Indazole macrocycle and its use
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- BLOSSOMHILL THERAPEUTICS INC
- Filing Date
- 2023-06-07
- Publication Date
- 2026-06-15
AI Technical Summary
Existing FLT3 inhibitors face the problem of drug resistance, especially their effectiveness against FLT3 mutations and drug-resistant cancer cells. PIM and CLK kinases play an important role in the drug resistance mechanism, and existing treatment plans are difficult to effectively target these kinases.
A series of novel multi-target FLT3 inhibitors have been developed to inhibit their abnormal activity by targeting FLT3 mutations, drug-resistant FLT3 mutations and other kinases such as PIM and CLK kinases by designing specific structure compounds such as compounds of Formula I, Formula II and Formula III, combining FLT3, PIM and CLK kinases.
These compounds can effectively inhibit FLT3 mutations and drug-resistant FLT3 mutations, enhance the therapeutic effect on drug-resistant cancer cells, provide more lasting disease control, and overcome the drug resistance limitations of existing treatment plans.
Smart Images

Figure 2023240140000001 
Figure 2023240140000002 
Figure 2023240140000003
Abstract
Description
Technical Field
[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 350,307, filed on June 8, 2022, and U.S. Provisional Patent Application No. 63 / 501,114, filed on May 9, 2023, and incorporates by reference in its entirety the disclosures of those applications herein.
[0002] Sequence Listing This application includes a sequence listing that was electronically submitted in XML format and is incorporated by reference in its entirety herein. The XML copy created on May 23, 2023, is named 83573-390331_SL.xml and is 21,203 bytes in size.
[0003] The present disclosure relates to indazole macrocyclic compounds, pharmaceutical compositions containing the macrocyclic compounds, and methods of using the macrocyclic compounds to treat diseases such as cancer.
Background Art
[0004] Protein kinases are tightly regulated signaling proteins that modulate the activation of signal transduction cascades by phosphorylating target proteins in response to extracellular and intracellular stimuli. The human genome encodes approximately 518 protein kinases (Manning G et al., The protein kinase complement of the human genome. Science. 2002, 298: 1912-34). Dysregulation of kinase activity is associated with numerous diseases, including cancer and cardiovascular, degenerative, immune, infectious, inflammatory, and metabolic disorders (Levitzki, A., Protein kinase inhibitors as a therapeutic modality. Acc. Chem. Res. 2003, 36:462-469). The molecular basis for various diseases includes gain-of-function and loss-of-function mutations, gene amplifications and deletions, splicing changes, and translocations of kinases (Wilson L J et al., New Perspectives, Opportunities, and Challenges in Exploring the Human Protein Kinome. Cancer Res. 2018, 78:15-29). Because kinases play a critical role in cancer and other diseases, kinases are attractive targets in drug discovery, and 62 small molecule kinase inhibitors have been approved, 55 of which are cancer-targeted therapeutics (Roskoski R Jr, Properties of FDA-approved Small Molecule Protein Kinase Inhibitors: A 2021 Update. Pharmacol Res 2021, 165: 105463). Kinase inhibitors have achieved dramatic success in cancer-targeted therapies, but the development of treatment resistance remains an issue for small molecule kinase inhibitors.Secondary mutations acquired within the kinase domain during treatment often lead to treatment resistance to kinase inhibitors (Pottier C et al., Tyrosine Kinase Inhibitors in Cancer: Breakthrough and Challenges of Targeted Therapy. Cancers (Basel), 2020, 12:731). Resistance can also arise from subpopulations of tolerant / persistent cells that survive in the presence of the therapeutic agent. The emergence of resistant persistent cells involves different processes, including the rebound of pathways through the release of negative feedback loops, transcriptional rewiring mediated by chromatin remodeling, and autocrine / paracrine communication between tumor cells and within the tumor microenvironment (Swayden M et al., Tolerant / Persister Cancer Cells and the Path to Resistance to Targeted Therapy. Cells 2020, 9, 2601). Therefore, there is a need to find kinase inhibitors that can target not only the oncogenic drivers of kinases that overcome the most frequent resistance mutations but also resistant persistent cancer cells to overcome resistance and achieve better efficacy and longer-term disease control.
[0005] Acute myeloid leukemia (AML) is a complex malignancy with many cytogenetic or chromosomal abnormalities. The most frequently identified mutation in AML is FMS-like tyrosine kinase 3 (FLT3), with approximately 25% of adult patients having FLT3 internal tandem duplications (FLT3-ITD) and 7-10% having point mutations or deletions (Daver N et al., Targeting FLT3 mutations in AML: review of current knowledge and evidence. Leukemia 2019, 33:299-312). Two FLT3 inhibitors, midostaurin, which is used in combination with standard induction and consolidation chemotherapy for newly diagnosed FLT3-mutated AML, and gilteritinib as monotherapy for relapsed or refractory FLT3-mutated AML, have been approved by the Food and Drug Administration (FDA) for AML indications. Although there have been significant advances in the treatment of AML with FLT3 inhibitors, leukemia relapse still remains the main cause of treatment failure. The mechanisms of action of drug resistance include the evolution of FLT3 resistance mutations, adaptive cellular mechanisms, and the protective leukemic microenvironment. The sites where resistance mutations frequently occur are the activation loop residues of FLT3 (e.g., D835, I836, D839, and Y842) or F691 of the gatekeeper residue. Changes in the leukemic microenvironment, including enhanced FGF2 and CXCL12 / CXCR4 signaling, can protect FLT3-mutated progenitor cells. Enhanced signaling through parallel survival-promoting pathways, including the RAS-RAF-MEK-ERK, PI3K-AKT-mTOR, and JAK-STAT5-PIM1 pathways, may also contribute to resistance to FLT3 inhibitors (Short NJ et al., Advances in the Treatment of Acute Myeloid Leukemia: New Drugs and New Challenges. Cancer Discov. 2020, 10: 506-525).
[0006] The Moloney murine leukemia virus (PIM) kinase incorporating the provirus is an oncogenic serine / threonine kinase that phosphorylates a wide range of substrates that control several features of cancer, including tumor metabolism, survival, metastasis, immune evasion, and inflammation (Toth RK, Warfel NA. Targeting PIM Kinases to Overcome Therapeutic Resistance in Cancer. Mol Cancer Ther. 2021, 20(1): 3-10). The PIM kinase interacts with numerous major oncogenic factors, including stabilization of p53, synergism with c-Myc, and notable parallel signaling with PI3K / Akt. Aberrant PIM kinase activity plays an important role in the resistance mechanisms of chemotherapy, radiotherapy, anti-angiogenic therapy, and targeted therapy, providing a basis for co-targeting therapeutic solutions to obtain a more sustained patient response (Malone T et al., Current perspectives on targeting PIM kinases to overcome mechanisms of drug resistance and immune evasion in cancer. Pharmacol Ther 2020 Mar; 207).
[0007] Cdc-like kinases (CLKs) are evolutionarily conserved dual-specificity kinases that can phosphorylate serine, threonine, and tyrosine residues. CLKs catalyze the phosphorylation of SR proteins, serine- and arginine-rich splicing factors 1-12 (SRSF1-12), which control the spliceosome molecular machinery (Martin Moyano P et al., Cdc-Like Kinases (CLKs): Biology, Chemical Probes, and Therapeutic Potential. Int J Mol Sci 2020, 21(20): 7549). Aberrant regulation of alternative splicing is a hallmark of cancer. Frequent mutations in SF3B1 or SRSF2 have been described in patients with myelodysplastic syndromes (MDS), chronic myelomonocytic leukemia, and acute myeloid leukemia (AML) (Papaemmanuil et al., Genomic classification and prognosis in acute myeloid leukemia. N Engl J Med. 2016, 374: 2209-2221). In addition, mutations in splicing-related genes have been found in various solid cancers, including lung cancer, breast cancer, and pancreatic cancer (Dvinge H et al., RNA splicing factors as oncoproteins and tumour suppressors. Nat Rev Cancer 2016, 16: 413-430). Regulation of pre-mRNA splicing through inhibition of CLK kinases is an attractive anti-tumor strategy, especially for cancers that exhibit abnormal pre-mRNA splicing.
[0008] Therefore, it is necessary to develop a new generation of multi-target FLT3 inhibitors that are potent against oncogenic FLT3 mutations, other newly emerging and established FLT3 resistance mutations, and newly emerging resistance targets in resistant / persistent cancer cells, such as PIM kinases and CLK kinases. SUMMARY OF THE INVENTION
[0009] In one aspect, the present disclosure provides a compound of formula I:
Chemical formula
[0010] In some embodiments, the disclosure provides a compound of formula II: [Chemical formula] [wherein: R 1 , R 2 , R 3 , R 4 , R 5 , A, B, L, m, n, p, q, and [Chemical formula] are as described herein] provides a compound represented by formula (II), or a pharmaceutically acceptable salt thereof.
[0011] In some embodiments, the disclosure provides a compound of formula III: [Chemical formula] [wherein: R 1 , R 2 , R 3 , R 4 , R 5 , A, B, L, X 1 , X 2 , X 3 , m, n, p, q, and [Chemical formula] are as described herein] provides a compound represented by formula (III), or a pharmaceutically acceptable salt thereof.
[0012] In a further aspect, the disclosure relates to a pharmaceutical composition comprising at least one compound of formula (I)-(VI) or a pharmaceutically acceptable salt thereof. The pharmaceutical composition according to the disclosure may further comprise a pharmaceutically acceptable excipient. In a further aspect, the disclosure relates to at least one compound of formula (I)-(VI) or a pharmaceutically acceptable salt thereof for use as a medicament.
[0013] In a further aspect, the disclosure relates to a method of treating a disease such as cancer, the method comprising administering to a subject in need thereof an effective amount of at least one compound of formula (I)-(VI) or a pharmaceutically acceptable salt thereof. In a further aspect, the disclosure relates to the use of a compound of formula (I)-(VI) or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for treating a disease such as cancer, and to the use of such a compound and salt for treating such a disease.
[0014] In a further aspect, the disclosure relates to a method of inhibiting one or more abnormal FLT3s, including mutations of oncogenic factors such as FLT3-ITD, and resistance mutations in activation loop residues (e.g., D835, I836, D839, and Y842), or resistance mutations in the gatekeeper residue F691 of FLT3, abnormal PIM kinases, and / or abnormal CLK kinases, the method comprising contacting a cell comprising one or more abnormal FLT3s (e.g., mutations of oncogenic factors such as FLT3-ITD, and resistance mutations in activation loop residues (e.g., D835, I836, D839, and Y842) or the gatekeeper residue F691 of FLT3, abnormal PIM kinases, and / or abnormal CLK kinases) with an effective amount of at least one compound of formula (I)-(VI), or a pharmaceutically acceptable salt thereof, and / or at least one pharmaceutical composition according to the disclosure, wherein the contacting is carried out in vitro, ex vivo or in vivo.
[0015] Further embodiments, features, and advantages of the disclosure will become apparent from the following detailed description and through its practice. The compounds of the disclosure may be described as embodiments of any of the items listed below. It will be understood that any of the embodiments described herein may be used in connection with other embodiments described herein to the extent that the embodiments are not mutually inconsistent.
[0016] 1. Formula I: [Chemical Formula] [wherein: Ring A is a 5- to 10-membered heteroarylene; Ring B is a 5- to 10-membered heteroarylene or C6-C 10 arylene; Each L is independently -O-, -S-, -S(O)-, -S(O)2-, -N(R 6 )C(O)-, -C(O)N(R 6 )-, -N(R 6 )-, -N(R 6 )S(O)-, -S(O)N(R 6 )-, -N(R 6 )S(O)2-, -S(O)2N(R 6 )-, or -C(R 7 )(R 8 )-, provided that (L) p does not contain an O-O, S-O, or N-N bond, and the point where (L) p covalently bonds to -NR 3 - does not form an -N-N- or -O-N- bond; R 1 and R 2 are each, when each is present, independently deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)Ra 、 -OS(O)2R a 、 -SR a 、 -S(O)R a 、 -S(O)2R a 、 -S(O)NR a R b 、 -S(O)2NR a R b 、 -OS(O)NR a R b 、 -OS(O)2NR a R b 、 -NR a R b 、 -NR a C(O)R b 、 -NR a C(O)OR b 、 -NR a C(O)NR a R b 、 -NR a S(O)R b 、 -NR a S(O)2R b 、 -NR a S(O)NR a R b 、 -NR a S(O)2NR a R b 、 -C(O)R a 、 -C(O)OR a 、 -C(O)NR a R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, where C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10Each hydrogen atom in aryl or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c 、-OC(O)R c 、-OC(O)NR c R d 、-OC(=N)NR c R d 、-OS(O)R c 、-OS(O)2R c 、-OS(O)NR c R d 、-OS(O)2NR c R d 、-SR c 、-S(O)R c 、-S(O)2R c 、-S(O)NR c R d 、-S(O)2NR c R d 、-NR c R d 、-NR c C(O)R d 、-N(C(O)R c )(C(O)R d 、-NR c C(O)OR d 、-NR c C(O)NR c R d 、-NR c C(=N)NR c R d 、-NR c S(O)R d 、-NR c S(O)2R d 、-NR c S(O)NR c R d 、-NR c S(O)2NR c R d 、-C(O)R c 、-C(O)OR c 、-C(O)NR c R d 、-C(=N)NR c R d 、-PR c R d 、-P(O)Rc R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2 may be optionally substituted; R 3 is H, deuterium, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)2R c 、 -OS(O)NR c R d 、 -OS(O)2NR c R d 、 -SR c 、 -S(O)R c 、 -S(O)2R c 、 -S(O)NR c R d 、 -S(O)2NR c R d 、 -NR c R d 、 -NR c C(O)R d 、 -N(C(O)R c )(C(O)R d )、 -NR c C(O)OR d 、 -NR c C(O)NRc R d , -NR c C(=N)NR c R d , -NR c S(O)R d , -NR c S(O)2R d , -NR c S(O)NR c R d , -NR c S(O)NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d , -C(=N)NR c R d , -PR c R d , -P(O)R c R d , -P(O)2R c R d , -P(O)NR c R d , -P(O)2NR c R d , -P(O)OR c , -P(O)2OR c , -CN, or -NO2; Each R 4 are independently deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a R b , -S(O)NR a R b、 -OS(O)NR a R b 、 -OS(O)2NR a R b 、 -NR a R b 、 -NR a C(O)R b 、 -NR a C(O)OR b 、 -NR a C(O)NR a R b 、 -NR a S(O)R b 、 -NR a S(O)2R b 、 -NR a S(O)NR a R b 、 -NR a S(O)2NR a R b 、 -C(O)R a 、 -C(O)OR a 、 -C(O)NR a R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, and 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR e 、 -OC(O)R e 、 -OC(O)NR e R f 、 -OS(O)R e 、 -OS(O)2R e 、 -OS(O)NR e Rf 、 -OS(O)2NR e R f 、 -SR e 、 -S(O)R e 、 -S(O)2R e 、 -S(O)NR e R f 、 -S(O)2NR e R f 、 -NR e R f 、 -NR e 、 -NR C(O)R f 、 -NR e 、 -NR C(O)OR f 、 -NR e 、 -NR C(O)NR e R f 、 -NR e 、 -NR S(O)R f 、 -NR e 、 -NR S(O)2R f 、 -NR e 、 -NR S(O)NR e R f 、 -NR e 、 -NR S(O)2NR e R f 、 -C(O)R e 、 -C(O)OR e 、 -C(O)NR e R f 、 -PR e R f 、 -P(O)R e R f 、 -P(O)2R e R f 、 -P(O)NR e R f 、 -P(O)2NR e R f 、 -P(O)OR e 、 -P(O)2OR e 、 may be optionally substituted by -CN, or -NO2; R 5 is H, deuterium, -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -P(O)2R c R d 、 -P(O)2NR c R d, -P(O)2OR c , or -S(O)2OR c ; Each R 6 , when present, is independently H, deuterium, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently -OR c , -OC(O)R c , -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NR c R d , -OS(O)2NR c R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d , -S(O)2NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c )(C(O)R d , -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c C(=N)NR c R d , -NR c S(O)R d , -NR c S(O)2R d, -NR c S(O)NR c R d , -NR c S(O)2NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d , -C(=N)NR c R d , -PR c R d , -P(O)R c R d , -P(O)2R c R d , -P(O)NR c R d , -P(O)2NR c R d , -P(O)OR c , -P(O)2OR c , -CN, or -NO2 may be optionally substituted; Each R 7 and R 8 are independently H, deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R<s a , -S(O)2R a , -S(O)NR a R b , -S(O)2NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a R b , -NR a C(O)Rb 、 -NR a C(O)OR b 、 -NR a C(O)NR a R b 、 -NR a S(O)R b 、 -NR a S(O)2R b 、 -NR a S(O)NR a R b 、 -NR a S(O)2NR a R b 、 -C(O)R a 、 -C(O)OR a 、 -C(O)NR a R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, and 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR e 、 -OC(O)R e 、 -OC(O)NR e R f 、 -OS(O)R e 、 -OS(O)2R e 、 -OS(O)NR e R f 、 -OS(O)2NR e R f 、 -SR e 、 -S(O)R e 、 -S(O)2R e 、 -S(O)NR e Rf 、 -S(O)2NR e R f 、 -NR e R f 、 -NR e C(O)R f 、 -NR e C(O)OR f 、 -NR e C(O)NR e R f 、 -NR e S(O)R f 、 -NR e S(O)2R f 、 -NR e S(O)NR e R f 、 -NR e S(O)2NR e R f 、 -C(O)R e 、 -C(O)OR e 、 -C(O)NR e R f 、 -PR e R f 、 -P(O)R e R f 、 -P(O)2R e R f 、 -P(O)NR e R f 、 -P(O)2NR e R f 、 -P(O)OR e 、 -P(O)2OR e 、 -CN, or -NO2 may be optionally substituted; or two Rs 7 and R 8 together with the carbon or carbons to which they are attached may optionally combine to form C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, where each hydrogen atom in the C3-C6 cycloalkyl or 3- to 7-membered heterocycloalkyl formed when two Rs 7 and R 8 are combined is independently -OR e 、 -OC(O)R e 、 -OC(O)NR e R f 、 -OS(O)R e, -OS(O)2R e , -OS(O)NR e R f , -OS(O)2NR e R f , -SR e , -S(O)R e , -S(O)2R e , -S(O)NR e R f , -S(O)2NR e R f , -NR e R f , -NR e , -NR f , -NR e , -NR f , -NR e , -NR e R f , -NR e , -NR f , -NR e , -NR f , -NR e , -NR e R f , -NR e , -NR e R f , -C(O)R e , -C(O)OR e , -C(O)NR e R f , -PR e R f , -P(O)R e R f , -P(O)2R e R f , -P(O)NR e R f , -P(O)2NR e R f , -P(O)OR e , -P(O)2OR e , may be optionally substituted by -CN, or -NO2; each R a , R b , R c , R d , R e , and R fis, independently, H, deuterium, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, C1-C6 alkylene-C6-C 10 aryl, 5- to 10-membered heteroaryl, and C1-C6 alkylene-5- to 10-membered heteroaryl, or R a and R b , or R c and R d , or R e and R f together with the atoms to which they are attached form a 3- to 7-membered heterocycloalkyl, where C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, C1-C6 alkylene-C6-C 10Each hydrogen atom in aryl, 5- to 10-membered heteroaryl, or C1-C6 alkylene-5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OH, -OC1-C6 alkyl, -OC(O)-(H or C1-C6 alkyl), -OC(O)N(H or C1-C6 alkyl)2, -OC(O)N(C2-C6 alkylene), -OS(O)-(H or C1-C6 alkyl), -OS(O)2-(H or C1-C6 alkyl), -OS(O)N(H or C1-C6 alkyl)2, -OS(O)N(C2-C6 alkylene), -OS(O)2N(H or C1-C6 alkyl)2, -OS(O)2N(C2-C6 alkylene), -S(H or C1-C6 alkyl), -S(O)(H or C1-C6 alkyl), -S(O)2(H or C1-C6 alkyl), -S(O)N(H or C1-C6 alkyl)2, -S(O)N(C2-C6 alkylene), -S(O)2N(H or C1-C6 alkyl)2, -S(O)2N(C2-C6 alkylene), -N(H or C1-C6 alkyl)2, -N(C2-C6 alkylene), -N(H or C1-C6 alkyl)C(O)-(H or C1-C6 alkyl), -N(H or C1-C6 alkyl)C(O)O(H or C1-C6 alkyl), -N(H or C1-C6 alkyl)C(O)N(H or C1-C6 alkyl)2, -N(H or C1-C6 alkyl)C(O)N(C2-C6 alkylene), -N(H or C1-C6 alkyl)S(O)-(H or C1-C6 alkyl), -N(H or C1-C6 alkyl)S(O)2(H or C1-C6 alkyl), -N(H or C1-C6 alkyl)S(O)N(H or C1-C6 alkyl)2, -N(H or C1-C6 alkyl)S(O)N(C2-C6 alkylene), -N(H or C1-C6 alkyl)S(O)2N(H or C1-C6 alkyl)2, -N(H or C1-C6 alkyl)S(O)2N(C2-C6 alkylene), -C(O)-(H or C1-C6 alkyl), -C(O)O(H or C1-C6 alkyl), -C(O)N(C2-C6 alkylene), -P(H or C1-C6 alkyl)2, -P(C2-C6 alkylene), -P(O)(H or C1-C6 alkyl)2,-P(O)(C2-C6 alkylene), -P(O)2(H or C1-C6 alkyl)2, -P(O)2(C2-C6 alkylene), -P(O)N(H or C1-C6 alkyl)2, -P(O)N(C2-C6 alkylene), -P(O)2N(H or C1-C6 alkyl)2, -P(O)2N(C2-C6 alkylene), -P(O)O(H or C1-C6 alkyl), -P(O)2O(H or C1-C6 alkyl), -CN, or NO2, may be optionally substituted; m is 0, 1, 2, or 3; n is 0, 1, 2, 3, or 4; p is 3, 4, 5, 6, or 7; and q is 0, 1, or 2] a compound represented by or a pharmaceutically acceptable salt thereof;
[0017] 2. Formula I: [Chemical formula] [wherein: Ring A is a 5- to 10-membered heteroarylene; Ring B is a 5- to 10-membered heteroarylene or C6-C 10 arylene; Each L is independently -O-, -S-, -S(O)-, -S(O)2-, -N(R 6 )C(O)-, -C(O)N(R 6 )-, -N(R 6 )-, -N(R 6 )S(O)-, -S(O)N(R 6 )-, -N(R 6 )S(O)2-, -S(O)2N(R 6 )-, or -C(R 7 )(R 8 )-: provided that (L) p does not contain an O-O, S-O, or N-N bond, and the point at which (L) p covalently bonds to -NR 3 - does not form an -N-N- or -O-N- bond; R 1 and R 2When each of them exists, independently, deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、-OC(O)R a 、-OC(O)NR a R b 、-OS(O)R a 、-OS(O)2R a 、-SR a 、-S(O)R a 、-S(O)2R a 、-S(O)NR a R b 、-S(O)2NR a R b 、-OS(O)NR a R b 、-OS(O)2NR a R b 、-NR a R b 、-NR a C(O)R b 、-NR a C(O)OR b 、-NR a C(O)NR a R b 、-NR a S(O)R b 、-NR a S(O)2R b 、-NR a S(O)NR a R b 、-NR a S(O)2NR a R b 、-C(O)R a 、-C(O)OR a 、-C(O)NR a R b 、-PR a R b 、-P(O)R a R b 、-P(O)2R a R b 、-P(O)NR a R b 、-P(O)2NRa R b 、 -P(O)OR a 、 -P(O)₂OR a 、 -CN, or -NO₂, where each hydrogen atom in C₁-C₆ alkyl, C₂-C₆ alkenyl, C₂-C₆ alkynyl, C₃-C₆ cycloalkyl, 3- to 7-membered heterocycloalkyl, C₆-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C₁-C₆ alkyl, C₁-C₆ haloalkyl, -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)₂R c 、 -OS(O)NR c R d 、 -OS(O)₂NR c R d 、 -SR c 、 -S(O)R c 、 -S(O)₂R c 、 -S(O)NR c R d 、 -S(O)₂NR c R d 、 -NR c R d 、 -NR c C(O)R d 、 -N(C(O)R c )(C(O)R d ) or -NR c C(O)OR d 、 -NR c C(O)NR c R d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)₂R d 、 -NR c S(O)NR c R d 、 -NR c S(O)₂NR c Rd 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2 may be optionally substituted; R 3 is H, deuterium, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)2R c 、 -OS(O)NR c R d 、 -OS(O)2NR c R d 、 -SR c 、 -S(O)R c 、 -S(O)2R c 、 -S(O)NR c R d 、 -S(O)2NR c R d 、 -NR cR d 、 -NR c C(O)R d 、 -N(C(O)R c )(C(O)R d )、 -NR c C(O)OR d 、 -NR c C(O)NR c R d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)2R d 、 -NR c S(O)NR c R d 、 -NR c S(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2, and may be optionally substituted as desired; Each R 4 is independently deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、 -OC(O)R a 、 -OC(O)NR a R b 、 -OS(O)R a, -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a R b , -S(O)2NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a R b , -NR a , -NR b , -NR a , -C(O)OR b , -NR a , -C(O)NR a R b , -NR a , -NR b , -NR a , -S(O)2R b , -NR a , -NR a R b , -NR a , -S(O)2NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R b , -P(O)NR a R b , -P(O)2NR a R b , -P(O)OR a , -P(O)2OR a , -CN, or -NO2, where C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10Each hydrogen atom in aryl and 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR e 、-OC(O)R e 、-OC(O)NR e R f 、-OS(O)R e 、-OS(O)2R e 、-OS(O)NR e R f 、-OS(O)2NR e R f 、-SR e 、-S(O)R e 、-S(O)2R e 、-S(O)NR e R f 、-S(O)2NR e R f 、-NR e R f 、-NR e C(O)R f 、-NR e C(O)OR f 、-NR e C(O)NR e R f 、-NR e S(O)R f 、-NR e S(O)2R f 、-NR e S(O)NR e R f 、-NR e S(O)2NR e R f 、-C(O)R e 、-C(O)OR e 、-C(O)NR e R f 、-PR e R f 、-P(O)R e R f 、-P(O)2R e R f 、-P(O)NR e R f 、-P(O)2NR e R f 、-P(O)OR e 、-P(O)2OR emay be optionally substituted by -CN or -NO2; R 5 is H, deuterium, -C(O)R c -C(O)OR c -C(O)NR c R d -P(O)2R c R d -P(O)2NR c R d -P(O)2OR c or -S(O)2OR c ; each R 6 is, when present, independently H, deuterium, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently -OR c -OC(O)R c -OC(O)NR c R d -OC(=N)NR c R d -OS(O)R c -OS(O)2R c -OS(O)NR c R d -OS(O)2NR c R d -SR c -S(O)R c -S(O)2R c -S(O)NR c R d -S(O)2NR [[ID=6-seven]] c R d -NR c R d -NR c C(O)R d -N(C(O)R c )(C(O)R d)、 -NR c C(O)OR d 、 -NR c C(O)NR c R d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)2R d 、 -NR c S(O)NR c R d 、 -NR c S(O)2NR c [[ID=X]]R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or may be optionally substituted by -NO2; R 7 and R 8 each of which is independently H, deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、 -OC(O)R a 、 -OC(O)NR a R b 、 -OS(O)R a 、 -OS(O)2R a 、 -SR a 、 -S(O)R a 、 -S(O)2R Note: In the original text, there seems to be a duplicate 'R' at line 34 which is marked as 'X' in the translation for clarity. If this is an error in the original, it should be corrected accordingly. Also, the text in the original seems to be incomplete at line 78 where it says "C6-C ". This might need to be fixed in the source material for a more accurate translation.a 、 -S(O)NR a R b 、 -S(O)2NR a R b 、 -OS(O)NR a R b 、 -OS(O)2NR a R b 、 -NR a R b 、 -NR a C(O)R b 、 -NR a C(O)OR b 、 -NR a C(O)NR a R b 、 -NR a S(O)R b 、 -NR a S(O)2R b 、 -NR a S(O)NR a R b 、 -NR a S(O)2NR a R b 、 -C(O)R a 、 -C(O)OR a 、 -C(O)NR a R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, and 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR e 、 -OC(O)R e 、 -OC(O)NR e Rf 、 -OS(O)R e 、 -OS(O)₂R e 、 -OS(O)NR e R f 、 -OS(O)₂NR e R f 、 -SR e 、 -S(O)R e 、 -S(O)₂R e 、 -S(O)NR e R f 、 -S(O)₂NR e R f 、 -NR e R f 、 -NR e C(O)R f 、 -NR e C(O)OR f 、 -NR e C(O)NR e R f 、 -NR e S(O)R f 、 -NR e S(O)₂R f 、 -NR e S(O)NR e R f 、 -NR e S(O)₂NR e R f 、 -C(O)R e 、 -C(O)OR e 、 -C(O)NR e R f 、 -PR e R f 、 -P(O)R e R f 、 -P(O)₂R e R f 、 -P(O)NR e R f 、 -P(O)₂NR e R f 、 -P(O)OR e 、 -P(O)₂OR e 、 -CN, or -NO₂ may be optionally substituted as desired; or two Rs 7 and R 8may, together with the carbon or carbons to which they are attached, optionally be joined to form a C3-C6 cycloalkyl or 3- to 7-membered heterocycloalkyl, where each hydrogen atom in the C3-C6 cycloalkyl or 3- to 7-membered heterocycloalkyl formed when two Rs 7 and Rs 8 are joined together is independently -OR e , -OC(O)R e , -OC(O)NR e R f , -OS(O)R e , -OS(O)2R e , -OS(O)NR e R f , -OS(O)2NR e R f , -SR e , -S(O)R e , -S(O)2R e , -S(O)NR e R f , -S(O)2NR e R f , -NR e R f , -NR e C(O)R f , -NR e C(O)OR f , -NR e C(O)NR e R f , -NR e S(O)R f , -NR e S(O)2R f , -NR e S(O)NR e R f , -NR e S(O)2NR e R f , -C(O)R e , -C(O)OR e , -C(O)NR e R f , -PR e R f , -P(O)R e R f , -P(O)2R e R f , -P(O)NRe R f 、 -P(O)2NR e R f 、 -P(O)OR e 、 -P(O)2OR e 、 -CN, or -NO2, and may be optionally substituted by; each R a 、 R b 、 R c 、 R d 、 R e 、 and R f is independently selected from the group consisting of H, deuterium, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, C1-C6 alkylene-C6-C 10 aryl, 5- to 10-membered heteroaryl, and C1-C6 alkylene-5- to 10-membered heteroaryl, or R a and R b 、 or R c and R d 、 or R e and R f together with the atom to which they are attached form a 3- to 7-membered heterocycloalkyl, where C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, C1-C6 alkylene-C6-C 10Each hydrogen atom in aryl, 5- to 10-membered heteroaryl, or C1-C6 alkylene-5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OH, -OC1-C6 alkyl, -OC(O)-(H or C1-C6 alkyl), -OC(O)N(H or C1-C6 alkyl)2, -OC(O)N(C2-C6 alkylene), -OS(O)-(H or C1-C6 alkyl), -OS(O)2-(H or C1-C6 alkyl), -OS(O)N(H or C1-C6 alkyl)2, -OS(O)N(C2-C6 alkylene), -OS(O)2N(H or C1-C6 alkyl)2, -OS(O)2N(C2-C6 alkylene), -S(H or C1-C6 alkyl), -S(O)(H or C1-C6 alkyl), -S(O)2(H or C1-C6 alkyl), -S(O)N(H or C1-C6 alkyl)2, -S(O)N(C2-C6 alkylene), -S(O)2N(H or C1-C6 alkyl)2, -S(O)2N(C2-C6 alkylene), -N(H or C1-C6 alkyl)2, -N(C2-C6 alkylene), -N(H or C1-C6 alkyl)C(O)-(H or C1-C6 alkyl), -N(H or C1-C6 alkyl)C(O)O(H or C1-C6 alkyl), -N(H or C1-C6 alkyl)C(O)N(H or C1-C6 alkyl)2, -N(H or C1-C6 alkyl)C(O)N(C2-C6 alkylene), -N(H or C1-C6 alkyl)S(O)-(H or C1-C6 alkyl), -N(H or C1-C6 alkyl)S(O)2(H or C1-C6 alkyl), -N(H or C1-C6 alkyl)S(O)N(H or C1-C6 alkyl)2, -N(H or C1-C6 alkyl)S(O)N(C2-C6 alkylene), -N(H or C1-C6 alkyl)S(O)2N(H or C1-C6 alkyl)2, -N(H or C1-C6 alkyl)S(O)2N(C2-C6 alkylene), -C(O)-(H or C1-C6 alkyl), -C(O)O(H or C1-C6 alkyl), -C(O)N(C2-C6 alkylene), -P(H or C1-C6 alkyl)2, -P(C2-C6 alkylene), -P(O)(H or C1-C6 alkyl)2,-P(O)(C2-C6 alkylene), -P(O)2(H or C1-C6 alkyl)2, -P(O)2(C2-C6 alkylene), -P(O)N(H or C1-C6 alkyl)2, -P(O)N(C2-C6 alkylene), -P(O)2N(H or C1-C6 alkyl)2, -P(O)2N(C2-C6 alkylene), -P(O)O(H or C1-C6 alkyl), -P(O)2O(H or C1-C6 alkyl), -CN, or NO2, may be optionally substituted; m is 0, 1, 2, or 3; n is 0, 1, 2, 3, or 4; p is 3, 4, 5, 6, or 7; and q is 0, 1, or 2] a compound represented by or a pharmaceutically acceptable salt thereof;
[0018] 3. Formula II:
Chem.
