Compositions and Methods for the Targeting of PCSK9
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- SCRIBE THERAPEUTICS INC
- Filing Date
- 2023-06-06
- Publication Date
- 2026-06-12
AI Technical Summary
Current methods for regulating PCSK9 gene expression are inefficient and can cause off-target effects, genomic instability, and oncogenic alterations, necessitating the development of improved gene repressor systems for therapeutic and diagnostic applications.
A repressor fusion protein system comprising a DNA-binding protein, such as a zinc finger (ZF) or CRISPR protein without catalytic activity, linked with a repressor domain, is used to suppress PCSK9 gene expression, delivered via vectors and lipid nanoparticles for targeted transcriptional repression.
The system effectively reduces PCSK9 levels, offering therapeutic benefits for metabolic disorders like familial hypercholesterolemia by minimizing off-target effects and genomic instability.
Abstract
Description
Technical Field
[0001] Cross - Reference to Related Applications This application claims priority and benefit to U.S. Provisional Patent Application No. 63 / 349,981, filed on June 7, 2022; U.S. Provisional Patent Application No. 63 / 492,923, filed on March 29, 2023; and U.S. Provisional Patent Application No. 63 / 505,823, filed on June 2, 2023, the contents of each of which are hereby incorporated by reference in their entirety.
[0002] Reference to Electronic Sequence Listing The contents of the electronic sequence listing (SCRB_055_01WO_SeqList_ST26.xml, size: 4,317,702 bytes, created on June 2, 2023) are hereby incorporated by reference in their entirety.
Background Art
[0003] In mammals, cholesterol is transported within lipoproteins via emulsification. Lipoprotein particles are classified based on their density: low - density lipoprotein (LDL), very - low - density lipoprotein (VLDL), high - density lipoprotein (HDL), and chylomicrons. Surface LDL receptors are internalized during cholesterol uptake. Cells rich in cholesterol block the synthesis of their LDL receptors to prevent the uptake of new cholesterol in LDL particles. Conversely, the synthesis of LDL receptors is promoted when a cell is cholesterol - deficient. If the process is not regulated, excess LDL particles move through the blood without being taken up by LDL receptors. LDL particles in the blood are oxidized and taken up by macrophages, which then become filled and form foam cells. These foam cells are trapped in the walls of blood vessels and can contribute to the formation of atherosclerotic plaques, which are one of the main causes of heart attacks, strokes, and other serious medical problems.
[0004] Hepatic protein proprotein convertase subtilisin / kexin type 9 (PCSK9) is a secreted globular autoactivated serine protease that binds to the low-density lipoprotein receptor (LDL-R) during endocytosis of LDL particles, prevents recycling of the LDL-R to the cell surface, and results in reduced LDL-cholesterol clearance. PCSK9 binds to the LDL-R (via the EGF-A domain), prevents conformational changes in the receptor-ligand complex, and instead redirects the LDL-R to the lysosome. The receptor for low-density lipoprotein particles (LDL) typically transports thousands of fat molecules (including cholesterol) per particle in the extracellular fluid, and thus blocking or inhibiting the function of PCSK9 can promote LDL-R-mediated clearance of LDL cholesterol and thereby reduce LDL particle concentration. PCSK9 is expressed mainly in the liver, intestine, kidney, and central nervous system, but is also highly expressed in the arterial wall, such as in endothelial, smooth muscle cells, and macrophages, and has local effects that can regulate vascular homeostasis and atherosclerosis.
[0005] PCSK9 is a member of the proprotein convertase (PC) family, and its gene mutates in approximately 2% - 3% of individuals with familial hypercholesterolemia (FH) (Sepideh Mikaeeli, S., et al. Functional analysis of natural PCSK9 mutants in modern and archaic humans. FEBS J. 2019 Aug 6. doi:10.1111 / febs.15036). Researchers have identified several PCSK9 mutations that cause the hypercholesterolemic genotype (hypercholesterolemia). These mutations change a single amino acid in the PCSK9 protein. Researchers describe mutations that cause hypercholesterolemia as "gain-of-function" because they appear to enhance the activity of the PCSK9 protein or confer new non-canonical functions to the protein (Blesa, S., et al. A New PCSK9 Gene Promoter Variant Affects Gene Expression and Causes Autosomal Dominant Hypercholesterolemia. J. Clin. Endocrinol. & Metab. 93:3577 (2008)). Hyperactive PCSK9 protein substantially reduces the number of low-density lipoprotein receptors on the surface of hepatocytes. Because there are fewer receptors to remove low-density lipoprotein from the blood, people with gain-of-function mutations in the PCSK9 gene have very high blood cholesterol levels. Autosomal dominant hypercholesterolemia (ADH) is a genetic disorder characterized by increased levels of low-density lipoprotein (LDL) cholesterol and a high risk of early cardiovascular disease. Approximately 10 mutations in PCSK9 have been identified as causative of the disease in different populations. All known mutations in PCSK9 that cause hypercholesterolemia result in increased enzymatic activity of this protease (Bleasa, S., 2008). Additionally, mutations in PCSK9 can result in autosomal dominant familial hypobetalipoproteinemia, which can lead to hepatic steatosis, cirrhosis, and other disorders.
[0006] The emergence of CRISPR / Cas systems and the programmable nature of these minimal systems have facilitated their use as versatile technologies for genome manipulation and engineering. However, current methods for generating PCSK9 protective variants and loss-of-function variants in vivo have been ineffective because they require modification of multiple cells to regulate cholesterol levels. Other concerns include off-target effects, genomic instability, or oncogenic alterations that can be caused by genome editing, and the lack of a safe delivery modality for gene repression systems. Furthermore, in certain disease indications, gene silencing, or repression, is preferred over gene editing. The ability to catalytically inactivate CRISPR nucleases such as Cas9 and CasX has been demonstrated (see International Publication No. WO2020247882A1 and U.S. Patent No. US20200087641A1, incorporated herein by reference), making these systems an attractive platform for the production of fusion proteins with repressor domains capable of gene silencing. While specific repressor systems are described, there is a need for additional gene repressor systems that are optimized and / or provide improvements compared to early-generation gene repressor systems, such as those based on Cas9, for use in various therapeutic, diagnostic, and research applications. Accordingly, there is a need for improved compositions and methods for regulating PCSK9. SUMMARY OF THE INVENTION
[0007] The present disclosure provides a system comprising or encoding a repressor fusion protein comprising a DNA-binding and linked repressor domain for use in suppressing and / or epigenetically modifying a target nucleic acid sequence of the proprotein convertase subtilisin / kexin type 9 (PCSK9) gene. In some cases, the repressor fusion protein comprises a DNA-binding protein comprising a zinc finger (ZF) or transcription activator-like effector (TALE) protein complementary to the PCSK9 gene target nucleic acid sequence and one or more linked repressor domains. In some cases, the repressor fusion protein comprises a DNA-binding protein comprising a CRISPR protein without catalytic activity and one or more linked repressor domains, and a guide nucleic acid comprising a targeting sequence complementary to the PCSK9 gene target nucleic acid sequence. The protein and the guide nucleic acid can be modified for passive entry into target cells and are useful in various methods for the suppression of PCSK9, and these methods are also provided. The present disclosure also provides vectors and lipid nanoparticles (LNPs) encoding or encapsulating the repressor fusion protein and guide nucleic acid components for delivery of the system to cells for transcriptional repression of the PCSK9 target nucleic acid sequence.
[0008] The present disclosure provides a pharmaceutical composition comprising the system, nucleic acid, LNP, and vector described herein.
[0009] The present disclosure also provides a method for treating a subject having a PCSK9-related disease. In some embodiments, the compositions and methods are useful in subjects having a metabolic disorder such as, but not limited to, familial hypercholesterolemia, familial hypobetalipoproteinemia, or elevated cholesterol levels.
[0010] In another aspect, provided herein is a PCRK9 repressor system for use in the manufacture of a medicament for treating a PCSK9-related disease in a subject in need thereof, or a system comprising or encoding a vector comprising the PCSK9 repressor system.
[0011] The present disclosure provides a composition for use in a method of treating a subject having a PCSK9-related disease. In some embodiments, the composition comprises a repressor fusion protein comprising a CRISPR protein without catalytic activity and one or more linked repressor domains, and a guide nucleic acid comprising a targeting sequence complementary to a PCSK9 gene target nucleic acid sequence for use in transcriptional repression of the PCSK9 gene target nucleic acid sequence in a subject. In some embodiments, the composition comprises a system, nucleic acid, LNP, vector, and / or pharmaceutical composition described herein.
