDCl3. MS m / z: calculated [M+H]+ 1039.67 m / z; found 1040.36, 671.78 m / z.

[0323] Synthesis of LP300-p

Chemical formula

[0324] To a solution of 2 (5.29 g) in 100 mL of toluene, TEA (8.4 mL) was added at room temperature, and then 1 (5.20 g) was added dropwise. The reaction mixture was stirred at 90 °C for 16 hours. After cooling to room temperature, EtOAc and water were added for workup. Purification was carried out using a 120 g column. A gradient from hexane to 30% EtOAc in hexane was used for purification. The product was a pale yellow oil, 3658 mg, 54%. LC-MS: calculated [M+H] 339.21, found 339.17.

Chemical formula

[0325] A mixture of 1 (0.113 g) and 10% Pd / C (0.0036 g) in 10 mL of EtOAc was added with H2 (~45 psi). The reaction mixture was stirred at room temperature for 4 hours. After filtration, the solvent was removed in vacuo. Then, the residue was placed under high vacuum for 1 hour. The residue was dissolved in 10 mL of DCM, and then TEA (0.279 mL) and 2 (0.405 mL) were added at room temperature. The reaction mixture was stirred at room temperature for 1 hour. Purification was carried out using a 12 g column. A gradient from hexane to 50% EtOAc in hexane was used for purification. The product was a white solid, 141 mg, 66%. LC-MS: calculated [M+H] 635.57, found 635.95. [Chemical formula]

[0326] To a solution of 1 (0.141 g) in MeOH / THF (3 mL / 3 mL) was added 1 N NaOH (3 mL) at room temperature. The mixture was stirred at room temperature for 2 hours. After removing the organic solvent in vacuo, the residue was acidified to pH ~1 with conc. HCl. EtOAc was added to extract the product. After removing the solvent in vacuo, the residue was placed under high vacuum for 3 hours. The residue was dissolved in DMF / DCM (5 mL / 5 mL), and then DIPEA (0.077 mL), COMU (0.143 g), and 2 (0.074 g) were added. The mixture was stirred at room temperature for 2 hours. The reaction mixture was diluted with EtOAc and then washed with 1 N HCl and brine. After removing the solvent in vacuo, the residue was loaded onto a 12 g column. A gradient from hexane to 30% EtOAc in hexane was used for purification. The product was a white solid, 80 mg, 47%. LC-MS: calculated [M+H] 769.55, found 769.98.

[0327] Synthesis of LP303-p [Chemical formula]

[0328] A solution of vitamin D1 (185 mg, 0.500 mmol, 1 eqv) and 2 (111 mg, 0.550 mmol, 1.10 eqv) in 30 mL of DCM was added with TEA (0.139 mL, 1.00 mmol, 2.0 eqv) under ambient conditions. The reaction mixture was stirred at room temperature for 8 hours. The reaction mixture was washed with 1 N HCl and then with brine. The mixture was then dried over Na2SO4 and concentrated. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient of EA to Hex 0 - 100%. 69 mg of the product was obtained (35% yield).

[0329] Synthesis of LP304-p [Chemical formula]

[0330] 1 (200 mg, 0.377 mmol, 1.0 eqv.) was hydrolyzed using LiOH (151 mg, 3.77 mmol, 10.0 eqv) in MeOH / TFH / H2O (1:1:1, 90 mL). After removing all organic solvents, the aqueous phase was acidified to pH = 3 using 1 N HCl. The reaction mixture was extracted with ethyl acetate (100 mL × 3). The combined organic phases were dried over Na2SO4 and concentrated to obtain the crude acid.

[0331] COMU (194 mg, 0.453 mmol, 1.20 eqv) was added to a solution of the above crude acid and tetrafluorophenol 4 (68.9 mg, 0.415 mmol, 1.10 eqv) in 30 mL of DCM under ambient conditions, and then TEA (0.158 mL, 1.13 mmol, 3.0 eqv) was added. The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was washed with 1 N HCl and then with brine. It was dried over Na2SO4 and concentrated. The reaction mixture was purified by CombiFlash® using silica gel as the stationary phase with a gradient of EA to Hex 0 - 100%. 170 mg of the product was obtained (85% yield).

[0332] Synthesis of LP310-p

Chem.

[0333] To a solution of 1 in DCM, DIPEA (0.057 mL), COMU (0.077 g) and 2 (0.0300 g) were added at room temperature. After stirring at room temperature for 2 hours, the reaction mixture was quenched with 0.1 N HCl. The organic layer was washed with brine. After removing the solvent, the residue was loaded onto a 4 g column. A gradient of 50% hexane in EtOAc from hexane was used for purification. The product was a white solid, 46 mg, 44%. LC-MS: calculated [M+H] 422.36, found 422.61.

Chem.

[0334] A solution of 1 (0.046 g) in 4N HCl / dioxane (2 mL) was stirred at room temperature overnight. After removing the solvent in vacuo, the residue was placed under high vacuum for 3 hours. The residue was then dissolved in DCM at room temperature, and then COMU (0.0700 g), DIPEA (0.038 mL) and 2 (0.036 g) were added at room temperature. After stirring at room temperature for 2 hours, the solvent was removed in vacuo. The residue was loaded onto a 4 g column. A gradient of 50% hexane in EtOAc from hexane was used for purification. The product was a white solid, 21 mg, 38%. LC-MS: calculated [M+H] 514.29, found 514.61.

[0335] Synthesis of LP383-p

Chem.

[0336] To a solution of compound 1 (0.050 g) in 5 mL of DCM, compound 2 (0.023 g) and EDC (0.039 g) were added at room temperature. The mixture was stirred at room temperature for 1 hour. After removing the solvent in vacuo, the residue was dry-packed onto a 4 g column. Hexane to 50% EtOAc in hexane was used for the purification of the product. The Pdt was a white solid, yield, 29 mg. LC-MS: calculated [M+H+H2O] 388.27, found 388.03.

[0337] Synthesis of LP409-p

Chem.

[0338] Compound 1 (1.40 g) and 2 (0.613 g) were dissolved in 100 mL of THF, and then TEA (2.01 mL) was added. The reaction was stirred at 60 °C until complete conversion was confirmed by LC-MS (2 - 3 h). The reaction was cooled to room temperature. The product was obtained as a white (whilte) precipitate and was filtered and washed with acetone (20 mL). The compound structure was 1 H and 13 verified using 1H and 31P NMR.

Chem.

[0339] Compound 1 (1.9 g), 2 (0.846 g) and 3 (2.98 g) were dissolved in 100 mL of DCM and then heated to 40 °C. The reaction was stirred until the solution became clear. The reaction was cooled to room temperature and stirred overnight. After removing all of the DCM, the product was dry-packed onto a 24 g column. The product was obtained as a white solid using 0 - 50% (EA / Hex, with 1% TEA added) as the mobile phase.

[0340] Synthesis of LP429-p

Chem.

[0341] 17-Hydroxyhexadecanoic acid (6) (3.53 g, 12.3 mmol) was added to a 500 mL RBF. The flask was purged with nitrogen, then DCM (150 mL) was added, followed by acetic anhydride (18.6 mL, 197 mmol) and pyridine (30.8 mL, 382 mmol). The reaction mixture was stirred overnight. The reaction mixture was concentrated and azeotroped three times with toluene to remove residual pyridine, acetic acid, and acetic anhydride. The residue was then stirred in a 100 mL 1:1 THF / NaHCO3 aqueous solution mixture for 24 hours. Approximately half of the THF was removed by rotary evaporator, the mixture was diluted with water, and acidified to pH 1 with 3 M HCl. The mixture became very foamy during acidification. The product was recovered by filtration and dried in vacuo to give 3.22 g (80% yield) of compound 5 as a white solid. No further purification was added to the product.