Chem.
[0019] 4. Formula III:
Chem.
Chem.
[0020] 5. Ring A is
Chem.
Chem.
[0021] 6. Ring A is
Chem.
Chem.
[0022] 7. Ring A is
Chem.
Chem.
[0023] 8. Ring B is C6-C 10 arylene, where n is 0, 1, or 2, The compound according to any one of the above, or a pharmaceutically acceptable salt thereof; 9. Ring B is phenylene, where n is 0, 1, or 2, The compound according to any one of the above, or a pharmaceutically acceptable salt thereof; 10. Ring B is phenylene, where n is 0 or 1, The compound according to any one of the above, or a pharmaceutically acceptable salt thereof;
[0024] 11. Ring B is phenylene, n is 1, and R 2 is methyl, ethyl, F, Cl, or Br, The compound according to any one of the above, or a pharmaceutically acceptable salt thereof; 12. Ring B is
Chemical formula
Chemical formula
[0025] 14. Ring B is
Chemical formula
Chemical formula
[0026] 15. Ring B is
Chemical formula
Chemical formula
[0027] 16. R 3 is H or methyl, a compound according to any one of the above items, or a pharmaceutically acceptable salt thereof; 17. R 4 is H or methyl, a compound according to any one of the above items, or a pharmaceutically acceptable salt thereof; 18. R 5 is H, a compound according to any one of the above items, or a pharmaceutically acceptable salt thereof;
[0028] 19. Each L is independently -C(R 7 )(R 8 )-, -C(O)-, -O-, or -N(R 6 )-: provided that (L) p does not contain an -O-O- or -O-N(R 6 )- bond, and the point of covalent bond of -NR p - in (L) 3 does not form an -N-N- or -O-N- bond, a compound according to any one of the above items, or a pharmaceutically acceptable salt thereof;
[0029] 20. -(L) p - is -(CR 7 R 8 )C(O)N(R 6 )-(CR 7 R 8 )2-, -(CR 7 R 8 )N(R 6 [[ID=1 ]])C(O)-(CR 7 R 8 )2-, -N(R 6 )-C(O)(CR 7 R 8 )2O(CR 7 R 8 )2-, -CR 7 R 8 O(CR 7 R 8 )2O-(CR 7 R 8 )2, -O(CR 7 R 8 )2O(CR 7 R 8 )2-, -CR 7 R 8 O-CR 7 R[[ID=]] 8 -C(O)N(R 6 )-(CR 7 R 8 )2-, -(CR 7 R 8 )3O(CR 7 R 8 )2-, -(CR 7 R 8 )2O(CR 7 R 8 )3-, -CR 7 R 8 -N(R 6 )-(CR 7 R 8 )2-, -CR 7 R 8 -N(R 6 )-(CR 7 R 8 )3-, -O(CR 7 R 8 )2O(CR 7 [[ID=]] 8 )3-, -(CR 7 R 8 )2N(R6 )-(CR 7 R 8 )3-, -(CR 7 R 8 )2-N(R 6 )-(CR 7 R 8 )2-, -O-(CR 7 R 8 )2-, -O-(CR 7 R 8 )3-, or -O(CR 7 R 8 )4-; The compound according to any one of the above, or a pharmaceutically acceptable salt thereof;
[0030] 21. R 6 is H or methyl; The compound according to any one of the above, or a pharmaceutically acceptable salt thereof; 22. R 7 and R 8 each is H; The compound according to any one of the above, or a pharmaceutically acceptable salt thereof; 23. -(L) p - is -CH2N(H)-(CH2)2-, -CH2N(CH3)-(CH2)2-, -O(CH2)2-, -OCH(CH3)CH2-, -O(CH2)3-, -O(CH2)4-, and -O(CH2)2O(CH2)2-; The compound according to any one of the above, or a pharmaceutically acceptable salt thereof;
[0031] 24.
Chemical formula
Chemical formula
[0032] 25. A pharmaceutical composition comprising the compound according to any one of the above, optionally containing one or more excipients. 26. A method for treating a disease in a subject, comprising administering a therapeutically effective amount of the compound according to any one of claims 1 to 24, or the pharmaceutical composition according to claim 25. 27. A compound according to any one of claims 1 to 24 for use in a method for treating a disease in a subject; 28. Use of a compound according to any one of claims 1 to 24 in the manufacture of a medicament for treating a disease in a subject
BEST MODE FOR CARRYING OUT THE INVENTION
[0033] Before further elaborating on the present disclosure, it should be understood that the disclosure is not limited to the specific embodiments described, and of course, it may change itself. Also, since the scope of the present disclosure is limited only by the appended claims, it should be understood that the terms used in this specification are for the purpose of describing specific embodiments only and are not intended to be limiting.
[0034] For the sake of brevity, the disclosures of publications (including patents) cited in this specification are incorporated herein by reference. Unless otherwise specified, all technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the art to which this disclosure pertains. All patents, applications, published applications, and other publications mentioned in this specification are incorporated herein by reference in their entirety. If the definitions defined in this section conflict with or are inconsistent with the definitions defined in the patents, applications, or other publications incorporated herein by reference, the definitions defined in this section shall prevail over the definitions incorporated herein by reference.
[0035] As used in the appended claims, herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Further, note that any claim may be drafted to exclude any optional element. As such, this application is intended to serve as a basis for precedence when exclusive terms such as "solely," "only," etc. are used in relation to the recitation of claim elements, or when "negative" limitations are used. As used herein, the terms "comprising," "containing," and "including" are used in an open, non-limiting sense.
[0036] To provide for a more concise description, some of the quantitative expressions set forth herein are not qualified with the term "about." Whether or not the term "about" is explicitly used, all quantities set forth herein are to be understood to refer to the actual given value, and also to any equivalent or approximation to such given value that would reasonably be inferred based on ordinary skill in the art, including equivalents or approximations due to experimental and / or measurement conditions for such given value. Whenever a yield is expressed as a percentage, such yield refers to the mass of the entity given with respect to the maximum amount of the same entity that could be obtained under the specific stoichiometric conditions. Concentrations expressed as percentages refer to mass ratios unless otherwise indicated.
[0037] Unless otherwise noted, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are now described herein. All publications mentioned herein are incorporated herein by reference in their entirety, as if each individual publication were specifically and individually indicated to be incorporated by reference, and are related to the disclosure or description of the methods and / or materials.
[0038] Unless otherwise specified, the methods and techniques of this embodiment are generally carried out in accordance with conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout this specification. For example, see Loudon, Organic Chemistry, Fourth Edition, New York: Oxford University Press, 2002, pp.360-361, 1084-1085; Smith and March, March’s Advanced-Organic Chemistry: Reactions, Mechanisms, and Structure, Fifth Edition, Wiley-Interscience, 2001. The chemical nomenclature of the compounds described in this specification is generally made using commercially available ACD / Name 2014 (ACD / Labs) or ChemBioDraw Ultra 13.0 (Perkin Elmer).
[0039] As used herein, in connection with the chemical structures showing the various embodiments described herein,
Chemical Structure
Chemical Structure
Chemical Structure
Chemical Structure
[0040] It is understood that, for clarity, certain features of the present disclosure that are described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for brevity, the various features of the present disclosure that are described in the context of a single embodiment may also be provided separately or in any suitable sub-combination. Any combination of embodiments related to chemical groups represented by variable groups is specifically included by the present disclosure, and to the extent that such combinations include stable compounds (i.e., compounds that can be isolated, characterized, and tested for biological activity), each and every combination is disclosed herein as if individually and explicitly disclosed. In addition, any sub-combination of the chemical groups recited in the embodiments describing such variable groups is also specifically included by the present disclosure, and each and every such sub-combination of chemical groups is disclosed herein as if individually and explicitly disclosed herein.
[0041] Chemical Definitions The term "alkyl" refers to a straight-chain or branched-chain monovalent hydrocarbon group. The term "alkylene" refers to a straight-chain or branched-chain divalent hydrocarbon group. In some embodiments, the number of atoms in "alkyl" or "alkylene" is C1-C 20 alkyl or C1-C 20 alkylene, C1-C 12 alkyl or C1-C 12It may be advantageous to limit to a specific range of atoms, such as alkylene, or C1-C6 alkyl or C1-C6 alkylene. Examples of alkyl groups include methyl (Me), ethyl (Et), n-propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl (tBu), pentyl, isopentyl, tert-pentyl, hexyl, isohexyl, and groups that are considered equivalent to any one of the above examples in light of the ordinary techniques in the art and the teachings provided herein. Examples of alkylene groups include methylene (-CH2-), ethylene ((-CH2-)2), n-propylene ((-CH2-)3), isopropylene ((-C(H)(CH3)CH2-)), n-butylene ((-CH2-)4), etc. It will be understood that the alkyl or alkylene group may be unsubstituted or may be substituted as described herein. The alkyl or alkylene group may be substituted with any of the various substituents described in the various embodiments herein, for example, with one or more such substituents.
[0042] The term "alkenyl" refers to a straight-chain or branched-chain monovalent hydrocarbon group having one or more double bonds. The term "alkenylene" refers to a straight-chain or branched-chain divalent hydrocarbon group having one or more double bonds. In some embodiments, the number of atoms in "alkenyl" or "alkenylene" is C2-C 20 alkenyl or C2-C 20 alkenylene, C2-C 12 alkenyl or C2-C 12It may be advantageous to limit to a specific range of atoms, such as alkenylene, or C2-C6 alkenyl or C2-C6 alkenylene. Examples of alkenyl groups include ethenyl (or vinyl), allyl, and but-3-en-1-yl. Examples of alkenylene groups include ethenylene (or vinylene) (-CH=CH-), n-propenylene (-CH=CHCH2-), isopropenylene (-CH=CH(CH3)-), etc. Cis and trans isomers, as well as mixtures thereof, are also included in this term. It will be understood that the alkenyl or alkenylene group may be unsubstituted or substituted as described herein. The alkenyl or alkenylene group may be substituted with any of the substituents in the various embodiments described herein, for example, with one or more such substituents.
[0043] The term "alkynyl" refers to a straight-chain or branched-chain monovalent hydrocarbon group having one or more triple bonds. The term "alkynylene" refers to a straight-chain or branched-chain divalent hydrocarbon group having one or more triple bonds. In some embodiments, the number of atoms in "alkynyl" or "alkynylene" is C2-C 20 alkynyl or C2-C 20 alkynylene, C2-C 12 alkynyl or C2-C 12 It may be advantageous to limit to a specific range of atoms, such as alkynylene, or C2-C6 alkynyl or C2-C6 alkynylene. Examples of alkynyl groups include ethynyl (-C≡CH) and propargyl (-CH2C≡CH), but-3-yne-1,4-diyl (-C≡C-CH2CH2-), etc. It will be understood that the alkynyl or alkynylene group may be unsubstituted or substituted as described herein. The alkynyl or alkynylene group may be substituted with any of the substituents in the various embodiments described herein, for example, with one or more such substituents.
[0044] The term "cycloalkyl" refers to a saturated or partially saturated, monocyclic or polycyclic monovalent carbocyclic ring. The term "cycloalkylene" refers to a saturated or partially saturated, monocyclic or polycyclic divalent carbocyclic ring. In some embodiments, it may be advantageous to limit the number of atoms in a "cycloalkyl" or "cycloalkylene" to a specific range of atoms, such as 3 to 12 ring atoms. Polycyclic carbocyclic rings include fused, bridged, and spiro polycyclic systems. Exemplification of cycloalkyl groups includes monovalent groups of the following entities in the form of appropriately attached moieties, while exemplification of cycloalkylene groups includes divalent groups of the following entities:
Chemical formula
[0045] In particular, a cyclopropyl moiety has the structural formula:
Chemical formula
Chemical formula
[0046] The term "halogen" or "halo" represents chlorine, fluorine, bromine or iodine. The term "haloalkyl" refers to an alkyl group having one or more halo substituents. Examples of haloalkyl groups include -CF3, -(CH2)F, -CHF2, -CH2Br, -CH2CF3, and -CH2CH2F. The term "haloalkylene" refers to an alkylene group having one or more halo substituents. Examples of haloalkyl groups include -CF2-, -C(H)(F)-, -C(H)(Br)-, -CH2CF2-, and -CH2C(H)(F)-.
[0047] The term "aryl" refers to a monovalent all-carbon monocyclic or fused-ring polycyclic group having a fully conjugated π electron system. The term "arylene" refers to a divalent all-carbon monocyclic or fused-ring polycyclic group having a fully conjugated π electron system. In some embodiments, it may be advantageous to limit the number of atoms in "aryl" or "arylene" to a specific range of atoms, such as a monocyclic or fused-ring polycyclic group of 6 to 14 carbon atoms (C6-C 14 aryl), a monocyclic or fused-ring polycyclic group of 6 to 10 carbon atoms (C6-C 10 aryl), a divalent monocyclic or fused-ring polycyclic group of 6 to 14 carbon atoms (C6-C 14 arylene), a divalent monocyclic or fused-ring polycyclic group of 6 to 10 carbon atoms (C6-C 10 arylene), etc. Examples of aryl groups include, but are not limited to, phenyl, naphthalenyl, and anthracenyl. Examples of arylene groups include, but are not limited to, phenylene, naphthalenylene, and anthracenylene. It will be understood that an aryl or arylene group can be unsubstituted or can be substituted as described herein. An aryl or arylene group can be substituted with any of the various substituents described herein, for example, with one or more such substituents.
[0048] The term "heterocycloalkyl" refers to a saturated or partially saturated monocyclic or polycyclic ring structure having one or more non-carbon ring atoms. The term "heterocycloalkylene" refers to a saturated or partially saturated divalent monocyclic or polycyclic ring structure having one or more non-carbon ring atoms. In some embodiments, it may be advantageous to limit the number of ring atoms in "heterocycloalkyl" or "heterocycloalkylene" to a specific range of ring atoms such as 3 to 12 ring atoms (3 to 12-membered), or 3 to 7 ring atoms (3 to 7-membered), or 3 to 6 ring atoms (3 to 6-membered), or 4 to 6 ring atoms (4 to 6-membered), 5 to 7 ring atoms (5 to 7-membered), or 4 to 10 ring atoms (4 to 10-membered). In some embodiments, it may be advantageous to limit the number and type of ring heteroatoms in "heterocycloalkyl" or "heterocycloalkylene" to a specific range or type such as 1 to 5 ring heteroatoms selected from nitrogen, oxygen, and sulfur. Polycyclic ring systems include fused, bridged, and spiro systems. The ring structure may optionally contain an oxo group or an imino group on a carbon ring member, and may contain up to 2 oxo groups on a sulfur ring member. Examples of heterocycloalkyl groups include monovalent groups of the following entities in the form of appropriately attached moieties, while examples of heterocycloalkylene groups include divalent groups of the following entities: [Chemical Formula] are included.
[0049] A 3-membered heterocycle may contain ring atoms of at least one heteroatom, where the ring atoms of the heteroatom are sulfur, oxygen or nitrogen. Non-limiting examples of 3-membered heterocyclic groups include monovalent and divalent groups of oxirane, azetidine and thiirane. A 4-membered heterocycle may contain ring atoms of at least one heteroatom, where the ring atoms of the heteroatom are sulfur, oxygen or nitrogen. Non-limiting examples of 4-membered heterocyclic groups include divalent groups of azetidine, oxetane, and thietane. A 5-membered heterocycle can contain ring atoms of up to 4 heteroatoms, where (a) at least one ring atom is oxygen or sulfur and 0, 1, 2 or 3 ring atoms are nitrogen, or (b) 0 ring atoms are oxygen or sulfur and up to 4 ring atoms are nitrogen. Non-limiting examples of 5-membered heterocyclic groups include monovalent and divalent groups of pyrrolidine, tetrahydrofuran, 2,5-dihydro-1H-pyrrole, pyrazolidine, thiazolidine, 4,5-dihydro-1H-imidazole, dihydrothiophen-2(3H)-one, tetrahydrothiophene 1,1-dioxide, imidazolidin-2-one, pyrrolidin-2-one, dihydrofuran-2(3H)-one, 1,3-dioxolan-2-one, and oxazolidin-2-one. A 6-membered heterocycle can contain ring atoms of up to 4 heteroatoms, where (a) at least one ring atom is oxygen or sulfur and 0, 1, 2 or 3 ring atoms are nitrogen, or (b) 0 ring atoms are oxygen or sulfur and up to 4 ring atoms are nitrogen. Non-limiting examples of 6-membered heterocyclic groups include monovalent or divalent groups of piperidine, morpholine, 4H-1,4-thiazine, 1,2,3,4-tetrahydropyridine, piperazine, 1,3-oxazinane-2-one, piperazin-2-one, thiomorpholine, and thiomorpholine 1,1-dioxide. "Heterobicycle" is a fused bicyclic system in which one heterocyclic ring is fused to cycloalkyl or to another heterocyclic ring.
[0050] It will be understood that the heterocycloalkyl or heterocycloalkylene group may be unsubstituted or substituted as described herein. The heterocycloalkyl or heterocycloalkylene group may be substituted with any of the substituents described herein in the various embodiments, for example, with one or more such substituents.
[0051] The term "heteroaryl" refers to a monovalent monocyclic, fused bicyclic, or fused polycyclic aromatic heterocycle that is completely unsaturated and has 3 to 12 ring atoms per heterocycle (the ring structure having ring atoms or ring members selected from carbon atoms and up to 4 heteroatoms selected from nitrogen, oxygen, and sulfur). The term "heteroarylene" refers to a divalent monocyclic, fused bicyclic, or fused polycyclic aromatic heterocycle having 3 to 12 ring atoms per heterocycle (the ring structure having ring atoms or ring members selected from carbon atoms and up to 4 heteroatoms selected from nitrogen, oxygen, and sulfur). In some embodiments, it may be advantageous to limit the number of ring atoms in "heteroaryl" or "heteroarylene" to a specific range of atomic members such as a 5- to 10-membered heteroaryl or a 5- to 10-membered heteroarylene. In some embodiments, a 5- to 10-membered heteroaryl may be a monocyclic ring or a fused bicyclic ring having 5 to 10 ring atoms, at least one of which is a heteroatom such as N, O, or S. In some embodiments, a 5- to 10-membered heteroarylene may be a monocyclic ring or a fused bicyclic ring having 5 to 10 ring atoms, at least one of which is a heteroatom such as N, O, or S. The ring structure may optionally contain an oxo group or an imino group on a carbon ring member or up to 2 oxo groups on a sulfur ring member. Exemplary examples of 5- to 10-membered heteroaryl groups include monovalent groups of the following entities in the form of appropriately linked moieties, while examples of 5- to 10-membered heteroarylene groups include divalent groups of the following entities:
Chemical formula
[0052] In some embodiments, a “monocyclic” heteroaryl can be an aromatic 5- or 6-membered heterocycle. A 5-membered heteroaryl or heteroarylene can contain up to 4 heteroatoms as ring atoms, where (a) at least 1 ring atom is oxygen and sulfur, and 0, 1, 2, or 3 ring atoms are nitrogen, or (b) 0 ring atoms are oxygen or sulfur and up to 4 ring atoms are nitrogen. Non-limiting examples of 5-membered heteroaryl groups include monovalent groups of furan, thiophene, pyrrole, oxazole, isoxazole, thiazole, isothiazole, pyrazole, imidazole, oxadiazole, thiadiazole, triazole, or tetrazole. Non-limiting examples of 5-membered heteroarylene groups include divalent groups of furan, thiophene, pyrrole, oxazole, isoxazole, thiazole, isothiazole, pyrazole, imidazole, oxadiazole, thiadiazole, triazole, or tetrazole. A 6-membered heteroaryl or heteroarylene can contain up to 4 heteroatoms as ring atoms, where (a) at least 1 ring atom is oxygen and sulfur, and 0, 1, 2, or 3 ring atoms are nitrogen, or (b) 0 ring atoms are oxygen or sulfur and up to 4 ring atoms are nitrogen. Non-limiting examples of 6-membered heteroaryl groups include monovalent groups of pyridine, pyrazine, pyrimidine, pyridazine, or triazine. Non-limiting examples of 6-membered heteroarylene groups include divalent groups of pyridine, pyrazine, pyrimidine, pyridazine, or triazine. “Bicyclic heteroaryl” or “bicyclic heteroarylene” is a fused bicyclic system in which one heteroaryl ring is fused to a phenyl or another heteroaryl ring. Non-limiting examples of bicyclic heteroaryl groups include monovalent groups of quinoline, isoquinoline, quinazoline, quinoxaline, 1,5-naphthyridine, 1,8-naphthyridine, isoquinolin-3(2H)-one, thieno[3,2-b]thiophene, 1H-pyrrolo[2,3-b]pyridine, 1H-benzo[d]imidazole, benzo[d]oxazole, and benzo[d]thiazole.Non-limiting examples of bicyclic heteroarylene groups include divalent groups of quinoline, isoquinoline, quinazoline, quinoxaline, 1,5-naphthyridine, 1,8-naphthyridine, isoquinolin-3(2H)-one, thieno[3,2-b]thiophene, 1H-pyrrolo[2,3-b]pyridine, 1H-benzo[d]imidazole, benzo[d]oxazole, and benzo[d]thiazole.
[0053] In particular, the pyrazolyl moiety has the structural formula:
Chemical formula
Chemical formula
[0054] It will be understood that the heteroaryl or heteroarylene group may be unsubstituted or substituted as described herein. The heteroaryl or heteroarylene group may be substituted with any of the various substituents in the various embodiments described herein, for example, with one or more such substituents. The term "oxo" represents a carbonyl oxygen. For example, cyclopentyl substituted with oxo is cyclopentanone.
[0055] The term "substituted" means that a particular group or moiety has one or more substituents. The term "unsubstituted" means that a particular group has no substituents. When the term "unsubstituted" is used to describe a structural system, it means that substitution occurs at any position where any valence on the system is allowed. In some embodiments, "substituted" means that a particular group or moiety has one, two, or three substituents. In other embodiments, "substituted" means that a particular group or moiety has one or two substituents. In still other embodiments, "substituted" means that a particular group or moiety has one substituent.
[0056] Any formula shown in this specification shall also cover the compounds of the structural formula, as well as specific modifications or forms thereof. For example, the formulas shown in this specification shall cover racemates, or one or more enantiomers, diastereomers, or geometric isomers, or mixtures thereof. In addition, any formula shown in this specification shall also refer to hydrates, solvates, or polymorphs of such compounds, or mixtures thereof.
[0057] Any formula shown in this specification shall also represent compounds in unlabeled form as well as in isotopically labeled form. Isotopically labeled compounds have the structure represented by the formula shown in this specification, except that one or more atoms are replaced with atoms having a selected atomic weight or mass number. Examples of isotopes that can be incorporated into the compounds of the present disclosure include 2 H, 3 H, 11 C, 13 C, 14 C, 15 N, 18 O, 17 O, 31 P, 32 P, 35 S, 18 F, 36 Cl, and 125 I, etc., which are isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, chlorine, and iodine, respectively. Such isotopically labeled compounds are useful in metabolic studies (preferably 14 C-based studies), studies of reaction kinetics (e.g., 2 H- or 3 H-based studies), detection or imaging techniques [such as positron emission tomography (PET) or single photon emission computed tomography (SPECT)] including tissue distribution assays of drugs or substrates, or in radioactive therapy of patients. Furthermore, deuterium (i.e., 2By replacing with heavy isotopes such as (H), specific therapeutic advantages resulting from higher metabolic stability can be obtained, such as an increase in in vivo half-life or a decrease in the required dosage. The isotope-labeled compounds and their prodrugs of the present disclosure can generally be produced according to the procedures disclosed in the following schemes, examples, and preparative examples by replacing non-isotope-labeled reagents with readily available isotope-labeled reagents.