[0012] In some embodiments, the PCSK9 gene comprises one or more mutations, for example, an amino acid substitution selected from the group consisting of S127R, D129G, F216L, D374H, and D374Y relative to the sequence of SEQ ID NO: 1823.
[0013] The present disclosure provides a method of suppressing transcription of the PCSK9 gene in a population of cells, the method comprising introducing into the population of cells a system, nucleic acid, LNP, vector, and / or pharmaceutical composition described herein.
[0014] In some embodiments, the CRISPR protein without catalytic activity and the guide nucleic acid for use in a PCSK9 repressor system comprise a CasX variant protein without catalytic activity and / or a CasX variant guide nucleic acid described herein.
[0015] Further features and advantages of certain embodiments of the present disclosure will become more fully apparent from the following description of the embodiments and their drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] The novel features of the present disclosure are set forth in detail in the appended claims. A further understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments in which the principles of the present disclosure are utilized, and to the appended drawings.
[0017]
Figure 1
[0018]
Figure 2
[0019]
Figure 3
[0020]
Figure 4
[0021]
Figure 5
[0022]
Figure 6
[0023]
Figure 7
[0024]
Figure 8
[0025]
Figure 9
[0026]
Figure 10A
[0027]
Figure 10B
[0028]
Figure 11A
[0029]
Figure 11B
[0030]
Figure 11C
[0031]
Figure 12
[0032]
Figure 13
[0033]
Figure 14
[0034]
Figure 15
[0035]
Figure 16A
[0036]
Figure 16B
[0037]
Figure 17
[0038]
Figure 18
[0039]
Figure 19A
[0040]
Figure 19B
[0041]
Figure 19C
[0042]
Figure 20
[0043]
Figure 21A
[0044]
Figure 21B
[0045]
Figure 22A
[0046]
Figure 22B
[0047]
Figure 23
[0048]
Figure 24
[0049]
Figure 25
[0050]
Figure 26
[0051]
Figure 27A
[0052]
Figure 27B
[0053]
Figure 28
[0054]
Figure 29
[0055]
Figure 30
[0056]
Figure 31
[0057]
Figure 32A
[0058]
Figure 32B
[0059]
Figure 33A
[0060]
Figure 33B
[0061]
Figure 34
[0062]
Figure 35
[0063]
Figure 36
[0064]
Figure 37A
[0065]
Figure 37B
[0066]
Figure 38
[0067]
Figure 39
[0068]
Figure 40
[0069]
Figure 41
[0070]
Figure 42
[0071]
Figure 43
[0072]
Figure 44
[0073]
Figure 45
[0074]
Figure 46
[0075]
Figure 47A
[0076]
Figure 47B
[0077]
Figure 47C
[0078]
Figure 48A
[0079]
Figure 48B
[0080]
Figure 48C
[0081]
Figure 49A
[0082]
Figure 49B
[0083]
Figure 49C
[0084]
Figure 50A
[0085]
Figure 50B
[0086]
Figure 51A
[0087]
Figure 51B
[0088]
Figure 52A
[0089]
Figure 52B
[0090]
Figure 53
[0091]
Figure 54
[0092]
Figure 55
[0093]
Figure 56
[0094]
Figure 57A
[0095]
Figure 57B
[0096]
Figure 57C
[0097]
Figure 57D
[0098]
Figure 57E
[0099]
Figure 57F
[0100]
Figure 57G
[0101]
Figure 57H
[0102]
Figure 57I
[0103]
Figure 58A
[0104]
Figure 58B
[0105]
Figure 58C
[0106]
Figure 58D
[0107]
Figure 58E
[0108]
Figure 59
[0109]
Figure 60
[0110]
Figure 61
[0111]
Figure 62
[0112]
Figure 63
[0113]
Figure 64
[0114]
Figure 65A
[0115]
Figure 65B
[0116]
Figure 66A
[0117]
Figure 66B
[0118]
Figure 67A
[0119]
Figure 67B
[0120]
Figure 68
[0121]
Figure 69A
[0122]
Figure 69B
[0123]
Figure 69C
[0124]
Figure 70A
[0125]
Figure 70B
[0126]
Figure 70C
Mode for Carrying Out the Invention
[0127] Exemplary embodiments are shown and described herein, but it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Without departing from the invention claimed herein, numerous variations, modifications, and substitutions will occur to those skilled in the art. It should be understood that various alternatives to the embodiments described herein may be employed in practicing the embodiments of the present disclosure. The claims define the scope of the invention, and methods and structures within the scope of these claims and their equivalents are intended to be covered.
[0128] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this embodiment, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Without departing from the present invention, numerous variations, modifications, and substitutions will occur to those skilled in the art here.
[0129] Definitions "Hybridizable" or "complementary" are used interchangeably to mean that a nucleic acid (e.g., RNA, DNA) contains a sequence of nucleotides that non-covalently binds to another nucleic acid in a sequence-specific and antiparallel manner (i.e., the nucleic acid specifically binds to a complementary nucleic acid) under appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength, i.e., forms Watson-Crick base pairs and / or G / U base pairs, or is able to "anneal" or "hybridize". The sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid in order to be specifically hybridizable and can have at least about 70%, at least about 80%, or at least about 90%, or at least about 95% sequence identity and still be able to hybridize to the target nucleic acid. Further, a polynucleotide can hybridize over one or more segments such that intervening or adjacent segments do not participate in the hybridization event (e.g., loop structures or hairpin structures, "bulges", "bubbles", etc.). Thus, one of skill in the art will understand that individual bases within a sequence may not be complementary to another sequence, but the sequence as a whole is still considered complementary overall.
[0130] For the purposes of the present disclosure, "gene" includes a DNA region encoding a gene product (e.g., protein, RNA), as well as all DNA regions that regulate the production of the gene product, regardless of whether such regulatory sequences are adjacent to the coding and / or transcriptional sequences. Thus, a gene can include, but is not limited to, regulatory sequences for translation such as promoter sequences, terminators, ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions, and can include associated element sequences. The coding sequence encodes a gene product upon transcription or transcription and translation, and the coding sequences of the present disclosure can include fragments and need not contain a full-length open reading frame. A gene can include both the transcribed strand and the complementary strand containing the anticodon.
[0131] The term "downstream" refers to a nucleotide sequence located 3' to a reference nucleotide sequence. In certain embodiments, the downstream nucleotide sequence relates to the sequence following the start point of transcription. For example, the translation start codon of a gene is located downstream of the transcription start site.
[0132] The term "upstream" refers to a nucleotide sequence located 5' to a reference nucleotide sequence. In certain embodiments, the upstream nucleotide sequence relates to the sequence located 5' of the coding region or the transcription start point. For example, most promoters are located upstream of the transcription start site.
[0133] With respect to a polynucleotide or amino acid sequence, the term "adjacent" refers to sequences that are next to each other or adjacent to each other within a polynucleotide or polypeptide. One of ordinary skill in the art will understand that two sequences are considered adjacent and may still include a limited amount of intervening sequence, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides or amino acids.
[0134] The term "regulatory element" is used interchangeably herein with the term "regulatory sequence" and is intended to include promoters, enhancers, and other expression regulatory elements. It will be understood that the selection of appropriate regulatory elements depends on whether the expressed encoded component (e.g., protein or RNA) or nucleic acid requires a different polymerase or includes multiple components not intended to be expressed as a fusion protein.
[0135] The term "accompanying element" is used interchangeably in this specification with the term "accompanying sequence" and is intended to include, inter alia, a polyadenylation signal (poly(A) signal), enhancer element, intron, post-transcriptional regulatory element (PTRE), nuclear localization signal (NLS), deaminase, DNA glycosylase inhibitor, additional promoter, factor that stimulates CRISPR-mediated homology-directed repair (e.g., in cis or in trans), self-cleaving sequence, and fusion domain, e.g., a fusion domain fused to a CRISPR protein. It will be understood that the selection of one or more appropriate accompanying elements depends on whether the expressed encoded component (e.g., protein or RNA), or nucleic acid, requires different polymerases or includes multiple components not intended to be expressed as a fusion protein.