Chemical formula

[0342] Compound 5 (3.47 g, 10.6 mmol) was dissolved in THF (55 mL) and cooled to -15 to -20 °C in a methanol / ice bath. At the point of cooling, N-methylmorpholine (1.4 mL, 12.7 mmol) and ethyl chloroformate (1.2 mL, 12.7 mmol) were added. The reaction mixture was stirred at -15 °C for 30 minutes. After 30 minutes, a solution of sodium azide (1.72 grams, 26.4 mmol) in water (6.6 mL) was added and the reaction mixture was stirred at -5 to 0 °C in a water / salt / ice bath for 30 minutes. The reaction mixture was diluted with EtOAc (20 mL) and water (20 mL). The layers were separated and the aqueous layer was extracted with EtOAc (2 x 50 mL). The combined organic layers were washed with water (50 mL), brine (50 mL), dried over sodium sulfate and concentrated to a white solid. Proton NMR showed no residual starting material based on the proton alpha to the carbonyl. The solid was dissolved in toluene (55 mL) and heated to 65 °C until gas evolution ceased (about 30 minutes). The reaction mixture was cooled to room temperature and N-hydroxysuccinimide (1.22 g, 10.5 mmol) was added, followed by pyridine (0.85 mL, 10.5 mmol). Proton NMR showed that not all of the isocyanate had been consumed after 2 hours and an additional 2 eq of N-hydroxysuccinimide (2.43 g, 21.1 mmol) was added. The reaction mixture was stirred overnight. After stirring overnight, no isocyanate was detected by proton NMR. The reaction mixture was concentrated and the resulting white powder was dissolved in EtOAc (100 mL) and poured into 300 mL of hexane. The precipitate was collected by filtration. Proton NMR of the product showed residual N-hydroxysuccinimide. The product was dissolved in DCM and purified by silica gel chromatography from 65:35 hexane:EtOAc to 0:100 hexane:EtOAc. The product was eluted starting with 50% EtOAc and soaked into the column. The fractions containing the product were combined to give 2.25 g (48% yield) of compound 7 as a white solid. [Chemical formula]

[0343] Compound 7 (1.00 g, 2.27 mmol) was added to a solution of 6-amino-1-hexanol (0.266 g, 2.27 mmol) and NEt3 (0.95 mL, 6.81 mmol) in DCM (50 mL). A white ppt was formed. According to LC-MS, after 18 hours, no SM remained. The reaction mixture was concentrated by rotary evaporator, and the residue was dissolved in about 8 mL of ethyl acetate and cooled to -20 °C in the freezer. A precipitate was formed and allowed to settle to the bottom of the flask. EtOAc was discarded by two decantations, the precipitate was collected and dried under vacuum to give 0.95 grams (94% yield) of compound 8 as a white powder.

Chemical Structure

[0344] Compound 8 (0.95 g, 2.14 mmol) in a 100 mL RBF was dried by three successive distillations of toluene. Diisopropylammonium tetrazolide (0.146 g, 0.86 mmol) and 4 Å molecular sieves were added to the flask. The flask was purged with nitrogen and backfilled three times, and the solid was dissolved in DCM (50 mL). The mixture was stirred for 30 minutes. After 30 minutes, 2-cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (0.98 g, 3.25 mmol) was added and the reaction was stirred for 18 hours. After 18 hours, LC-MS indicated no starting alcohol remaining. The reaction was transferred to a separatory funnel and washed with saturated aqueous NaHCO3 (2 × 40 mL), water (40 mL), brine (40 mL), dried over magnesium sulfate, and concentrated to dryness. Hexane was added to the flask and the residue was stirred in hexane for 2 hours to give a white precipitate. The white solid was collected by filtration, washed with hexane (2 × 20 mL), and dried under vacuum to give 1.2 grams (87% yield) of compound 9 as a white solid.

[0345] Synthesis of LP430-p

Chem.

[0346] A solution of 1,6 - hexanediol (1 eq) and TEA (2 eq) in DCM (5 mL) was added to a round - bottom flask containing hexadecyl isocyanate (1 eq) in DCM (5 mL). The mixture was stirred at room temperature for 2 h. Then, the mixture was concentrated under vacuum and purified by CombiFlash chromatography using 2% MeOH in DCM to give compound 1 as an off - white solid in 20% yield. LC - MS [M + H] + 386.3634 m / z, found 386.3642 m / z.

[0347] Compound 1 (1 eq) was dried by distilling toluene twice. Then, it was dissolved in anhydrous DCM (10 mL), and diisopropylammonium tetrazolide (1.4 eq) was added, followed by activated molecular sieves (100 mg). The mixture was stirred at room temperature for 30 min under N2 gas. Then, 2 - cyanoethyl N,N,N’,N’ - tetraisopropyl phosphorodiamidite (1.6 eq) was added, and stirring was continued at room temperature for 12 h. Thereafter, 0.3 mL of TEA was added to quench the reaction, and the mixture was directly loaded onto celite. Pure product was obtained as a waxy, off - white solid in 41.7% yield by CombiFlash chromatography using hexane:ethyl acetate + 1% TEA (70:30). LC - MS [M + H] + 586.4713 m / z, found 586.4720 m / z.

[0348] Synthesis of LP431 - p

Chem.

[0349] To a round-bottom flask containing 6-amino-1-hexanol (1.2 eq) and TEA (2 eq) in DCM (5 mL), a solution of hexadecyl chloroformate (1 eq) in DCM (5 mL) was added. The reaction mixture was stirred at room temperature for 2 h. The mixture was then concentrated under vacuum and purified by CombiFlash chromatography using 2% MeOH in DCM to afford Compound 1 as an off-white solid in 20% yield. LC-MS [M+H] + 386.3634 m / z, found 386.3638 m / z.

[0350] Compound 1 (1 eq) was dried by distilling off toluene twice. It was then dissolved in anhydrous DCM (10 mL), and diisopropylammonium tetrazolide (1.4 eq) was added, followed by activated molecular sieves (100 mg). The mixture was stirred under N2 gas at room temperature for 30 min. Then 2-cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (1.6 eq) was added and stirring was continued at room temperature for 12 h. Subsequently, 0.3 mL of TEA was added to quench the reaction and the mixture was directly loaded onto celite. Pure product was obtained as a waxy, off-white solid in 82.3% yield by CombiFlash chromatography using hexane:ethyl acetate + 1% TEA (70:30). LC-MS [M+H] + 586.4713 m / z, found 586.4705 m / z.

[0351] Synthesis of LP435-p [Chemical formula]

[0352] Undecanoic acid (2.0 g, 10.7 mmol) was dissolved in toluene (30 mL) and triethylamine (3.0 mL, 21.5 mmol), and diphenylphosphoryl azide (3.84 g, 14.0 mmol) was added. The reaction mixture was stirred overnight. The acyl azide was observed by mass spectrometry under basic conditions. The mixture was concentrated, and the crude product was purified by silica gel chromatography (chromatorgraphy) (from 0:100 EtOAc:hexane to 20:80 EtOAc:hexane). The product was eluted with 10% EtOAc. The fractions containing the product were concentrated to give 0.975 g (43% yield) of compound 21 as a clear liquid.

Chemical formula

[0353] Compound 21 (0.975, 5.2 mmol) was dissolved in toluene (40 mL) and heated to 65 °C over 1 hour. Gas evolution was observed when 65 °C was reached and ceased after about 30 minutes. The reaction mixture was cooled to room temperature. In a separatory flask, 1-amino-12-dodecanol (1.05 g, 5.2 mmol) was dissolved in THF (20 mL) and pyridine (0.85 mL, 10.5 mmol). When the toluene solution was added to the THF solution, a white ppt rapidly formed. The reaction mixture was stirred overnight. The reaction mixture was concentrated, and the crude product was recrystallized from isopropanol to give 1.5558 g (77% yield) of compound 22 as a white solid.

Chemical formula

[0354] Compound 22 (1.55 g, 4.0 mmol) in 100 mL of RBF was dried by two consecutive distillations of toluene. Diisopropylammonium tetrazolide (0.277 g, 1.6 mmol) and 4 Å molecular sieves were added to the flask. The flask was purged with nitrogen and backfilled three times, and the solid was suspended in DCM (20 mL). Only the solid was partially dissolved. To the mixture was added 2-cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (1.88 g, 6.2 mmol), and the reaction was stirred for 18 hours. After 18 hours, LC-MS indicated that there was no remaining starting alcohol. The reaction was transferred to a separatory funnel and washed with saturated aqueous NaHCO3 (2 × 40 mL), water (40 mL), and brine (40 mL), dried over sodium sulfate, and concentrated to dryness. Hexane was added to the flask, and the residue was stirred in hexane for 1 hour to obtain a white precipitate. The white solid was collected by filtration, washed with hexane (2 × 20 mL), and dried under vacuum to obtain 1.103 grams of a white powder. Proton NMR indicated that a large amount of water remained and a significant amount of the substance was insoluble in chloroform and DCM. The mixture was suspended in DCM, dried over magnesium sulfate, filtered through an additional pad of magnesium sulfate, and concentrated to obtain 0.46 g (19% yield) of compound LP435-p as an off-white powder.