[0058] Specific chemical entities of formulas (I) to (VI) can be shown in two or more tautomeric forms. All possible alternative tautomers are included within the scope of these formulas, and it should not be inferred whether the chemical entity exists in the tautomeric form in which it is depicted. It will be understood that the specific chemical entities described herein may exist in different tautomeric forms. Those skilled in the art will readily understand that tautomers can generally be considered the same compound because the interconversion is rapid. Examples of tautomers include, but are not limited to, enol-keto tautomers, amine-imine tautomers, and the like.
Chemical formula
[0059] When applied to a series of substituents herein, the term “(ATOM) i -(ATOM) j ” (j > i) refers to embodiments of this disclosure in which each of the number of atomic members from i to j, including i and j, is independently understood. By way of example, the term C1-C3 refers independently to embodiments having 1 carbon member (C1), embodiments having 2 carbon members (C2), and embodiments having 3 carbon members (C3).
[0060] Any disubstituent referred to herein is intended to encompass such possibilities when more than one of the various bonding possibilities is allowed. For example, the disubstituent -J-K-
Chemical formula
[0061] It will be understood that the specific compounds described herein may contain one or more positions that can exist as stereoisomers. For example, the specific compounds described herein may contain one or more carbon atoms that can exist in one or more stereoisomeric configurations. Carbon atoms depicted without indicating any stereoisomeric configuration, which can exist in a stereoisomeric configuration, are understood to include each of the possible stereoisomeric configurations. For example, a carbon atom having four groups to which priorities can be assigned according to the Cahn-Ingold Prelog rules known to those skilled in the art is described herein without defining a specific stereochemistry as in the structure on the left below, and is also understood to describe both the possibilities of the stereoisomers (S) and (R) as shown below. [Chemical formula] Here, according to the Cahn-Ingold Prelog rules, R a >R b >R c >R d is.
[0062] The present disclosure also encompasses pharmaceutically acceptable salts of the compounds represented by formulas (I) to (VI), preferably salts of the above-described compounds, and salts of the specific compounds exemplified herein, as well as compositions containing such salts, and methods of using such salts.
[0063] "Pharmaceutically acceptable salts" shall mean salts of the free acids or bases of the compounds shown herein that are non-toxic, biologically acceptable, or otherwise biologically suitable for administration to a subject. See generally S.M. Berge et al., "Pharmaceutical Salts" J. Pharm. Sci., 1977, 66, 1-19. Preferred pharmaceutically acceptable salts are salts that are pharmacologically effective and suitable for contact with the tissues of a subject without undue toxicity, irritation, or allergic response. The compounds acceptable herein may have sufficient acidic groups, sufficient basic groups, functional groups of both types, or one or more functional groups of each type, and thus react with many inorganic or organic bases, and inorganic and organic acids to form pharmaceutically acceptable salts.
[0064] Examples of pharmaceutically acceptable salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, phosphate, monohydrogen sulfate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caproate, heptanoate, propionate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1,4-dioate, hexyne-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, sulfonate, methylsulfonate, propylsulfonate, besylate, xylenesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, γ-hydroxybutyrate, glycolate, tartrate, and mandelate. A list of other suitable pharmaceutically acceptable salts is described in Remington’s Pharmaceutical Sciences, 17th Edition, Mack Publishing Company, Easton, Pa., 1985.
[0065] For compounds of formulas (I)-(VI) containing basic nitrogen, pharmaceutically acceptable salts can be prepared by any suitable method available in the art, for example, treating the free base with an inorganic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, nitric acid, boric acid, phosphoric acid, etc., or an organic acid such as acetic acid, phenylacetic acid, propionic acid, stearic acid, lactic acid, ascorbic acid, maleic acid, hydroxymaleic acid, isethionic acid, succinic acid, valeric acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, oleic acid, palmitic acid, lauric acid, glucuronic acid or galacturonic acid, mandelic acid, alpha-hydroxy acids such as citric acid or tartaric acid, amino acids such as aspartic acid or glutamic acid, aromatic acids such as benzoic acid, 2-acetoxybenzoic acid, naphthoic acid, or cinnamic acid, sulfonic acids such as laurylsulfonic acid, p-toluenesulfonic acid, methanesulfonic acid, or ethanesulfonic acid, or any compatible mixture of acids exemplified herein, and other any acids and their mixtures regarded as equivalents or acceptable alternatives in light of the ordinary skill in this art.
[0066] The present disclosure also relates to pharmaceutically acceptable prodrugs of the compounds of formulas (I)-(VI), and methods of treatment using such pharmaceutically acceptable prodrugs. The term "prodrug" means a precursor of a designated compound that, after administration to a subject, generates the compound in vivo through a chemical or physiological process such as solvolysis or enzymatic cleavage, or under physiological conditions (e.g., when the prodrug is in a physiological pH situation, it is converted to the compound of formulas (I)-(VI)). A "pharmaceutically acceptable prodrug" is a prodrug that is non-toxic, biologically acceptable, and otherwise biologically suitable for administration to a subject. Exemplary procedures for selecting and preparing suitable prodrug derivatives are described, for example, in "Design of Prodrugs", ed. H. Bundgaard, Elsevier, 1985.
[0067] The present disclosure also relates to pharmaceutically active metabolites of the compounds of formulas (I)-(VI) and to their use in the disclosed methods of the compounds. "Pharmaceutically active metabolite" means a pharmacologically active product of the metabolic action in vivo of a compound of formulas (I)-(VI) or a salt thereof. The prodrugs and active metabolites of a compound can be determined using conventional techniques known or available in the art. See, for example, Bertolini et al., J. Med. Chem. 1997, 40, 2011-2016; Shan et al., J. Pharm. Sci. 1997, 86(7), 765-767; Bagshawe, Drug Dev. Res. 1995, 34, 220-230; Bodor, Adv. Drug Res. 1984, 13, 255-331; Bundgaard, Design of Prodrugs (Elsevier Press, 1985); and Larsen, Design and Application of Prodrugs, Drug Design and Development (edited by Krogsgaard-Larsen et al., Harwood Academic Publishers, 1991).
[0068] Representative embodiments In some embodiments, the present disclosure provides a compound of formula I: [Chem.] [wherein: R 1 , R 2 , R 3 , R 4 , R 5 , A, B, L, m, n, p, and q are as described herein] and pharmaceutically acceptable salts thereof.
[0069] In some embodiments, the present disclosure provides a compound of formula II: [Chem.] [[ID=
[36] ]wherein: R 1 , R2 and R 3 and R 4 and R 5 and A, B, L, m, n, p, q, and [Chemical formula] are as described herein] provides a compound represented by or a pharmaceutically acceptable salt thereof.
[0070] In some embodiments, the present disclosure provides a compound of formula III: [Chemical formula] [wherein: R 1 and R 2 and R 3 and R 4 and R 5 and A, B, L, X 1 and X 2 and X 3 and m, n, p, q, and [Chemical formula] are as described herein] provides a compound represented by or a pharmaceutically acceptable salt thereof.
[0071] In some embodiments, the present disclosure provides a compound of formula IV: [Chemical formula] [wherein: R 1 and R 2 and R 3 and R 4 and R 5 and A, B, L, m, n, and p are as described herein] provides a compound represented by or a pharmaceutically acceptable salt thereof.
[0072] In some embodiments, the present disclosure provides a compound of formula V: [Chemical formula] [Wherein: R 1 , R 2 , R 3 , R 4 , R 5 , A, B, L, m, n, p, and [Chemical formula] is as described herein] provides a compound represented by or a pharmaceutically acceptable salt thereof.
[0073] In some embodiments, the present disclosure relates to Formula VI: [Chemical formula] [Wherein: R 1 , R 2 , R 3 , R 4 , R 5 , A, B, L, X 1 , X 2 , X 3 , m, n, p, and [Chemical formula] is as described herein] provides a compound represented by or a pharmaceutically acceptable salt thereof.
[0074] In some embodiments, ring A is a 5- to 10-membered heteroarylene. In some embodiments, ring A is a 5- or 6-membered heteroarylene. In some embodiments, ring A is a 5-membered heteroarylene. In some embodiments, ring A is a 6-membered heteroarylene. In some embodiments, ring A is a fused bicyclic 8- to 10-membered heteroarylene.
[0075] In some embodiments, ring A is a 5- to 10-membered heteroarylene, such as a monocyclic 5- or 6-membered heteroarylene, or a bicyclic 8- to 10-membered heteroarylene, where, as described herein, each hydrogen atom in the 5- to 10-membered heteroarylene is independently deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、-OC(O)R a 、-OC(O)NR a R b 、-OS(O)R a 、-OS(O)2R a 、-SR a 、-S(O)R a 、-S(O)2R a 、-S(O)NR a R b 、-S(O)2NR a R b 、-OS(O)NR a R b 、-OS(O)2NR a R b 、-NR a R b 、-NR a C(O)R b 、-NR a C(O)OR b 、-NR a C(O)NR a R b 、-NR a S(O)R b 、-NR a S(O)2R b 、-NR a S(O)NR a R b 、-NR a S(O)2NR a R b 、-C(O)R a 、-C(O)OR a 、-C(O)NR a R b 、-PR a R b, -P(O)R a R b , -P(O)₂R a R b , -P(O)NR a R b , -P(O)₂NR a R b , -P(O)OR a , -P(O)₂OR a , -CN, or -NO₂, where each hydrogen atom in C₁-C₆ alkyl, C₂-C₆ alkenyl, C₂-C₆ alkynyl, C₃-C₆ cycloalkyl, 3- to 7-membered heterocycloalkyl, C₆-C 1 aryl, or 5- to 10-membered heteroaryl may optionally be replaced by, where C₁-C₆ alkyl, C₂-C₆ alkenyl, C₂-C₆ alkynyl, C₃-C₆ cycloalkyl, 3- to 7-membered heterocycloalkyl, C₆-C 10 aryl, or each hydrogen atom in 5- to 10-membered heteroaryl is independently deuterium, halogen, C₁-C₆ alkyl, C₁-C₆ haloalkyl, -OR c , -OC(O)R c , -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)₂R c , -OS(O)NR c R d , -OS(O)₂NR c R d , -SR c , -S(O)R c , -S(O)₂R c , -S(O)NR c R d , -S(O)₂NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c )(C(O)R d , -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c C(=N)NR c R d , -NR cS(O)R d , -NR c S(O)2R d , -NR c S(O)NR c R d , -NR c S(O)NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d , -C(=N)NR c R d , -PR c R d , -P(O)R c R d , -P(O)2R c R d , -P(O)NR c R d , -P(O)2NR c R d , -P(O)OR c , -P(O)2OR c , -CN, or -NO2.
[0076] In some embodiments, Ring A is pyrrolylene, isoxazolylene, isothiazolylene, pyrazolylene, or imidazolylene, wherein each hydrogen atom in the pyrrolylene, isoxazolylene, isothiazolylene, pyrazolylene, and imidazolylene is independently selected from deuterium, halogen, C-C alkyl, C-C alkenyl, C-C alkynyl, C-C cycloalkyl, 3- to 7-membered heterocycloalkyl, C-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a R b , -S(O)NRa R b 、 -OS(O)NR a R b 、 -OS(O)2NR a R b 、 -NR a R b 、 -NR a C(O)R b 、 -NR a C(O)OR b 、 -NR a C(O)NR a R b 、 -NR a S(O)R b 、 -NR a S(O)2R b 、 -NR a S(O)NR a R b 、 -NR a S(O)2NR a R b 、 -C(O)R a 、 -C(O)OR a 、 -C(O)NR a R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, and R may be optionally substituted by 1 where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NRc R d ,-OS(O)R c ,-OS(O)2R c ,-OS(O)NR c R d ,-OS(O)2NR c R d ,-SR c ,-S(O)R c ,-S(O)2R c ,-S(O)NR c R d ,-S(O)2NR c R d ,-NR c R d ,-NR c C(O)R d ,-N(C(O)R c )(C(O)R d )、-NR c C(O)OR d 、-NR c C(O)NR c R d 、-NR c C(=N)NR c R d 、-NR c S(O)R d 、-NR c S(O)2R d 、-NR c S(O)NR c R d 、-NR c S(O)2NR c R d 、-C(O)R c 、-C(O)OR c 、-C(O)NR c R d 、-C(=N)NR c R d 、-PR c R d 、-P(O)R c R d 、-P(O)2R c R d 、-P(O)NR c R d 、-P(O)2NR c R d 、-P(O)OR c 、-P(O)2ORc , -CN, or -NO2.
[0077] In some embodiments, Ring A is pyridinylene, pyrazinylene, pyrimidinylene, pyridazinylene, or triazinylene, wherein each hydrogen atom in the pyridinylene, pyrazinylene, pyrimidinylene, pyridazinylene, and triazinylene is independently selected from deuterium, halogen, C-C alkyl, C-C alkenyl, C-C alkynyl, C-C cycloalkyl, 3- to 7-membered heterocycloalkyl, C-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a R b , -S(O)NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O)2R b , -NR a S(O)NR a R b , -NR a S(O)NR a R b , -C(O)R a , -C(O)OR a , -C(O)NRa R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)₂R a R b 、 -P(O)NR a R b 、 -P(O)₂NR a R b 、 -P(O)OR a 、 -P(O)₂OR a 、 -CN, or -NO₂, where R 1 may be optionally substituted by, where each hydrogen atom in C₁-C₆ alkyl, C₂-C₆ alkenyl, C₂-C₆ alkynyl, C₃-C₆ cycloalkyl, 3- to 7-membered heterocycloalkyl, C₆-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C₁-C₆ alkyl, C₁-C₆ haloalkyl, -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)₂R c 、 -OS(O)NR c R d 、 -OS(O)₂NR c R d 、 -SR c 、 -S(O)R c 、 -S(O)₂R c 、 -S(O)NR c R d 、 -S(O)₂NR c R d 、 -NR c R d 、 -NR c C(O)R d 、 -N(C(O)R c )(C(O)R d )、 -NR c C(O)OR d 、 -NR c C(O)NR c R d 、 -NRc C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)2R d 、 -NR c S(O)NR c R d 、 -NR c S(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2, and may be optionally substituted by them as desired.
[0078] In some embodiments, ring A is a 5- to 10-membered heteroarylene, such as a monocyclic 5- or 6-membered heteroarylene, or a bicyclic 8- to 10-membered heteroarylene, where the 5- to 10-membered heteroarylene is, as described herein, 1, 2, 3, 4, or 5 R 1 (m R 1 ) and may be optionally substituted, each of which is deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、 -OC(O)R a 、 -OC(O)NR a R b 、 -OS(O)Ra 、 -OS(O)2R a 、 -SR a 、 -S(O)R a 、 -S(O)2R a 、 -S(O)NR a R b 、 -S(O)2NR a R b 、 -OS(O)NR a R b 、 -OS(O)2NR a R b 、 -NR a R b 、 -NR a 、 -NR b 、 -NR a C(O)OR b 、 -NR a C(O)NR a R b 、 -NR a S(O)R b 、 -NR a S(O)2R b 、 -NR a S(O)NR a R b 、 -NR a S(O)2NR a R b 、 -C(O)R a 、 -C(O)OR a 、 -C(O)NR a R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, and -NO2, and is independently selected from the group consisting of, where C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3 to 7 membered heterocycloalkyl, C6-C 10Each hydrogen atom in aryl or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c 、-OC(O)R c 、-OC(O)NR c R d 、-OC(=N)NR c R d 、-OS(O)R c 、-OS(O)2R c 、-OS(O)NR c R d 、-OS(O)2NR c R d 、-SR c 、-S(O)R c 、-S(O)2R c 、-S(O)NR c R d 、-S(O)2NR c R d A、-NR c R d 、-NR c C(O)R d 、-N(C(O)R c )(C(O)R d 、-NR c C(O)OR d 、-NR c C(O)NR c R d 、-NR c C(=N)NR c R d 、-NR c S(O)R d 、-NR c S(O)2R d 、-NR c S(O)NR c R d 、-NR c S(O)2NR c R d 、-C(O)R c 、-C(O)OR c 、-C(O)NR c R d 、-C(=N)NR c R d 、-PR c R d 、-P(O)Rc R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2, may be optionally substituted as desired.
[0079] In some embodiments, ring A is pyrrolylene, isoxazolylene, isothiazolylene, pyrazolylene, or imidazolylene, where each may be optionally substituted with 1, 2, 3, 4, or 5 R 1 (m R 1 ) and each of which is deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、 -OC(O)R a 、 -OC(O)NR a R b 、 -OS(O)R a 、 -OS(O)2R a 、 -SR a 、 -S(O)R a 、 -S(O)2R a 、 -S(O)NR a R b 、 -S(O)2NR a R b 、 -OS(O)NR a R b 、 -OS(O)2NR a R b 、 -NR a R b 、 -NR a C(O)R b 、 -NR a C(O)OR b 、 -NR a C(O)NR a R b 、 -NR a S(O)R b, -NR a S(O)2R b , -NR a S(O)NR a R b , -NR a S(O)2NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R[[ID=3D]] b , -P(O)NR a R b , -P(O)2NR a R b , -P(O)OR a , -P(O)2OR a , -CN, or -NO2, independently selected from the group consisting of, wherein each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c , -OC(O)R c , -OC(O)NR c [[ID=5G]]R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NR c R d ' , -OS(O)2NR c R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d , -S(O)2NR c R d , -NR c R d , -NRc C(O)R d 、 -N(C(O)R c )(C(O)R d )、 -NR c C(O)OR d 、 -NR c C(O)NR c R d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)2R d 、 -NR c S(O)NR c R d 、 -NR c S(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, and -NO2 may be optionally substituted.
[0080] In some embodiments, ring A has the formula:
Chemical formula
Chemical formula
[0081] In some embodiments, ring A has the formula: [Chemical formula] [wherein: [Chemical formula] may optionally be a carbon-carbon single bond or a carbon-carbon double bond, [Chemical formula] Each represents a point of covalent bonding, X 1 , X 2 , and X 3 are each independently -O-, -S-, =C(H)-, =C(R 1 )-, -N(H)-, -N(R 1 )- or =N-: provided that at least one of X 1 , X 2 , and X 3 is =C(H)-, or =C(R 1)-A radical other than, wherein ring A is a 5-membered heteroarylene, and R 1 and m are as described herein.
[0082] In some embodiments, ring A is pyridinylene, pyrazinylene, pyrimidinylene, pyridazinylene, or triazinylene, where each is optionally substituted with 1, 2, 3, 4, or 5 R 1 (m R's 1 ) and each of which is deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a R b , -S(O)2NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O)2R b , -NR a S(O)NR a R b , -NR a S(O)2NR a R b, -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R b , -P(O)NR a R b , -P(O)2NR a R b , -P(O)OR a , -P(O)2OR a , -CN, or independently selected from the group consisting of -NO2, wherein each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c , -OC(O)R c , -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NR c R d , -OS(O)2NR c R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d , -S(O)2NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c )(C(O)R d , -NR c C(O)OR d , -NR c C(O)NRc R d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)2R d 、 -NR c S(O)NR c R d 、 -NR c S(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2, and may be optionally substituted as desired.
[0083] In some embodiments, m is 0, 1, 2, 3, or 4. In some embodiments, m is 0, 1, 2, or 3. In some embodiments, m is 0, 1, or 2. In some embodiments, m is 0 or 1. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4.
[0084] In some embodiments, ring A is
Chemical formula
[0085] In some embodiments, ring A is [[ID=%D]] [Chemical formula] a 5-membered heteroarylene selected from the group consisting of, wherein [Chemical formula] each represents a point of covalent bonding, and each R 1 is independently as described herein.
[0086] In some embodiments, ring A is [Chemical formula] a 5-membered heteroarylene selected from the group consisting of, wherein [Chemical formula] each represents a point of covalent bonding, and each R 1 is independently as described herein.
[0087] In some embodiments, ring A is [Chemical formula] [[ID=6Q]]a 5-membered heteroarylene selected from the group consisting of, wherein [Chemical formula] each represents a point of covalent bonding, and each R 1 is independently as described herein.
[0088] In some embodiments, ring A is
Chem.
Chem.
[0089] In some embodiments, ring A is
Chem.
Chem.
[0090] In some embodiments, ring A is
Chem.
Chem.
[0091] In some embodiments, each R 1 is, independently, deuterium, a halogen, or C1-C6 alkyl, where each hydrogen atom in the C1-C6 alkyl is, independently, optionally, deuterium, a halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c ,-OC(O)R c, -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NR c R d , -OS(O)2NR c R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d , -S(O)2NR c R d , -NR c R d , -NR c , -NR d , -N(C(O)R c )(C(O)R d , -NR c , -NR d , -NR c , -NR c R d , -NR c , -NR c R d , -NR c , -NR d , -NR c , -NR d , -NR c , -NR c R d , -NR c , -NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d , -C(=N)NR c R d , -PR c R d , -P(O)R c R d , -P(O)2R c R d , -P(O)NR c R d , -P(O)2NRc R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2, and may be substituted. In some embodiments, R 1 where each R 1 is independently methyl, ethyl, F, Cl, Br,
Chemical formula
Chemical formula
[0092] In some embodiments, ring A is
Chemical formula
Chemical formula
[0093] In some embodiments, ring A is
Chemical formula
Chemical formula
[0094] In some embodiments, ring B is a 5- to 10-membered heteroarylene or C6-C 10 arylene. In some embodiments, ring B is a monocyclic or bicyclic C6-C 10 arylene, or a monocyclic or bicyclic 5- to 10-membered heteroarylene. In some embodiments, ring B is a 5- to 10-membered heteroarylene. In some embodiments, ring B is a 5- or 6-membered heteroarylene. In some embodiments, ring B is a 5-membered heteroarylene. In some embodiments, ring B is a 6-membered heteroarylene. In some embodiments, ring B is a fused bicyclic 8- to 10-membered heteroarylene.
[0095] In some embodiments, ring B is a 5- to 10-membered heteroarylene, such as a monocyclic 5- or 6-membered heteroarylene, or a bicyclic 8- to 10-membered heteroarylene, wherein each hydrogen atom in the 5- to 10-membered heteroarylene is independently deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、-OC(O)R a 、-OC(O)NR a R b 、-OS(O)R a 、-OS(O)2R a 、-SR a 、-S(O)R a 、-S(O)2R a 、-S(O)NR a R b 、-S(O)2NR a R b 、-OS(O)NR a R b 、-OS(O)2NR a R b 、-NR a R b 、-NR a C(O)R b 、-NR a C(O)OR b 、-NR a C(O)NR a R b 、-NR a S(O)R b 、-NR a S(O)2Rb 、 -NR a S(O)NR a R b 、 -NR a S(O)2NR a R b 、 -C(O)R a 、 -C(O)OR a 、 -C(O)NR a R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, and R 2 may be optionally substituted by, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)2R c 、 -OS(O)NR c R d 、 -OS(O)2NR c R d 、 -SR c 、 -S(O)R c 、 -S(O)2R c 、 -S(O)NR c R d 、 -S(O)2NR c R d 、 -NR c R d 、 -NR cC(O)R d 、 -N(C(O)R c )(C(O)R d 、 -NR c C(O)OR d 、 -NR c C(O)NR c R d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)2R d 、 -NR c S(O)NR c R d 、 -NR c S(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2, and may be optionally substituted by -CN or -NO2 as desired.
[0096] In some embodiments, ring B is isoxazolylene, isothiazolylene, or pyrazolylene, where each hydrogen atom in isoxazolylene, isothiazolylene, or pyrazolylene, and imidazolylene is independently deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a, -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a R b , -S(O)2NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a R b , -NR a , -NR b , -NR a , -NR b , -NR a , -NR a R b , -NR a , -NR b , -NR a , -NR b , -NR a , -NR a R b , -NR a , -NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R b , -P(O)NR a R b , -P(O)2NR a R b , -P(O)OR a , -P(O)2OR a , -CN, or -NO2 is R 2and optionally substituted by C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 Each hydrogen atom in the aryl or 5- to 10-membered heteroaryl is independently selected from deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c , -OC(O)R c , -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NR c R d , -OS(O)2NR c R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d , -S(O)NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c )(C(O)R d ), -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c C(=N)NR c R d , -NR c S(O)R d , -NR c S(O)2R d , -NR c S(O)NR c R d , -NR c S(O)NR c R d , -C(O)R c , -C(O)OR c , -C(O)NRc R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)₂R c R d 、 -P(O)NR c R d 、 -P(O)₂NR c R d 、 -P(O)OR c 、 -P(O)₂OR c 、 -CN, or -NO₂, and may be optionally substituted by them.
[0097] In some embodiments, ring B is isoxazolylene, isothiazolylene, or pyrazolylene, where each hydrogen atom in isoxazolylene, isothiazolylene, or pyrazolylene is independently deuterium, halogen, C₁-C₆ alkyl, C₂-C₆ alkenyl, C₂-C₆ alkynyl, C₃-C₆ cycloalkyl, 3- to 7-membered heterocycloalkyl, C₆-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、 -OC(O)R a 、 -OC(O)NR a R b 、 -OS(O)R a 、 -OS(O)₂R a 、 -SR a 、 -S(O)R a 、 -S(O)₂R a 、 -S(O)NR a R b 、 -S(O)₂NR a R b 、 -OS(O)NR a R b 、 -OS(O)₂NR a R b 、 -NR a R b 、 -NR a C(O)R b 、 -NR a C(O)OR b 、 -NR a C(O)NR aR b , -NR a S(O)R b , -NR a S(O)2R b , -NR a S(O)NR a R b , -NR a S(O)NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R b , -P(O)NR a R b , -P(O)2NR a R b , -P(O)OR a , -P(O)2OR a , -CN, or -NO2 2 and optionally substituted by C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 Each hydrogen atom in the aryl or 5- to 10-membered heteroaryl is independently selected from deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c , -OC(O)R c , -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NR c R d , -OS(O)2NR c R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d, -S(O)2NR c R d , -NR c R d , -NR c , -NRC(O)R d , -N(C(O)R c )(C(O)R d ), -NR c , -NRC(O)OR d , -NR c , -NRC(O)NR c R d , -NR c , -NRC(=N)NR c R d , -NR c , -NR S(O)R d , -NR c , -NR S(O)2R d , -NR c , -NR S(O)NR c R d , -NR c , -NR S(O)2NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d , -C(=N)NR c R d , -PR c R d , -P(O)R c R d , -P(O)2R c R d , -P(O)NR c R d , -P(O)2NR c R d , -P(O)OR c , -P(O)2OR c It may be optionally substituted by -CN, or -NO2.
[0098] In some embodiments, ring B is a 5- to 10-membered heteroarylene, for example, a monocyclic 5- or 6-membered heteroarylene, or a bicyclic 8- to 10-membered heteroarylene, where the 5- to 10-membered heteroarylene has 1, 2, 3, 4, or 5 R's as described herein 2(m R's 2 ) may be optionally replaced, each of which is deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a >R b , -S(O)2NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O)2R b , -NR a S(O)NR a R b , -NR a S(O)2NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R b , -P(O)NR a R b, -P(O)2NR a R b , -P(O)OR a , -P(O)2OR a , -CN, or -NO2, independently selected from the group consisting of, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c , -OC(O)R c , -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NR c R d , -OS(O)2NR c R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d , -S(O)2NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c )(C(O)R d , -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c C(=N)NR c R d , -NR c S(O)R d , -NR c S(O)2R d , -NR c S(O)NR c R d , -NR cS(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2 may be optionally substituted as desired.
[0099] In some embodiments, ring B is isoxazolylene, isothiazolylene, or pyrazolylene, where each is optionally substituted with 1, 2, 3, 4, or 5 R 2 (m R 2 ) and each of which may be optionally substituted, and each of them is deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、 -OC(O)R a 、 -OC(O)NR a R b 、 -OS(O)R a 、 -OS(O)₂R a 、 -SR a 、 -S(O)R a 、 -S(O)₂R a 、 -S(O)NR a R b 、 -S(O)₂NR a R b 、 -OS(O)NR a R b 、 -OS(O)₂NR a R b 、 -NR a Rb 、 -NR a C(O)R b 、 -NR a C(O)OR b 、 -NR a C(O)NR a R b 、 -NR a S(O)R b 、 -NR a S(O)2R b 、 -NR a S(O)NR a R b 、 -NR a S(O)2NR a R b 、 -C(O)R a 、 -C(O)OR a 、 -C(O)NR a R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, and is independently selected from the group consisting of, wherein each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)2R c 、 -OS(O)NR c R d 、 -OS(O)2NR c R d, -SR c , -S(O)R c , -S(O)₂R c , -S(O)NR c R d 0, -S(O)₂NR1 c 2R3 d 4, -NR5 c 6R7 d 8, -NR9 c 0, -NR1 d 2C(O)R3 c 4, -N(C(O)R5 d 6)(C(O)R7 c 8, -NR9 d 0, -NR1 c 2C(O)NR3 c 4R5 d 6, -NR7 c 8C(=N)NR9 c 0R1 d 2, -NR3 c 4S(O)R5 d 6, -NR7 c 8S(O)₂R9 d 0, -NR1 c 2S(O)NR3 c 4R5 d 6, -NR7 c 8S(O)₂NR9 c 0R1 d 2, -C(O)R3 c 4, -C(O)OR5 c 6, -C(O)NR7 c 8R9 d 0, -C(=N)NR1 c 2R3 d 4, -PR5 c 6R7 d 8, -P(O)R9 c 0R1 d 2, -P(O)₂R3 c 4R5 d 6, -P(O)NR7 c 8R9 d 0, -P(O)₂NR1 c 2R3 d 4, -P(O)OR5 c 6, -P(O)₂OR7 c 8, -CN, or may be optionally substituted by -NO₂. 9 00
[0100] 01 In some embodiments, n is 0, 1, 2, 3, or 4. In some embodiments, n is 0, 1, 2, or 3. In some embodiments, n is 0, 1, or 2. In some embodiments, n is 0 or 1. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4.