[0136] The term "promoter" refers to a DNA sequence that includes a transcription start site and additional sequences for promoting polymerase binding and transcription. Exemplary eukaryotic promoters include elements such as the TATA box and / or the B recognition element (BRE), and assist or facilitate the transcription and expression of related transcribable polynucleotide sequences and / or genes (or transgenes). A promoter can be produced synthetically or can be derived from a known or naturally occurring promoter sequence, or another promoter sequence. A promoter can also include a chimeric promoter that includes a combination of two or more heterologous sequences for imparting specific properties. The promoters of the present disclosure can include variants of promoter sequences that are known or have a similar composition but are not identical to other promoters provided herein. Promoters can be classified according to criteria that result in a pattern of expression of related coding or transcribable sequences or genes operably linked to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc. Promoters can also be classified according to their strength. When used in the context of a promoter, "strength" refers to the transcription rate of the gene controlled by the promoter. A "strong" promoter means a high transcription rate, while a "weak" promoter means a relatively low transcription rate.
[0137] The promoter of the present disclosure can be a polymerase II (Pol II) promoter. Polymerase II transcribes all protein-coding genes and many non-coding genes. A representative Pol II promoter is a sequence of about 100 base pairs surrounding the transcription start site and includes a core promoter that serves as a binding platform for Pol II polymerase and related basal transcription factors. The promoter can contain one or more core promoter elements such as the TATA box, BRE, initiator (INR), motif 10 element (MTE), downstream core promoter element (DPE), downstream core element (DCE), etc., but core promoters lacking these elements are known in the art. All Pol II promoters are contemplated within the scope of the present disclosure.
[0138] The promoter of the present disclosure can be a polymerase III (Pol III) promoter. Pol III transcribes DNA to synthesize small ribosomal RNAs such as 5S rRNA, tRNA, and other small RNAs. Representative Pol III promoters use internal control sequences (sequences within the transcribed portion of the gene) to support transcription, although upstream elements such as the TATA box may also be used. All Pol III promoters are contemplated within the scope of the present disclosure.
[0139] The term "enhancer" refers to a regulatory DNA sequence that, when bound by specific proteins called transcription factors, regulates the expression of the associated gene. Enhancers can be located in the introns of a gene, or in the 5' or 3' of the coding sequence of a gene. Enhancers can be located proximal to the gene (i.e., within dozens or hundreds of base pairs (bp) of the promoter) or distal to the gene (i.e., thousands, tens of thousands, or even millions of bp away from the promoter). A single gene may be regulated by two or more enhancers, all of which are contemplated within the scope of the present disclosure.
[0140] As used herein, a "post-transcriptional regulatory element (PTRE, or TRE)", such as a hepatitis PTRE, refers to a DNA sequence that, when transcribed, generates a tertiary structure capable of exhibiting post-transcriptional activity to enhance or promote the expression of an associated gene operably linked thereto.
[0141] In the context of the present disclosure and with respect to a gene, "suppress", "suppression", "suppressing", "inhibition of gene expression", "downregulation", and "silencing" are used interchangeably herein to refer to the inhibition or blocking of transcription of a gene or a portion thereof. Thus, suppression of a gene can result in a decrease in the production of the gene product. Examples of gene suppression processes that reduce transcription include, but are not limited to, those that inhibit the formation of the transcription initiation complex, reduce the transcription initiation rate, reduce the transcription elongation rate, reduce the processivity of transcription, and antagonize transcription activation (e.g., by blocking the binding of a transcription activator). Gene suppression can constitute, for example, prevention of activation and inhibition of expression below existing levels. Transcriptional suppression includes both reversible and irreversible inactivation of gene transcription, the latter of which can result from epigenetic modification of the gene.
[0142] "Repressor" or "repressor domain" are used interchangeably and refer to polypeptide factors that act as regulatory elements of DNA that inhibit, suppress, or block the transcription of DNA, resulting in the suppression of gene expression. In the context of the present disclosure, the linkage of a repressor domain to a DNA-binding protein that can prevent transcription from a promoter or inhibit the expression of a gene when bound to a target nucleic acid. While not wishing to be bound by theory, transcriptional repressors can function by various mechanisms including physically blocking the passage of RNA polymerase by steric hindrance, changing the post-translational modification state of the polymerase, modifying the epigenetic state of nascent RNA, changing the epigenetic state of DNA through methylation, changing the epigenetic state of DNA through histone deacetylation, or regulating nucleosome remodeling, or preventing enhancer-promoter interactions, thereby resulting in gene silencing or a reduction in gene expression levels.
[0143] "Long-term repressor protein" or "LTRP" is used interchangeably herein with "repressor fusion protein" and refers to a fusion protein comprising a DNA-binding protein (or the DNA-binding domain of a protein) fused to one or more domains capable of suppressing the transcription of a target nucleic acid sequence. Optionally, the repressor fusion proteins of the present disclosure may include additional elements such as linkers between any domains of the fusion protein, nuclear localization signals, nuclear export signals, and additional protein domains that confer additional activity to the repressor fusion protein.
[0144] As used herein, the "repressor fusion protein:gRNA system" is a system for transcriptional repression, comprising a repressor fusion protein that includes a CRISPR protein without catalytic activity and one or more linked repressor domains, and a guide nucleic acid (gRNA) that binds to the CRISPR protein without catalytic activity. For clarity, the system also includes any coding DNA, RNA, vector, etc. that can be used to produce the repressor fusion protein and gRNA components of the system.
[0145] As used herein, a DNA-binding protein refers to a protein or protein domain that can bind to DNA. Exemplary DNA-binding proteins include zinc finger (ZF) proteins, TALEs, and CRISPR proteins. One of ordinary skill in the art will understand that in a multifunctional protein such as a CRISPR protein that can both bind to DNA and perform another activity such as DNA cleavage, the DNA-binding function can be separated from the other functions of the protein to yield a DNA-binding protein without catalytic activity.
[0146] As used herein, a "CRISPR protein without catalytic activity" refers to a CRISPR protein lacking endonuclease activity. One of ordinary skill in the art will understand that a CRISPR protein may lack catalytic activity but can still perform additional protein functions such as DNA binding. Similarly, "CasX without catalytic activity" refers to a CasX protein that lacks endonuclease activity but can still perform additional protein functions such as DNA binding.
[0147] As used herein, "recombinant" means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, and / or ligation steps, resulting in a construct having a structural coding or non-coding sequence distinguishable from the endogenous nucleic acid found in the natural system. Generally, a DNA sequence encoding a structural coding sequence can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid capable of expressing from a recombinant transcription unit contained in a cell or cell-free transcription and translation system. Such sequences can typically be provided in the form of an open reading frame not interrupted by internal non-translated sequences or introns typically present in eukaryotic genes. Genomic DNA containing related sequences can also be used in the formation of recombinant genes or transcription units. Sequences of non-translated DNA can be present 5' or 3' to the open reading frame, and such sequences do not interfere with the manipulation or expression of the coding region and, in fact, can act to regulate the production of the desired product by various mechanisms (see "enhancers" and "promoters" above).
[0148] The term "recombinant polynucleotide" or "recombinant nucleic acid" refers to something that does not occur naturally, e.g., something made by the artificial combination of two originally separated amino acid sequence segments by human intervention. This artificial combination is often achieved either by chemical synthetic means or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace codons with redundant codons encoding the same or conserved amino acids, often while introducing or removing sequence recognition sites. Alternatively, this is carried out by joining together nucleic acid segments of desired function to generate the desired combination of functions. This artificial combination is often achieved either by chemical synthetic means or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
[0149] Similarly, the terms "recombinant polypeptide" or "recombinant protein" refer to polypeptides or proteins that do not occur naturally and are made, for example, by the artificial combination of two originally separated amino acid sequence segments through human intervention. Thus, for example, a protein containing a heterologous amino acid sequence is recombinant.
[0150] As used herein, "lipoproteins" such as VLDL, LDL, and HDL refer to a population of proteins found in serum, plasma, and lymph and important for lipid transport. The chemical composition of each lipoprotein differs, for example, in that HDL has a higher protein-to-lipid ratio while VLDL has a lower protein-to-lipid ratio.
[0151] As used herein, "atherosclerosis" means the hardening of arteries that affects large and medium-sized arteries and is characterized by the presence of fatty deposits. The fatty deposits consist mainly of cholesterol and other fats, calcium, and scar tissue and are called "atheromas" or "plaques" that damage the inner layer of the artery.
[0152] As used herein, "coronary heart disease (CHD)" means the narrowing of the small blood vessels that supply blood and oxygen to the heart, which is often the result of atherosclerosis.