[0355] Synthesis of LP439-p

Chemical formula

[0356] (3-Aminobicyclo[1.1.1]pentan-1-yl)methanol (2) (0.20 g, 1.77 mmol) and 2,5-dioxopyrrolidin-1-yl hexadecylcarbamate (3) (0.67 g, 1.75 mmol) were dissolved in DCM (40 mL), and then triethylamine (0.72 mL, 5.3 mmol) was added. The reaction mixture was stirred overnight. After 18 hours, a precipitate was observed. The precipitate was collected by filtration and washed with DCM (2 × 10 mL). The precipitate was dried in vacuo to give 0.325 g (48% yield) of a white solid. Proton NMR analysis was consistent with the product, and the crude material was of acceptable purity to proceed to the next step.

Chemical formula

[0357] Compound 1 (0.3 gram, 0.79 mmol) was dried by four successive evaporations of toluene, then diisopropylammonium tetrazolide (0.054 g, 0.315 mmol) was added to the flask. The flask was purged with nitrogen and backfilled three times, the solid was suspended in DCM (20 mL), 2-cyanoethyl N,N,N’,N’-tetraisopropylphosphorodiamidite (0.39 mL, 1.214 mmol) was added, and the reaction mixture was stirred for 18 hours. After 18 hours, LC-MS analysis indicated the absence of residual starting alcohol. The reaction mixture was transferred to a separatory funnel, washed with saturated aqueous NaHCO3 (2 × 40 mL), water (40 mL), and concentrated to dryness. Hexane was added to the residue, and the mixture was stirred for 1 hour to give a white precipitate. The precipitate was collected by filtration, washed with hexane, and dried under vacuum to give 0.395 g (86% yield) of LP439-p as a white solid.

[0358] Synthesis of LP440-p

Chemical formula

[0359] Anhydrous MeOH (8 mL) was cooled to 0 °C, potassium hydroxide (3 eq) was added, and the solution was stirred for 30 minutes. Then, a solution of 16-bromohexadecanoic acid (1 eq) in anhydrous MeOH (7 mL) was added by syringe. The reaction mixture was heated to reflux temperature and stirred overnight. After cooling to room temperature, MeOH was removed in vacuo, and the resulting crude mixture was reconstituted with 1 N HCl (25 mL) and diethyl ether (5 mL). The crude product was extracted using diethyl ether (4 × 30 mL), and the combined organic layers were washed with brine (30 mL), dried over Na2SO4, and then the solvent was removed in vacuo. The product was then purified by silica gel column chromatography using hexane:ethyl acetate (85:15) to give Compound 1 as an oil in 86% yield. LC-MS [M+H] + 287.2586 m / z, found 287.2590.

[0360] To a solution of Compound 1 (1 eq) in DCM (50 mL) was added COMU (1.2 eq) and DIPEA (2 eq). The mixture was stirred at room temperature for 30 minutes. Then, 6-amino-1-hexanol (1.2 eq) was added, and the reaction mixture was stirred at room temperature for 12 hours. The mixture was then washed three times with 1 M HCl (3 × 50 mL) and once with brine (50 mL), dried over Na2SO4, and concentrated under vacuum. ACN (100 mL) was added to the crude product, and it was carefully heated using a heat gun until all solids had dissolved. The mixture was then allowed to stand at room temperature to afford the formation of white crystals. The precipitate was then collected by vacuum filtration and washed several times with ACN to remove the remaining pink color. Compound 2 was obtained as a white solid in 74% yield. LC-MS [M+H] + 386.3634 m / z, found 386.3626.

[0361] Compound 3 (1 eq) was dried by distilling off toluene twice. It was then dissolved in anhydrous DCM (10 mL), and diisopropylammonium tetrazolide (0.4 eq) was added, followed by activated molecular sieves (100 mg). The mixture was stirred for 30 minutes at room temperature under N2 gas. Then, 2-cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (1.5 eq) was added, and stirring was continued at room temperature for 12 hours. Thereafter, 0.3 mL of TEA was added to quench the reaction, and the mixture was directly loaded onto celite. Pure product was obtained as a waxy, off-white solid in 86% yield by CombiFlash chromatography using hexane:ethyl acetate + 1% TEA (70:30). LC-MS [M+H] + 586.4713 m / z, found 586.4705.

[0362] Synthesis of LP441-p

Chemical formula

[0363] To a round-bottom flask containing 6-amino-1-hexanol (2 eq) in EtOH (20 mL), 1-bromohexadecane (1 eq) and TEA (1.1 eq) were added. The mixture was refluxed for 12 hours. The solution was then cooled to room temperature, and the solvent was removed in vacuo. Next, the crude product was dissolved in H2O (20 mL) and extracted three times with CH3Cl (3 × 25 mL). The combined organics were washed once with brine (20 mL), dried over Na2SO4, and concentrated under reduced pressure. The crude mixture was purified by CombiFlash chromatography using 10% MeOH + 1% TEA in DCM to give Compound 1 as an oil in 44% yield. LC-MS [M+H] + 342.3736 m / z, found 342.3728.

[0364] Ethyl trifluoroacetate (5 eq) and DIPEA (2 eq) were added to a round-bottom flask containing Compound 1 (1 eq) in MeOH (25 mL). The reaction mixture was stirred at 40 °C for 12 h. Then, the solvent was removed under vacuum, and the crude product was purified by CombiFlash chromatography using 4%-6% MeOH in DCM to afford Compound 2 as an oil in 73% yield. LC-MS [M+H] + 438.3559 m / z, found 438.3551.

[0365] Compound 2 (1 eq) was dried by distilling off toluene twice. It was then dissolved in anhydrous DCM (10 mL), and diisopropylammonium tetrazolide (0.4 eq) was added, followed by activated molecular sieves (100 mg). The mixture was stirred at room temperature for 30 min under N2 gas. Then, 2-cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (1.5 eq) was added, and stirring was continued at room temperature for 12 h. Then, 0.3 mL of TEA was added to quench the reaction, and the mixture was directly loaded onto Celite. The pure product was obtained as a waxy, off-white solid in 56% yield by CombiFlash chromatography using hexane:ethyl acetate + 1% TEA (70:30). LC-MS [M+H] + 638.4637 m / z, found 638.4629.

[0366] Synthesis of LP456-p

Chemical Structure

[0367] A 1 M solution of borane-tetrahydrofuran complex in tetrahydrofuran (1.5 eq) was added dropwise to a solution of 16 (tert-r (1 eq) in anhydrous tetrahydrofuran (20 mL) at 0 °C under nitrogen. The resulting solution was stirred at 0 °C for 2 h, then the cooling bath was removed and the mixture was stirred overnight at room temperature. A saturated aqueous solution of sodium bicarbonate (50 mL) was added to quench the reaction. The mixture was then diluted with water (50 mL) and extracted three times with DCM (3 × 50 mL). The combined organics were dried over Na2SO4 and concentrated in vacuo. The crude product was purified by CombiFlash chromatography using hexane:ethyl acetate (80:20) to give compound 1 as an oil in 82% yield. LC-MS [M+H] + 329.3056 m / z, found 329.5060.

[0368] A mixture of compound 1 (1 eq), silver carbonate (3 eq), and a catalytic amount of iodine in DCM (5 mL) was stirred with molecular sieves for 15 min. To this mixture was added 2,3,4,6-tetra-O-acetyl-α-D-glucopyranosyl bromide (1.5 eq) in DCM (5 mL) (similarly stirred with molecular sieves for 15 min). The resulting mixture was covered with aluminum foil and stirred at room temperature for 48 h, then filtered through celite using EtOAc washes. The filtrate was concentrated and the crude product was purified by CombiFlash column chromatography using hexane:ethyl acetate (80:20) to give compound 2 as an oil in 33% yield. LC-MS: [M+H2O] + 676.4034 m / z, found 676.4041.