[0101] In some embodiments, ring B is
Chemical Formula
Chemical Formula
[0102] In some embodiments, R 2 is deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a [[ID=4**]]R b , -S(O)2NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NRa R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O)2R b , -NR a S(O)NR a R b , -NR a S(O)NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R b , -P(O)NR a R b , -P(O)2NR a R b , -P(O)OR a , -P(O)2OR a , -CN, or -NO2, where C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 Each hydrogen atom in the aryl or 5- to 10-membered heteroaryl is independently selected from deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c , -OC(O)R c , -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NR c R d , -OS(O)2NR c R d, -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d , -S(O)2NR c R d , -NR c R d , -NR c , -NR d , -N(C(O)R c )(C(O)R d ), -NR c , -NR d , -NR c , -NR c R d , -NR c , -NR c R d , -NR c , -NR d , -NR c , -NR d , -NR c , -NR c R d , -NR c , -NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d , -C(=N)NR c R d , -PR c R d , -P(O)R c R d , -P(O)2R c R d , -P(O)NR c R d , -P(O)2NR c R d , -P(O)OR c , -P(O)2OR c , -CN, or -NO2 may be optionally substituted as desired. In some embodiments, R 2 is methyl or ethyl.
[0103] In some embodiments, ring B is a 5-membered heteroarylene selected from the group consisting of
Chemical formula
Chemical formula
[0104] In some embodiments, ring B is a monocyclic or bicyclic C6-C 10 arylene. In some embodiments, ring B is a monocyclic C6-C 10 arylene. In some embodiments, ring B is a bicyclic C6-C 10 arylene.
[0105] In some embodiments, ring B is a monocyclic or bicyclic arylene of C6-C 10 wherein each hydrogen atom in the monocyclic or bicyclic arylene of C6-C 10 is independently deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a R b , -S(O)2NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a Rb 、 -NR a C(O)R b 、 -NR a C(O)OR b 、 -NR a C(O)NR a R b 、 -NR a S(O)R b 、 -NR a S(O)2R b 、 -NR a S(O)NR a R b 、 -NR a S(O)2NR a R b 、 -C(O)R a 、 -C(O)OR a 、 -C(O)NR a R b 、 -PR a R b 、 -P(O)R a R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, and R may be optionally substituted by 2 where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)2R c 、 -OS(O)NR c R d 、 -OS(O)2NRc R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d , -S(O)NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c )(C(O)R d ), -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c C(=N)NR c R d , -NR c S(O)R d , -NR c S(O)2R d , -NR c S(O)NR c R d , -NR c S(O)NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d , -C(=N)NR c R d , -PR c R d , -P(O)R c R d , -P(O)2R c R d , -P(O)NR c R d , -P(O)2NR c R d , -P(O)OR c , -P(O)2OR c , -CN, or -NO2.
[0106] In some embodiments, ring B is phenylene or naphthylene, where each hydrogen atom in the phenylene or naphthylene is independently deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a R b , -S(O)2NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O)2R b , -NR a S(O)NR a R b , -NR a S(O)2NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R b , -P(O)NRa R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, and R 2 may be optionally substituted by, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)2R c 、 -OS(O)NR c R d 、 -OS(O)2NR c R d 、 -SR c 、 -S(O)R c 、 -S(O)2R c 、 -S(O)NR c R d 、 -S(O)2NR c R d 、 -NR c R d 、 -NR c C(O)R d 、 -N(C(O)R c )(C(O)R d )、 -NR c C(O)OR d 、 -NR c C(O)NR c R d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)2R d 、 -NR c S(O)NRc R d 、 -NR c S(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d s、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2 may be optionally substituted as desired.
[0107] In some embodiments, ring B is a monocyclic or bicyclic arylene of C6-C 10 each of which may be optionally substituted with 1, 2, 3, 4, or 5 Rs 2 (n Rs 2 ) and each of which may be deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、 -OC(O)R a 、 -OC(O)NR a R b 、 -OS(O)R a 、 -OS(O)2R a 、 -SR a 、 -S(O)R a 、 -S(O)2R a 、 -S(O)NR a R b 、 -S(O)2NR a R b 、 -OS(O)NR a R b, -OS(O)2NR a R b , -NR a R b , -NR a , -NR b , -NR a , -NR b , -NR a , -NR a R b , -NR a , -NR b , -NR a , -NR b , -NR a , -NR a R b , -NR a , -NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R b , -P(O)NR a R b , -P(O)2NR a R b , -P(O)OR a , -P(O)2OR a , -CN, or independently selected from the group consisting of -NO2, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c , -OC(O)R c , -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NRc R d 、 -OS(O)2NR c R d 、 -SR c 、 -S(O)R c 、 -S(O)2R c 、 -S(O)NR c R d 、 -S(O)2NR c R d 、 -NR c R d 、 -NR c C(O)R d 、 -N(C(O)R c )(C(O)R d 、 -NR c C(O)OR d 、 -NR c C(O)NR c R d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)2R d 、 -NR c S(O)NR c R d 、 -NR c S(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, and -NO2 may be optionally substituted.
[0108] In some embodiments, ring B is phenylene or naphthylene, each of which may be optionally substituted by 1, 2, 3, 4, or 5 Rs 2 (n Rs 2 ) and each of which may be deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)NR a R b , -S(O)2NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O)2R b , -NR a S(O)NR a R b , -NR a S(O)2NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)Ra R b 、 -P(O)2R a R b 、 -P(O)NR a R b 、 -P(O)2NR a R b 、 -P(O)OR a 、 -P(O)2OR a 、 -CN, or -NO2, and is independently selected from the group consisting of, wherein each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)2R c 、 -OS(O)NR c R d 、 -OS(O)2NR c R d 、 -SR c 、 -S(O)R c 、 -S(O)²R c 、 -S(O)NR c R d 、 -S(O)²NR c R d 、 -NR c R d 、 -NR c C(O)R d 、 -N(C(O)R c )(C(O)R d )、 -NR c C(O)OR d 、 -NR c C(O)NR c R[[ID=८०]] d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NRc S(O)2R d 、 -NR c S(O)NR c R d 、 -NR c S(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2 may be optionally substituted as desired.
[0109] In some embodiments, ring B is C6-C 10 arylene, and n is as described herein. In some embodiments, ring B is phenylene, and n is as described herein. In some embodiments, n is 0, 1, 2, 3, or 4. In some embodiments, n is 0, 1, 2, or 3. In some embodiments, n is 0, 1, or 2. In some embodiments, n is 0 or 1. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, R 2 is methyl, ethyl, F, Cl, or Br. In some embodiments, ring B is phenylene, n is 1, and R 2is methyl, ethyl, F, Cl, or Br.
[0110] In some embodiments, ring B is of the formula:
Chemical formula
Chemical formula
[0111] In some embodiments, R 3 is H, deuterium, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently -OR c 、-OC(O)R c 、-OC(O)NR c R d 、-OC(=N)NR c R d 、-OS(O)R c 、-OS(O)2R c 、-OS(O)NR c R d 、-OS(O)2NR c R d 、-SR c 、-S(O)R c 、-S(O)2R c 、-S(O)NR c R d 、-S(O)2NR c R d 、-NR c R d 、-NR c C(O)R d 、-N(C(O)R c )(C(O)Rd )、 -NR c C(O)OR d 、 -NR c C(O)NR c R d 、 -NR c C(=N)NR c R d 、 -NR c S(O)R d 、 -NR c S(O)2R d 、 -NR c S(O)NR c R d 、 -NR c S(O)2NR c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2 may be optionally substituted as desired. In some embodiments, R 3 is H or C1-C6 alkyl, where each hydrogen atom in C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently -OR c 、 -OC(O)R c 、 -OC(O)NR c R d 、 -OC(=N)NR c R d 、 -OS(O)R c 、 -OS(O)2R c, -OS(O)NR c R d , -OS(O)2NR c R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R d , -S(O)2NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c )(C(O)R d , -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c C(=N)NR .. c R d , -NR c S(O)R d , -NR c S(O)2R d , -NR c S(O)NR c R .. d , -NR c S(O)2NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d , -C(=N)NR c R d , -PR c R d , -P(O)R c R d , -P(O)2R c R d , -P(O)NR c R d , -P(O)2NR c R d , -P(O)OR c , -P(O)2OR c , -CN, or -NO2, and may be optionally substituted as desired. In some embodiments, R3 is H, deuterium, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl, wherein each hydrogen atom in the C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, or 5- to 10-membered heteroaryl is independently deuterium, -OR c , -OC(O)R c , -OC(O)NR c R d , -OC(=N)NR c R d , -OS(O)R c , -OS(O)2R c , -OS(O)NR c R d , -OS(O)2NR c R d , -SR c , -S(O)R c , -S(O)2R c , -S(O)NR c R<000३407>, -S(O)2NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c )(C(O)R d ), -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c C(=N)NR[[ID=🔴8]] c R d , -NR c S(O)R d , -NR c S(O)2R d , -NR c S(O)NR c R[[ID=🔴4]] d , -NR c S(O)2NR Note: There seems to be a formatting or content issue in the original text where some of the tags like d and c etc. might be incorrect in the provided format. Also, the translation assumes the text is some sort of chemical or technical description where these notations are standard. The translation has been done as per the rules while trying to make sense of the overall context. If there are specific requirements or corrections needed for the original text, it would affect the translation accuracy.c R d 、 -C(O)R c 、 -C(O)OR c 、 -C(O)NR c R d 、 -C(=N)NR c R d 、 -PR c R d 、 -P(O)R c R d 、 -P(O)2R c R d 、 -P(O)NR c R d 、 -P(O)2NR c R d 、 -P(O)OR c 、 -P(O)2OR c 、 -CN, or -NO2, and may be optionally substituted as desired. In some embodiments, R 3 is H or C1-C6 alkyl. In some embodiments, R 3 is H or methyl.
[0112] In some embodiments, q is 0, 1, or 2. In some embodiments, q is 0 or 1. In some embodiments, q is 0. In some embodiments, q is 1. In some embodiments, q is 2.
[0113] In some embodiments, each R 4 is, independently, deuterium, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 aryl, 5- to 10-membered heteroaryl, -OR a 、 -OC(O)R a 、 -OC(O)NR a R b 、 -OS(O)R a 、 -OS(O)2R a 、 -SR a 、 -S(O)R a 、 -S(O)2R a 、 -S(O)NR aR b , -S(O)NR a R b , -OS(O)NR a R b , -OS(O)2NR a R b , -NR a R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O)2R b , -NR a S(O)NR a R b , -NR a S(O)NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)R a R b , -P(O)2R a R b , -P(O)NR a R b , -P(O)2NR a R b , -P(O)OR a , -P(O)2OR a , -CN, or -NO2, where C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C6-C 10 Each hydrogen atom in the aryl and 5- to 10-membered heteroaryl is independently selected from deuterium, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR e , -OC(O)R e , -OC(O)NR e R f , -OS(O)R e, -OS(O)2R e , -OS(O)NR e R f , -OS(O)2NR e R f , -SR e , -S(O)R e , -S(O)2R e , -S(O)NR e R f , -S(O)2NR e R f , -NR e R f , -NR e , -NR f , -NR e , -NR f , -NR e , -NR e R f , -NR e , -NR f , -NR e , -NR f , -NR e , -NR e R f , -NR e , -NR e R f , -C(O)R e , -C(O)OR e , -C(O)NR e R f , -PR e R f , -P(O)R e R f , -P(O)2R e R f , -P(O)NR e R f , -P(O)2NR e R f , -P(O)OR e , -P(O)2OR e , -CN, or -NO2 may be optionally substituted as desired. In some embodiments, each R 4 is independently deuterium, halogen, or C1-C6 alkyl. In some embodiments, each R 4 is H, fluoro, chloro, or methyl.
[0114] In some embodiments, R 5 is H, deuterium, -C(O)R c , -C(O)OR c , -C(O)NR c R d , -P(O)2R c R d , -P(O)2NR c R d , -P(O)2OR c , or -S(O)2OR c . In some embodiments, R 5 is H or deuterium. In some embodiments, R 5 is -C(O)R c , -C(O)OR c , -C(O)NR c R d , -P(O)2R c R d , -P(O)2NR c R d , -P(O)2OR c , or -S(O)2OR c . In some embodiments, R 5 is C1-C6 alkyl. In some embodiments, R 5 is methyl or ethyl.
[0115] In some embodiments, each L is independently -O-, -S-, -S(O)-, -S(O)2-, -N(R 6 )C(O)-, -C(O)N(R 6 )-, -N(R 6 )-, -N(R 6 )S(O)-, -S(O)N(R 6 )-, -N(R 6 )S(O)2-, -S(O)2N(R 6 )-, or -C(R 7 )(R 8 ): provided that (L) p does not contain an O-O, S-O, or N-N bond. In some embodiments, each L is independently -C(R 7 )(R 8)-, -C(O)-, -O-, or -N(R 6 )-: provided that (L) p does not contain an -O-O- or -O-N(R 6 )- bond, and the point where (L) p shares a bond with -NR 3 - does not form an -N-N- or -O-N- bond.
[0116] In some embodiments, p is 3, 4, 5, 6, 7, 8, or 9. In some embodiments, p is 5, 6, 7, 8, or 9. In some embodiments, p is 4, 5, 6, 7, or 8. In some embodiments, p is 5, 6, 7, or 8. In some embodiments, p is 6, 7, 8, or 9. In some embodiments, p is 5, 6, or 7. In some embodiments, p is 3, 4, 5, 6, or 7. In some embodiments, p is 3, 4, 5, or 6. In some embodiments, p is 3. In some embodiments, p is 4. In some embodiments, p is 5. In some embodiments, p is 6. In some embodiments, p is 7. In some embodiments, p is 8. In some embodiments, p is 9.
[0117] In some embodiments, -(L) p - is -(CR 7 R 8 )C(O)N(R 6 )-(CR 7 R 8 )2-, -(CR 7 R 8 )N(R 6 )C(O)-(CR 7 R 8 )2-, -N(R 6 )-C(O)(CR 7 R 8 )2O(CR 7 R 8 )2-, -CR 7 R 8 O(CR 7 R 8)2O-(CR 7 R 8 )2、-O(CR 7 R 8 )2O(CR 7 R 8 )2-、-CR 7 R 8 O-CR 7 R 8 -C(O)N(R 6 )-(CR 7 R 8 )2-、-(CR 7 R 8 )3O(CR 7 R 8 )2-、-(CR 7 [[ID=3,6]]R 8 )2O(CR 7 R 8 )3-、-CR 7 R 8 -N(R 6 )-(CR 7 R 8 )2-、-CR 7 R 8 -N(R 6 )-(CR 7 R 8 )3-、-O(CR 7 R 8 )2O(CR 7 R 8 )3-、-(CR 7 R 8 )2-N(R 6 )-(CR 7 R 8 )3-、-(CR 7 R 8 )2-N(R 6 )-(CR 7 R 8 )2-、-O-(CR 7 R 8 )2-、-O-(CR 7 R 8 )3-、または-O-(CR 7 R 8 )4- is included.
[0118] In some embodiments, -(L) p - is -(CR 7 R 8 )C(O)N(R6 )-(CR 7 R 8 )2-、-(CR 7 R 8 )N(R 6 )C(O)-(CR 7 R 8 )2-、-N(R 6 )-C(O)(CR 7 R 8 )2O(CR 7 R 8 )2-、-CR 7 R 8 O(CR 7 R 8 )2O-(CR 7 R 8 )2、-O(CR 7 R 8 )2O(CR 7 R 8 )2-、-CR 7 R 8 O-CR 7 R 8 -C(O)N(R 6 )-(CR 7 R 8 )2-、-(CR 7 R 8 )3O(CR 7 R 8 )2-、-(CR 7 R 8 )2O(CR 7 R 8 )3-、-CR 7 R 8 -N(R 6 )-(CR 7 R 8 )2-、-CR 7 R 8 -N(R 6 )-(CR 7 R 8 )3-、-O(CR 7 R 8 )2O(CR 7 R 8 )3-、-(CR 7 R 8 )2-N(R 6 )-(CR 7 R 8 )3-、-(CR 7 R 8)2-N(R 6 )-(CR 7 R 8 )2-、-O-(CR 7 R 8 )2-、-O-(CR 7 R 8 )3-、 or -O-(CR 7 R 8 )4-.
[0119] In some embodiments, R 6 , when present, is H or C1-C6 alkyl. In some embodiments, R 6 , when present, is H or methyl. In some embodiments, R 7 , when present, is H, C1-C6 alkyl, -OH, or -OCH3. In some embodiments, R 7 , when present, is H, methyl, -OH, or -OCH3. In some embodiments, R 8 , when present, is H, C1-C6 alkyl, -OH, or -OCH3. In some embodiments, R 8 , when present, is H, methyl, -OH, or -OCH3. In some embodiments, R 7 and R 8 each, when present, is H.
[0120] In some embodiments, -(L) p- is -CH2C(O)N(H)-(CH2)2O-, -CH2C(O)N(CH3)(CH2)2O-, -CH2C(O)N(CH2CH3)-(CH2)2O-, -CH2N(H)C(O)-(CH2)2O-, -CH2C(O)N(CH3)C(O)-(CH2)2O-, -CH2C(O)N(CH2CH3)C(O)-(CH2)2O-, -C(O)N(H)(CH2)2O(CH2)2-, -N(H)-C(O)(CH2)2O(CH2)2-, -CH2O(CH2)3O-, -CH2O(CH2)2OCH2-, -(CH2)2O(CH2)2O-, -CH2O-CH2-C(O)N(H)-(CH2)2-, -CH2O(CH2)2C(O)N(H)-CH2-, -CH2O(CH2)2N(H)C(O)-, -CH2O(CH2)3N(H)C(O)-, -(CH2)2O(CH2)2N(H)C(O)-, -CH(CH3)CH2O(CH2)2N(CH3)C(O)-, -CH(CH3)-CH2O(CH2)2N(H)C(O)-, -CH(OCH3)-CH2O(CH2)2N(CH3)C(O)-, -CH(OCH3)-CH2O(CH2)2N(H)C(O)-, -O(CH2)2O(CH2)2N(H)C(O)-, -CH2O(CH2)2N(H)C(O)-CH2-, or -O-(CH2)3C(O)N(H)-.
[0121] In some embodiments, -(L) p- is -CH2C(O)N(H)-(CH2)2OCH2-, -C(O)N(H)-(CH2)2O(CH2)2-, -N(H)-C(O)(CH2)2O(CH2)2-, -CH2O(CH2)2O-(CH2)2, -O(CH2)2O(CH2)2O-, -CH2O-CH2-C(O)N(H)-(CH2)2-, -CH2O(CH2)2C(O)N(H)-CH2-, -CH2O(CH2)2N(H)C(O)-, -CH2O(CH2)3N(H)C(O)-, -(CH2)2O(CH2)2N(H)C(O)-, -CH(CH3)CH2O(CH2)2N(CH3)C(O)-, -CH(CH3)-CH2O(CH2)2N(H)C(O)-, -CH(OCH3)-CH2O(CH2)2N(CH3)C(O)-, -CH(OCH3)-CH2O(CH2)2N(H)C(O)-, -O(CH2)2O(CH2)2N(H)C(O)-, -CH2O(CH2)2N(H)C(O)-CH2-, or -O-(CH2)3C(O)N(H)-.
[0122] In some embodiments, -(L) p - is -CH2N(H)-(CH2)2-, -CH2N(CH3)-(CH2)2-, -O(CH2)2-, -O(CH2)3-, -O(CH2)4-, and -O(CH2)2O(CH2)2-. In some embodiments, -(L) p - is -CH2N(H)-(CH2)2-, -CH2N(CH3)-(CH2)2-, -O(CH2)2-, -O(CH2)3-, -O(CH2)4-, and -O(CH2)2O(CH2)2-. In some embodiments, -(L) p - is -CH2N(H)-(CH2)2-, -CH2N(CH3)-(CH2)2-, -O(CH2)2-, -OCH(CH3)CH2-, -O(CH2)3-, -O(CH2)4-, and -O(CH2)2O(CH2)2-.
[0123] In some embodiments, the present disclosure [Chemical formula] [Chemical formula] Provided is a compound selected from the group consisting of, or a pharmaceutically acceptable salt thereof.
[0124] In some embodiments, the present disclosure (17E)-8,12,15-Trimethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-16-Ethyl-8,12,14-trimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-16-Ethyl-8,12,15-trimethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-8,12,14,16-Tetramethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-8,12,15,16-Tetramethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-8,15,16-Trimethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-14-ethyl-8,12,16-trimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3',4'-j:4'',3''-n][1,4]oxyazacyclopentadecin-13(10H)-one; (19E)-8,14,16,18-tetramethyl-2,11,12,13,14,16-hexahydro-8H-3,5-ethenotripyrazolo[3,4-h:3',4'-l:4'',3''-p][1,6]oxyazacycloheptadecin-15(10H)-one; (18E)-8,13,15,17-tetramethyl-2,10,11,12,13,15-hexahydro-3,5-ethenotripyrazolo[3,4-g:3',4'-k:4'',3''-o][1,5]oxyazacyclohexadecin-14(8H)-one; (15E)-3,10,12,14-tetramethyl-5,6,9,10,12,18-hexahydro-3H-19,21-ethenotripyrazolo[3,4-i:3',4'-m:4'',3''-q][1,4,7]dioxyazacyclooctadecin-11(8H)-one; (18E)-8,10,13,15,17-pentamethyl-2,8,9,10,11,12,13,15-octahydro-14H-3,5-ethenotripyrazolo[3,4-f:3',4'-j:4'',3''-n][1,4]diazacyclohexadecin-14-one; (17E)-14-(2-hydroxyethyl)-8,12,16-trimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3',4'-j:4'',3''-n][1,4]oxyazacyclopentadecin-13(10H)-one; (17E)-15-(2-hydroxyethyl)-8,12,16-trimethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3',4'-j:4'',3''-n][1,4]oxyazacyclopentadecin-13(10H)-one; (17E)-8,12,16-Trimethyl-14-[2-(pyrrolidin-1-yl)ethyl]-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; and (17E)-8,12,16-Trimethyl-15-[2-(pyrrolidin-1-yl)ethyl]-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one A compound selected from the group consisting of, or a pharmaceutically acceptable salt thereof.
[0125] In some embodiments, the present disclosure (18E)-17-Ethyl-7-fluoro-13,16-dimethyl-2,12,13,16-tetrahydro-3,5-ethenodipyrazolo[3,4-f:3’,4’-j][1,4]benzoxaazacyclopentadecin-14(11H)-one; (18E)-17-Ethyl-7-fluoro-13,15-dimethyl-2,12,13,15-tetrahydro-3,5-ethenodipyrazolo[3,4-f:3’,4’-j][1,4]benzoxazacyclopentadecin-14(11H)-one; (18E)-13,16-Dimethyl-2,12,13,16-tetrahydro-3,5-ethenodipyrazolo[3,4-f:3’,4’-j][1,4]benzoxaazacyclopentadecin-14(11H)-one; and (18E)-21-Chloro-17-ethyl-7-fluoro-13,16-dimethyl-2,12,13,16-tetrahydro-3,5-ethenodipyrazolo[3,4-f:3’,4’-j][1,4]benzoxaazacyclopentadecin-14(11H)-one A compound selected from the group consisting of, or a pharmaceutically acceptable salt thereof.
[0126] In some embodiments, the present disclosure (17E)-8,12,15-Trimethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-16-Ethyl-8,12,14-trimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-16-Ethyl-8,12,15-trimethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-8,12,14,16-Tetramethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-8,12,15,16-Tetramethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-8,15,16-Trimethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-14-Ethyl-8,12,16-trimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (19E)-8,14,16,18-Tetramethyl-2,11,12,13,14,16-hexahydro-8H-3,5-ethenotripyrazolo[3,4-h:3’,4’-l:4’’,3’’-p][1,6]oxaazacycloheptadecin-15(10H)-one; (18E)-8,13,15,17-Tetramethyl-2,10,11,12,13,15-hexahydro-3,5-ethenotripyrazolo[3,4-g:3’,4’-k:4’’,3’’-o][1,5]oxaazacyclohexadecin-14(8H)-one; (15E)-3,10,12,14-Tetramethyl-5,6,9,10,12,18-hexahydro-3H-19,21-ethenotripyrazolo[3,4-i:3’,4’-m:4’’,3’’-q][1,4,7]dioxaazacyclooctadecin-11(8H)-one; (18E)-8,10,13,15,17-Pentamethyl-2,8,9,10,11,12,13,15-octahydro-14H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]diazacyclohexadecin-14-one; (17E)-14-(2-Hydroxyethyl)-8,12,16-trimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-15-(2-Hydroxyethyl)-8,12,16-trimethyl-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one;
[0127] (17E)-8,12,16-Trimethyl-14-[2-(pyrrolidin-1-yl)ethyl]-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-8,12,16-Trimethyl-15-[2-(pyrrolidin-1-yl)ethyl]-2,11,12,15-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-8,12,16-Trimethyl-14-(propan-2-yl)-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-16-Ethyl-8-methyl-12,14-bis 2 ((H3)methyl]-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-16-Ethoxy-8,12,14-trimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (10S,17E)-16-Ethyl-8,10,12,14-tetramethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (17E)-8,12,14-Trimethyl-13-oxo-2,10,11,12,13,14-hexahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-16-carbonitrile; (17E)-16-Ethyl-8,12-dimethyl-2,8,11,12-tetrahydro-3,5-etheno[1,2]oxazolo[5,4-f]dipyrazolo[3,4-j:4’,3’-n][1,4]oxaazacyclopentadecin-13(10H)-one; (18E)-15-(2-Hydroxyethyl)-8,10,13,17-tetramethyl-2,8,9,10,11,12,13,15-octahydro-14H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]diazacyclohexadecin-14-one; and (17E)-16-Ethoxy-14-(2-hydroxyethyl)-8,12-dimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one; A compound selected from the group consisting of, or a pharmaceutically acceptable salt thereof, is provided.
[0128] Exemplary embodiments of the compounds of formula (I) and their pharmaceutically acceptable salts are shown below: [Table 1] [Table 2] [Table 3] [Table 4] [Table 5] [Table 6] [Table 7]
[0129] One of ordinary skill in the art will recognize that the species listed or exemplified herein are not exhaustive and that additional species within the scope of these defined terms may also be selected.
[0130] Pharmaceutical composition For therapeutic purposes, the pharmaceutical compositions containing the compounds described herein may further comprise one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients are non-toxic and otherwise biologically suitable substances for administration to a subject. Such excipients facilitate the administration of the compounds described herein and are compatible with the active ingredient. Examples of pharmaceutically acceptable excipients include stabilizers, lubricants, surfactants, diluents, antioxidants, binders, colorants, bulking agents, emulsifiers or flavoring and odor-masking agents. In a preferred embodiment, the pharmaceutical composition according to the disclosure is a sterile composition. The pharmaceutical composition can be manufactured using known or available compounding techniques to those skilled in the art.
[0131] Sterile compositions are also contemplated by the present disclosure and include compositions that comply with the national and local regulations governing such compositions. The pharmaceutical compositions and compounds described herein can be formulated as solutions, emulsions, suspensions or dispersions in a suitable pharmaceutical solvent or carrier, or as pills, tablets, lozenges, suppositories, sachets, dragees, granules, powders, reconstitutable powders, or capsules, together with a solid carrier, according to general methods known in the art for manufacturing various dosage forms. The pharmaceutical compositions of the present disclosure can be administered by a suitable route of delivery such as oral, parenteral, rectal, nasal, topical, or ophthalmic routes, or by inhalation. Preferably, the composition is formulated for intravenous or oral administration.