[0153] As used herein, "dyslipidemia" refers to disorders of lipid and / or lipoprotein metabolism that include overproduction or deficiency of lipids and / or lipoproteins. Dyslipidemia can manifest as elevated levels of lipids such as chylomicrons, cholesterol, and triglycerides, as well as elevated levels of lipoproteins such as low-density lipoprotein (LDL) cholesterol.
[0154] As used herein, "high density lipoprotein cholesterol" or "HDL-C" means cholesterol associated with high density lipoprotein particles. The concentration of HDL-C in serum (or plasma) is typically quantified in mg / dL or nmol / L. "Serum HDL-C" and "plasma HDL-C" mean HDL-C in serum and plasma, respectively.
[0155] As used herein, "low density lipoprotein cholesterol (LDL-C)" means cholesterol carried in low density lipoprotein particles. The concentration of LDL-C in serum (or plasma) is typically quantified in mg / dL or nmol / L. "Serum LDL-C" and "plasma LDL-C" mean LDL-C in serum and plasma, respectively.
[0156] As used herein, "hypercholesterolemia" means a condition characterized by an elevation of cholesterol or circulating (plasma) cholesterol, LDL cholesterol, and VLDL cholesterol according to the guidelines of the Expert Panel Report on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III) of the National Cholesterol Education Program (NCEP) (see Arch. Int. Med. 148: 36 (1988)).
[0157] As used herein, "dyslipidemia" or "hyperlipidemia" is a condition characterized by an elevation of serum lipids or circulating (plasma) lipids. This condition shows abnormally high concentrations of fat. The lipid fraction in circulating blood is cholesterol, low density lipoprotein, very low density lipoprotein, chylomicrons, and triglycerides. The Fredrickson classification of dyslipidemia is based on the pattern of triglyceride- and cholesterol-rich lipoprotein particles measured by electrophoresis or ultracentrifugation and is commonly used to characterize the main causes of dyslipidemia such as hypertriglyceridemia.
[0158] As used herein, "triglyceride" or "TG" means a lipid or neutral fat consisting of glycerol combined with three fatty acid molecules.
[0159] As used herein, "hypertriglyceridemia" means a condition characterized by elevated triglyceride levels. Its etiology includes primary (i.e., genetic causes) and secondary (other underlying causes such as diabetes, metabolic syndrome / insulin resistance, obesity, physical inactivity, cigarette smoking, excessive alcohol, and a very high carbohydrate diet), or most frequently, a combination of both.
[0160] As used herein, "true diabetes" or "diabetes" is a syndrome characterized by abnormally high blood sugar (hyperglycemia) resulting from a metabolic disorder and insufficient levels of insulin or reduced insulin sensitivity. Characteristic symptoms are excessive urine production (polyuria) due to high blood sugar levels, excessive thirst and increased fluid intake (polydipsia) to compensate for increased urination, blurred vision due to the hyperglycemic effect on the optical system of the eye, unexplained weight loss, and lethargy.
[0161] As used herein, "diabetic dyslipidemia" or "type 2 diabetes with dyslipidemia" means a condition characterized by type 2 diabetes, reduced HDL-C, elevated triglycerides (TG), and increased small, dense LDL particles.
[0162] As used herein, "lipid nanoparticle" refers to a particle having at least one dimension on the order of nanometers (e.g., 1 to 1,000 nm) and comprising one or more lipids (e.g., cationic lipids, non-cationic lipids, and PEGylated lipids). In some embodiments, the lipid nanoparticle is included in a formulation that can be used to deliver an active agent or therapeutic agent, such as a nucleic acid (e.g., mRNA), to a target site of interest (e.g., a cell, tissue, organ, tumor, etc.). In some embodiments, the lipid nanoparticles of the present disclosure contain nucleic acids. Such lipid nanoparticles typically include neutral lipids, charged lipids, steroids, and polymer-conjugated lipids. In some embodiments, an active agent or therapeutic agent, such as a nucleic acid, may be encapsulated in the lipid moiety of the lipid nanoparticle, or in an aqueous space surrounded by some or all of the lipid moiety of the lipid nanoparticle, thereby protecting it from enzymatic degradation or other undesirable effects induced by the mechanisms of the host organism or cell, such as a harmful immune response.
[0163] As used herein, "lipid encapsulation" refers to a lipid nanoparticle that provides an active agent or therapeutic agent, such as a nucleic acid (e.g., mRNA), with complete encapsulation, partial encapsulation, or both. In one embodiment, the nucleic acid (e.g., mRNA) is completely encapsulated within the lipid nanoparticle.
[0164] As used herein, the term "contacting" means establishing a physical connection between two or more entities. For example, contacting a target nucleic acid with a guide nucleic acid means allowing the target nucleic acid and the guide nucleic acid to share a physical connection, e.g., to be able to hybridize if the sequences share sequence similarity.
[0165] "Dissociation constant" or "K d " are used interchangeably and refer to the affinity between a ligand "L" and a protein "P", i.e., how tightly the ligand binds to a particular protein. This is given by the equation K dIt can be calculated using = [L][P] / [LP], where [P], [L], and [LP] represent the molar concentrations of protein, ligand, and complex, respectively.
[0166] The present disclosure provides compositions and methods useful for modifying a target nucleic acid. As used herein, the terms “editing,” “modifying,” and “modification” are used interchangeably and include, but are not limited to, cleavage, nicking, editing, deletion, knock-in, knock-out, etc. Modification can also include, but is not limited to, epigenetic modifications to nucleic acids, or chromatin containing nucleic acids, such as DNA methylation, and changes in histone methylation and acetylation.
[0167] “Cleavage” means the breakage of the covalent backbone of a target nucleic acid molecule (e.g., RNA, DNA). Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-strand and double-strand cleavages are possible, and double-strand cleavage can result from two separate single-strand cleavage events.
[0168] As used herein, the term “knockdown” refers to the reduction of the expression of a gene or its gene product. As a result of gene knockdown, protein activity or function may be diminished, or protein levels may be reduced or eliminated.
[0169] A polynucleotide or polypeptide has a certain percentage of "sequence similarity" or "sequence identity" with another polynucleotide or polypeptide, which means that when aligned, the percentage of bases or amino acids is the same and they are at the same relative positions when the two sequences are compared. Sequence similarity (sometimes referred to as similarity rate, identity rate, or homology) can be determined in several different ways. To determine sequence similarity, the sequences can be aligned using methods and computer programs known in the art, including BLAST, which is available on the World Wide Web at ncbi.nlm.nih.gov / BLAST. The percentage of complementarity between specific stretches of nucleic acid sequences within a nucleic acid can be determined using any convenient method. Exemplary methods include using the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program (Altschul et al., J. Mol. Biol., 1990, 215, 403-410, Zhang and Madden, Genome Res., 1997, 7, 649-656), or the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), for example, using the default settings that use the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).
[0170] The terms "polypeptide" and "protein" are used interchangeably herein and refer to a polymeric form of amino acids of any length that can include encoded and non-encoded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having a modified peptide backbone. The term includes fusion proteins, including but not limited to fusion proteins having heterologous amino acid sequences.
[0171] A "vector" or "expression vector" is a replicon, such as a plasmid, phage, virus, or cosmid, to which another DNA segment, i.e., an expression cassette, can be attached so as to cause replication or expression of the attached segment in a cell.
[0172] As used herein, the terms "naturally occurring", "unmodified", or "wild-type" when applied to a nucleic acid, polypeptide, cell, or organism refer to a nucleic acid, polypeptide, cell, or organism found in nature.
[0173] As used herein, "mutation" refers to an insertion, deletion, substitution, duplication, or inversion of one or more amino acids or nucleotides as compared to a wild-type or reference amino acid sequence, or a wild-type or reference nucleotide sequence.
[0174] As used herein, the term "isolated" is intended to describe a polynucleotide, polypeptide, or cell that is in an environment different from that in which it naturally occurs. An isolated recombinant host cell can be present in a mixed population of recombinant host cells.
[0175] "Host cell" as used herein means a cell derived from a eukaryotic cell, prokaryotic cell, or multicellular organism (e.g., cell line) cultured as a single cell entity, wherein the eukaryotic or prokaryotic cell is used as a recipient for a nucleic acid (e.g., AAV vector) and includes progeny of the original cell that have been genetically modified by the nucleic acid. Progeny of a single cell may not necessarily be identical to the original parent in morphology or in genomic or total DNA complement due to natural, accidental, or intentional mutations. A "recombinant host cell" (also referred to as a "genetically recombinant host cell") is a host cell into which a heterologous nucleic acid, e.g., an AAV vector, has been introduced.