[0369] To a solution of Compound 2 (in 5 mL of DCM), TFA (15 mL) was added. The solution was stirred at room temperature for 2 hours. Then, the mixture was carefully poured into 100 mL of saturated NaHCO3 (aq) solution. At the point of neutralization, the aqueous phase was extracted three times with DCM (3 × 100 mL). The combined organics were dried over Na2SO4 and concentrated under vacuum to give Compound 3 as a white solid in 97% yield. LC-MS: [M+H] + 603.3381 m / z8, found 603.338.

[0370] To a solution of Compound 3 (1 eq) in DCM (10 mL), COMU (1.2 eq) and DIPEA (2 eq) were added. The mixture was stirred at room temperature for 30 minutes. Then, 6-amino-1-hexanol (1.2 eq) was added and the reaction mixture was stirred at room temperature for 12 hours. Then, the mixture was washed three times with 1 M HCl (3 × 10 mL) and once with brine (10 mL), dried over Na2SO4, and concentrated under vacuum. The crude product was purified by CombiFlash chromatography using 0 - 100% hexane:ethyl acetate over 40 minutes to give Compound 4 as an oil in 83% yield. LC-MS [M+H] + 702.4429 m / z, found 702.4421.

[0371] Compound 4 (1 eq) was concentrated by rotary evaporator twice using toluene, and then anhydrous DCM (10 mL) was added to the reaction flask. The suspension was stirred with molecular sieves at 900 RPM at ambient temperature under N2. 2-Cyanoethyl N,N,N’,N’-tetraisopropylphosphorodiamidite (1.5 eq) was added to the suspension, followed by diisopropylammonium tetrazolide (0.4 eq). After 12 hours, TEA (300 μL) was added and the reaction mixture was dry-packed with celite. The product was purified using hexane:ethyl acetate + 1% TEA (60:40) to give LP-456p as an oil in 64% yield. LC-MS [M+H] + 902.5507 m / z, found 902.5517.

[0372] Synthesis of LP462-p

Chem.

[0373] Anhydrous THF (30 mL) was added to a round-bottom flask containing 2099-117 (1 eq), and the solution was cooled to -20 °C. Ethyl chloroformate (1.2) and N-methylmorpholine (1.2 eq) were added to the solution, and the solution was stirred at -20 °C to -10 °C for 30 minutes. A solution of sodium azide (2.5 eq) in 1.5 mL of water was added to the reaction mixture, and the reaction mixture was stirred at -7 °C for 90 minutes. The reaction mixture was diluted with EtOAc. The aqueous layer was separated and extracted twice more with EtOAc. The combined organic layers were washed with brine, dried over Na2SO4, and concentrated to a clear liquid. The liquid was dissolved in toluene (30 mL) and heated to 65 °C over 1 hour, at which time no further nitrogen gas evolution was observed. Next, the solution was concentrated under vacuum and then dissolved in 30 mL of anhydrous DCM. 6-Amino-1-hexanol (3 eq) and pyridine (1 eq) were added to the reaction mixture, and stirring was continued for 12 hours. The mixture was concentrated under vacuum onto celite and purified by CombiFlash chromatography using 5% methanol in 95% DCM to give Compound 1 as an oil in 51% yield. LC-MS [M+H2O] + 717.4538 m / z, found 717.4530.

[0374] Compound 1 (1 eq) was subjected to rotary evaporation twice using toluene and then anhydrous DCM (10 mL) was added to the reaction flask. The suspension was stirred at ambient temperature at 900 RPM with molecular sieves under N2. 2-Cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (1.5 eq) was added to the suspension, followed by diisopropylammonium tetrazolide (0.4 eq). After 12 h, TEA (300 μL) was added and the reaction mixture was dry-packed onto celite. The product was purified using hexane:ethyl acetate + 1% TEA (60:40) to give LP462-p as an oil in 64% yield. LC-MS [M+H] + 916.5538 m / z, found 916.5543.

[0375] Synthesis of LP463-p

Chemical formula

[0376] To a solution of 16-hydroxyhexadecanoic acid (1.5 g, 5.5 mmol) in DCM (60 mL) was added acetic anhydride (8.3 mL, 88 mmol) at room temperature, followed by pyridine (13.75 mL, 171 mmol). The mixture was stirred at room temperature overnight. After removal of the solvent in vacuo, the residue was redissolved in DCM and dry-packed onto an 80 g column. Hexane to 50% EtOAc in hexane was used for purification. Compound 24 was obtained as a white solid, 1.22 g, 62%. LC-MS: calcd [M+H+ H2O] 375.27, found 374.80.

Chemical formula

[0377] A suspension of compound 24 (1.22 g, 3.4 mmol) in ACN (40 mL) and saturated aqueous NaHCO3 (10 mL) was stirred overnight at room temperature. The pH was adjusted to 1 using 1 N HCl. The precipitate was collected by suction filtration, washed with H2O, and air-dried to give 1.15 g (107% yield) of compound 25 as a white solid. The yield exceeding 100% is 1 due to residual water measured by 1H NMR. LC-MS: calcd [M+H] 315.25, found 315.59.

Chem.

[0378] To a solution of compound 25 (1.15 g, 3.66 mmol) and diisopropylethylamine (1.28 mL, 7.3 mmol) in DCM (40 mL) was added COMU (1.8 g, 4.4 mmol) and tert-butyl 3-aminobicyclo[1.1.1]pentane-1-carboxylate (0.81 g, 4.4 mmol) at room temperature. The mixture was stirred at room temperature for 2 h. The reaction mixture was concentrated onto silica gel and purified by column chromatography, eluting with 100% hexane:0% EtOAc to 0% hexane:100% EtOAc. The fractions containing the product were combined and the solvent removed by rotary evaporator to give 1.66 g (94% yield) of compound 26 as a brown solid. LC-MS: calcd [M+H] 480.37, found 480.76.

Chem.

[0379] To a solution of Compound 26 (10 mL) in DCM (10 mL), TFA (10 mL) was added, and the reaction mixture was stirred at room temperature for 1.5 h. After removing the solvent in vacuo, the residue was dried under high vacuum for 2 h. The residue was dissolved in DCM (30 mL) and diisopropylethylamine (1.2 mL, 6.9 mmol). After dissolving the residue, COMU (1.77 g, 4.1 mmol) and 6-amino-1-hexanol (0.49 g, 4.1 mmol) were added at room temperature. The mixture was stirred at room temperature for 2.5 h. After removing a portion of the solvent in vacuo, the residue was recrystallized using ACN. The product was collected by suction filtration and dried in vacuo to give 1.48 g (82% yield) of Compound 27 as an off-white solid. LC-MS: calculated [M+H] 523.41, found 524.06.

Chemical formula

[0380] To a mixture of Compound 27 (0.3 g, 0.57 mmol) in DCM (20 mL), diisopropylammonium tetrazolide (0.039 g, 0.23 mmol) was added at room temperature, followed by the dropwise addition of 2-cyanoethyl N,N,N’,N’-tetraisopropylphosphorodiamidite (0.277 g, 0.92 mmol). The mixture was then refluxed for 2 h. After cooling to room temperature, the mixture was washed twice with saturated aqueous NaHCO3, followed by washing with H2O. After removing almost all of the solvent in vacuo, the residue was added to stirred hexane to form a white gel precipitate. After filtration, the white solid was collected by suction filtration and washed twice with hexane. The white solid was dried under high vacuum to give 0.305 g (73% yield) of Compound LP463-p as a white solid. LC-MS: calculated [M+H] 723.52, found 724.23.

[0381] Synthesis of LP464-p

Chemical formula

[0382] To a solution of 16-aminohexadecanoic acid (1 eq) in anhydrous MeOH (20 mL), ethyl trifluoroacetate (1.5 eq) and TEA (1.1 eq) were added. The reaction mixture was stirred at 50 °C for 12 h under a nitrogen atmosphere. Then, the mixture was concentrated under vacuum, diluted with EtOAc (30 mL), washed twice with saturated KHSO4 (15 mL) and once with brine (15 mL), dried over Na2SO4, and concentrated under vacuum to afford Compound 1 as a white solid in 79% yield. LC-MS [M+H] + 368.2412 m / z, found 368.2419.