[0132] For oral administration, the compounds of the present disclosure can be provided in solid forms such as tablets or capsules, or as solutions, emulsions or suspensions. To manufacture oral compositions, the compounds of the present disclosure can be formulated to provide a dosage of, for example, about 0.1 mg to 1 g per day, or about 1 mg to 50 mg per day, or about 50 mg to 250 mg per day, or about 250 mg to 1 g per day. Oral tablets may contain the active ingredient mixed with compatible pharmaceutically acceptable excipients such as diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, coloring agents and preservatives. Suitable inert fillers include sodium and calcium carbonates, sodium and calcium phosphates, lactose, starch, sucrose, glucose, methylcellulose, magnesium stearate, mannitol, sorbitol, etc. Exemplary liquid oral excipients include ethanol, glycerol, water, etc. Starch, polyvinylpyrrolidone (PVP), sodium starch glycolate, microcrystalline cellulose, and alginic acid are exemplary disintegrants. Starches and gelatin are mentioned as binders. Lubricants, if incorporated, may be magnesium stearate, stearic acid, or talc. If necessary, tablets can be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract, or may be coated with an enteric coating.
[0133] Capsules for oral administration include hard gelatin capsules and soft gelatin capsules. To manufacture hard gelatin capsules, the active ingredient may be mixed with a solid, semi-solid or liquid diluent. Soft gelatin capsules can be manufactured by mixing the active ingredient with water, an oil such as peanut oil or olive oil, liquid paraffin, a mixture of monoglycerides and diglycerides of short-chain fatty acids, polyethylene glycol 400, or propylene glycol.
[0134] The liquid for oral administration may be in the form of a suspension, solution, emulsion, or syrup, or alternatively may be provided as a lyophilized or dry product for reconstitution with water or other suitable vehicle prior to use. Such liquid compositions may optionally contain an anti-precipitant (e.g., sorbitol, methylcellulose, sodium alginate, gelatin, hydroxyethylcellulose, carboxymethylcellulose, aluminum stearate gel, etc.); a non-aqueous vehicle, such as an oil (e.g., almond oil or fractionated coconut oil), propylene glycol, ethyl alcohol, or water; a preservative (e.g., methyl or propyl p-hydroxybenzoate, or sorbic acid); a wetting agent such as lecithin; and, optionally, pharmaceutically acceptable excipients such as flavoring or coloring agents.
[0135] For parenteral use, including intravenous, intramuscular, intraperitoneal, intranasal, or subcutaneous routes, the agents of the present disclosure may be provided in a sterile aqueous solution or aqueous suspension buffered to an appropriate pH and isotonicity, or in a parenterally acceptable oil. Suitable aqueous vehicles include Ringer's solution and isotonic sodium chloride. Such forms may be provided in unit dose forms such as ampules or disposable syringes, in multiple dose forms such as vials from which appropriate amounts can be withdrawn, or in solid forms or pre-concentrates that can be used to prepare injectable formulations. Exemplary infusion doses range from about 1 to 1000 μg / kg / min over a period of several minutes to several days for the agent admixed with a pharmaceutical carrier.
[0136] For nasal, inhalation, or oral administration, the pharmaceutical compositions of the present invention can be administered, for example, using a spray formulation that also contains a suitable carrier. The compositions of the present invention can be formulated for rectal administration as suppositories. In the case of topical application, the compounds of the present disclosure are preferably formulated as creams or ointments, or as similar vehicles suitable for topical administration. For topical administration, the compounds of the present invention may be mixed with a pharmaceutical carrier at a concentration of about 0.1% to about 10% of the drug with respect to the vehicle. Another mode of administering the agents of the present disclosure may be transdermal delivery using a patch formulation.
[0137] As used herein, the terms “treating” or “treatment” include both “preventive” and “curative” treatment. “Preventive” treatment means delaying the onset of a disease, disease symptom, or medical condition, suppressing symptoms that may develop, or reducing the risk of onset or recurrence of a disease or symptom. “Curative” treatment includes reducing the severity of an existing disease, symptom, or condition, or suppressing its worsening. Thus, treatment includes improving or preventing the worsening of symptoms of an existing disease, preventing the occurrence of additional symptoms, improving or preventing the underlying systemic cause of the symptoms, inhibiting a disorder or disease, e.g., preventing the onset of a disorder or disease, alleviating a disorder or disease, inducing regression of a disorder or disease, alleviating symptoms caused by a disease or disorder, or stopping the symptoms of a disease or disorder. The term “subject” refers to a mammalian patient, such as a human, in need of such treatment.
[0138] Exemplary diseases include cancer, pain, neurological diseases, autoimmune diseases, and inflammation. As used herein, the term "cancer" includes, but is not limited to, ALCL, NSCLC, neuroblastoma, inflammatory myofibroblastic tumor, adult renal cell carcinoma, pediatric renal cell carcinoma, breast cancer, ER+ breast cancer, colon adenocarcinoma, glioblastoma, glioblastoma multiforme, anaplastic thyroid cancer, cholangiocarcinoma, ovarian cancer, gastric adenocarcinoma, colorectal cancer, inflammatory myofibroblastic tumor, angiosarcoma, epithelioid hemangioendothelioma, intrahepatic cholangiocarcinoma, papillary thyroid cancer, Spitzoid tumor, sarcoma, astrocytoma, low-grade glioma of the brain, secretory breast cancer, breast-like cancer, myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia (CML), acute myeloid leukemia (AML), congenital mesoblastic nephroma, congenital fibrosarcoma, Ph-like acute lymphoblastic leukemia, thyroid cancer, cutaneous melanoma, head and neck squamous cell carcinoma, pediatric glioma prostate cancer, lung squamous cell carcinoma, ovarian serous cystadenocarcinoma, cutaneous melanoma, castration-resistant prostate cancer, Hodgkin lymphoma, and serous and clear cell endometrial cancer. In some embodiments, cancer includes lung cancer, colon cancer, breast cancer, prostate cancer, hepatocellular carcinoma, renal cell carcinoma, gastric cancer and esophagogastric cancer, glioblastoma, head and neck cancer, inflammatory myofibroblastic tumor, and anaplastic large cell lymphoma.
[0139] In one aspect, the compounds and pharmaceutical compositions of the disclosure specifically target FLT3. Thus, these compounds and pharmaceutical compositions can be used to prevent, reverse, delay, or inhibit diseases such as cancer driven by the activity of FLT3. In some embodiments, the compounds described herein can target FLT3 with oncogenic driver mutations such as FLT3-ITD. In some embodiments, the compounds described herein can target FLT3 (such as in FLT3-ITD) having one or more resistance mutations, such as resistance mutations in the activation loop residues (e.g., D835, I836, D839, and Y842) or in the gatekeeper residue F691 of FLT3. In some embodiments, methods of treating target cancers such as AML are described.
[0140] In one aspect, the compounds and pharmaceutical compositions of the present disclosure specifically target PIM kinases. In some embodiments, the compounds described herein target PIM kinase activity and can overcome resistance mechanisms to chemotherapy, radiotherapy, anti-angiogenic therapy, and targeted therapy. In some embodiments, methods of treating target cancers such as AML are described.
[0141] In one aspect, the compounds and pharmaceutical compositions of the present disclosure specifically target CLK kinases. In some embodiments, the compounds described herein target CLK kinase activity and can treat diseases such as cancer through the regulation of pre-mRNA splicing via inhibition of CLK kinase activity. In some embodiments, methods of treating target cancers such as myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia, AML, lung cancer, breast cancer, and pancreatic cancer are described.
[0142] In some embodiments, the compounds described herein may be useful in the treatment of diseases such as cancer, such as AML, by inhibiting one or more abnormal FLT3s, including oncogenic driver mutations such as FLT3-ITD, and resistance mutations in the activation loop residues (e.g., D835, I836, D839, and Y842), or resistance mutations in the gatekeeper residue F691 of FLT3, abnormal PIM kinases, and / or abnormal CLK kinases.
[0143] In the inhibition method of the present disclosure, an "effective amount" means an amount sufficient to inhibit the target protein. Measurement of such target modulation can be performed by conventional analytical methods such as the methods shown below. Such modulation is useful in various settings, including in vitro assays. In such methods, the cells are preferably cancer cells having abnormal signal transduction due to mutations in FLT3, PIM, and / or CLK as shown below.
[0144] In the treatment methods according to the present disclosure, an "effective amount" means an amount or dosage sufficient to generally provide the desired therapeutic benefit in a subject in need of such treatment, including subjects suffering from diseases such as cancer, such as AML, including diseases associated with abnormal FLT3, including oncogenic driver mutations such as FLT3-ITD, and resistance mutations in activation loop residues (e.g., D835, I836, D839, and Y842), or resistance mutations in the gatekeeper residue F691 of FLT3, such as FLT3 resistance mutations, abnormal PIM kinases, and / or abnormal CLK kinases. The effective amount or dosage of the compounds of the present disclosure can be confirmed by conventional methods such as dose escalation or modeling clinical trials, taking into account conventional factors such as the form or route of administration or drug delivery, the pharmacokinetics of the agent, the severity and course of the infection, the health status, situation, and weight of the subject, and the judgment of the consulting physician. Exemplary dosages are in the range of about 0.1 mg to 1 g per day, or about 1 mg to 50 mg per day, or about 50 mg to 250 mg per day, or about 250 mg to 1 g per day. The total dosage may be administered in single or divided dosage units (e.g., BID, TID, QID).
[0145] If improvement of the subject's disease is seen, the dosage can be adjusted for preventive or maintenance treatment. For example, the dosage or dosing frequency, or both, can be lowered as a function of the symptoms to a level at which the desired therapeutic or preventive effect is maintained. Of course, if the symptoms are alleviated to an appropriate level, treatment may be discontinued. However, if the symptoms recur, the patient may require ongoing treatment based on long-term treatment. The patient may also require chronic treatment based on long-term treatment.
[0146] Drug combinations The compounds of the invention described in the specification can be used in pharmaceutical compositions or methods in combination with one or more additional active ingredients in the treatment of the diseases and disorders described herein. Further additional active ingredients include other therapeutic agents or agents that mitigate the side effects of the therapy of the intended target disease. Such combinations can be used to increase efficacy, improve the symptoms of other diseases, reduce one or more side effects, or reduce the dosage required of the compounds of the invention. The additional active ingredients may be administered in a pharmaceutical composition separate from the compounds of the present disclosure or may be formulated together with the compounds of the present disclosure in a single pharmaceutical composition. The additional active ingredients may be administered simultaneously with, prior to, or after administration of the compounds of the present disclosure.
[0147] Combination agents containing additional active ingredients are known or found to be effective in treating the diseases and disorders described herein, including agents that are active against another target associated with the disease. For example, the compositions and formulations of the present disclosure, and methods of treatment, may further comprise other drugs or medicaments, such as other active agents useful in the treatment or alleviation of the target disease or related symptoms or conditions. In the case of cancer indications, such additional agents include, but are not limited to, kinase inhibitors such as ALK inhibitors (e.g., crizotinib), Raf inhibitors (e.g., vemurafenib), VEGFR inhibitors (e.g., sunitinib), alkylating agents, antimetabolites, antitumor antibiotics, topoisomerase inhibitors, platinum drugs, cell division inhibitors, antibodies, hormone therapy agents, or standard chemotherapeutic agents such as corticosteroids.
[0148] Chemical synthesis method The following examples are provided to illustrate the present disclosure and are not limiting. Those skilled in the art will recognize that the following synthetic reactions and schemes can be modified by selecting appropriate starting materials and reagents to access other compounds of formulas (I)-(VI).
[0149] Abbreviations: The examples described in this specification use materials described by the following abbreviations known to those skilled in the art, but are not limited to using only these:
Table 8
Table 9
Table 10
[0150] The proposed targets can be produced via conventional chemical techniques or according to a general scheme using selected examples as shown below for illustration:
[0151] General Scheme I
Chemical formula
[0152] General Scheme I uses Example 1 as an example. Compounds I-1 and I-2 are produced from commercially available materials via conventional chemicals. Under the palladium-catalyzed coupling condition A, Compounds I-1 and I-2 are converted to the product I-3, which is then reacted with iodine under condition B to obtain I-4, subjected to de-Boc under condition C to obtain I-5, and subjected to amide coupling with various carboxylic acids I-6 under condition D to obtain I-7. Under the palladium-catalyzed Heck coupling condition E, I-7 is subjected to macrocyclization to the final product, for example, Ex.1.
[0153] General Scheme II
Chemical formula
[0154] General Scheme II uses Example 13 as an example. Compounds II-1 and II-2 are prepared from commercially available materials via conventional chemicals. Under the palladium-catalyzed coupling condition F, compounds II-1 and II-2 are converted to product II-3, which is then subjected to de-Boc under condition G to obtain II-4, and subsequently subjected to amide coupling with various carboxylic acids, such as II-5, under condition H to obtain II-6. II-6 is deprotected under condition I to obtain II-7, which is converted to boronic acid ester II-8 under condition J. Under the Suzuki coupling condition of the palladium catalyst, II-8 is subjected to macrocyclization to obtain II-9. After deprotection under condition L, II-9 is converted to the final product, such as Ex.13.
[0155] General Scheme III
Chemical formula
[0156] General Scheme III uses Example 13 as an example. Boronic acid ester III-1 and bromo starting material III-3 are exchanged compared to compounds II-1 and II-2. Under the palladium-catalyzed coupling condition M, compounds III-1 and III-2 are converted to the same product II-3 shown in General Scheme II, which is then subjected to de-Boc under condition G to obtain II-4, and subsequently subjected to amide coupling with various carboxylic acids, such as II-5, under condition H to obtain II-6. II-6 is subjected to deprotection under condition I to obtain II-7, which is converted to boronic acid ester II-8 under condition J. Under the Suzuki coupling condition of the palladium catalyst, II-8 is subjected to macrocyclization to obtain II-9. After deprotection under condition L, II-9 is converted to the final product, such as Ex.13.
[0157] Preparation of tert-butyl N-[2-(2-bromo-4-fluoro-phenoxy)ethyl]-N-methyl-carbamate (I-2-1)
Chemical formula
[0158] Step 1. To a solution of 2-bromo-4-fluoro-phenol (5.00 g, 26.2 mmol, 1 eq) in DMF (120 mL) was added K2CO3 (10.8 g, 78.5 mmol, 3 eq) and tert-butyl N-(2-bromoethyl)carbamate (7.04 g, 31.4 mmol, 1.2 eq). The mixture was stirred at 80 °C for 2 h. LCMS indicated that the starting material was completely consumed, showing the desired MS at the main peak. The mixture was diluted with water (300 mL) and extracted with EtOAc (50 mL x 4). The organic layers were combined, dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated under vacuum to give tert-butyl N-[2-(2-bromo-4-fluoro-phenoxy)ethyl]carbamate (9.45 g, crude) as a pale yellow oil. 1 H NMR (400 MHz, CDCl3) δ = 7.30 (dd, J = 8.0, 3.2 Hz, 1H), 6.94 - 7.02 (m, 1H), 6.82 - 6.89 (m, 1H), 5.07 (s, 1H), 4.05 (t, J = 4.8 Hz, 2H), 3.57 (q, J = 10.4, 5.2 Hz, 2H), 1.46 (s, 11H)
[0159] Step 2. To a solution of tert-butyl N-[2-(2-bromo-4-fluoro-phenoxy)ethyl]carbamate (7.50 g, 22.4 mmol, 1 eq) in DMF (80 mL) was added NaH (1.35 g, 33.7 mmol, 60% purity, 1.5 eq) at 0 °C and stirred for 30 min. Then MeI (3.82 g, 26.9 mmol, 1.2 eq) was added to the mixture and stirred at 15 °C for 3 h. The mixture was quenched with water (150 mL) and extracted with EtOAc (50 mL x 4). The organic layers were combined, dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated under vacuum to give I-2-1 (7.80 g, 22.4 mmol, 99.8% yield) as a yellow solid.
[0160] Preparation of tert-butyl N-[2-(2-bromo-4-fluoro-phenoxy)ethyl]-N-methyl-carbamate (I-2-2)
Chem.
[0161] I-2-2 was prepared using 2-bromo-phenol as the starting material and following the same procedure as I-2-1.
[0162] Preparation of tert-butyl N-[2-(4-bromo-2-methyl-pyrazol-3-yl)oxyethyl]-N-methyl-carbamate (I-2-3)
Chem.
[0163] I-2-3 was first prepared using 2-methylpyrazol-3-ol as the starting material and following the same procedure as I-2-1. Next, a bromo group was introduced. To a solution of tert-butyl N-methyl-N-[2-(2-methylpyrazol-3-yl)oxyethyl]carbamate (2 g, 7.83 mmol, 1 equiv) in ACN (20 mL) was added NBS (1.44 g, 8.07 mmol, 1.03 equiv). The mixture was stirred at 25 °C for 2 h. After completion, the mixture was concentrated and the residue was purified by silica gel column chromatography to give I-2-3 (1.73 g, 5.18 mmol, 66.08% yield) as a red oil. 1 H NMR (400 MHz, DMSO-d6) δ = 7.32 (s, 1H), 4.24 (t, J = 5.6 Hz, 2H), 3.54 (s, 3H), 3.48 (t, J = 5.6 Hz, 2H), 2.81 (s, 3H), 1.31 (d, J = 4.0 Hz, 9H)
[0164] Preparation of 5-ethyl-1-methyl-4-vinyl-pyrazole-3-carboxylic acid (I-6-1) and 5-ethyl-2-methyl-4-vinyl-pyrazole-3-carboxylic acid (I-6-2)
Chem.
[0165] Step 1. To a solution of ethyl 2,4-dioxohexanoate (10.0 g, 58.1 mmol, 1 equiv) in AcOH (65.7 g, 1.09 mol, 18.8 equiv) was added methylhydrazine (7.45 g, 64.7 mmol, purity 40%, 1.11 equiv) at 0 °C. The mixture was stirred at 15 °C for 5 h and concentrated under vacuum. The residue was purified by combiflash chromatography (120 g silica gel column, 0% - 50% EtOAc / PE) to give ethyl 5-ethyl-1-methyl-pyrazole-3-carboxylate (10.1 g, 55.5 mmol, 95.5% yield) as a yellow oil. 1 H NMR (400 MHz, CDCl3) δ = 6.59 (s, 1H), 4.39 (q, J = 14.4, 7.2 Hz, 2H), 3.85 (s, 3H), 2.62 (q, J = 14.4, 7.2 Hz, 2H), 1.39 (t, J = 7.2 Hz, 3H), 1.28 (t, J = 7.6 Hz, 3H)
[0166] Ethyl 5-ethyl-2-methyl-pyrazole-3-carboxylate (1.33 g, 7.30 mmol, 12.6% yield) was obtained as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ = 6.65 (s, 1H), 4.34 (q, J = 7.2 Hz, 2H), 4.18 - 4.11 (m, 4H), 2.65 (q, J = 15.2, 7.6 Hz, 2H), 1.38 (t, J = 7.2 Hz, 3H), 1.25 (t, J = 7.6 Hz, 3H)
[0167] Step 2. To a solution of ethyl 5-ethyl-1-methyl-pyrazole-3-carboxylate (10.0 g, 54.9 mmol, 1 equiv) in MeCN (200 mL) was added NBS (10.7 g, 60.4 mmol, 1.1 equiv). The mixture was stirred at 15 °C for 3 h. The mixture was diluted with water (200 mL) and extracted with EtOAc (50 mL x 3). The organic layers were combined, dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated under vacuum to give crude ethyl 4-bromo-5-ethyl-1-methyl-pyrazole-3-carboxylate (13.4 g, 51.4 mmol, 93.8% yield) as a yellow oil.1 1H NMR (400 MHz, CDCl3) δ = 4.41 (q, J = 7.2 Hz, 2H), 3.91 (s, 3H), 2.78 - 2.64 (m, 2H), 1.40 (t, J = 7.2 Hz, 3H), 1.18 (t, J = 7.6 Hz, 3H)
[0168] Step 3. A solution of ethyl 4 - bromo - 5 - ethyl - 1 - methyl - pyrazole - 3 - carboxylate (13.4 g, 51.5 mmol, 1 equiv), potassium hydride; trifluoro(vinyl)boron (13.8 g, 103 mmol, 2 equiv), Cs2CO3 (50.3 g, 154 mmol, 3 equiv), Pd(dppf)Cl2 (3.77 g, 5.15 mmol, 0.1 equiv) in dioxane (200 mL) and H2O (40 mL) was stirred at 80 °C under N2 for 3 h. The mixture was stirred at 80 °C for 16 h and cooled to ambient temperature. The mixture was separated and the organic layer was concentrated in vacuo. The residue was purified by combiflash chromatography (120 g silica gel column, 0% - 60% EtOAc / PE) to give ethyl 5 - ethyl - 1 - methyl - 4 - vinyl - pyrazole - 3 - carboxylate (7.62 g, 36.6 mmol, 71.1% yield) as a brown oil. 1 1H NMR (400 MHz, CDCl3) δ = 7.05 (dd, J = 14.0, 11.6 Hz, 1H), 5.47 - 5.26 (m, 2H), 4.42 (J = 7.2 Hz, 2H), 3.90 (s, 3H), 2.83 - 2.69 (m, 2H), 1.46 - 1.37 (m, 3H), 1.27 - 1.17 (m, 3H)
[0169] Procedure 4. To a solution of ethyl 5-ethyl-1-methyl-4-vinyl-pyrazole-3-carboxylate (1.00 g, 4.80 mmol, 1 equiv) in THF (5 mL), MeOH (5 mL), and H2O (3 mL) was added LiOH·H2O (604 mg, 14.4 mmol, 3 equiv). The mixture was stirred at 15 °C for 5 h. LCMS showed the desired MS at the main peak. 2N HCl was added to the mixture to adjust the pH to approximately 5. The resulting solution was extracted with EtOAc (10 mL x 4). The combined organic layers were dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated under vacuum to obtain the crude product. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150 x 25 mm x 10 μ, mobile phase: [water (0.225% FA)-ACN]; B%: 40% - 79%, 11 min). 5-Ethyl-1-methyl-4-vinyl-pyrazole-3-carboxylic acid (746 mg, 4.14 mmol, 86.2% yield) was obtained as a brown solid. 1 H NMR (400 MHz, MeOD-d4) δ = 7.03 (dd, J = 18.0, 11.6 Hz, 1H), 5.44 (dd, J = 18.0, 1.6 Hz, 1H), 5.27 (dd, J = 11.8, 1.6 Hz, 1H), 3.87 (s, 3H), 2.84 (q, J = 7.6 Hz, 2H) 1.23 (t, J = 7.6 Hz, 3H)
[0170] I-6-2 was prepared as a white solid using ethyl 5-ethyl-2-methyl-pyrazole-3-carboxylate from Procedure 2. 1 H NMR (400 MHz, MeOD-d4) δ = 7.07 (dd, J = 18.0, 11.6 Hz, 1H), 5.44 (dd, J = 18.0, 1.6 Hz, 1H), 5.30 (dd, J = 11.6, 1.6 Hz, 1H), 4.04 (s, 3H), 2.74 (q, J = 7.2 Hz, 2H), 1.25 (t, J = 7.6 Hz, 3H)
[0171] Preparation of 1-methyl-4-vinyl-pyrazole-3-carboxylic acid (I-6-3)
Chemical Structure
[0172] I-6-3 was produced as a yellow solid according to the same method as Steps 3 and 4 of the production of I-6-1 using methyl 4-bromo-1-methyl-pyrazole-3-carboxylate as the starting material. 1 H NMR (400 MHz, DMSO-d6) δ = 12.79 - 12.48 (m, 1H), 8.09 (s, 1H), 7.02 (dd, J = 11.2, 18.0 Hz, 1H), 5.54 (dd, J = 1.6, 18.0 Hz, 1H), 5.13 (dd, J = 1.6, 11.2 Hz, 1H), 3.87 (s, 3H)
[0173] General Method A: Production of (18E)-17-ethyl-7-fluoro-13,16-dimethyl-2,12,13,16-tetrahydro-3,5-ethenodipyrazolo[3,4-f:3’,4’-j][1,4]benzoxazacyclopentadecin-14(11H)-one (Ex.1)
Chemical formula
[0174] Step 1. To a mixture of I-2-1 (4.00 g, 11.5 mmol, 1 equivalent) and 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-indazole (3.37 g, 13.8 mmol, 1.2 equivalents) in dioxane (60 mL) and H2O (12 mL), K3PO4 (7.32 g, 34.5 mmol, 3 equivalents), tri-tert-butylphosphonium; tetrafluoroborate (333 mg, 1.15 mmol, 0.1 equivalent) and Pd2(dba)3 (526 mg, 0.575 mmol, 0.05 equivalent) were added. The resulting mixture was stirred under N2 at 120 °C for 16 hours. The mixture was separated and the organic layer was dried over anhydrous Na2SO4 and filtered. The filtrate was concentrated under vacuum and the residue was purified by combiflash chromatography to obtain I-3-1 (2.44 g, 6.33 mmol, 55.1% yield) as a brown oil. 11H NMR (400 MHz, CDCl3) δ = 8.12 (s, 1H), 7.87 (s, 1H), 7.60 - 7.47 (m, 2H), 7.10 (d, J = 8.8 Hz, 1H), 7.04 - 6.97 (m, 1H), 6.96 - 6.89 (m, 1H), 5.03 (d, J = 21.2 Hz, 2H), 3.49 (s, 2H), 2.70 (d, J = 18 Hz, 2H), 1.41 (s, 9H)
[0175] Step 2. To a solution of I-3-1 (2.44 g, 6.33 mmol, 1 equiv) in THF (40 mL) was added t-BuOK (2.13 g, 18.9 mmol, 3 equiv). The resulting mixture was stirred at 0 °C for 5 minutes, and then I2 (2.09 g, 8.23 mmol, 1.3 equiv) / THF (5 mL) was added dropwise. The resulting mixture was stirred at 25 °C for an additional 2 hours, and the mixture was filtered. The filtrate was concentrated under vacuum, and the residue was purified by combi-flash to give I-4-1 (1.87 g, 3.66 mmol, 57.77% yield) as a brown oil. 1 1H NMR (400 MHz, CDCl3) δ = 7.63 (s, 2H), 7.52 (d, J = 8.8 Hz, 1H), 7.12 (d, J = 7.2 Hz, 1H), 7.07 - 6.99 (m, 1H), 6.97 - 6.90 (m, 1H), 4.07 (d, J = 22.8 Hz, 2H), 3.51 (s, 2H), 2.72 (d, J = 15.2 Hz, 3H), 1.42 (s, 9H)
[0176] Step 3. To a solution of I-4-1 (1.00 g, 1.96 mmol, 1 equiv) in dioxane (8 mL) was added HCl / dioxane (4 M, 8.77 mL, 17.9 equiv). The mixture was stirred at 15 °C for 3 hours. The mixture was filtered, and the solid was dried under vacuum to give I-5-1 (890 mg, crude) as a white solid. 1 1H NMR (400 MHz, MeOD-d4) δ = 7.68 - 7.57 (m, 3H), 7.25 - 7.06 (m, 3H), 4.24 - 4.16 (m, 2H), 3.35 - 3.33 (m, 2H), 2.61 (s, 3H)
[0177] Step 4. To a solution of Project 4. I-5-1 (417 mg, 0.932 mmol, 1.05 eq., HCl salt) and I-6-1 (160 mg, 0.888 mmol, 1 eq.), DIEA (574 mg, 4.44 mmol, 5 eq.) in DCM (8 mL) was added T3P (847 mg, 1.33 mmol, purity 50%, 1.5 eq.) at 0 °C. The mixture was stirred at 15 °C for 2.5 h, diluted with water (30 mL), and extracted with EtOAc (15 mL x 3). The combined organic layers were dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated under vacuum. The residue was purified by combiflash (40 g silica gel column, 0% - 100% EtOAc / PE) to give I-7-1 (147 mg, 0.256 mmol, yield 28.9%) as a white solid. LCMS: m / z 574.4 (M+1)
[0178] Step 5. To a solution of I-7-1 (147 mg, 0.256 mmol, 1 eq.) in DMF (28 mL) were added tris-o-tolylphosphane (7.80 mg, 0.0256 mmol, 0.1 eq.), N-ethyl-N-isopropyl-propan-2-amine (66.3 mg, 0.513 mmol, 2 eq.) and Pd(OAc)2 (2.88 mg, 0.128 mmol, 0.05 eq.). The resulting mixture was stirred at 120 °C for 12 h. The mixture was concentrated under vacuum and the residue was purified by preparative HPLC (column: Phenomenex Luna C18 100x30mmx5μm; mobile phase: [water (0.225% FA) - ACN]; B%: 38% - 68%, 10 min) to give Ex.1 (5.09 mg, yield 4.42%) as a white solid.
[0179] Ex.2 - 5 was prepared according to the general method A.