[0176] The term "conservative amino acid substitution" refers to the interchangeability in proteins of amino acid residues having similar side chains. For example, the group of amino acids having aliphatic side chains consists of glycine, alanine, valine, leucine, and isoleucine; the group of amino acids having aliphatic-hydroxyl side chains consists of serine and threonine; the group of amino acids having amide-containing side chains consists of asparagine and glutamine; the group of amino acids having aromatic side chains consists of phenylalanine, tyrosine, and tryptophan; the group of amino acids having basic side chains consists of lysine, arginine, and histidine; and the group of amino acids having sulfur-containing side chains consists of cysteine and methionine. Exemplary conservative amino acid substituents are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine.
[0177] As used herein, "treatment" or "treating" are used interchangeably herein and refer to an approach for obtaining a beneficial or desired result, including and not limited to therapeutic and / or prophylactic benefits. Therapeutic benefit means eradication or amelioration of the underlying disorder or disease being treated. Therapeutic benefit can also be achieved by eradication or amelioration of one or more symptoms, or improvement of one or more clinical parameters associated with the underlying disorder, such that improvement is observed in the subject, even if the subject still suffers from the underlying disorder.
[0178] As used herein, the terms "therapeutically effective amount" and "therapeutically effective dose" refer to an amount of a drug or biologic agent, alone or as part of a composition, which when administered to a subject, such as a human or experimental animal, in a single or repeated dose, is capable of producing any detectable and beneficial effect on a disease state or any symptom, aspect, measured parameter, or characteristic thereof. Such an effect need not be absolute in order to be beneficial.
[0179] As used herein, "administering" means a method of providing a subject with a dosage of a compound (e.g., a composition of the present disclosure) or a composition (e.g., a pharmaceutical composition).
[0180] A "subject" is a mammal. Mammals include, but are not limited to, domestic animals, non-human primates, humans, dogs, rabbits, mice, rats, and other rodents.
[0181] The term "low density lipoprotein (LDL)" refers to one of five major groups of lipoproteins ranging from the lowest density (low weight-to-volume ratio particles) to the highest density (large weight-to-volume ratio particles): chylomicrons, very low density lipoprotein (VLDL), low density lipoprotein (LDL), intermediate density lipoprotein (IDL), and high density lipoprotein (HDL). Lipoproteins transport lipids (fats) throughout the body in extracellular fluid, thereby facilitating the transfer of fats to the cell body via receptor-mediated endocytosis. LDL particles are approximately 220 - 275 angstroms in diameter.
[0182] The "low density lipoprotein (LDL) receptor" refers to an 839 amino acid receptor protein (after removal of the 21 amino acid signal peptide) that mediates the endocytosis of cholesterol-rich LDL particles. It is a cell surface receptor that recognizes the apolipoprotein B100 and apoE proteins found in chylomicron remnants and VLDL remnants (IDL), resulting in the binding and endocytosis of LDL-cholesterol. This process occurs in all nucleated cells, but mainly in the liver, which removes approximately 70% of LDL from the circulation. The human LDLR gene is partially described in the NCBI database (ncbi.nlm.nih.gov) as reference sequence NG_009060.1, which is incorporated herein by reference.
[0183] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. The contents of International Patent Publication No. WO 2020 / 247882, filed on June 5, 2020, International Patent Publication No. WO 2020 / 247883, filed on June 5, 2020, International Patent Publication No. WO 2021 / 050593, filed on September 9, 2020, International Patent Publication No. WO 2021 / 050601, filed on September 9, 2021, International Patent Publication No. WO 2021 / 142342, filed on January 8, 2021, International Patent Publication No. WO 2021 / 113763, filed on December 4, 2020, International Patent Publication No. WO 2021 / 113769, filed on December 4, 2020, International Patent Publication No. WO 2021 / 113772, filed on December 4, 2020, International Patent Publication No. WO 2021 / 188729, filed on December 4, 2020, International Patent Publication No. WO 2022 / 120095, filed on December 2, 2021, International Patent Publication No. WO 2022 / 120094, filed on December 2, 2021, International Patent Publication No. WO 2022 / 125843, filed on December 9, 2021, International Patent Publication No. WO 2022 / 120089, filed on December 2, 2021, International Patent Publication No. WO 2022 / 261150, filed on June 7, 2022, International Patent Publication No. WO 2023 / 049742, filed on September 21, 2022, International Patent Publication No. WO 2022 / 261149, filed on June 7, 2022, and International Application PCT / US2023 / 067791, filed on June 1, 2023, are hereby incorporated by reference in their entirety.
[0184] I. General Methods The practice of the present invention, unless otherwise indicated, employs conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, which are described in Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001), Short Protocols in Molecular Biology, 4 th Ed. (Ausubel et al. eds., John Wiley & Sons 1999), Protein Methods (Bollag et al., John Wiley & Sons 1996), Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999), Viral Vectors (Kaplift & Loewy eds., Academic Press 1995), Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997), and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), and the disclosures of which are incorporated herein by reference.
[0185] When ranges of values are provided, endpoints are included, and between the upper and lower limits of the range, and between any other stated value or intervening value within the stated range, each intervening value to one tenth of the unit of the lower limit is understood to be included, unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and also are included subject to any specifically excluded limits within the stated range. When the stated range includes one or both of the limits, ranges excluding either one or both of those included limits also are included.
[0186] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated herein by reference for the purpose of disclosing and describing the methods and / or materials related to which the publications are cited.
[0187] As used in this specification and the appended claims, it should be noted that the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise.
[0188] For clarity, it will be understood that certain features of the present disclosure described in the context of separate embodiments may be provided in combination in a single embodiment. In other instances, various features of the present disclosure described in the context of a single embodiment may also be provided separately or in any suitable sub-combination. All combinations of embodiments of the present disclosure are specifically encompassed by the present disclosure and are intended to be disclosed herein in the same manner as if each and every combination was individually and explicitly disclosed. Additionally, all sub-combinations of the various embodiments and their elements are also specifically encompassed by the present disclosure and are intended to be disclosed herein in the same manner as if each and every such sub-combination was individually and explicitly disclosed herein.
[0189] II. System for Epigenetic Modification and Suppression of the PCSK9 Gene In a first aspect, the present disclosure provides a system comprising or encoding a fusion protein comprising a DNA-binding protein and a linked repressor domain capable of binding to a target nucleic acid sequence of the PCSK9 gene that targets transcriptional repression, silencing, and / or epigenetic modification (collectively, a long-term repressor protein, referred to herein as "LTRP" or "LTRP fusion protein" or "repressor fusion protein", reflecting the long-term inhibitory effect achievable on a target gene). As used herein, "system" is used interchangeably with "composition". The present disclosure also provides a nucleic acid encoding the system provided herein. Also provided herein are methods of making the system, as well as methods of using the system including methods of gene repression and / or epigenetic modification and methods of treating PCSK9-related diseases.
[0190] In some embodiments, the DNA-binding protein comprises a zinc finger (ZF) or TALE (transcription activator-like effector) protein, or its DNA-binding domain that binds but does not cleave the target nucleic acid, also referred to herein as a DNA-binding protein. The DNA-binding domain of TALE consists of an array of customizable monomers that are 33-34 amino acids (aa) in length and can be assembled to recognize any gene sequence according to a recognition code in which one repeat binds to one base pair (see Jain, S., et al. TALE outperforms Cas9 in editing heterochromatin target sites. Nat. Commun. 12:606 (2021)). The specificity of TALE for binding to DNA arises from two polymorphic amino acids, so-called repeat variable diresidues (RVDs), which are located at positions 12 and 13 of the repeat unit. By rearranging the repeats, the DNA-binding specificity of TALE can be arbitrarily changed. Zinc finger proteins are transcription factors, and each finger recognizes 3-4 bases of DNA. By mixing and matching these finger modules, ZF can be customized for the target sequence. Exemplary ZFs that can bind to the PCSK9 gene are described in International Publication No. WO 2018 / 049009A2.