[0383] To a solution of Compound 1 (1 eq) in DCM (30 mL), COMU (1.2 eq) and DIPEA (2 eq) were added. The mixture was stirred at room temperature for 30 min. Then, 6-amino-1-hexanol (1.2 eq) was added and the reaction mixture was stirred at room temperature for 12 h. Then, the mixture was washed three times with 1 M HCl (3 × 15 mL) and once with brine (15 mL), dried over Na2SO4, and concentrated under vacuum. ACN (100 mL) was added to the crude product and it was carefully heated using a heat gun until all solids had dissolved. Then, the mixture was allowed to stand at room temperature to afford the formation of white crystals. Then, the precipitate was collected by vacuum filtration, washed several times with ACN to remove the remaining pink color. Compound 2 was obtained as a white solid in 82% yield. LC-MS [M+H] + 467.3461 m / z, found 467.3457.

[0384] Compound 2 (1 eq) was concentrated by rotary evaporator twice using toluene, and then anhydrous DCM (10 mL) was added to the reaction flask. The suspension was stirred with molecular sieves at 900 RPM at ambient temperature under N2. 2-Cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (1.5 eq) was added to the suspension, followed by diisopropylammonium tetrazolide (0.4 eq). After 12 h, TEA (300 μL) was added and the reaction mixture was dry-packed onto celite. The product was purified using hexane:ethyl acetate + 1% TEA (60:40) to give LP464-p as a waxy solid in 77% yield. LC-MS [M+H] + 667.4539 m / z, found 667.4544.

[0385] Synthesis of LP465-p

Chem.

[0386] 17-Methoxy-17-oxohexadecanoic acid (1.0 g, 3.2 mmol) was dissolved in THF (50 mL), and triethylamine (0.89 mL, 6.4 mmol) and DPPA (0.75 mL, 3.5 mmol) were added. The reaction was stirred overnight. The reaction mixture was concentrated and the crude product was purified by silica gel chromatography (20:80 EtOAc:hexane to 100:0 EtOAc:hexane). The product was eluted with 10% EtOAc. Fractions 1 - 4 were found to contain the product, which was concentrated to give 0.60 g (56% yield) of compound 17 as a white solid.

Chem.

[0387] Compound 17 (0.58 g, 1.7 mmol) was dissolved in toluene (20 mL) and heated to 65 °C until no further gas evolution was observed (30 minutes). The solution was cooled to room temperature and then added to a solution of 6-amino-1-hexanol (0.2 g, 1.7 mmol) and pyridine (0.14, 1.7 mmol) in THF (20 mL). The reaction mixture was diluted with acetonitrile and the precipitate was collected by suction filtration, washed with acetonitrile and hexane, and dried in vacuo to give 0.614 g (84% yield) of compound 19 as a white solid.

Chem.

[0388] Compound 19 (0.60 g, 1.4 mmol) in a 100 mL RBF was dried by three successive distillations of toluene. Diisopropylammonium tetrazolide (0.096 g, 0.56 mmol) and 4 Å molecular sieves were added to the flask. The flask was purged three times and then backfilled with nitrogen, and the solid was suspended in DCM (40 mL). Only part of the solid dissolved. To the mixture was added 2-cyanoethyl N,N,N’,N’-tetraisopropylphosphorodiamidite (0.65 g, 2.2 mmol), and the reaction was stirred for 18 hours. After 18 hours, LC-MS indicated that no starting alcohol remained. The reaction was transferred to a separatory funnel, washed with saturated aqueous NaHCO3 (2 × 40 mL) and water (40 mL), and concentrated to dryness. Hexane was added to the flask and the residue was stirred in hexane for 2 hours to give a white precipitate. The white solid was collected by filtration, washed with hexane (2 × 20 mL), and dried under vacuum to give 0.678 grams (77% yield) of LP465-p as a white solid.

[0389] Synthesis of LP466-p

Chem.

[0390] Compound 7 (0.22 g, 0.50 mmol) and tert-butyl 3-aminobicyclo[1.1.1]pentane-1-carboxylate (0.0915 g, 0.50 mmol) were dissolved in DCM (10 mL), and triethylamine (0.21 mL, 1.5 mmol) was added. After 18 h, according to LC-MS, <2% of the starting NHS ester remained. The reaction mixture was concentrated and directly loaded onto a silica gel column for purification. The product was purified by column chromatography, from 0% EtOAc / 100% hexane to 50% EtOAc / 50% hexane. Fractions 3 - 5 were combined to give 0.23 g (89% yield) of compound 10 as a white solid.

Chemical Structure

[0391] Compound 10 (0.23 g, 0.45 mmol) was dissolved in DCM (3 mL), and trifluoroacetic acid (3 mL) was added. The solution was stirred overnight. After 18 h, according to LC-MS, no SM was present. The reaction mixture was concentrated, and then the residual TFA was removed by azeotropic distillation with toluene twice to give 0.189 mg (93%) of compound 11 as a white solid.

Chemical Structure

[0392] Compound 11 (0.189 g, 0.48 mmol) and COMU (0.215 g, 0.5 mmol) were dissolved in DCM (10 mL), and triethylamine (0.333 mL, 2.4 mmol) was added. The reaction was stirred for about 5 min, then 6-amino-1-hexanol (0.059 g, 0.5 mmol) was added. After 1 h, according to LC-MS, no starting material remained. The reaction mixture was concentrated, and water was added to the residue. The mixture was sonicated until all materials were suspended in water, the precipitate was collected by filtration, and washed three times with water. The precipitate was dried in vacuo to give 0.166 g (70% yield) of compound 12 as a white solid. [Chemistry]

[0393] Compound 12 (0.166 g, 0.3 mmol) in 100 mL of RBF was dried by two successive distillations of toluene. Diisopropylammonium tetrazolide (0.02 g, 0.12 mmol) and 4 Å molecular sieves were added to the flask. The flask was purged three times and then backfilled with nitrogen, and the solid was suspended in DCM (20 mL). Only a part of the solid dissolved. 2-Cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (0.14 g, 0.46 mmol) was added to the mixture, and the reaction was stirred for 18 hours. After 18 hours, LC-MS indicated that there was no remaining starting alcohol. The reaction was transferred to a separatory funnel and washed with saturated aqueous NaHCO3 (2 × 40 mL), water (40 mL), and brine (40 mL), dried over magnesium sulfate, and concentrated to dryness. Hexane was added to the flask, and the residue was stirred in hexane for 1 hour to obtain a white precipitate. The white solid was collected by filtration, washed with hexane (2 × 20 mL), and dried under vacuum to give 0.116 grams (51% yield) of LP-466p as a white waxy solid.

[0394] Synthesis of LP493-p (designated as LP493-p uridine) [Chemistry]

[0395] A solution of 1-bromohexadecane-16-ol (6.0 g, 18.7 mmol) in DCM (90 mL) was added with triethylamine (2.9 mL, 20.5 mmol). The resulting solution was cooled to 0 °C in an ice / water bath. After cooling, acetyl chloride (1.46 mL, 20.5 mmol) was added dropwise. After the addition was complete, the reaction was stirred at 0 °C for 1 hour, then returned to room temperature and stirred overnight. After about 18 hours, the reaction mixture was washed with saturated NaHCO3 (20 mL), water, 1 M HCl (20 mL), water (2×20 mL), brine (20 mL), dried over sodium sulfate, and concentrated to a white solid. The crude product was purified by silica gel chromatography (0:100 EtOAc:hexane to 20:80 EtOAc:hexane). The product was eluted with 10% EtOAc. Fractions 5 - 12 were concentrated to give 6.02 g (89% yield) of compound 29 as a white powder.

Chemical Structure

[0396] Compound 31 was prepared according to the literature procedure. Compound 31 (1.0 g, 2.1 mmol), compound 29 (1.53 g, 4.2 mmol), and tetrabutylammonium iodide (1.6 g, 0.42 mmol) were placed in an oven-dried flask. The flask was evacuated and purged with nitrogen three times, then dry DMF (10 mL) was added to the flask. The solution was heated to 110 °C over 18 hours. After 18 hours, the reaction was cooled to room temperature and the solvent was removed in vacuo. The residue was resuspended in DCM / MeOH and concentrated on silica gel for purification. The column was eluted with 3% MeOH / 97% DCM to 20% MeOH / 80% DCM. Fractions containing the 2’ and 3’-addition products were pooled and concentrated to give 0.236 g (21% yield) of compound 30 and the 3’-addition product.