[0180] Preparation of 2-(5-bromo-1-tetrahydropyran-2-yl-indazol-3-yl)ethynyl-triisopropyl-silane (II-1-1)
Chemical formula
[0181] Step 1. A solution of 5-bromo-1H-indazole (21.0 g, 107 mmol, 1 equiv) in THF (250 mL) was cooled in an ice bath, and KOtBu (35.9 g, 320 mmol, 3 equiv) was added portionwise. The resulting slurry was stirred at 0 °C, and a solution of I2 (54.1 g, 213 mmol, 42.9 mL, 2 equiv) in THF (250 mL) was added dropwise. The mixture was stirred at 25 °C for 12 h. After completion, the reaction mixture was filtered, the filtrate was diluted with H2O (20 mL), and extracted with EtOAc (20 mL x 3). The combined organic layers were washed with brine (20 mL x 3), dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by flash silica gel chromatography to give 5-bromo-3-iodo-1H-indazole (120 g, 350 mmol, 82% yield, 94% purity) as a white solid. LCMS: 324.7 (M+1)
[0182] Step 2. To a mixture of 5-bromo-3-iodo-1H-indazole (25.0 g, 77.4 mmol, 1 equiv) and 3,4-dihydro-2H-pyran (13.0 g, 155 mmol, 2 equiv) in toluene (250 mL) was added 4-methylbenzenesulfonic acid (2.67 g, 15.5 mmol, 0.2 equiv). The mixture was stirred at 90 °C for 12 h. After completion, the reaction was diluted with H2O and extracted with EtOAc. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by flash silica gel chromatography to give 5-bromo-3-iodo-1-tetrahydropyran-2-yl-indazole (24.0 g, 58.9 mmol, 76% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 7.64 (d, J = 1.6 Hz, 1H), 7.54 - 7.44 (m, 2H), 5.68 (dd, J = 3.2, 9.1 Hz, 1H), 4.04 - 3.95 (m, 1H), 3.79 - 3.66 (m, 1H), 2.58 - 2.46 (m, 1H), 2.20 - 2.03 (m, 2H), 1.87 - 1.54 (m, 3H)
[0183] Step 3. To a mixture of 3,5-bromo-3-iodo-1-tetrahydropyran-2-yl-indazole (23.0 g, 56.5 mmol, 1 equiv) and ethynyl(triisopropyl)silane (11.3 g, 62.2 mmol, 1.1 equiv) in DMF (250 mL) were added Cs2CO3 (55.2 g, 170 mmol, 3 equiv), Pd(dppf)Cl2 (2.48 g, 3.39 mmol, 0.06 equiv) and CuI (646 mg, 3.39 mmol, 0.06 equiv) under N2. The mixture was stirred at 25 °C for 3 h. After completion, the reaction was diluted with H2O and extracted with EtOAc. The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by flash silica gel chromatography to give 2-(5-bromo-1-tetrahydropyran-2-yl-indazol-3-yl)ethynyl-triisopropyl-silane (II-1-1, 38.0 g, 79.9 mmol, 70% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 7.87 (s, 1H), 7.57 - 7.43 (m, 2H), 5.70 (dd, J = 2.4, 9.2 Hz, 1H), 4.02 (bd, J = 11.2 Hz, 1H), 3.80 - 3.65 (m, 1H), 2.59 - 2.41 (m, 1H), 2.14 (d, J = 3.2 Hz, 1H), 2.08 (s, 1H), 1.79 - 1.70 (m, 2H), 1.67 (s, 1H), 1.22 - 1.18 (m, 18H), 1.18 - 1.14 (m, 3H)
[0184] Preparation of tert-butyl N-methyl-N-[3-[2-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazol-3-yl]oxyethyl]carbamate (II-2-1)
Chemical Structure
[0185] A solution of tert-butyl N-[2-(4-bromo-2-methyl-pyrazol-3-yl)oxyethyl]-N-methyl-carbamate (20.0 g, 59.8 mmol, 1 equiv) in THF (200 mL) was added with n-BuLi (2.5 M, 23.9 mL, 1 equiv) at -78 °C. The mixture was stirred at this temperature for 30 minutes, and then 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (22.2 g, 119 mmol, 2 equiv) was added dropwise at -78 °C. The mixture was stirred at -78 °C for 2 hours. After completion, the mixture was quenched with water (200 mL) and extracted with ethyl acetate (250 mL x 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a residue. The residue was purified by column chromatography to obtain II-2-1 (21.2 g, 55.6 mmol, 92% yield) as a yellow oil. LCMS: m / z 381.9 (M+1)
[0186] Preparation of tert-butyl N-[3-[2-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazol-3-yl]oxyethyl]carbamate (II-2-2)
Chemical formula
[0187] Preparation of tert-butyl N-methyl-N-[4-[2-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazol-3-yl]oxybutyl]carbamate (II-2-3)
Chemical formula
[0188] Production of tert-butyl N-methyl-N-[4-[2-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazol-3-yl]oxypropyl]carbamate (II-2-4)
Chem.
[0189] Production of tert-butyl N-methyl-N-[2-[2-[2-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazol-3-yl]oxyethoxy]ethyl]carbamate (II-2-5)
Chem.
[0190] Production of 5-ethyl-4-iodo-2-methyl-pyrazole-3-carboxylic acid (II-5-1)
Chem.
[0191] To a solution of 5-ethyl-2-methyl-pyrazole-3-carboxylic acid (1 g, 6.49 mmol, 1 eq) in AcOH (10 mL) was added NIS (1.75 g, 7.78 mmol, 1.2 eq). The mixture was stirred at 90 °C for 2 h. Additional NIS (291.87 mg, 1.30 mmol, 0.2 eq) was added to the mixture and the resulting mixture was stirred at 90 °C for 12 h. The reaction mixture was quenched by adding saturated aqueous Na2SO3 (20 mL) at 0 °C, then diluted with H2O (10 mL), K2CO3 (20 mg) was added to the mixture, then the pH was adjusted with HCl (2N), and extracted with EtOAc (10 mL x 2). The combined organic layers were washed with brine (10 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure to give a residue, which was triturated with petroleum ether:ethyl acetate = 10:1 to give II-5-1 (705 mg, 2.41 mmol, 37% yield) as a pale yellow solid. LCMS: m / z 280.9 (M+1)
[0192] Preparation of 5-ethyl-4-iodo-1-methyl-pyrazole-3-carboxylic acid (II-5-2), 5-methyl-4-iodo-2-methyl-pyrazole-3-carboxylic acid (II-5-3), 5-methyl-4-iodo-1-methyl-pyrazole-3-carboxylic acid (II-5-4), and 2-ethyl-4-iodo-5-methyl-pyrazole-3-carboxylic acid (II-5-5)
Chemical formula
[0193] Preparation of 1-(2-ethoxy-2-oxo-ethyl)-4-iodo-5-methyl-pyrazole-3-carboxylic acid (II-5-5) and 2-(2-ethoxy-2-oxo-ethyl)-4-iodo-5-methyl-pyrazole-3-carboxylic acid (II-5-5)
Chemical formula
[0194] Step 1. To a solution of 3-methyl-1H-pyrazole-5-carboxylic acid (10.0 g, 79.3 mmol, 1.0 eq) in DMSO (200 mL) was added NaHCO₃ (7.99 g, 95.2 mmol, 3.70 mL, 1.2 eq). The mixture was stirred at 20 °C for 0.5 h, and then benzyl bromide (13.6 g, 79.3 mmol, 1.0 eq) was added. The mixture was stirred at 20 °C for 4 h, quenched with water (100 mL), and extracted with ethyl acetate (250 mL×3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography to give benzyl 3-methyl-1H-pyrazole-5-carboxylate (3.20 g, 14.1 mmol, yield 17.7%, purity 95%) as a white solid. LCMS: m / z (M + 1)
[0195] Step 2. To a solution of benzyl 3-methyl-1H-pyrazole-5-carboxylate (3.00 g, 13.9 mmol, 1.0 eq) in DMF (30 mL) were added K₂CO₃ (5.75 g, 41.6 mmol, 3.0 eq) and ethyl 2-bromoacetate (3.48 g, 20.8 mmol, 1.5 eq). The mixture was stirred at 25 °C for 16 h, quenched with water (200 mL), and extracted with ethyl acetate (50 mL×3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography to give benzyl 2-(2-ethoxy-2-oxo-ethyl)-5-methyl-pyrazole-3-carboxylate (850 mg, 2.81 mmol, yield 20.3%) as a colorless oil from the first fraction. 1 H NMR (400 MHz, CDCl₃) δ = 7.38 - 7.35 (m, 4H), 7.34 - 7.33 (m, 1H), 6.70 (s, 1H), 5.26 (s, 2H), 5.22 (s, 2H), 4.22 - 4.21 (m, 2H), 2.26 (s, 3H), 1.23 - 1.19 (m, 3H)
[0196] From the second fraction, benzyl 1-(2-ethoxy-2-oxoethyl)-5-methyl-1H-pyrazole-3-carboxylate (2.52 g, 8.34 mmol, yield 60.1%) was obtained as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 7.44 (d, J = 6.4 Hz, 2H), 7.39 - 7.30 (m, 3H), 6.63 (s, 1H), 5.37 (s, 2H), 4.93 (s, 2H), 4.23 (q, J = 7.2 Hz, 2H), 2.27 (s, 3H), 1.27 (t, J = 7.2 Hz, 3H)
[0197] Step 3. To a solution of benzyl 1-(2-ethoxy-2-oxoethyl)-5-methyl-1H-pyrazole-3-carboxylate (2.50 g, 8.27 mmol, 1.0 equiv) in MeOH (40 mL) was added Pd / C (300 mg, 0.331 mmol, purity 10%, 1.0 equiv) under N2. The suspension was subjected to degassing under vacuum and purging with H2 several times. The mixture was stirred at 20 °C for 16 h under H2 (15 psi). The reaction mixture was filtered and the filtrate was concentrated to give 1-(2-ethoxy-2-oxoethyl)-5-methyl-1H-pyrazole-3-carboxylic acid (1.9 g, crude) as a colorless oil. 1 H NMR (400 MHz, DMSO-d6) δ = 6.49 (s, 1H), 5.10 (s, 2H), 4.17 (q, J = 7.2 Hz, 2H), 2.22 (s, 3H), 1.21 (t, J = 7.2 Hz, 3H)
[0198] Step 4. To a solution of 1-(2-ethoxy-2-oxo-ethyl)-5-methyl-pyrazole-3-carboxylic acid (1.42 g, 6.69 mmol, 1.0 equiv) in ACN (20 mL) was added NIS (1.66 g, 7.36 mmol, 1.1 equiv). The mixture was stirred at 60 °C for 16 h. The mixture was dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by column chromatography to give 1-(2-ethoxy-2-oxo-ethyl)-4-iodo-5-methyl-pyrazole-3-carboxylic acid (II-5-5, 1.6 g, 4.26 mmol, yield 63.7%) as a yellow solid.1 1H NMR (400 MHz, DMSO-d6) δ = 12.79 - 9.38 (m, 1H), 5.23 (s, 2H), 4.17 (q, J = 7.2 Hz, 2H), 4.03 (q, J = 7.2 Hz, 2H), 2.26 (s, 3H), 1.17 (t, J = 7.2 Hz, 3H)
[0199] II-5-6 was produced from benzyl 2-(2-ethoxy-2-oxo-ethyl)-5-methyl-pyrazole-3-carboxylate derived from Step 2, and then as II-5-5 from Steps 3 and 4.
[0200] General Method B: Preparation of (17E)-16-ethyl-8,12,14-trimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one (Ex. 6)
Chemical Structure
[0201] Step 1. A mixture of 2-(5-bromo-1-tetrahydropyran-2-yl-indazol-3-yl)ethynyl-triisopropyl-silane (II-1-1, 5.00 g, 10.83 mmol, 1 equiv), tert-butyl N-methyl-N-[2-[2-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazol-3-yl]oxyethyl]carbamate (II-2-1, 4.96 g, 13.00 mmol, 1.2 equiv), Pd(dppf)Cl2 (1.59 g, 2.17 mmol, 0.2 equiv), and Cs2CO3 (2 M, 16.25 mL, 3 equiv) in dioxane (50 mL) was subjected to degassing treatment, purged three times with N2, and then the mixture was stirred at 80 °C for 5 h under a N2 atmosphere. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was diluted with H2O (50 mL) and extracted with EtOAc (60 mL x 3). The combined organic layers were washed with brine (50 mL x 3), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a residue, which was purified by column chromatography to give II-3-1 (5.00 g, 7.86 mmol, yield 72.6%) as a yellow oil. 1 H NMR (400 MHz, CDCl3) δ = 7.82 (s, 1H), 7.65 - 7.55 (m, 3H), 5.72 (dd, J = 2.8, 9.2 Hz, 1H), 4.00 (s, 2H), 3.76 (s, 3H), 3.56 - 3.47 (m, 2H), 2.99 - 2.93 (m, 3H), 2.62 - 2.48 (m, 1H), 2.16 (dd, J = 3.6, 8.4 Hz, 1H), 1.83 - 1.59 (m, 5H), 1.47 (s, 3H), 1.41 - 1.31 (m, 6H), 1.21 - 1.18 (m, 21H)
[0202] Step 2. ZnBr2 (1.77 g, 7.86 mmol, 5 equiv) was added to a solution of II-3-1 (1 g, 1.57 mmol, 1 equiv) in CH2Cl2 (10 mL). The mixture was stirred at 25 °C for 2 h. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was purified by column chromatography to give II-4-1 (800 mg, 1.49 mmol, yield 95.0%) as a yellow solid. LCMS: m / z 536.1 (M+1)
[0203] To a solution of Project 3. II-4-1 (1.5 g, 2.80 mmol, 1 eq) and 5-ethyl-4-iodo-2-methyl-pyrazole-3-carboxylic acid (II-5-1, 705 mg, 2.52 mmol, 0.9 eq) in CH2Cl2 (30 mL) were added DIPEA (2.89 g, 22.4 mmol, 8 eq) and T3P (3.56 g, 5.60 mmol, purity 50%, 2 eq). The mixture was stirred at 40 °C for 12 h. The reaction mixture was partitioned between H2O (50 mL) and CH2Cl2 (30 mL). The organic phase was separated, washed with brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a residue, which was purified by column chromatography to give II-6-1 (1.15 g, 1.37 mmol, yield 49.0%, purity 95.1%) as a yellow gum. LCMS: EC5257-79-P1E (M+1: 798.4)
[0204] To a solution of Project 4. II-6-1 (1.15 g, 1.44 mmol, 1 eq) in DMSO (12 mL) was added CsF (438 mg, 2.88 mmol, 2 eq). The mixture was stirred at 40 °C for 12 h. The reaction mixture was partitioned between H2O (10 mL) and EtOAc (10 mL). The organic phase was separated, washed with brine (10 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a residue, which was purified by flash silica gel chromatography to give II-7-1 (650 mg, 1.01 mmol, yield 70.3%) as a yellow oil. 1 H NMR (400 MHz, DMSO-d6) δ = 7.87 - 7.43 (m, 4H), 5.93 - 5.85 (m, 1H), 4.55 (d, J = 7.6 Hz, 1H), 4.22 - 4.09 (m, 1H), 3.94 - 3.61 (m, 8H), 3.58 - 3.46 (m, 2H), 3.16 - 3.00 (m, 3H), 2.56 - 2.52 (m, 3H), 2.40 - 2.28 (m, 1H), 2.09 - 1.95 (m, 2H), 1.81 - 1.68 (m, 1H), 1.65 - 1.55 (m, 2H), 1.20 - 1.13 (m, 3H)
[0205] A mixture of Project 5. II-7-1 (650 mg, 1.01 mmol, 1 equiv), Pin2B2 (257 mg, 1.01 mmol, 1 equiv), PPh3 (266 mg, 1.01 mmol, 1 equiv) and Cu2O (72.5 mg, 0.507 mmol, 0.5 equiv) in dioxane (12 mL) was subjected to a degassing treatment, purged three times with N2, and then the mixture was stirred at 100 °C for 12 h under a N2 atmosphere. The reaction mixture was partitioned between H2O (30 mL) and EtOAc (30 mL). The organic phase was separated, washed with brine (20 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure to obtain a residue, which was purified by flash silica gel chromatography to obtain II-8-1 (750 mg, 0.974 mmol, yield 96.2%) as a yellow solid. LCMS: m / z 770.4 (M+1)
[0206] A mixture of Project 6. II-8-1 (700 mg, 0.91 mmol, 1 equiv), Cs2CO3 (889 mg, 2.73 mmol, 3 equiv) and Pd(dppf)Cl2 (66.6 mg, 0.91 mmol, 0.1 equiv) in dioxane (12 mL) and H2O (1.2 mL) was subjected to a degassing treatment, purged three times with N2, and then the mixture was stirred at 90 °C for 12 h under a N2 atmosphere. The reaction mixture was partitioned between H2O (10 mL) and EtOAc (10 mL). The organic phase was separated, washed with brine (20 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure to obtain a residue, which was purified by flash silica gel chromatography to obtain II-9-1 (140 mg, 0.271 mmol, yield 29.7%) as a yellow oil. LCMS: m / z 516.3 (M+1)
[0207] To a solution of Project 7. II-9-1 (140 mg, 0.271 mmol, 1 equiv) in CH2Cl2 (2 mL) was added TFA (1 mL). The mixture was stirred at 15 °C for 1 hour. The reaction mixture was concentrated under reduced pressure. The residue was diluted with NaHCO3 (10 mL) and extracted with CH2Cl2 (5 mL x 2). The combined organic layers were washed with brine (5 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a residue, which was purified by flash silica gel chromatography to give Ex.6 (56.9 mg, 0.130 mmol, 48.0% yield) as an off-white solid.
[0208] Ex.6-14 was produced according to the general method B.
[0209] Production of Triisopropyl-[2-[1-tetrahydropyran-2-yl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)indazol-3-yl]ethynyl]silane (III-1-1)
Chemical formula
[0210] 2-(5-Bromo-1-tetrahydropyran-2-yl-indazol-3-yl)ethynyl-triisopropyl-silane (2 g, 4.33 mmol) was added to a solvent, 1,4-dioxane (20.86 mL), along with 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (1.43 g, 5.63 mmol) and potassium acetate (1.28 g, 13.00 mmol). The mixture was stirred while bubbling argon through it for 5 minutes, and then the catalyst Pd(dppf)Cl2 (158.55 mg, 216.68 micromol) was added. The vessel was sealed and heated at 85 °C for 18 hours. The reaction was diluted with DCM and water (80 mL), and the layers were separated. The aqueous layer was extracted again with DCM (2 x 40 mL). The organic layers were combined, washed with brine, and dried over sodium sulfate. It was subjected to flash column chromatography to obtain triisopropyl-[2-[1-tetrahydropyran-2-yl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)indazol-3-yl]ethynyl]silane (1.87 g, 3.68 mmol, yield: 84.85%). LCMS: [M+H]+ m / z = 509.28
[0211] Preparation of tert-butyl N-[2-[(4-bromo-2-methyl-pyrazol-3-yl)methyl-methyl-amino]ethyl]-N-methyl-carbamate (III-2-1)
Chemical formula
[0212] Step 1. To a solution of 2-methylpyrazole-3-carbaldehyde (1 g, 9.08 mmol, 1 equiv) in DMF (15 mL) was added NBS (1.78 g, 9.99 mmol, 1.1 equiv). The reaction mixture was stirred at 25 °C for 12 h. The residue was diluted with H2O (50 mL) and extracted with EtOAc (50 mL×3). The combined organic layers were washed with brine (30 mL×2), dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by flash silica gel chromatography to give 4-bromo-2-methyl-pyrazole-3-carbaldehyde (1.3 g, 6.88 mmol, 75.7% yield) as a white solid. 1 1H NMR (400 MHz, DMSO-d6) δ = 9.84 (s, 1H), 7.77 (s, 1H), 4.08 (s, 3H)
[0213] Step 2. To a solution of 4-bromo-2-methyl-pyrazole-3-carbaldehyde (5 g, 26.45 mmol, 1 equiv) in EtOH (100 mL) were added AcOH (159 mg, 2.65 mmol, 0.1 equiv) and tert-butyl N-(2-aminoethyl)-N-methyl-carbamate (5.53 g, 31.7 mmol, 1.2 equiv). The reaction mixture was stirred at 80 °C for 12 h. Then NaBH3CN (4.99 g, 79.4 mmol, 3 equiv) was added to the mixture and stirred at 25 °C for 1 h. The reaction mixture was concentrated under reduced pressure and purified by reverse-phase HPLC to give tert-butyl N-[2-[(4-bromo-2-methyl-pyrazol-3-yl)methylamino]ethyl]-N-methyl-carbamate (5 g, 14.4 mmol, 54.4% yield) as a yellow gum. 1 1H NMR (400 MHz, DMSO-d6) δ = 7.43 (s, 1H), 3.84 (s, 3H), 3.75 (s, 2H), 3.19 (s, 2H), 2.75 (s, 3H), 2.57 (t, J = 6.4 Hz, 2H), 1.43 - 1.30 (m, 9H)
[0214] To a solution of tert-butyl N-[2-[(4-bromo-2-methyl-pyrazol-3-yl)methylamino]ethyl]-N-methyl-carbamate (5 g, 14.4 mmol, 1 eq) in MeOH (50 mL) were added HCHO (2.34 g, 28.8 mmol, purity 37%, 2 eq), AcOH (86.5 mg, 1.44 mmol, 0.1 eq) and NaBH3CN (2.71 g, 43.2 mmol, 3 eq). The reaction was stirred at 25 °C for 2 h. The reaction mixture was concentrated under reduced pressure. The crude product was purified by reverse phase HPLC to give tert-butyl N-[2-[(4-bromo-2-methyl-pyrazol-3-yl)methyl-methyl-amino]ethyl]-N-methyl-carbamate (3.2 g, 8.86 mmol, 61.5% yield) as a yellow gum. 1 H NMR (400 MHz, DMSO-d6) δ = 7.46 (s, 1H), 3.80 (s, 3H), 3.52 (s, 2H), 3.29 - 3.13 (m, 2H), 2.76 - 2.55 (m, 3H), 2.40 (d, J = 5.6 Hz, 2H), 2.29 - 2.07 (m, 3H), 1.42 - 1.26 (m, 9H)
[0215] General Method C: Preparation of (18E)-8,10,13,15,17-pentamethyl-2,8,9,10,11,12,13,15-octahydro-14H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]diazacyclohexadecin-14-one (Ex.15)
Chemical formula
[0216] Project 1. A mixture of III-1-1 (700 mg, 1.38 mmol, 1.1 eq), III-2-1 (452 mg, 1.25 mmol, 1 eq), di-tert-butyl(cyclopentyl)phosphane; dichloropalladium; iron (81.6 mg, 0.125 mmol, 0.1 eq), Cs2CO3 (1.22 g, 3.75 mmol, 3 eq) in dioxane (10 mL) and H2O (2 mL) was subjected to degassing treatment, purged three times with N2, and then the mixture was stirred at 80 °C for 2 hours under a N2 atmosphere. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was purified by flash silica gel chromatography to obtain tert-butyl N-methyl-N-[2-[methyl-[[2-methyl-4-[1-tetrahydropyran-2-yl-3-(2-triisopropylsilylethynyl)indazol-5-yl]pyrazol-3-yl]methyl]amino]ethyl]carbamate (182 mg, 0.239 mmol, yield 19.1%) as a yellow solid. LCMS: m / z 663.6 (M+1)
[0217] tert-butyl N-methyl-N-[2-[methyl-[[2-methyl-4-[1-tetrahydropyran-2-yl-3-(2-triisopropylsilylethynyl)indazol-5-yl]pyrazol-3-yl]methyl]amino]ethyl]carbamate was converted to Ex.15 using the same method as in Steps 2 - 6 of General Method B.
[0218] General Method D: Preparation of (17E)-14-(2-hydroxyethyl)-8,12,16-trimethyl-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one (Ex.16)
Chemical Structure
[0219] Step 1. D-1 was prepared according to general method B. To a solution of D-1 (30.8 mg, 0.536 mmol, 1 equiv) in MeOH (2 mL), NaBH4 (40.5 mg, 1.07 mmol, 20 equiv) was added at 0 °C. The mixture was stirred at 0 °C for 3 h. After completion, the mixture was quenched with water (20 mL) and extracted with ethyl acetate (25 mL x 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to give D-2 (400 mg, crude) as a white solid. LCMS: m / z 532.2 (M+1) Step 2. To a solution of D-2 (28.0 mg, 0.526 mmol, 1 equiv) in DCM (1 mL), TFA (1.54 g, 13.5 mmol, 256 equiv) was added. The mixture was stirred at 25 °C for 1 h. After completion, the mixture was concentrated. The crude product was purified by preparative HPLC to give Ex.16 (4.49 mg, 0.100 mmol, 19% yield) as a white solid.
[0220] Ex.17 was prepared according to general method D.
[0221] General method E: Preparation of (17E)-8,12,16-trimethyl-14-[2-(pyrrolidin-1-yl)ethyl]-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,{4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one (Ex.18)
Chemical Structure
[0222] Step 1. To a solution of D-2 (50.0 mg, 0.094 mmol, 1 equiv) in DCM (2 mL) was added Et3N (47.5 mg, 0.470 mmol, 5 equiv), and then MsCl (64.6 mg, 0.564 mmol, 6 equiv) was added dropwise at 0 °C. The mixture was stirred at 0 °C for 2 h. After completion, the mixture was quenched with water (20 mL) and extracted with DCM (25 mL x 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to give E-1 (57.0 mg, 0.0934 mmol, 99% yield) as a yellow oil.
[0223] Step 2. To a solution of E-1 (57.0 mg, 0.0934 mmol, 1 equiv) and pyrrolidine (9.97 mg, 0.140 mmol, 1.5 equiv) in DMF (2 mL) was added K2CO3 (38.7 mg, 0.280 mmol, 3 equiv). The mixture was stirred at 80 °C for 12 h. After completion, the mixture was quenched with water (20 mL) and extracted with ethyl acetate (25 mL x 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to give E-2 (54.0 mg, 0.0923 mmol, 98% yield) as a yellow oil. LCMS: m / z 585.3 (M+1)
[0224] Step 3. To a solution of E-2 (50.0 mg, 0.0855 mmol, 1 equiv) in DCM (1 mL) was added TFA (1.54 g, 13.5 mmol, 157 equiv). The mixture was stirred at 25 °C for 2 h. After completion, the mixture was filtered and concentrated. The crude product was purified by preparative HPLC to give Ex.18 (4.54 mg, 0.009 mmol, 10% yield) as a yellow solid.
[0225] Ex.19 was prepared according to the general method E.
[0226] Preparation of 5-ethoxy-4-iodo-2-methyl-pyrazole-3-carboxylic acid (I-22):
Chemical formula
[0227] Step 1. To a solution of methyl 5-hydroxy-2-methyl-pyrazole-3-carboxylate (800 mg, 5.12 mmol, 1 equiv) in DMF (10 mL) were added K2CO3 (2.12 g, 15.4 mmol, 3 equiv) and EtI (799 mg, 5.12 mmol, 1 equiv), and then the mixture was stirred at 80 °C for 2 h. After completion, the reaction mixture was diluted with H2O (30 mL) and extracted with EA (10 mL x 3). The combined organic layers were washed with brine (10 mL x 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain a residue. The residue was purified by flash silica gel chromatography (ISCO (registered trademark); 12 g SepaFlash (registered trademark) silica flash column, eluent with a 0 - 30% THF / petroleum ether gradient, 30 mL / min) to give methyl 5-ethoxy-2-methyl-pyrazole-3-carboxylate (780 mg, 4.23 mmol, 82.65% yield) as a yellow oil.
[0228] Step 2. To a solution of methyl 5-ethoxy-2-methyl-pyrazole-3-carboxylate (750 mg, 4.07 mmol, 1 equiv) in ACN (10 mL) was added NIS (1.83 g, 8.14 mmol, 2 equiv) at 0 °C, and then the mixture was stirred at 60 °C for 12 h. After completion, the reaction mixture was quenched by adding saturated Na2SO3 (20 mL) at 25 °C, then extracted with H2O (10 mL) and extracted with EA (10 mL x 3). The combined organic layers were washed with brine (10 mL x 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain methyl 5-ethoxy-4-iodo-2-methyl-pyrazole-3-carboxylate (1.53 g, crude product) as a yellow solid.