[0191] In some embodiments, the DNA-binding protein is a class 1 or class 2 CRISPR protein without catalytic activity. CRISPR proteins without catalytic activity are also referred to in the art as "catalytically inactive" CRISPR proteins. In some embodiments, the class 2, type II protein is Cas9 without catalytic activity. In other embodiments, the class 2 CRISPR protein is selected from the group consisting of type II, type V, or type VI proteins. In one embodiment, the class 2, type V protein is selected from the group consisting of Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12k, Cas14, and / or CasΦ, and in each case has lost catalytic activity due to specific mutations as described herein. In some embodiments, the CasX protein is a CasX mutant without catalytic activity (dCasX), and CasX comprises a sequence selected from the group consisting of SEQ ID NOs: 4-29, or a sequence having at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto, and the fusion protein comprising dCasX retains the ability to form gRNA and RNP. In some embodiments, dCasX comprises a sequence selected from the group consisting of SEQ ID NOs: 4-29. In some embodiments, dCasX comprises a sequence selected from the group consisting of SEQ ID NOs: 3281-3441 and comprises an RuvC domain having one or more mutations that inactivate the cleavage activity of the RuvC domain, thereby rendering the CasX protein catalytically inactive. In certain embodiments, dCasX comprises the sequence of SEQ ID NO: 4.
[0192] The CRISPR system further includes a guide nucleic acid (gNA), for example, a guide ribonucleic acid (gRNA) having a targeting sequence complementary to the target sequence of a gene. When the CRISPR system (CRISPR protein and linked repressor domain) and the gRNA bind to the target sequence, the transcription of the gene is suppressed.
[0193] The present disclosure provides a system for transcriptional repression of the PCSK9 gene. In some embodiments, the system includes a repressor fusion protein comprising a CasX protein without catalytic activity and a linked repressor domain, and a guide ribonucleic acid (gRNA) comprising a targeting sequence complementary to the target nucleic acid sequence of the PCSK9 gene that targets repression, silencing, or downregulation (repressor fusion protein: gRNA system). In some embodiments, the system includes a nucleic acid encoding a repressor fusion protein, such as dCasX and a linked repressor domain, and a gRNA. In some embodiments, the system includes a repressor fusion protein and a gRNA as a gene repressor pair that can form a ribonucleoprotein (RNP) complex and bind to the PCSK9 target nucleic acid in eukaryotic cells. In other cases, the present disclosure provides a system of a nucleic acid encoding a repressor fusion protein and a gRNA, or a gRNA and an mRNA encoding a repressor fusion protein for use in the specific particle formulations (e.g., LNPs) described herein.
[0194] Also provided herein are methods of making a repressor fusion protein and a gRNA, and methods of using the repressor fusion protein: gRNA system, including gene repression and / or epigenetic modification, and therapeutic methods. The DNA-binding protein (e.g., dCasX) and the linked repressor domain and the gRNA components of the system and their characteristics, as well as the modes of delivery and the method of using the system for repression, downregulation, or silencing of the PCSK9 gene, are described more fully below.
[0195] The present disclosure provides a system specifically designed to suppress or silence the transcription of the PCSK9 gene. In some cases, the system is designed to suppress the transcription of the PCSK9 gene in eukaryotic cells having a gain-of-function mutation. In some cases, the system is designed to suppress the transcription of the wild-type PCSK9 gene in eukaryotic cells. Alternatively, the system is designed to suppress the transcription of a mutant allele of the PCSK9 gene in eukaryotic cells. Generally, any portion of the PCSK9 gene can be targeted using the programmable systems and methods provided herein, which are more fully described herein.
[0196] The PCSK9 gene encodes the proprotein convertase subtilisin / kexin type 9 (「PCSK9」), a protein that binds to the receptor for low-density lipoprotein particles (LDL) for the transport of LDL into cells. The PCSK9 gene encompasses a sequence spanning chr1:55,039,476 - 55,064,853 of the human genome (GRCh38 / hg38) (the notation refers to chromosome 1 (chr1), starting at 55,039,476 bp and ending at 55,064,853 bp on chromosome 1 (Homo sapiens Updated Annotation Release 109.20190905, GRCh38.p13) (NCBI)). The human PCSK9 gene is partially described in the NCBI database (ncbi.nlm.nih.gov) as reference sequence NG_009061.1, which is incorporated herein by reference. The PCSK9 locus has 12 exons that produce a 3636-bp mRNA encoding a 692-amino acid protein, which, after synthesis, undergoes an autocatalytic cleavage reaction that cleaves the prodomain, resulting in an activated protein with 540 amino acids. The prodomain remains attached to the catalytic domain and the resistin-like domain, which is likely because the prodomain functions as a chaperone to facilitate folding and secretion (Seidah, NG et al., Proc Natl Acad Sci USA 100(3):928(2003)). Secreted convertase proprotein neuroapoptosis regulatory convertase 1 (NARC-1): liver regeneration and neural differentiation (Seidah NG, et al.). This protein, also called neuroapoptosis regulatory convertase, is a serine protease belonging to the subtilase family of protease K.
[0197] The human PCSK9 gene (HGNC:20001) is It encodes a protein (Q8NBP7) having the sequence of MGTVSSRRSWWPLPLLLLLLLLLGPAGARAQEDEDGDYEELVLALRSEEDGLAEAPEHGTTATFHRCAKDPWRLPGTYVVVLKEETHLSQSERTARRLQAQAARRGYLTKILHVFHGLLPGFLVKMSGDLLELALKLPHVDYIEEDSSVFAQSIPWNLERITPPRYRADEYQPPDGGSLVEVYLLDTSIQSDHREIEGRVMVTDFENVPEEDGTRFHRQASKCDSHGTHLAGVVSGRDAGVAKGASMRSLRVLNCQGKGTVSGTLIGLEFIRKSQLVQPVGPLVVLLPLAGGYSRVLNAACQRLARAGVVLVTAAGNFRDDACLYSPASAPEVITVGATNAQDQPVTLGTLGTNFGRCVDLFAPGEDIIGASSDCSTCFVSQSGTSQAAAHVAGIAAMMLSAEPELTLAELRQRLIHFSAKDVINEAWFPEDQRVLTPNLVAALPPSTHGAGWQLFCRTVWSAHSGPTRMATAVARCAPDEELLSCSSFSRSGKRRGERMEAQGGKLVCRAHNAFGGEGVYAIARCCLLPQANCSVHTAPPAEASMGTRVHCHQQGHVLTGCSSHWEVEDLGTHKPPVLRPRGQPNQCVGHREASIHASCCHAPGLECKVKEHGIPAPQEQVTVACEEGWTLTGCSALPGTSHVLGAYAVDNTCVVRSRDVSTTGSTSEGAVTAVAICCRSRHLAQASQELQ (SEQ ID NO: 1823).
[0198] III. Proteins without catalytic activity for use in a repressor system In some embodiments, the DNA-binding protein for use in the fusion proteins, systems, and methods of the present disclosure is a zinc finger (ZF) or TALE (transcription activator-like effector) protein that can bind to, but not cleave, a PCSK9 target nucleic acid.
[0199] In some embodiments, the DNA binding protein is a Class 1 or Class 2 CRISPR protein without catalytic activity. In one embodiment, the Class 2, Type II protein is Cas9 without catalytic activity. In another embodiment, the Class 2 CRISPR protein is selected from the group consisting of Type II, Type V, or Type VI proteins. In one embodiment, the Class 2 CRISPR Type V protein is selected from the group consisting of Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12k, Cas14, and / or CasΦ, and in each case has lost catalytic activity due to specific mutations as described herein. In some embodiments, the CasX protein is a CasX variant without catalytic activity (dCasX).
[0200] As used herein, the term "CasX protein" refers to a family of proteins and includes all naturally occurring CasX proteins ("reference CasX"), as well as engineered CasX proteins with multiple sequence modifications, in addition to CasX with lost catalytic activity (dCasX) having one or more improved properties compared to the reference CasX protein, which is more fully described below. The CasX proteins of the present disclosure include a non-target strand binding (NTSB) domain, a target strand loading (TSL) domain, a helix I domain, a helix II domain, an oligonucleotide binding domain (OBD), and an RuvC domain, and in some cases, the domains are further classified into subdomains listed in Table 1.
[0201] In the context of the present disclosure, CasX for use in repressor fusion proteins, systems, and methods is without catalytic activity (dCasX) and is achieved by mutations introduced at selected positions in the RuvC sequence described below.
[0202] a. Reference CasX protein The present disclosure provides a naturally occurring CasX protein (referred to herein as the reference CasX protein), which was then modified to generate the engineered dCasX of the present disclosure. For example, the reference CasX protein can be isolated from naturally occurring prokaryotes such as Deltaproteobacteria species, Planctomycetes species, or Candidatus Sungbacteria species. The reference CasX protein (referred to interchangeably herein as the reference CasX polypeptide) is a class 2 type V CRISPR / Cas endonuclease of the CasX (also referred to as Cas12e) family of proteins that interacts with a guide RNA to form a ribonucleoprotein (RNP) complex.