Chemical Structure

[0397] The compound 30 + 3'-adduct (0.23 g, 0.44 mmol) was dried by successive distillation of toluene and anhydrous pyridine using a rotary evaporator. DMAP (0.003 g, 0.022 mmol) and dimethoxytrityl chloride (0.165 g, 0.49 mmol) were added to the flask, and the flask was evacuated and purged with nitrogen three times. The solid was dissolved in pyridine (10 mL). The reaction mixture was stirred overnight at room temperature. All volatiles were removed, and the residual pyridine was removed by co-distillation with toluene. The residue was partitioned between DCM (20 mL) and aqueous NaHCO3 (20 mL). The organic phase was separated, the aqueous portion was extracted with DCM (20 mL), and the combined organic phases were dried (Na2SO4) and concentrated. The crude product was purified by silica gel chromatography. The silica was pretreated with a 50:50 mixture of hexane / EtOAc + 2% v / v triethylamine. The product was isolated by CombiFlash using a 40 g column, eluent: hexane - ethyl acetate + 1% Et3N, and the 20 - 60% compound was eluted with 60% EtOAc. The slower fractions were contaminated with the 3'-alkylated product. The fractions containing the pure 2'-alkylated product were combined and concentrated to give 0.107 g (27% yield) of compound 32 as a white solid.

Chemical formula

[0398] Into a 25 mL RBF, compound 32 (0.150 g, 0.18 mmol), diisopropylammonium tetrazolide (0.043 g, 0.25 mmol), and 4 Å molecular sieves were placed, and then the flask was evacuated and purged with nitrogen three times. DCM (5 mL) was added, followed by the dropwise addition of 2-cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (0.092 mL, 0.29 mmol). The reaction mixture was stirred overnight. The reaction mixture was quenched with ~2 mL of saturated NaHCO3, filtered into a separatory funnel, the layers were separated, and the NaHCO3 layer was extracted one more time with DCM (10 mL). The combined organic layers were dried over Na2SO4 and concentrated to a thick viscous liquid. The crude product was purified by silica gel chromatography (from 0:100 EtOAc:hexane to 100:0 EtOAc:hexane). The silica was pretreated with a 50:50 mixture of hexane / EtOAc + 2% v / v triethylamine. The product was eluted with 45% EtOAc. Fractions 15 - 35 were found to contain the product along with a small amount of oxidized product contaminants, so they were combined to give 0.088 g (47% yield) of compound 33 as a sticky colorless solid. Fractions 36 - 50 were combined to give 44 mg of a sticky colorless solid, but it contained a product with more oxidized material.

[0399] Synthesis of (2C8C12) Phosphoramidite

Chemical Structure

[0400] 2-Octyl-1-decanol (1.00 g, 3.35 mmol) and diisopropylammonium tetrazolide (0.2868 g, 1.68 mmol) were placed in a flask, and the flask was purged with nitrogen. DCM (50 mL) was added to the mixture, and 2-cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (2.66 mL, 8.37 mmol) was added dropwise. At the end of the reaction, 3 mL of triethylamine was added to the reaction, and then the reaction was concentrated directly onto celite for purification. The crude product was purified by silica gel chromatography (from 0:100 EtOAc:hexane + 2% triethylamine to 100:0 EtOAc:hexane + 2% triethylamine). The product was eluted with 100% hexane. The fractions containing the product were concentrated to 1.268 g (76% yield) of a clear liquid.

[0401] (2C6C10) Phosphoramidite synthesis

Chemical formula

[0402] 2-Hexyl-1-decanol (1.00 g, 4.13 mmol) and diisopropylammonium tetrazolide (0.353 g, 2.06 mmol) were placed in a flask, and the flask was purged with nitrogen. DCM (50 mL) was added to the mixture, and 2-cyanoethyl N,N,N’,N’-tetraisopropyl phosphorodiamidite (3.27 mL, 10.3 mmol) was added dropwise. At the end of the reaction, 3 mL of triethylamine was added to the reaction, and then the reaction was concentrated directly onto celite for purification. The crude product was purified by silica gel chromatography (from 0:100 EtOAc:hexane + 2% triethylamine to 100:0 EtOAc:hexane + 2% triethylamine). The product was eluted with 100% hexane. The fractions containing the product were concentrated to 1.32 g (72% yield) of a clear liquid.

[0403] Synthesis of HO-C16 Phosphoramidite [Chemical formula]

[0404] 1,16-Hexadecanediol and N,N-diisopropylethylamine (0.100 g) were dissolved in 2 mL of THF. 4,4'-Dimethoxytrityl chloride (2.2 g, 6.6 mmol) was slowly added as a solid. After 2 hours, the reaction mixture was concentrated by rotary evaporation, and the product was purified by column chromatography (25% ethyl acetate / 75% hexane).

[0405] DMT-O-C 16 -OH (0.200 g), Bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.227 mL), and Bis diisopropylammonium tetrazolide (0.0611 g) were dissolved in anhydrous DCM at room temperature. The reaction mixture was sealed and stirred overnight. The conversion was measured by LC-MS (0.25 M NH4HCO3:H2O buffer system). Celite® was added to the reaction mixture and it was concentrated under vacuum until a white powder remained. The mixture was dry-packed onto a silica column (12 grams) using an EtOAc / hexane (1% triethylamine) solvent system to prevent hydrolysis from the silica gel. [1] . The product was 31 characterized by 31P NMR, 1 1H NMR, and LC-MS.

[0406] Synthesis of C16 Phosphoramidite [Chemical formula]

[0407] Cetyl alcohol (1.10 g), Bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.88 mL), and Bis diisopropylammonium tetrazolide (0.778 g) were dissolved in anhydrous DCM at room temperature. The reaction mixture was sealed and stirred overnight. Conversion was measured by LC-MS (0.25 M NH4HCO3:H2O buffer system). Celite® was added to the reaction mixture and it was concentrated under vacuum until a white powder remained. The mixture was dry-packed onto a silica column (12 grams) using an EtOAc / hexane (1% triethylamine) solvent system to prevent hydrolysis from the silica gel. The desired product was not retained in the column and eluted immediately after packing. The isolated product was then characterized by LC-MS, 1 1H NMR and 31 31P NMR. Final yield: 856.5 mg (93.8%).

[0408] Synthesis of C22 Phosphoramidite

Chemical formula

[0409] Docosanol (1.10 g), Bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.1 mL), and Bis diisopropylammonium tetrazolide (0.577 g) were dissolved in anhydrous DCM at room temperature. The reaction mixture was sealed and stirred overnight. Conversion was measured by LC-MS (0.25 M NH4HCO3:H2O buffer system). Celite® was added to the reaction mixture and it was concentrated under vacuum until a white powder remained. The mixture was dry-packed onto a silica column (12 grams) pretreated with 3 mL of triethylamine using an EtOAc / hexane (1% triethylamine) solvent system to prevent hydrolysis from the silica gel. The isolated product was then characterized by LC-MS, 1 1H NMR and 31 31P NMR. Final yield: 2.1085 g (118.8%).

[0410] Conjugation of Lipid PK / PD Modulator Precursors

[0411] Either before or after annealing, one or more lipid PK / PD modulator precursors can be linked to the RNAi agents disclosed herein. The general conjugation process used to link lipid PK / PD modulator precursors to the constructs defined in the examples shown herein is described below.

[0412] A. Conjugation of Activated Ester PK / PD Modulators

[0413] The following procedure was used to conjugate a PK / PD modulator having an activated ester moiety such as TFP (tetrafluorophenoxy) or PNP (paranitrophenol) to an RNAi agent having an amine-functionalized sense strand such as C6-NH2, NH2-C6, or (NH2-C6). The annealed RNAi agent dried by lyophilization was dissolved in DMSO and 10% water (v / v%) at 25 mg / mL. Then, 50 - 100 equivalents of TEA and 3 equivalents of the activated ester PK / PD modulator were added to the solution. The solution was reacted for 1 - 2 hours while being observed by RP-HPLC-MS (mobile phase A: 100 mM HFIP, 14 mM TEA, mobile phase B: acetonitrile, Waters™ XBridge C18 column, by Waters Corp.).

[0414] The product was then precipitated by adding 12 mL of acetonitrile and 0.4 mL of PBS, and the solid was centrifuged into a pellet. The pellet was then redissolved in 0.4 mL of 1×PBS and 12 mL of acetonitrile. The resulting pellet was dried under high vacuum for 1 hour.