[0229] Procedure 3. To a solution of methyl 5-ethoxy-4-iodo-2-methyl-pyrazole-3-carboxylate (1.5 g, 4.84 mmol, 1 equiv) in MeOH (3 mL), THF (6 mL) and H2O (3 mL) was added LiOH·H2O (609 mg, 14.5 mmol, 3 equiv), and then the mixture was stirred at 25 °C for 2 h. After completion, the pH was adjusted to 4 using 1 M HCl. The precipitate was collected by filtration. The precipitate was triturated in H2O and collected by filtration to give 5-ethoxy-4-iodo-2-methyl-pyrazole-3-carboxylic acid (1.00 g, 3.38 mmol, 70% yield) as a yellow solid.
[0230] Ex. 22 was prepared according to the general method B using I-22 of Procedure 3.
[0231] Preparation of tert-butyl N-[(2S)-2-[4-(3-ethynyl-1-tetrahydropyran-2-yl-indazol-5-yl)-2-methyl-pyrazol-3-yl]oxypropyl]-N-methyl-carbamate (I-23):
Chemical formula
[0232] Step 1. To a mixture of 2-methyl-4-[1-tetrahydropyran-2-yl-3-(2-triisopropylsilylethynyl)indazol-5-yl]pyrazol-3-ol (3 g, 6.27 mmol) in DMF (31.33 mL) was added potassium carbonate (2.60 g, 18.80 mmol), followed by tert-butyl (5R)-5-methyl-2,2-dioxo-oxathiazolidine-3-carboxylate (1.78 g, 7.52 mmol). The mixture was stirred at 80 °C for 18 h, diluted with DCM (50 mL) and cooled. The mixture was then filtered through a Celite pad and the filtrate was concentrated. The remaining residue was worked up with DCM and water (50 mL) and the layers were separated. The aqueous layer was extracted again with DCM (2 x 25 mL). The organic layers were combined, washed with brine and dried over sodium sulfate. Purification by flash column chromatography (automatic system, 40 g silica, 0 - 70% EA in hexane) gave tert-butyl N-[(2S)-2-[2-methyl-4-[1-tetrahydropyran-2-yl-3-(2-triisopropylsilylethynyl)indazol-5-yl]pyrazol-3-yl]oxypropyl]carbamate (2.72 g, 4.28 mmol, 68.25% yield).
[0233] In a mixture of tert-butyl N-[(2S)-2-[2-methyl-4-[1-tetrahydropyran-2-yl-3-(2-triisopropylsilylethynyl)indazol-5-yl]pyrazol-3-yl]oxypropyl]carbamate (2.2 g, 3.46 mmol) in anhydrous DMF (17 mL), sodium hydride (145.29 mg, 3.63 mmol, purity 60%) was added at 0 °C. The mixture was stirred for 1 hour, and methyl iodide (540.2 mg, 3.81 mmol, 237 μL) was added. The reaction was stirred while raising the temperature to ambient temperature and the mixture was stirred overnight. The reaction was then carefully quenched at 0 °C with a saturated aqueous solution of ammonium chloride (about 1 mL). The mixture was worked up with DCM and water (10 mL). The aqueous layer was extracted with DCM (2 x 5 mL), the organic layers were combined, washed with brine and dried over sodium sulfate. It was subjected to flash column chromatography (automatic system, 12 g silica, 0 - 100% EA in hexane) to obtain tert-butyl N-[(2S)-2-[4-(3-ethynyl-1-tetrahydropyran-2-yl-indazol-5-yl)-2-methyl-pyrazol-3-yl]oxypropyl]-N-methyl-carbamate (456 mg, 0.924 mmol, yield 26.70%).
[0234] Ex. 23 was prepared according to the general method B using I-23 of Step 2.
[0235] Preparation of 5-bromo-4-iodo-2-methyl-pyrazole-3-carboxylic acid (I-24):
Chemical Structure
[0236] Step 1. To a mixture of methyl 5-bromo-2-methyl-pyrazole-3-carboxylate (200 mg, 0.913 mmol) in acetonitrile (4 mL) was added NIS (616 mg, 2.7 mmol), and the mixture was stirred at 85 °C for 18 h. The reaction was then quenched with water (4 mL), diluted with DCM and water (10 mL), and the layers were separated. The aqueous layer was extracted again with DCM (2 x 5 mL). The combined organic layers were washed with brine, dried over sodium sulfate, and subjected to flash column chromatography (automatic system, 12 g silica, 0 - 40% EA in hexane) to afford methyl 5-bromo-4-iodo-2-methyl-pyrazole-3-carboxylate (231 mg, 0.670 mmol, 73.34% yield).
[0237] Step 2. To a mixture of methyl 5-bromo-4-iodo-2-methyl-pyrazole-3-carboxylate (231 mg, 0.670 mmol) in THF (2 mL) was added LiOH (2 M, 0.4 mL, aqueous solution), and the mixture was stirred at 22 °C for 4 h. The reaction was then cooled in a -20 °C freezer, diluted with DCM (5 mL), and 2 M HCl (aqueous, 0.5 mL) was added with vigorous stirring. The reaction was then diluted with DCM and (20 mL), and the layers were separated. The aqueous layer was extracted again with DCM (2 x 10 mL). The combined organic layers were washed with brine, dried over sodium sulfate, and the solid was filtered off and washed with DCM to afford 5-bromo-4-iodo-2-methyl-pyrazole-3-carboxylic acid (223 mg, 0.674 mmol, 100% yield).
[0238] General Procedure F: Preparation of (17E)-8,12,14-trimethyl-13-oxo-2,10,11,12,13,14-hexahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-16-carbonitrile (Ex. 24)
Chem.
[0239] Procedure 1. 5-Bromo-1-tetrahydropyran-2-yl-3-vinyl-indazole (10.08 g, 32.81 mmol), 2-methylpyrazol-3-ol (4.18 g, 42.66 mmol) and anhydrous 325 mesh potassium carbonate powder (11.34 g, 82.04 mmol) were added into a vial containing dioxane (82.04 mL). An argon stream was bubbled through for 15 minutes. t-BuBrettPhos Pd G3 (1.12 g, 1.31 mmol) was added under argon. The vial was sealed and stirred at 100 °C. Water (800 mL) was added to the reaction mixture, followed by 20% aqueous K2CO3 solution (150 mL) to adjust the pH to 9 - 10, and then extracted with ether (100 mL x 2). The ether layers were combined and washed with 20 mL of 20% aqueous K2CO3 solution. The aqueous layer was cooled in an ice bath, acidified to pH ~6 using NaHSO4 and extracted with 10% MeOH / DCM (200 mL x 6). The organic layers were combined, washed with water and brine, and dried over Na2SO4. The solvent was removed under vacuum, and the residue was dissolved in DCM (50 mL). 15 w / w% activated carbon (0.825 g) and 20 w / w% trisamine resin (1.1 g) were added and stirred for 3 hours. Next, the suspension was filtered through a Celite cake, and the cake was washed with DCM (20 mL). The filtrate was evaporated to obtain 2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-ol, which was carried over to the next step without further purification.
[0240] Step 2. To a mixture of 2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-ol (250 mg, 0.771 mmol) in NMP (3.85 mL) was added potassium carbonate (320 mg, 2.3 mmol) as the base, followed by tert-butyl N-(2-chloroethyl)-N-methyl-carbamate (224 mg, 1.2 mmol). The mixture was stirred at 90 °C for 2 h. The reaction mixture was cooled and diluted with DCM (20 mL). It was filtered through a microfilter, and the filtrate was subjected to post-treatment with DCM and water (25 mL), and the layers were separated. The aqueous layer was extracted again with DCM (2 x 10 mL). The combined organic layers were washed with brine and dried over sodium sulfate. It was subjected to F flash column chromatography (automatic system, 12 g silica, 0 - 50% EA in hexane) twice to obtain tert-butyl N-methyl-N-[2-[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]oxyethyl]carbamate (198 mg, 0.411 mmol, 53.35% yield).
[0241] Step 3. To a mixture of tert-butyl N-methyl-N-[2-[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]oxyethyl]carbamate (198 mg, 0.411 mmol) in DCM (2 mL) was added zinc bromide (370 mg, 1.6 mmol), and the reaction mixture was stirred at 22 °C for 2 days. The reaction mixture was diluted with DCM and water (20 mL), and the layers were separated. The aqueous layer was extracted again with DCM (2 x 10 mL). The combined organic layers were washed with brine and dried over sodium sulfate. It was subjected to flash column chromatography (automatic system, 12 g silica, 0 - 20% methanol in DCM) to obtain N-methyl-2-[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]oxy-ethanamine (63 mg, 0.165 mmol, 40.17% yield).
[0242] Step 4. To a mixture of 4,5-bromo-4-iodo-2-methyl-pyrazole-3-carboxylic acid (66 mg, 198.2 μmol) in DCM (1 mL) was added N-methyl-2-[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]oxy-ethanamine (63 mg, 0.165 mmol) and DIPEA (1.65 mmol, 288 μL), followed by T3P (0.330 mmol, 193 μL, 50% in EA). The mixture was stirred at 40 °C for 18 h. The reaction was then diluted with DCM and water (5 mL) and the layers were separated. The aqueous layer was extracted again with DCM (2 x 3 mL). The combined organic layers were washed with brine, dried over sodium sulfate, and subjected to flash column chromatography (automatic system, 12 g silica, 40-100% EA in hexane) to afford 5-bromo-4-iodo-N,2-dimethyl-N-[2-[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]oxyethyl]pyrazole-3-carboxamide (75 mg, 0.108 mmol, 65.40% yield).
[0243] In a mixture of 5-bromo-4-iodo-N,2-dimethyl-N-[2-[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]oxyethyl]pyrazole-3-carboxamide (75 mg, 0.108 mmol) in anhydrous DMF (2 mL), sodium bicarbonate (28 mg, 0.324 mmol) and TBAC (33 mg, 0.119 mmol) were added. The mixture was stirred while purging with argon, and palladium acetate (3 mg, 0.011 mmol) as a catalyst was added. Argon was purged for an additional 5 minutes. Next, the vessel was sealed and the reaction was heated at 140 °C for 1.5 hours. The reaction was diluted with DCM and water (20 mL), and the layers were separated. The aqueous layer was extracted again with DCM (2 x 10 mL). The organic layers were combined, washed with brine, dried over sodium sulfate, and subjected to flash column chromatography (automatic system, 12 g silica, 0 - 10% methanol in DCM) to obtain (17E)-16-bromo-8,12,14-trimethyl-2-(oxan-2-yl)-2,11,12,14-tetrahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecin-13(10H)-one (58 mg, 0.102 mmol, 94.80% yield).
[0244] Procedure 6. To a mixture of (13E)-22-bromo-29,30,32-trimethyl-31-tetrahydropyran-2-yl-34-oxa-26,27,28,29,30,31,32-heptaazapentacyclohexacos-3,5(15),6(26),13,16,18(23),19(21),20(27),22(28)-nonaen-25-one (58 mg, 0.102 mmol) in DMA (1 mL) were added zinc (13.5 mg, 0.205 mmol) and zinc cyanide (132 mg, 1.13 mmol), and dppf (34 mg, 0.061 mmol) was then added followed by Pd(dba)2 (18 mg, 0.030 mmol) while purging with argon. The mixture was stirred under argon for about 5 minutes. The vessel was sealed, heated to 120 °C and stirred for 18 hours. The reaction was diluted with DCM and water (10 mL) and the layers were separated. The aqueous layer was extracted again with DCM (2 x 5 mL). The combined organic layers were washed with brine, dried over sodium sulfate and subjected to flash column chromatography (automatic system, 12 g silica, 0 - 10% methanol in DCM) to give (17E)-8,12,14-trimethyl-2-(oxan-2-yl)-13-oxo-2,10,11,12,13,14-hexahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecine-16-carbonitrile (30 mg, 0.0585 mmol, 57.16% yield).
[0245] Step 7. To a mixture of (13E)-31,32,34-trimethyl-26-oxo-33-tetrahydropyran-2-yl-36-oxa-28,29,30,31,32,33,34-heptaazapentacyclohexacos-3,5(16),6(28),13,17,19(24),20(23),21(29),22(30)-nonaene-22-carbonitrile (30 mg, 0.585 mmol) in DCM (1 mL) was added TFA (6.53 mmol, 0.5 mL). The mixture was stirred at 22 °C for 2 h. The volatiles were removed under reduced pressure and 0.5 mL of triethylamine was added. It was subjected to flash column chromatography (automatic system, 12 g silica, 0-10% MeOH in DCM), followed by trituration in DCM / ethanol (0.2 / 2 mL) to give (17E)-8,12,14-trimethyl-13-oxo-2,10,11,12,13,14-hexahydro-8H-3,5-ethenotripyrazolo[3,4-f:3’,4’-j:4’’,3’’-n][1,4]oxaazacyclopentadecine-16-carbonitrile (15 mg, 0.035 mmol, yield 59.33%, purity 99.18%) after filtration (Ex.24).
[0246] Preparation of 3-ethyl-4-iodo-isoxazole-5-carboxylic acid:
Chemical formula
[0247] To a mixture of 3-ethyl isoxazole-5-carboxylic acid (296 mg, 2.10 mmol) in TFA (5 mL) was added NIS (566 mg, 2.5 mmol). The mixture was stirred at 70 °C for 30 min. The reaction was diluted with DCM and water (25 mL) and the layers were separated. The obtained layer was extracted again with DCM (2 x 15 mL). The organic layers were combined, washed with brine and dried over sodium sulfate. It was subjected to flash column chromatography (automatic system, 12 g silica, 20-60% EA in hexane) to give 3-ethyl-4-iodo-isoxazole-5-carboxylic acid (109 mg, 0.408 mmol, yield 19.46%).
[0248] Example 25 was prepared by the general method F according to Steps 1-5 and 7 using 3-ethyl-4-iodo-isoxazole-5-carboxylic acid in Step 1 described above.
[0249] Preparation of 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-4-iodo-5-methyl-pyrazole-3-carboxylic acid:
Chemical formula
[0250] Step 1: To a solution of methyl 3-methyl-1H-pyrazole-5-carboxylate (1.00 g, 7.14 mmol, 1 equiv.) and 2-[tert-butyl(dimethyl)silyl]oxyethanol (2.52 g, 14.3 mmol, 2 equiv.) in THF (10 mL) was added PPh3 (4.12 g, 15.7 mmol, 2.2 equiv.). The mixture was degassed and purged with N2 three times, stirred at 25 °C for 30 minutes, and then DIAD (3.17 g, 15.7 mmol, 2.2 equiv.) was added dropwise at 0 °C. The mixture was stirred at 25 °C for 12 hours under an N2 atmosphere. After completion, the mixture was concentrated to obtain a residue. The residue was purified by column chromatography (SiO2, PE / THF = 1:0 to 8:1) to obtain methyl 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-5-methyl-pyrazole-3-carboxylate (1.84 g, 6.16 mmol, 86% yield) as a colorless oil.
[0251] Step 2: To a solution of methyl 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-5-methyl-pyrazole-3-carboxylate (1.63 g, 5.46 mmol, 1 equiv) in acetonitrile (17 mL) was added NIS (3.69 g, 16.38 mmol, 3 equiv) at 0 °C. The mixture was stirred at 80 °C for 12 h. After completion, the mixture was quenched with saturated Na2SO3 (25 mL) and extracted with ethyl acetate (25 mL x 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to give a residue. The residue was purified by column chromatography (SiO2, PE / THF = 1:0~15:1) to afford methyl 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-4-iodo-5-methyl-pyrazole-3-carboxylate (2.13 g, 5.02 mmol, 92% yield) as a yellow oil.
[0252] Step 3: To a solution of methyl 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-4-iodo-5-methyl-pyrazole-3-carboxylate (1.00 g, 2.36 mmol, 1 equiv) in MeOH (2 mL), THF (4 mL) and H2O (2 mL) was added LiOH·H2O (98.9 mg, 2.36 mmol, 1 equiv). The mixture was stirred at 0 °C for 4 h. After completion, the mixture was quenched with 1 M HCl (5 mL) and extracted with 2-MeTHF (15 mL x 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to give 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-4-iodo-5-methyl-pyrazole-3-carboxylic acid (783 mg, 1.91 mmol, 8l% yield) as a white solid.
[0253] A solution of tert-butyl N-methyl-N-[2-[methyl-[[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]methyl]amino]ethyl]carbamate (700 mg, 1.38 mmol, 1 eq) in acetonitrile (7 mL) was added with TMSI (358 mg, 1.79 mmol, 1.3 eq) at 0 °C. The mixture was stirred at 0 °C for 2 h. After completion, the mixture was quenched with saturated NaHCO3 (20 mL) and extracted with ethyl acetate (25 mL x 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered and concentrated to give a residue. The residue was purified by column chromatography (SiO2, DCM / MeOH = 1:0 ~ 5:1) to afford N,N'-dimethyl-N'-[[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]methyl]ethane-1,2-diamine (100 mg, 0.245 mmol, yield 18%) as a yellow oil.
[0254] Preparation of (2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-4-iodo-N,5-dimethyl-N-[2-[methyl-[[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]methyl]amino]ethyl]pyrazole-3-carboxamide [Chemical formula]
[0255] Project 1: tert-Butyl N-[2-[(4-bromo-2-methyl-pyrazol-3-yl)methyl-methyl-amino]ethyl]-N-methyl-carbamate (Intermediate III-2-1, 1.22 g, 3.39 mmol, 2 equivalents), 1-tetrahydropyran-2-yl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3-vinyl-indazole (600 mg, 1.69 mmol, 1 equivalent, prepared using General Method F, Project 1), K2CO3 (702 mg, 5.08 mmol, 3 equivalents), Pd(dppf)Cl2·CH2Cl2 (138 mg, 0.169 mmol, 0.1 equivalent) in a mixture of dioxane (12 mL) and H2O (1.5 mL) was subjected to degassing treatment, purged with N2 three times, and then the mixture was stirred at 100 °C for 12 hours under an N2 atmosphere. After completion, the mixture was filtered and concentrated to obtain a residue. The residue was purified by column chromatography (SiO2, PE / THF = 1:0 to 2:1) to obtain tert-butyl N-methyl-N-[2-[methyl-[[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]methyl]amino]ethyl]carbamate (699 mg, 1.37 mmol, 81% yield) as a yellow oil.
[0256] Procedure 2: To a solution of tert-butyl N-methyl-N-[2-[methyl-[[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]methyl]amino]ethyl]carbamate (700 mg, 1.38 mmol, 1 equiv) in acetonitrile (7 mL) was added TMSI (358 mg, 1.79 mmol, 1.3 equiv) at 0 °C. The mixture was stirred at 0 °C for 2 h. After completion, the mixture was quenched with saturated NaHCO3 (20 mL) and extracted with ethyl acetate (25 mL x 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to give a residue. The residue was purified by column chromatography (SiO2, DCM / MeOH = 1:0 to 5:1) to afford N,N'-dimethyl-N'-[[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]methyl]ethane-1,2-diamine (100 mg, 0.245 mmol, 18% yield) as a yellow oil.
[0257] Procedure 3: To a solution of 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-4-iodo-5-methyl-pyrazole-3-carboxylic acid (80.4 mg, 0.196 mmol, 1 equiv) in DMF (1 mL) were added HATU (89.4 mg, 0.235 mmol, 1.2 equiv) and DIEA (75.9 mg, 0.587 mmol, 3 equiv), and the mixture was stirred at 25 °C for 30 min. Then N,N'-dimethyl-N'-[[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]methyl]ethane-1,2-diamine (80.0 mg, 0.196 mmol, 1 equiv) was added to the mixture, and the resulting mixture was stirred at 25 °C for 1 h. After completion, the mixture was quenched with water (5 mL) and extracted with ethyl acetate (5 mL×3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to give a residue. The residue was purified by column chromatography (SiO2, PE / THF = 1:0~2:1) to afford 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-4-iodo-N,5-dimethyl-N-[2-[methyl-[[2-methyl-4-(1-tetrahydropyran-2-yl-3-vinyl-indazol-5-yl)pyrazol-3-yl]methyl]amino]ethyl]pyrazole-3-carboxamide (69.0 mg, 0.086 mmol, 44% yield) as a yellow oil.
[0258] Ex. 26 was prepared according to the general method F from the above-mentioned intermediate, following Steps 5 and 7.
[0259] Preparation of 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-5-ethoxy-4-iodo-pyrazole-3-carboxylic acid:
Chem.
[0260] Step 1. To a mixture of ethyl 3-hydroxy-1H-pyrazole-5-carboxylate (250 mg, 1.60 mmol) in DMF (8 mL) was added potassium carbonate (664 mg, 4.8 mmol), followed by ethyl iodide (1.60 mmol, 130 μL). The mixture was stirred at 80 °C for 2 h. The reaction was cooled, diluted with DCM (20 mL), and then filtered. The filtrate was worked up with DCM and water (100 mL). After separating the layers, the aqueous layer was extracted again with DCM (2 x 50 mL). The combined organic layers were washed with brine and then dried over sodium sulfate. Purification by flash column chromatography (automatic system, 12 g silica, 0 - 30% EA in hexane) gave ethyl 3-ethoxy-1H-pyrazole-5-carboxylate (184 mg, 0.999 mmol, 62.39% yield).
[0261] Step 2. To a mixture of ethyl 3-ethoxy-1H-pyrazole-5-carboxylate (184 mg, 998.96 μmol) in DMF (5 mL) was added potassium carbonate (414 mg, 3 mmol), followed by 2-bromoethoxy-tert-butyl-dimethyl-silane (1.50 mmol, 322 μL) and TBAI (369 mg, 999 μmol). The mixture was stirred at 60 °C for 6 h. The reaction was diluted with DCM, cooled in an ice bath, then the mixture was filtered and further washed with DCM. The filtrate was concentrated to dryness and the residue was purified by flash column chromatography (automatic system using ELSD, 12 g silica, 0 - 20% EA in hexane) to give ethyl 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-5-ethoxy-pyrazole-3-carboxylate (220 mg, 0.642 mmol, 64.30% yield).
[0262] Step 3. To a mixture of ethyl 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-5-ethoxy-pyrazole-3-carboxylate (150 mg, 0.438 mmol) in methanol (0.2 mL) and THF (1 mL) was added LiOH in water (2 M, 1 mL). The mixture was stirred at 22 °C for 18 h. The reaction was cooled in a -20 °C freezer, diluted with DCM, and 2 M HCl (aqueous) (1 mL) was added with vigorous stirring. The reaction was then diluted with DCM and water (5 mL), and the layers were separated. The aqueous layer was extracted again with DCM (2 x 5 mL). The combined organic layers were washed with brine and dried over sodium sulfate. Subjected to flash column chromatography (automatic system, 12 g silica, 0 - 12.5% MeOH in DCM), 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-5-ethoxy-pyrazole-3-carboxylic acid (36 mg, 114.48 μmol, 26.14% yield) and 5-ethoxy-2-(2-hydroxyethyl)pyrazole-3-carboxylic acid (4.2 mg, 0.021 mmol, 4.79% yield) were obtained.
[0263] Step 4. To a mixture of 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-5-ethoxy-pyrazole-3-carboxylic acid (36 mg, 0.114 mmol) in acetonitrile (1 mL) was added NIS (28 mg, 125.9 μmol). The reaction was stirred at 70 °C for 1.5 h. The mixture was then cooled, quenched with water, and subjected to workup with DCM and water (10 mL), and the layers were separated. The aqueous layer was extracted again with DCM (2 x 5 mL). The combined organic layers were washed with brine and dried over sodium sulfate. Subjected to flash column chromatography (automatic system, 12 g silica, 0 - 25% methanol in DCM), 2-[2-[tert-butyl(dimethyl)silyl]oxyethyl]-5-ethoxy-4-iodo-pyrazole-3-carboxylic acid (34 mg, 0.077 mmol, 67.44% yield) was obtained.
[0264] Ex. 27 was manufactured according to Steps 1-5 and 7 using General Method F with the intermediate of Step 4 above.
[0265]
Table 11
Table 12
Table 13
[0266]
Table 14
[0267]
Table 15
Table 16
[0268] Screening assay Biochemical assay Evaluation of FLT3 and PIM kinase activities at Reaction Biology The inhibitory activity against the enzyme kinase was evaluated using the Hot Spot Assay platform (www.reactionbiology.com), a radiometric assay that directly measures the kinase catalytic activity towards a specific substrate based on the conventional filter binding assay (Anastassiadis T et al., Comprehensive Assay of Kinase Catalytic Activity Reveals Features of Kinase Inhibitor Selectivity. Nat Biotechnol. 2011, 29: 1039 - 45). Briefly, it was prepared in a reaction buffer (20 mM Hepes pH 7.5, 10 mM MgCl2, 1 mM EGTA, 0.02% Brij35, 0.02 mg / ml BSA, 0.1 mM Na3VO4, 2 mM DTT, 1% DMSO) together with the cofactors required for a specific kinase / substrate pair. The compound was delivered to the reactants, and then after about 20 minutes, a mixture of ATP (Sigma, St. Louis MO) and 33 γ32P ATP (Perkin Elmer, Waltham MA) was added to a final concentration of 10 μM. The reaction was carried out at room temperature for 120 minutes, and then the reactants were spotted onto P81 ion exchange filter paper (Whatman Inc., Piscataway, NJ). Unbound phosphate was removed by thoroughly washing the filter with 0.75% phosphoric acid. After subtracting the background derived from a control reaction containing the inactive enzyme, the kinase activity data was expressed as the percentage of kinase activity remaining in the test sample compared to the vehicle (dimethyl sulfoxide) reaction. IC 50 values and curve fitting were obtained using Prism (GraphPad Software).
[0269] Table 1. Inhibition of the kinase activities of FLT3 and FLT3 - ITD
Table 17
[0270] Evaluation of the binding affinity with wild-type and mutant FLT3 kinases using the KINOMEscan assay of Eurofins DiscoveRx For most kinases, kinase-tagged T7 phage strains were produced in an E. coli host derived from the BL21 strain. E. coli was grown to the logarithmic phase, infected with T7 phage, and cultured with shaking at 32 °C until lysis. The lysate was centrifuged and filtered to remove cell debris. The remaining kinases were produced in HEK-293 cells and then tagged with DNA for qPCR detection. Magnetic beads coated with streptavidin were treated with biotinylated low-molecular-weight ligand at room temperature for 30 minutes to prepare an affinity resin for kinase assay. The ligand-attached beads were blocked with an excess amount of biotin and washed with a blocking buffer (SeaBlock (Pierce), 1% BSA, 0.05% Tween 20, 1 mM DTT) to remove unbound ligand and reduce non-specific binding. The binding reaction was assembled by combining kinase, affinity beads attached with ligand, and test compounds in 1x binding buffer (20% SeaBlock, 0.17x PBS, 0.05% Tween 20, 6 mM DTT). The test compounds were prepared as 111X stocks in 100% DMSO. Kd was measured using an 11-point 3-fold compound dilution series including 3 DMSO controls. All compounds for Kd measurement were dispensed by acoustic transfer (non-contact dispensing) in 100% DMSO. Next, the compounds were directly diluted in the assay to a final DMSO concentration of 0.9%. All reactions were performed in 384-well polypropylene plates. Each final dose was 0.02 ml. The assay plates were incubated for 1 hour with shaking at room temperature, and the affinity beads were washed with a wash buffer (1x PBS, 0.05% Tween 20). Next, the beads were resuspended in an elution buffer (1x PBS, 0.05% Tween 20, 0.5 μM non-biotinylated affinity ligand) and incubated for 30 minutes with shaking at room temperature. The kinase concentration in the eluate was measured by qPCR. The binding constant (Kd) was calculated from the standard dose-response curve using non-linear least squares fitting by the Levenberg-Marquardt algorithm.
[0271] Table 2. Binding Affinity with Wild-Type and Mutant FLT3 Kinases in Ex.6 [Table 18]
[0272] Inhibition of CLK1, CLK2, CLK3, and CLK4 Kinase Activities The kinase protein and substrate were pre-diluted with HEPES assay buffer (100 mM HEPES, pH 7.5, 0.01% Triton X-100, 0.1% BSA, 5 mM MgCl2, 1 mM DTT, 10 μM sodium orthovanadate, 10 μM beta-glycerophosphate) and dispensed into 384-well plates (5 μL per well). Control samples (without inhibitor, 0% inhibition with DMSO only) and 100% inhibition (without enzyme) were assembled in six replicates and used to calculate the % inhibition in the presence of the compound. The test compound was added to the protein sample by acoustic dispensing (Labcyte Echo550). The concentration of DMSO was normalized to 1% in all samples. The reaction was initiated by adding ATP by acoustic dispensing (Labcyte Echo550) and incubated according to the assay-specific incubation time. After incubation, 5 μL of Promega ADP-Glo reagent was added and incubated for 40 minutes. After 40 minutes, 10 μL of Promega kinase detection reagent was added. After incubation with the kinase detection reagent for 10 minutes, fluorescence was read with a microplate reader (Biotek Synergy).