[0203] In some cases, the reference CasX protein is isolated from or derived from a Deltaproteobacter having the following sequence: 1 MEKRINKIRK KLSADNATKP VSRSGPMKTL LVRVMTDDLK KRLEKRRKKP EVMPQVISNN 61 AANNLRMLLD DYTKMKEAIL QVYWQEFKDD HVGLMCKFAQ PASKKIDQNK LKPEMDEKGN 121 LTTAGFACSQ CGQPLFVYKL EQVSEKGKAY TNYFGRCNVA EHEKLILLAQ LKPEKDSDEA 181 VTYSLGKFGQ RALDFYSIHV TKESTHPVKP LAQIAGNRYA SGPVGKALSD ACMGTIASFL 241 SKYQDIIIEH QKVVKGNQKR LESLRELAGK ENLEYPSVTL PPQPHTKEGV DAYNEVIARV 301 RMWVNLNLWQ KLKLSRDDAK PLLRLKGFPS FPVVERRENE VDWWNTINEV KKLIDAKRDM 361 GRVFWSGVTA EKRNTILEGY NYLPNENDHK KREGSLENPK KPAKRQFGDL LLYLEKKYAG 421 DWGKVFDEAW ERIDKKIAGL TSHIEREEAR NAEDAQSKAV LTDWLRAKAS FVLERLKEMD 481 EKEFYACEIQ LQKWYGDLRG NPFAVEAENR VVDISGFSIG SDGHSIQYRN LLAWKYLENG 541 KREFYLLMNY GKKGRIRFTD GTDIKKSGKW QGLLYGGGKA KVIDLTFDPD DEQLIILPLA 601 FGTRQGREFI WNDLLSLETG LIKLANGRVI EKTIYNKKIG RDEPALFVAL TFERREVVDP 661 SNIKPVNLIG VDRGENIPAV IALTDPEGCP LPEFKDSSGG PTDILRIGEG YKEKQRAIQA 721 AKEVEQRRAG GYSRKFASKS RNLADDMVRN SARDLFYHAV THDAVLVFEN LSRGFGRQGK 781 RTFMTERQYT KMEDWLTAKL AYEGLTSKTY LSKTLAQYTS KTCSNCGFTI TTADYDGMLV 841 RLKKTSDGWA TTLNNKELKA EGQITYYNRY KRQTVEKELS AELDRLSEES GNNDISKWTK 901 GRRDEALFLL KKRFSHRPVQ EQFVCLDCGH EVHADEQAAL NIARSWLFLN SNSTEFKSYK 961 SGKQPFVGAW QAFYKRRLKE VWKPNA (SEQ ID NO: 1).
[0204] In some cases, the reference CasX protein is isolated from or derived from Planctomycetes having the following sequence: 1 MQEIKRINKI RRRLVKDSNT KKAGKTGPMK TLLVRVMTPD LRERLENLRK KPENIPQPIS 61 NTSRANLNKL LTDYTEMKKA ILHVYWEEFQ KDPVGLMSRV AQPAPKNIDQ RKLIPVKDGN 121 ERLTSSGFAC SQCCQPLYVY KLEQVNDKGK PHTNYFGRCN VSEHERLILL SPHKPEANDE 181 LVTYSLGKFG QRALDFYSIH VTRESNHPVK PLEQIGGNSC ASGPVGKALS DACMGAVASF 241 LTKYQDIILE HQKVIKKNEK RLANLKDIAS ANGLAFPKIT LPPQPHTKEG IEAYNNVVAQ 301 IVIWVNLNLW QKLKIGRDEA KPLQRLKGFP SFPLVERQAN EVDWWDMVCN VKKLINEKKE 361 DGKVFWQNLA GYKRQEALLP YLSSEEDRKK GKKFARYQFG DLLLHLEKKH GEDWGKVYDE 421 AWERIDKKVE GLSKHIKLEE ERRSEDAQSK AALTDWLRAK ASFVIEGLKE ADKDEFCRCE 481 LKLQKWYGDL RGKPFAIEAE NSILDISGFS KQYNCAFIWQ KDGVKKLNLY LIINYFKGGK 541 LRFKKIKPEA FEANRFYTVI NKKSGEIVPM EVNFNFDDPN LIILPLAFGK RQGREFIWND 601 LLSLETGSLK LANGRVIEKT LYNRRTRQDE PALFVALTFE RREVLDSSNI KPMNLIGIDR 661 GENIPAVIAL TDPEGCPLSR FKDSLGNPTH ILRIGESYKE KQRTIQAAKE VEQRRAGGYS 721 RKYASKAKNL ADDMVRNTAR DLLYYAVTQD AMLIFENLSR GFGRQGKRTF MAERQYTRME 781 DWLTAKLAYE GLPSKTYLSK TLAQYTSKTC SNCGFTITSA DYDRVLEKLK KTATGWMTTI 841 NGKELKVEGQ ITYYNRYKRQ NVVKDLSVEL DRLSEESVNN DISSWTKGRS GEALSLLKKR 901 FSHRPVQEKF VCLNCGFETH ADEQAALNIA RSWLFLRSQE YKKYQTNKTT GNTDKRAFVE 961 TWQSFYRKKL KEVWKPAV (SEQ ID NO: 2).
[0205] In some cases, the reference CasX protein is isolated from or derived from Candidatus Sungbacteria having the following sequence: 1 MDNANKPSTK SLVNTTRISD HFGVTPGQVT RVFSFGIIPT KRQYAIIERW FAAVEAARER 61 LYGMLYAHFQ ENPPAYLKEK FSYETFFKGR PVLNGLRDID PTIMTSAVFT ALRHKAEGAM 121 AAFHTNHRRL FEEARKKMRE YAECLKANEA LLRGAADIDW DKIVNALRTR LNTCLAPEYD 181 AVIADFGALC AFRALIAETN ALKGAYNHAL NQMLPALVKV DEPEEAEESP RLRFFNGRIN 241 DLPKFPVAER ETPPDTETII RQLEDMARVI PDTAEILGYI HRIRHKAARR KPGSAVPLPQ 301 RVALYCAIRM ERNPEEDPST VAGHFLGEID RVCEKRRQGL VRTPFDSQIR ARYMDIISFR 361 ATLAHPDRWT EIQFLRSNAA SRRVRAETIS APFEGFSWTS NRTNPAPQYG MALAKDANAP 421 ADAPELCICL SPSSAAFSVR EKGGDLIYMR PTGGRRGKDN PGKEITWVPG SFDEYPASGV 481 ALKLRLYFGR SQARRMLTNK TWGLLSDNPR VFAANAELVG KKRNPQDRWK LFFHMVISGP 541 PPVEYLDFSS DVRSRARTVI GINRGEVNPL AYAVVSVEDG QVLEEGLLGK KEYIDQLIET 601 RRRISEYQSR EQTPPRDLRQ RVRHLQDTVL GSARAKIHSL IAFWKGILAI ERLDDQFHGR 661 EQKIIPKKTY LANKTGFMNA LSFSGAVRVD KKGNPWGGMI EIYPGGISRT CTQCGTVWLA 721 RRPKNPGHRD AMVVIPDIVD DAAATGFDNV DCDAGTVDYG ELFTLSREWV RLTPRYSRVM 781 RGTLGDLERA IRQGDDRKSR QMLELALEPQ PQWGQFFCHR CGFNGQSDVL AATNLARRAI 841 SLIRRLPDTD TPPTP (SEQ ID NO: 3).