[0415] B. Conjugation of Phosphoramidite PK / PD Modulators

[0416] A PK / PD modulator having a phosphoramidite moiety can also be attached to a resin using typical oligonucleotide manufacturing conditions.

[0417] C. Hydrolysis of the PK / PD Modulator

[0418] Certain PK / PD modulators are hydrolyzed under the cleavage and deprotection conditions described in Example 1 above. For example, LP-429p, LP-456p, LP-462p, LP-463p, LP-464p, LP-466p, LP-493p, and HO-C16 phosphoramidite all contain moieties that are hydrolyzed under cleavage and deprotection conditions.

[0419] LP-465p is hydrolyzed after conjugation to an oligonucleotide chain in a 0.5 - 1M potassium carbonate solution in 1:1 methanol:water and heated to 50 - 60 °C for about 4 hours.

[0420] Example 2. In Vivo Knockdown of SOD1 in Transgenic B6.Cg-Tg(SOD1*G93A) Mice

[0421] On the first day of the test, B6.Cg-Tg(SOD1*G93A) mice were injected with either 10 μL of phosphate-buffered saline (PBS) according to Table 12 below, or for groups 2, 4, and 6, 10 μL of a compound formulation at a concentration of 5 mg / mL in PBS, or for groups 3, 5, and 7, 10 μL of a compound formulation at a concentration of 20 mg / mL in PBS:

[0422]

Table 15

[0423] In each group, four mice (n = 4) were dosed. The mice were injected intracerebroventricularly on day 1. On day 12, the mice were euthanized, and the left half of the brain and the thoracic spinal cord were harvested and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results for each group are shown in Table 13 below:

[0424]

Table 16

[0425] As shown in Table 13, the SOD1 RNAi agents AC001455 and AC001465 showed dose-dependent improvement in mRNA knockdown in all tissues analyzed, exceeding that of the PBS-administered group.

[0426] Example 3. In Vivo Knockdown of SOD1 in Transgenic B6.Cg-Tg(SOD1*G93A) Mice

[0427] On the first day of the test, B6.Cg-Tg(SOD1*G93A) mice were injected with either 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of a compound formulation at a concentration of 7 mg / mL in aCSF, according to Table 14 below:

[0428]

Table 17

[0429] The mice were injected intracerebroventricularly on day 1. On day 12, the mice were euthanized, and the left half of the brain and the thoracic spinal cord were harvested and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results for each group of the thoracic spinal cord are shown in Table 15 below:

[0430]

Table 18

[0431] As shown in Table 15, in some dosing groups, significant improvements in mRNA knockdown were shown, exceeding the aCSF administration group. For example, the SOD1 RNAi agent AC001455 showed a reduction of approximately 32% (0.680), and the SOD1 RNAi agent AD001461 showed a reduction of approximately 35% (0.643).

[0432] Example 4. In Vivo Knockdown of SOD1 in Transgenic Tg SOD1 G93A Mice

[0433] On the first day of the test, Tg SOD1 G93A mice were injected with either 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of a compound formulation at a concentration of 10 mg / mL in aCSF according to Table 16 below:

[0434]

Table 19

[0435] The mice were injected intracerebroventricularly on the first day. On the eighth day, the mice were euthanized, and the left half of the brain and the thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the left half of the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results for each group are shown in Table 17 below:

[0436]

Table 20

[0437] As shown in Table 17, all dosing groups showed numerical improvements in mRNA knockdown that exceeded the aCSF administration group in all tissues analyzed, and AC001455, AC001461, and AC001623 showed particularly robust inhibition across several different tissue types.

[0438] Example 5. In Vivo Knockdown of SOD1 in Transgenic Tg SOD1 G93A Mice

[0439] On the first day of the test, Tg SOD1 G93A mice were injected with either 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of a compound formulation at a concentration of 10 mg / mL in aCSF, according to Table 18 below:

[0440] [Table 21]

[0441] The mice were injected intracerebroventricularly on the first day. On the eighth day, the mice were euthanized, and the left half of the brain and the thoracic spinal cord were harvested and stored in 10% NBF. Tissue samples were taken from the left half of the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results for each group are shown in Table 19 below:

[0442] [Table 22]

[0443] As shown in Table 19, all dosing groups showed numerical improvements in mRNA knockdown that exceeded the aCSF administration group in all tissues analyzed. Notably, AC001813, AC001814, and AC001818 showed particularly potent inhibition of SOD1 gene expression across all experimental tissues.

[0444] Example 6. In Vivo Knockdown of SOD1 in Transgenic Tg SOD1 G93A Mice

[0445] On the first day of the test, Tg SOD1 G93A mice were injected with either 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of a compound formulation at a concentration of 10 mg / mL in aCSF, according to Table 20 below:

[0446] [Table 23]

[0447] The mice were injected intracerebroventricularly on the first day. On the eighth day, the mice were euthanized, and the left half of the brain and the thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the left half of the thoracic spinal cord, the cerebral cortex, the cerebellum, and the brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results for each group are shown in Table 21 below:

[0448] [Table 24]

[0449] As shown in Table 21, almost all dosing groups showed improved mRNA knockdown, exceeding the aCSF administration group, in most of the tissues analyzed.

[0450] Example 7. In Vivo Knockdown of SOD1 in Transgenic Tg SOD1 G93A Mice

[0451] On the first day of the test, Tg SOD1 G93A mice were injected with either 10 μL of artificial cerebrospinal fluid (aCSF) or 10 μL of a compound formulation at a concentration of 5 mg / mL in aCSF, according to Table 22 below:

[0452] [Table 25]

[0453] On the first day, the mouse was injected intracerebroventricularly. On the eighth day, the mouse was euthanized, and the left half of the brain and the thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the left half of the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results for each group are shown in Table 23 below:

[0454]

Table 26

[0455] As shown in Table 23, all dosing groups showed improvement in mRNA knockdown that exceeded the aCSF administration group in all tissues analyzed.

[0456] Example 8. In Vivo Knockdown of SOD1 in Transgenic Tg SOD1 G93A Mice

[0457] On the first day of the test, Tg SOD1 G93A mice were injected with either 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of a compound formulation at a concentration of 5 mg / mL in aCSF, according to Table 24 below:

[0458]

Table 27

[0459] On the first day, the mouse was injected intracerebroventricularly. On the eighth day, the mouse was euthanized, and the left half of the brain and the thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the left half of the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results for each group are shown in Table 25 below:

[0460]

Table 28

[0461] As shown in Table 25, all dosing groups showed improvement in mRNA knockdown that exceeded the aCSF administration group in the thoracic spinal cord, cerebellum, and brainstem.

[0462] Example 9. In Vivo Knockdown of SOD1 in Transgenic Tg SOD1 G93A Mice

[0463] On the first day of the test, Tg SOD1 G93A mice were injected with either 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of a compound formulation at a concentration of 3 mg / mL in aCSF, according to Table 26 below:

[0464]

Table 29

[0465] The mice were injected intracerebroventricularly on the first day. On the eighth day, the mice were euthanized, and the left half of the brain and the thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the left half of the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results for each group are shown in Table 27 below:

[0466]

Table 30

[0467] Example 10. In Vivo Knockdown of SOD1 in Transgenic Tg SOD1 G93A Mice

[0468] On the first day of the test, Tg SOD1 G93A mice were injected with either 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of a compound formulation at a concentration of 3 mg / mL in aCSF, according to Table 28 below:

[0469]

Table 31

[0470] The mice were injected intracerebroventricularly on the first day. On the eighth day, the mice were euthanized, and the left half of the brain and the thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the left half of the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results for each group are shown in Table 29 below:

[0471]

Table 32

[0472] Example 11. In Vivo Knockdown of SOD1 in Transgenic Tg SOD1 G93A Mice

[0473] On the first day of the test, Tg SOD1 G93A mice were injected with either 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of a compound formulation at a concentration of 1 mg / mL in aCSF for groups 2 - 4, or 3 mg / mL in aCSF for groups 5 - 7, and 10 mg / mL in aCSF for groups 8 - 10, according to Table 30 below:

[0474]

Table 33

[0475] On the first day, it was injected into the cerebral ventricle of the mouse. On the eighth day, the mouse was euthanized, and then the left half of the brain and the thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the left half of the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results of each group are shown in Table 31 below:

[0476]

Table 34

[0477] As shown in Table 31, almost all dosing groups showed improvement in mRNA knockdown that exceeded the aCSF administration group in all tissues analyzed.