[0273] Table 3. Inhibition of CLK1, CLK2, CLK3, and CLK4 Kinase Activities [Table 19]
[0274] Cell Proliferation Assay The MV-4-11 cell line was obtained from ATCC and maintained in RPMI medium supplemented with 10% fetal bovine serum and 100 U / mL penicillin / streptomycin. White 384-well plates were seeded with 1000 MV-4-11 cells / 50 μL per well, and then the compounds shown were treated with an 11-fold dilution series. Cell proliferation was measured using an ATP detection assay (CellTiter-Glo 2.0 luciferase-based, Promega, Madison, WI) according to the manufacturer's protocol. Next, the plates were read on a TECAN Spark multimode microplate reader. The data were analyzed using GraphPad Prism 9 (GraphPad Software, San Diego, CA) to obtain the IC 50 values.
[0275] Table 4. Inhibition of MV-4-11 cell proliferation
Table 20
[0276] Inhibition of cell proliferation in a broad panel of cell proliferation assays Ba / F3 cells were purchased from DSMZ. The FLT3-ITD gene was synthesized by GenScript and cloned into the pCDH-CMV-MCS-EF1-Puro plasmid (System Biosciences, Inc). FLT3-ITD / D835V and FLT3-ITD / F691L cDNA clones were generated by PCR at GenScript and confirmed by sequencing. Ba / F3 FLT3-ITD, FLT3-ITD / D835V, and FLT3-ITD / F691L cell lines were generated by infecting Ba / F3 cells with lentiviruses containing the FLT3-ITD, FLT3-ITD / D835V, or FLT3-ITD / F691L gene. Stable cell lines were selected by puromycin treatment and then IL-3 was removed.
[0277] The cell proliferation assay was performed on a panel of 108 cell lines. In a 96-well black plate with a transparent bottom (Corning #3904), 1000 cells (adherent cells) or 3000 cells (suspension cells) per well / 100 μl were seeded. Using a Tecan D300e Digital Dispenser, the compound was added at 9 doses in a 1:3 titration. The plate was incubated at 37 °C and 5% CO2 for 5 days. Cell proliferation was measured at 50 μl per well using a CellTiter-Glo 2.0 luciferase-based ATP detection assay (Promega, Madison, WI) according to the manufacturer's protocol. The plate was then read on a TECAN Spark multimode microplate reader. The data was analyzed using GraphPad Prism 9 (GraphPad Software, San Diego, CA) to obtain the IC 50 value. The IC 50 value was determined using Prism software (GraphPad Software, San Diego, CA).
[0278] Table 5. Anti-cell proliferation activity of Ex.6 in a panel of 108 cell lines [Table 21] [Table 22] [Table 23] [Table 24] [Table 25] [Table 26] [Table 27]
[0279] Inhibition of kinase phosphorylation in the MV-4-11 and MOLM13 cell lines Inhibition of kinase phosphorylation assay was performed by Western blotting using MV-4-11 and MOLM13 cell lines. One million cells per well were plated in 24-well plates and then treated with compounds at different concentrations starting from 100 nM with a 1:4 titration of DMSO as a control. After incubation for 4 hours, the cells were washed once with ice-cold PBS and lysed in RIPA lysis buffer containing protease and phosphatase inhibitors. The cell lysates were then subjected to sonication, spun down, and 40 μg of protein was separated by sodium dodecyl sulfate electrophoresis on a 4-12% bis-tris polyacrylamide gel and transferred to a nitrocellulose membrane using the Bio-Rad Trans-Blot Turbo Transfer System (Bio-Rad). Blocking was performed using 3% BSA or 5% non-fat dry milk (Fisher Scientific) in TBST (Tris-buffered saline containing 0.05% Tween 20) (Bio-Rad Laboratories, Inc.). The membranes were incubated overnight with anti-phospho-FLT3 (Y589 / Y591) (CST#60413), anti-phospho-STAT5 (Y694) (CST#4322), anti-phospho-p44 / 42 MAPK (Erk1 / 2) (T202 / Y204) (CST#9101), anti-phospho-S6 ribosomal protein (S235 / 236) (CST#4858), and anti-β-actin (CST#8457), each diluted 1000-fold with 3% BSA in TBST. The membranes were washed with TBST and then incubated for 1 hour at room temperature with an HRP-labeled anti-rabbit IgG polyclonal antibody (CST#7074) diluted 1000-fold with 3% BSA. After washing with TBST, the blots were developed using a chemiluminescence system (SuperSignal West Femto Maximum Sensitivity Substrate, Pierce#34095). Luminescence was detected using a LI-COR Odyssey M imaging system, and the luminescence intensity was quantified using Empiria Studio 2.2 software. Data were analyzed using GraphPad Prism 9 (GraphPad Software, San Diego, CA), and IC50 The value was obtained.
[0280] Table 7. Inhibition of kinase phosphorylation by Ex.6 and gilteritinib in MV-4-11 and MOLM-13 cells [Table 28]
[0281] Another regulation of splicing using Ex.6 in MV-4-11 and MOLM-13 cells The ratio of alternative splicing to RNA transcripts was measured in MV-4-11 and MOLM-13 by qPCR. Cells were plated at 1 million cells per well in a 24-well plate, then treated with only DMSO as a control and with different concentrations of the compound. After incubating for 8 hours, the cells were harvested, washed once with ice-cold PBS, and lysed in RNA lysis buffer (Invitrogen). Total RNA was extracted using an RNA purification kit (Invitrogen). 2 μg of RNA was used for cDNA synthesis using a cDNA synthesis kit (ThermoFisher), and 20 ng of cDNA was used for qPCR using a PROFLEX 96-well PCR system (ThermoFisher).
[0282] The following primers were used for the measurement: BCLAF1 exon 10-12 / exon 10-11 (TaqMan, IDT) BCLAF1 (ex10-11) F: CAGGAGTTAGCCGACCACG (SEQ ID NO: 1) BCLAF1 (ex10-11) R: GTTTGGACCAGTATTTGTCCCAG (SEQ ID NO: 2) BCLAF1 (ex10-11) probe: AACCTTTTTTCGAATTAGAGGCA (SEQ ID NO: 3) BCLAF1 (ex10-12) F: TGCAGGAGTTAGCCGACCAC (SEQ ID NO: 4) BCLAF1(ex10-12)R: TTGGCCCAATAATCCACACC (SEQ ID NO: 5) BCLAF1(ex10-12) Probe: AACCTTTCATGACGACAGAG (SEQ ID NO: 6)
[0283] PRS6KB1 Exons 6-8 / Exons 6-7 (TaqMan, IDT) S6K(ex6-7)F: TTATGCAGTTAGAAAGAGAGGGAATATTT (SEQ ID NO: 7) S6K(ex6-7)R: CCCCAAAGCCATGGAGATTT (SEQ ID NO: 8) S6K(ex6-7) Probe: TGGAAGACACTGCCTGCTTTTACTTGG (SEQ ID NO: 9) S6K(ex6-8)F: TTATGCAGTTAGAAAGAGAGGGAATATTT (SEQ ID NO: 10) S6K(ex6-8)R: GATTCTTTGCATAGTCCAAAGTCTGT (SEQ ID NO: 11) S6K(ex6-8) Probe: TGGAAGACACTGCCTGGTCATGTGAAA (SEQ ID NO: 12)
[0284] BCLxS / xL (SYBR Green, IDT) BCLxS F: GAGCTTTGAACAGGATACTTTTGTG (SEQ ID NO: 13) BCLxS R: GAAGAGTGAGCCCAGCAGAA (SEQ ID NO: 14) BCLxL F: GATGGCCACTTACCTGAATGA (SEQ ID NO: 15) BCLxL R: TGCTGCATTGTTCCCATAGA (SEQ ID NO: 16)
[0285] Table 8. Another regulation of BCLAF1, SK6K and BCL-x splicing in MOLM-13 cell line using Ex.6 by qPCR method
Table 29
[0286] Table 9. Another splicing regulation using Ex.6 by qPCR method of BCL-x in MV-4-11 cell line
Table 30
[0287] Another splicing event by RNAseq in MOLM-13 Another splicing event was measured by RNAseq in MOLM-13. Cells were plated at 1 million cells per well in 24-well plates and then treated with different concentrations of the compound with DMSO as a control. After incubation for 8 hours, the cells were harvested, washed once with ice-cold PBS, and lysed in RNA lysis buffer (Invitrogen). Total RNA was extracted using an RNA purification kit (Invitrogen). RNAseq was performed by Biomiga (San Diego).
[0288] Table 10. Another splicing event by RNAseq in MOLM-13
Table 31
[0289] Inhibition of tumor growth by Ex.6 in cell-derived xenograft (CDX) tumor experiments in mice Tumor cells were cultured using the above standard techniques and harvested by subjecting them to centrifugation at 1000 rpm for 5 minutes to form pellets. The pellet-shaped cells were washed once with serum-free medium and then resuspended again in serum-free medium supplemented with 50% Matrigel (Corning, Inc.). 5 million tumor cells were subcutaneously implanted into the right flank of each mouse, and then the tumor volume and body weight were measured once or twice a week using an electronic caliper (Fowler) and a balance, respectively. When the average size of the tumor reached a predetermined volume, the mice were grouped and treated with Ex.6. One group of mice was treated with the vehicle as a control. During the treatment, the mice were monitored daily by cage-side observation. The tumor volume (TV) and body weight were measured two or three times a week during the treatment period. The study was terminated either 4 - 5 weeks after the treatment or when the tumor volume of any mouse reached 1000 or 2000 mm 3 whichever occurred first. Tumor growth inhibition (TGI) was calculated as follows: TV 処理期間の最終日の処理群 > TV 処理期間の第1日目の処理群 When, it was calculated as 100%*{1 - [(TV 処理期間の最終日の処理群 - TV 処理期間の第1日目の処理群 ) / (TV 処理期間の最終日の対照群 - TV 処理期間の第1日目の対照群 )]}. When TV 処理期間の最終日の処理群 < TV 処理期間の第1日目の処理群 it was the case, TGI was calculated as 100%*(2 - TV 処理期間の最終日の処理群 / TV 処理期間の第1日目の処理群 )
[0290] Table 11. Inhibition of tumor growth by Ex.6 in CDX tumor experiments by oral, once-daily (QD) or other dosing regimens
Table 32
Claims
1. Formula I: 【Chemistry 1】 [In the formula: Ring A is a 5- to 10-membered heteroarylene; Ring B is a 5- to 10-membered heteroarylene or C 6 -C 10 It is Arirene; Each L is independently, -O-, -S-, -S(O)-, -S(O) 2 -, -N(R 6 ), -C(O)N(R 6 ), -N(R 6 ), -N(R 6 ), -S(O)N(R 6 ), -N(R 6 ), -S(O) 2 -, -S(O) 2 N(R 6 ), or -C(R 7 )(R 8 )-: provided that, (L) p does not contain an O - O, S - O, or N - N bond, and the point where (L) p covalently bonds to -NR 3 - does not form an -N - N - or -O - N - bond; R 1 and R 2 If each of them is present, independently, deuterium, halogen, and C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 Aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O) 2 R a , -SR a , -S(O)R a , -S(O) 2 R a , -S(O)NR a R b , -S(O) 2 NR a R b , -OS(O)NR a R b , -OS(O) 2 NR a R b , -NR a R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O) 2 R b , -NR a S(O)NR a R b , -NR a S(O) 2 NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b , -PR a R b , -P(O)RR a R b , -P(O) 2 R a R b , -P(O)NRR a R b , -P(O) 2 NR a R b , -P(O)OR a , -P(O) 2 OR a , -CN, or -NO 2 where C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C 3 -C 6 cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 aryl, or each hydrogen atom in 5- to 10-membered heteroaryl is independently deuterium, halogen, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, -OR c , -OC(O)R c , -OC(O)NR c R d , -OS(O)R c , -OS(O) 2 R c , -OS(O)NR c R d , -OS(O) 2 NR c R d , -SR c , -S(O)R c , -S(O) 2 R c , -S(O)NR c R d , -S(O) 2 NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c ) (C(O)R d ), -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c S(O)R d , -NR c S(O) 2 R d , -NR c S(O)NR c R d , -NR c S(O) 2 NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d ,-PR c R d ,-P(O)R c R d , -P(O) 2 R c R d , -P(O)NR c R d , -P(O) 2 NR c R d , -P(O)OR c , -P(O) 2 OR c -CN, or -NO 2 It may be replaced by; R 3 H, deuterium, C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 An aryl, or a 5- to 10-membered heteroaryl, where C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 Each hydrogen atom in an aryl or 5- to 10-membered heteroaryl is independently -OR c , -OC(O)R c , -OC(O)NR c R d , -OS(O)R c , -OS(O) 2 R c , -OS(O)NR c R d , -OS(O) 2 NR c R d , -SR c , -S(O)R c , -S(O) 2 R c , -S(O)NR c R d , -S(O) 2 NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c ) (C(O)R d ), -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c S(O)R d , -NR c S(O) 2 R d , -NR c S(O)NR c R d , -NR c S(O) 2 NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d ,-PR c R d ,-P(O)R c R d , -P(O) 2 R c R d , -P(O)NR c R d , -P(O) 2 NR c R d , -P(O)OR c , -P(O) 2 OR c -CN, or -NO 2 It may be replaced by; Each R 4 These are independently deuterium, halogen, and C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 Aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O) 2 R a , -SR a , -S(O)R a , -S(O) 2 R a , -S(O)NR a R b , -S(O) 2 NR a R b , -OS(O)NR a R b , -OS(O) 2 NR a R b , -NR a R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O) 2 R b , -NR a S(O)NR a R b , -NR a S(O) 2 NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b ,-PR a R b ,-P(O)R a R b , -P(O) 2 R a R b , -P(O)NR a R b , -P(O) 2 NR a R b , -P(O)OR a , -P(O) 2 OR a -CN, or -NO 2 And here C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 Each hydrogen atom in aryls and 5- to 10-membered heteroaryls is independently a deuterium, halogen, or C. 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl, -OR e , -OC(O)R e , -OC(O)NR e R f , -OS(O)R e , -OS(O) 2 R e , -OS(O)NR e R f , -OS(O) 2 NR e R f , -SR e , -S(O)R e , -S(O) 2 R e , -S(O)NR e R f , -S(O) 2 NR e R f , -NR e R f , -NR e C(O)R f , -NR e C(O)OR f , -NR e C(O)NR e R f , -NR e S(O)R f , -NR e S(O) 2 R f , -NR e S(O)NR e R f , -NR e S(O) 2 NR e R f , -C(O)R e , -C(O)OR e , -C(O)NR e R f ,-PR e R f ,-P(O)R e R f , -P(O) 2 R e R f , -P(O)NR e R f , -P(O) 2 NR e R f , -P(O)OR e , -P(O) 2 OR e -CN, or -NO 2 It may be replaced by; R 5 H, deuterium, -C(O)R c , -C(O)OR c , -C(O)NR c R d , -P(O) 2 R c R d , -P(O) 2 NR c R d , -P(O) 2 OR c , or -S(O) 2 OR c And; Each R 6 If present, independently, H, deuterium, and C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 An aryl, or a 5- to 10-membered heteroaryl, where C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 Each hydrogen atom in an aryl or 5- to 10-membered heteroaryl is independently -OR c , -OC(O)R c , -OC(O)NR c R d , -OS(O)R c , -OS(O) 2 R c , -OS(O)NR c R d , -OS(O) 2 NR c R d , -SR c , -S(O)R c , -S(O) 2 R c , -S(O)NR c R d , -S(O) 2 NR c R d , -NR c R d , -NR c C(O)R d , -N(C(O)R c ) (C(O)R d ), -NR c C(O)OR d , -NR c C(O)NR c R d , -NR c S(O)R d , -NR c S(O) 2 R d , -NR c S(O)NR c R d , -NR c S(O) 2 NR c R d , -C(O)R c , -C(O)OR c , -C(O)NR c R d ,-PR c R d ,-P(O)R c R d , -P(O) 2 R c R d , -P(O)NR c R d , -P(O) 2 NR c R d , -P(O)OR c , -P(O) 2 OR c -CN, or -NO 2 It may be replaced by; Each R 7 and R 8 These are independently H, deuterium, halogen, and C. 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 Aryl, 5- to 10-membered heteroaryl, -OR a , -OC(O)R a , -OC(O)NR a R b , -OS(O)R a , -OS(O) 2 R a , -SR a , -S(O)R a , -S(O) 2 R a , -S(O)NR a R b , -S(O) 2 NR a R b , -OS(O)NR a R b , -OS(O) 2 NR a R b , -NR a R b , -NR a C(O)R b , -NR a C(O)OR b , -NR a C(O)NR a R b , -NR a S(O)R b , -NR a S(O) 2 R b , -NR a S(O)NR a R b , -NR a S(O) 2 NR a R b , -C(O)R a , -C(O)OR a , -C(O)NR a R b ,-PR a R b ,-P(O)R a R b , -P(O) 2 R a R b , -P(O)NR a R b , -P(O) 2 NR a R b , -P(O)OR a , -P(O) 2 OR a -CN, or -NO 2 And here C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 Each hydrogen atom in aryls and 5- to 10-membered heteroaryls is independently a deuterium, halogen, or C. 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl, -OR e , -OC(O)R e , -OC(O)NR e R f , -OS(O)R e , -OS(O) 2 R e , -OS(O)NR e R f , -OS(O) 2 NR e R f , -SR e , -S(O)R e , -S(O) 2 R e , -S(O)NR e R f , -S(O) 2 NR e R f , -NR e R f , -NR e C(O)R f , -NR e C(O)OR f , -NR e C(O)NR e R f , -NR e S(O)R f , -NR e S(O) 2 R f , -NR e S(O)NR e R f , -NR e S(O) 2 NR e R f , -C(O)R e , -C(O)OR e , -C(O)NR e R f ,-PR e R f ,-P(O)R e R f , -P(O) 2 R e R f , -P(O)NR e R f , -P(O) 2 NR e R f , -P(O)OR e , -P(O) 2 OR e -CN, or -NO 2 It may be replaced by; or two R 7 and R 8 They bond together with the carbon or multiple carbons they bond to, C 3 -C 6 A cycloalkyl group or a 3- to 7-membered heterocycloalkyl group may be formed, where two R groups are present. 7 and R 8 C is formed when they come together. 3 -C 6 Each hydrogen atom in a cycloalkyl or 3- to 7-membered heterocycloalkyl is independently -OR e , -OC(O)R e 、-OC(O)NR e R f 、-OS(O)R e 、-OS(O) 2 R e 、-OS(O)NR e R f 、-OS(O) 2 NR e R f 、-SR e 、-S(O)R e 、-S(O) 2 R e 、-S(O)NR e R f 、-S(O) 2 NR e R f 、-NR e R f 、-NR e C(O)R f 、-NR e C(O)OR f 、-NR e C(O)NR e R f 、-NR e S(O)R f 、-NR e S(O) 2 R f 、-NR e S(O)NR e R f 、-NR e S(O) 2 NR e R f 、-C(O)R e 、-C(O)OR e 、-C(O)NR e R f 、-PR e R f 、-P(O)R e R f 、-P(O) 2 R e R f 、-P(O)NR e R f 、-P(O) 2 NR e R f 、-P(O)OR e 、-P(O) 2 OR e -CN, or -NO 2 It may be replaced by; Each R a , R b , R c , R d , R e , and R f These are independently H, deuterium, and C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 Ariel, C 1 -C 6 Alkylene-C 6 -C 10 Aryls, 5- to 10-membered heteroaryls, and C 1 -C 6 Selected from the group consisting of alkylene-5 to 10-membered heteroaryls, or R a and R b , or R c and R d , or R e and R f However, together with the atoms to which they bond, they form a 3- to 7-membered heterocycloalkyl group, where C 1 -C 6 Alkyl, C 2 -C 6 Alkenil, C 2 -C 6 Alkinyl, C 3 -C 6 Cycloalkyl, 3- to 7-membered heterocycloalkyl, C 6 -C 10 Ariel, C 1 -C 6 Alkylene-C 6 -C 10 Aryl, 5- to 10-membered heteroaryl, or C 1 -C 6 Each hydrogen atom in an alkylene-5 to 10-membered heteroaryl is independently a deuterium, halogen, or C. 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl, -OH, -OC 1 -C 6 Alkyl, -OC(O)-(H or C 1 -C 6 Alkyl), -OC(O)N(H or C 1 -C 6 Alkyl) 2 , -OC(O)N(C 2 -C 6 Alkylene), -OS(O)-(H or C 1 -C 6 Alkyl), -OS(O) 2 - (H or C 1 -C 6 Alkyl), -OS(O)N(H or C 1 -C 6 Alkyl) 2 , -OS(O)N(C 2 -C 6 Alkylene), -OS(O) 2 N (H or C 1 -C 6 Alkyl) 2 , -OS(O) 2 N(C) 2 -C 6 Alkylene), -S (H or C 1 -C 6 Alkyl), -S(O)(H or C 1 -C 6 Alkyl), -S(O) 2 (H or C 1 -C 6 Alkyl), -S(O)N(H or C 1 -C 6 Alkyl) 2 , -S(O)N(C 2 -C 6 Alkylene), -S(O) 2 N (H or C 1 -C 6 Alkyl) 2 , -S(O) 2 N(C) 2 -C 6 Alkylene), -N(H or C) 1 -C 6 Alkyl) 2 , -N(C 2 -C 6 Alkylene), -N(H or C) 1 -C 6 Alkyl)C(O)-(H or C 1 -C 6 Alkyl), -N(H or C) 1 -C 6 Alkyl)C(O)O(H or C 1 -C 6 Alkyl), -N(H or C) 1 -C 6 Alkyl)C(O)N(H or C 1 -C 6 Alkyl) 2 , -N(H or C 1 -C 6 Alkyl)C(O)N(C 2 -C 6 Alkylene), -N(H or C) 1 -C 6 Alkyl)S(O)-(H or C 1 -C 6 Alkyl), -N(H or C) 1 -C 6 Alkyl)S(O) 2 (H or C 1 -C 6 Alkyl), -N(H or C) 1 -C 6 Alkyl) S(O) N(H or C 1 -C 6 Alkyl) 2 , -N(H or C 1 -C 6 Alkyl) S(O) N(C) 2 -C 6 Alkylene), -N(H or C) 1 -C 6 Alkyl)S(O) 2 N (H or C 1 -C 6 Alkyl) 2 , -N(H or C 1 -C 6 Alkyl)S(O) 2 N(C) 2 -C 6 Alkylene), -C(O)-(H or C 1 -C 6 alkyl), -C(O)O(H or C 1 -C 6 alkyl), -C(O)N(C 2 -C 6 alkylene), -P(H or C 1 -C 6 alkyl) 2 , -P(C 2 -C 6 alkylene), -P(O)(H or C 1 -C 6 alkyl) 2 , -P(O)(C 2 -C 6 alkylene), -P(O) 2 (H or C 1 -C 6 alkyl) 2 , -P(O) 2 (C 2 -C 6 alkylene), -P(O)N(H or C 1 -C 6 alkyl) 2 , -P(O)N(C 2 -C 6 alkylene), -P(O) 2 N(H or C 1 -C 6 alkyl) 2 , -P(O) 2 N(C 2 -C 6 alkylene), -P(O)O(H or C 1 -C 6 alkyl), -P(O) 2 O(H or C 1 -C 6 alkyl), -CN, or NO 2 may be substituted by; m is 0, 1, 2, or 3; n is 0, 1, 2, 3, or 4; p is 3, 4, 5, 6, or 7; and q is 0, 1, or 2. The compound indicated by or a pharmaceutically acceptable salt thereof.
2. Formula II: 【Chemistry 2】 [In the formula: 【Transformation 3】 The bond may be either a carbon-carbon single bond or a carbon-carbon double bond, and ring A is a five-membered heteroarylene. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, as shown by [the formula].
3. Formula III: 【Chemistry 4】 [In the formula: X 1 , X 2 , and X 3 These are, independently of each other, -O-, -S-, =C(H)-, and =C(R 1 )-, -N(H)-, -N(R 1 ) - or = N - and ring A is a 5-membered heteroarylene: where X 1 , X 2 , and X 3 At least one of them is =C(H)- or =C(R 1 ) - is a group other than; 【Transformation 5】 This can be either a carbon-carbon single bond or a carbon-carbon double bond. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, as shown by [the formula].
4. Ring A is 【Transformation 6】 A five-member heteroarylene selected from the group consisting of, where each 【Transformation 7】 The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein represents a covalent bonding point.
5. Ring A is 【Transformation 8】 A five-membered heteroarylene selected from the group consisting of, where each 【Chemistry 9】 A compound according to claim 1 or a pharmaceutically acceptable salt thereof, representing a point of covalent bonding.
6. Ring A 【Chemistry 10】 A five-membered heteroarylene selected from the group consisting of, where each 【Chemistry 11】 A compound according to claim 1 or a pharmaceutically acceptable salt thereof, representing a point of covalent bonding.
7. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein ring B is phenylene and n is 0, 1, or 2.
8. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein ring B is phenylene, n is 0 or n is 1, and R2 is methyl, ethyl, F, Cl or Br.
9. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein ring B is a 5- to 10-membered heteroarylene.
10. Ring B 【Chemistry 12】 A five-membered heteroarylene selected from the group consisting of, where each 【Chemistry 13】 A compound according to claim 1 or a pharmaceutically acceptable salt thereof, representing a point of covalent bonding.
11. Ring B 【Chemistry 14】 A five-member heteroarylene selected from the group consisting of, where each 【Chemistry 15】 A compound according to claim 1 or a pharmaceutically acceptable salt thereof, representing a point of covalent bonding.
12. R 3 A compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is H or methyl.
13. R 4 A compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is H or methyl.
14. R 5 A compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is H.
15. Each L independently -C(R 7 ) (Caution 8 )-, -C(O)-, -O-, or -N(R 6 ) - is: however, (L) p is -O-O- or -O-N(R 6 ) - Does not contain bonds, (L) p No-NR 3 The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the points covalently bonded with - do not form -N-N- or -O-N- bonds.
16. -(L) p -が、-(CR 7 R 8 )C(O)N(R 6 )-(CR 7 R 8 ) 2 -、-(CR 7 R 8 )N(R 6 )C(O)-(CR 7 R 8 ) 2 -、-N(R 6 )-C(O)(CR 7 R 8 ) 2 O(CR 7 R 8 ) 2 -、-CR 7 R 8 O(CR 7 R 8 ) 2 O-(CR 7 R 8 ) 2 、-O(CR 7 R 8 ) 2 O(CR 7 R 8 ) 2 -、-CR 7 R 8 O-CR 7 R 8 -C(O)N(R 6 )-(CR 7 R 8 ) 2 -、-(CR 7 R 8 ) 3 O(CR 7 R 8 ) 2 -、-(CR 7 R 8 ) 2 O(CR 7 R 8 ) 3 -、-CR 7 R 8 -N(R 6 )-(CR 7 R 8 ) 2 -、-CR 7 R 8 -N(R 6 ) - (CR 7 R 8 ) 3 -, -O(CR 7 R 8 ) 2 O(CR 7 R 8 ) 3 -, - (CR 7 R 8 ) 2 -N(R) 6 ) - (CR 7 R 8 ) 3 -, - (CR 7 R 8 ) 2 -N(R) 6 ) - (CR 7 R 8 ) 2 -, -O-(CR 7 R 8 ) 2 -, -O-(CR 7 R 8 ) 3 -, or -O-(CR 7 R 8 ) 4 - The compound according to claim 1 or a pharmaceutically acceptable salt thereof.
17. R 6 A compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is H or methyl.
18. Each R 7 and R 8 A compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is H.
19. - (L) p -but, -CH 2 N(H)-(CH 2 ) 2 -ien-CH 2 N(CH 3 )-(CH 2 ) 2 -, -O(CH 2 ) 2 -, -OCH(CH 3 )CH 2 -, -O(CH 2 ) 3 -, -O(CH 2 ) 4 -, and -O(CH 2 ) 2 O(CH 2 ) 2 - The compound according to claim 1 or a pharmaceutically acceptable salt thereof. 【Request Item 20】 【Chemistry 16】 【Chemistry 17】 A compound selected from the group consisting of the following, or a pharmaceutically acceptable salt thereof. 【Request Item 21】 【Chemistry 18】 A compound selected from the group consisting of the following, or a pharmaceutically acceptable salt thereof.
22. A pharmaceutical composition comprising the compound described in any one of claims 1 to 21, and optionally comprising one or more excipients.
23. A composition comprising a compound according to any one of claims 1 to 21, for use in a method for treating a disease in a subject.
24. The composition according to claim 23, wherein the disease is cancer.
25. Use of a compound according to any one of claims 1 to 21 in the manufacture of a pharmaceutical product for treating a disease in a subject.
26. The use according to claim 25, wherein the disease is cancer.