[0478] Example 12. In Vivo Knockdown of SOD1 in Transgenic Tg SOD1 G93A Rats

[0479] On the first day of the test, Tg SOD1 G93A rats were injected with either 30 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) according to Table 32 below, or for groups 2 - 6, 30 μL of either compound formulation at concentrations of 0.33, 1.0, 3.33, 10, and 30 mg / mL in aCSF, respectively:

[0480]

Table 35

[0481] The rats were injected into the subarachnoid space on the first day. On the 85th day, CSF was collected from each animal, then the rats were euthanized, and the left half of the brain and the thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the left half of the thoracic spinal cord, cerebral cortex, cerebellum, and brainstem. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The averaged results of each group are shown in Table 33 below:

[0482]

Table 36

[0483] As shown in Table 33 above, a dose-dependent decrease in SOD1 mRNA expression was observed in transgenic rats treated with AD12261 (also known as AC910358). In fact, at the highest dose of 900 μg, the SOD1 RNAi agent AD12261 achieved a reduction of approximately 27% (0.733) in the cerebral cortex; approximately 69% (0.316) in the cerebellum; approximately 79% (0.217) in the thoracic spinal cord; and approximately 40% (0.605) in the brainstem.

[0484] Example 13. In Vivo Knockdown of SOD1 in Cynomolgus Monkeys

[0485] On the first day of the test, cynomolgus monkeys were injected with either artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or a compound formulation containing 45 mg of AD12261 in aCSF, according to Table 34 below:

[0486]

Table 37

[0487] In Group 1 (control), 4 monkeys (n = 4) were dosed, and in Groups 2, 3, and 4 (trigger treatment), 5 monkeys (n = 5) were dosed. The monkeys were injected into the subarachnoid space on the first day. On the 29th day of the investigation, the animals in Groups 1 and 2 were euthanized, and brain and spinal cord tissues were harvested from each animal. On the 85th day of the investigation, the animals in Group 3 were euthanized, and brain and spinal cord tissues were harvested from each animal. On the 168th day of the investigation, the animals in Group 4 were euthanized, and brain and spinal cord tissues were harvested from each animal. The samples were analyzed by qPCR for SOD1 mRNA knockdown. The average results for each group relative to Group 1 are shown in Table 35 below:

[0488]

Table 38-1

Table 38-2

[0489] As shown in Table 35 above, a long-term (up to 168 days after a single intrathecal injection) reduction in SOD1 mRNA expression was observed in many tissues in non-human primates treated with AD12261. Other embodiments

[0490] The present invention has been described in conjunction with its detailed description, but it should be understood that the foregoing description is intended to illustrate, and not limit, the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. RNAi agents for inhibiting the expression of the superoxide dismutase 1 (SOD1) gene, as follows: The following nucleic acid bases (5'→3'): UGAGAUCACAGAAUCUUCAAC (Sequence ID 1105) and an antisense strand containing at least 17 consecutive nucleotides that are different by 0 or 1 nucleotide; and The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand. RNAi agents containing [specific components].

2. The RNAi agent according to claim 1, wherein at least one nucleotide of the SOD1 RNAi agent is a modified nucleotide or comprises a modified nucleoside bond.

3. The RNAi agent according to claim 1, wherein all or substantially all of the nucleotides are modified nucleotides.

4. The RNAi agent according to claim 3, wherein the modified nucleotide is selected from the group consisting of 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-seconucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, inverted nucleotide, inverted 2'-O-methylnucleotide, inverted 2'-deoxynucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3'-O-methylnucleotide.

5. The RNAi agent according to claim 1, wherein the sense strand and the antisense strand are each 21 nucleotides long.

6. The RNAi agent according to claim 5, wherein the RNAi agent has two blunt ends.

7. The RNAi agent according to claim 1, wherein the sense strand comprises one or two inverted debase residues.

8. The sense strand has the following nucleotide sequence (5'→3'): GUUGAAGAUUCUGUGAUCUCA (Sequence ID 1172), The RNAi agent according to claim 1, comprising, essentially, a nucleotide sequence that is 0 or 1 nucleotide different, or comprising a nucleotide sequence that is 0 or 1 nucleotide different.

9. The following nucleotide sequence (5'→3'): cPrpusGfsaGfaucacagAfaUfcUfucasasc (SEQ ID NO: 646) and comprising an antisense chain containing a modified nucleotide sequence that differs by 0 or 1 nucleotide, an antisense chain consisting of a modified nucleotide sequence that differs by 0 or 1 nucleotide, or an antisense chain essentially consisting of a modified nucleotide sequence that differs by 0 or 1 nucleotide; The RNAi agent according to claim 1, wherein in the sequence a, c, g, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpu represents 5'-cyclopropyl-2'-O-methyluridine phosphonate; s represents a phosphorothioate linkage; and in the sequence, all or substantially all of the nucleotides in the sense strand are modified nucleotides.

10. The sense strand has the following nucleotide sequence (5'→3'): guugaagaUfuCfuGfugaucuca (Sequence ID 771), and comprising, consisting of, or essentially consisting of, a modified nucleotide sequence that differs by 0 or 1 nucleotide; The RNAi agent according to claim 1, wherein in the sequence a, c, g, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Cf, Gf, and Uf represent 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and s represents a phosphorothioate linkage; and in the sequence all or substantially all of the nucleotides of the antisense strand are modified nucleotides.

11. The RNAi agent according to claim 10, wherein the sense strand further comprises an inverted debase residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both.

12. The RNAi agent according to claim 1, wherein the RNAi agent is linked to a lipid portion.

13. The aforementioned lipid portion is as follows: Table 1-1 Table 1-2 Table 1-3 Table 1-4 Table 1-5 Table 1-6 Table 1-7 Table 1-8 It is selected from the group consisting of, in the formula, 【Chemistry 1】 The RNAi agent according to claim 12, wherein indicates a connection site to the RNAi agent.

14. The RNAi agent according to claim 12, wherein the lipid portion is conjugated to the sense strand.

15. The RNAi agent according to claim 14, wherein the lipid portion is conjugated to the 5' end of the sense strand.

16. A composition comprising an RNAi agent according to any one of claims 1 to 15, further comprising a pharmaceutically acceptable excipient.

17. The composition according to claim 16, further comprising a second RNAi agent capable of inhibiting the expression of the superoxide dismutase 1 gene.

18. The composition according to claim 16, further comprising one or more additional therapeutic agents.

19. The composition according to claim 16, wherein the RNAi agent is a sodium salt.

20. The composition according to claim 16, wherein the pharmaceutically acceptable excipient is water for injection.

21. The composition according to claim 16, wherein the pharmaceutically acceptable excipient is buffered saline.

22. The composition according to claim 16, for use in a method for inhibiting the expression of the SOD1 gene in cells.

23. The composition according to claim 22, wherein the aforementioned cells are present within the target.

24. The composition according to claim 23, wherein the subject is a human subject.

25. The composition according to claim 16, for use in a method of treating one or more symptoms or diseases associated with enhanced or elevated levels of mutant SOD1 activity.

26. The composition according to claim 25, wherein the disease is a neurodegenerative disease.

27. The composition according to claim 26, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or Alzheimer's disease.

28. The composition according to claim 25, wherein the disease is ALS.

29. The composition according to claim 28, wherein the disease is SOD1-related familial ALS.

30. The composition according to claim 16, wherein the RNAi agent is administered at a dose of approximately 0.01 mg / kg to approximately 5.0 mg / kg per body weight of the subject.

31. Use of an RNAi agent according to any one of claims 1 to 15 for the treatment of a disease, disorder, or condition mediated at least partially by mutant SOD1 activity and / or SOD1 gene expression.

32. Use of the composition according to claim 16 for the manufacture of a pharmaceutical product for the treatment of a disease, disorder, or condition mediated at least partially by superoxide dismutase 1 (SOD1) and / or superoxide dismutase 1 (SOD1) gene expression.

33. The use according to claim 31, wherein the disease is a neurodegenerative disease.

34. The use according to claim 32, wherein the disease is a neurodegenerative disease.