[0206] b. Catalytic activity - free CasX variant protein In the repressor fusion proteins and systems containing the same of the present disclosure, the CasX protein lacks catalytic activity in that it cannot cleave DNA but retains the ability to bind to a target nucleic acid when complexed with a guide RNA (gRNA). The present disclosure provides variants lacking catalytic activity (hereinafter interchangeably referred to as "dCasX variants" or "dCasX variant proteins"), and the CasX variants lacking catalytic activity contain multiple modifications in selected domains relative to the catalytically inactive versions of the sequences of SEQ ID NOs: 1-3 (above). Exemplary CasX proteins lacking catalytic activity contain one or more mutations in the active site of the RuvC domain of the CasX protein. In some embodiments, the reference CasX protein lacking catalytic activity contains substitutions at residues 672, 769, and / or 935 with reference to SEQ ID NO: 1. In some embodiments, the reference CasX protein lacking catalytic activity contains substitutions at D672A, E769A, and / or D935A with reference to SEQ ID NO: 1. In other embodiments, the reference CasX protein lacking catalytic activity contains substitutions at amino acids 659, 756, and / or 922 with reference to SEQ ID NO: 2. In some embodiments, the reference CasX protein lacking catalytic activity contains substitutions at D659A, E756A, and / or D922A with reference to SEQ ID NO: 2. An exemplary RuvC domain of dCasX of the present disclosure contains amino acids 661-824 and 935-986 of SEQ ID NO: 1, or amino acids 648-812 and 922-978 of SEQ ID NO: 2, and has one or more amino acid modifications to the RuvC cleavage domain sequence, and the dCasX variant exhibits one or more improved characteristics compared to the reference dCasX. In further embodiments, the CasX variant protein lacking catalytic activity contains a deletion of all or part of the RuvC domain of the reference CasX protein. It will be understood that the same aforementioned substitutions or deletions can be introduced into CasX variants known in the art as well, resulting in dCasX variants (for example, for exemplary sequences, see International Publication No. WO 2022 / 120095 A1 and US Patent Publication No. US 11,560,555, which are incorporated herein by reference).
[0207] In some embodiments, a dCasX variant having a linked repressor domain exhibits at least one improved characteristic as compared to a reference dCasX protein having a linked repressor domain configured in an equivalent manner. All dCasX variants that improve one or more functions or characteristics of a dCasX variant protein having a linked repressor domain as compared to the reference dCasX protein having a linked repressor domain described herein are contemplated to be within the scope of the present disclosure. In some embodiments, the modification is a mutation of one or more amino acids of the reference dCasX other than to render the catalytic activity of dCasX lost. For example, the dCasX variant can include one or more amino acid substitutions, insertions, deletions, or swapped domains relative to the reference dCasX protein sequence, or any combination thereof. Any amino acid can be substituted for any other amino acid in the substitutions described herein. The substitution can be a conservative substitution (e.g., a basic amino acid is substituted for another basic amino acid). The substitution can be a non-conservative substitution (e.g., a basic amino acid is substituted for an acidic amino acid, or vice versa). For example, a proline in the reference dCasX protein can be substituted with any of arginine, histidine, lysine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, glycine, alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, tyrosine, or valine to produce a dCasX variant protein of the present disclosure. In some embodiments, the dCasX variant exhibits improved properties as compared to the reference dCasX.Examples of improved features of dCasX variant embodiments include improved folding of the variant, increased binding affinity for the gRNA, increased binding affinity for the target nucleic acid, improved ability to utilize a larger spectrum of PAM sequences in the suppression and / or binding of the target nucleic acid, improved rewinding of the target DNA, increased loading of the target strand, increased binding of the non-target strand of DNA, improved protein stability, increased ability to complex with the gRNA, improved stability of the protein:gRNA (RNP) complex, and, when complexed with a linked repressor domain and as an RNP, increased repressor activity, improved repressor specificity for the target nucleic acid, decreased off-target suppression, increased proportion of the eukaryotic genome that can be efficiently suppressed and / or epigenetically modified, but are not limited thereto. In some embodiments, the improved features of the dCasX variant are improved by at least about 1.1- to about 100,000-fold compared to the reference dCasX protein.In some embodiments, the improved characteristics of the dCasX variant are improved by at least about 1.1- to about 10,000-fold, at least about 1.1- to about 1,000-fold, at least about 1.1- to about 500-fold, at least about 1.1- to about 400-fold, at least about 1.1- to about 300-fold, at least about 1.1- to about 200-fold, at least about 1.1- to about 100-fold, at least about 1.1- to about 50-fold, at least about 1.1- to about 40-fold, at least about 1.1- to about 30-fold, at least about 1.1- to about 20-fold, at least about 1.1- to about 10-fold, at least about 1.1- to about 9-fold, at least about 1.1- to about 8-fold, at least about 1.1- to about 7-fold, at least about 1.1- to about 6-fold, at least about 1.1- to about 5-fold, at least about 1.1- to about 4-fold, at least about 1.1- to about 3-fold, at least about 1.1- to about 2-fold, at least about 1.1- to about 1.5-fold, at least about 1.5- to about 3-fold, at least about 1.5- to about 4-fold, at least about 1.5- to about 5-fold, at least about 1.5- to about 10-fold, at least about 5- to about 10-fold, at least about 10- to about 20-fold, at least 10- to about 30-fold, at least 10- to about 50-fold, or at least 10- to about 100-fold compared to the reference dCasX protein. In some embodiments, the improved characteristics of the dCasX variant are improved by at least about 10- to about 1,000-fold compared to the reference dCasX protein. Additional disclosure regarding the improved characteristics is described herein below.
[0208] In other embodiments, the modification is a replacement of one or more domains of the reference dCasX with one or more domains from a different CasX. In some embodiments, the insertion includes the insertion of part or all of a domain from a different CasX protein. Mutations can occur in any one or more domains of the dCasX variant, and can include, for example, partial or complete deletions of one or more domains, or one or more amino acid substitutions, deletions, or insertions in any domain. The domains of the dCasX protein include a non-target strand binding (NTSB) domain, a target strand loading (TSL) domain, a helix I domain, a helix II domain, an oligonucleotide binding domain (OBD), and an RuvC DNA cleavage domain, which may further include the subdomains described below.
[0209] Suitable methods for generating mutations to produce the dCasX variant proteins of the present disclosure include, for example, Deep Mutational Evolution (DME), deep mutational scanning (DMS), error-prone PCR, cassette mutagenesis, random mutagenesis, staggered extension PCR, gene shuffling, or domain swapping. In some embodiments, the dCasX variant is designed, for example, by selecting one or more desired mutations in the reference dCasX. In certain embodiments, the activity of the reference dCasX protein is used as a benchmark to compare the activity of one or more dCasX variants, thereby measuring the improvement of the function of the dCasX variant.
[0210] In some embodiments, the dCasX variant protein comprises 700 to 1200 amino acids, 800 to 1100 amino acids, or 900 to 1000 amino acids.
[0211] The dCasX of the present disclosure and the linked repressor domain, when complexed with a gRNA as an RNP, utilize a PAM TC motif containing a PAM sequence selected from TTC, ATC, GTC, or CTC to bind with enhanced ability to efficiently bind to a target nucleic acid as compared to the RNP of a reference dCasX protein and a reference gRNA in a comparative assay system. As described above, the PAM sequence is located at least 1 nucleotide 5' to the non-target strand of the protospacer having identity with the targeting sequence of the gRNA.
[0212] In some embodiments, the RNP comprising the dCasX variant protein having a linked repressor domain of the present disclosure and a gRNA can bind to a double-stranded DNA target at a concentration of 20 pM or less with an efficiency of at least 70%, at least 80%, at least 85%, at least 90%, or at least 95%. In one embodiment, the RNP of the dCasX variant having a linked repressor domain and the gRNA variant shows greater binding of the target sequence in the target nucleic acid compared to the RNP comprising a reference dCasX protein having a linked repressor domain and a reference gRNA in an equivalent assay system, and the PAM sequence of the target nucleic acid is TTC. In another embodiment, the RNP of the dCasX variant having a linked repressor domain and the gRNA variant shows greater binding affinity for the target sequence in the target nucleic acid compared to the RNP comprising a reference dCasX protein having a linked repressor domain and a reference gRNA in an equivalent assay system, and the PAM sequence of the target nucleic acid is ATC. In another embodiment, the RNP of the dCasX variant having a linked repressor domain and the gRNA variant shows greater binding affinity for the target sequence in the target nucleic acid compared to the RNP comprising a reference dCasX protein having a linked repressor domain and a reference gRNA in an equivalent assay system, and the PAM sequence of the target nucleic acid is CTC. In another embodiment, the RNP of the dCasX variant having a linked repressor domain and the gRNA variant shows greater binding affinity for the target sequence in the target nucleic acid compared to the RNP comprising a reference dCasX protein having a linked repressor domain and a reference gRNA in an equivalent assay system, and the PAM sequence of the target nucleic acid is GTC. In the foregoing embodiments, the increase in binding affinity for one or more PAM sequences is at least 1.5-fold or more compared to the binding affinity of any one of the reference dCasX proteins (modified from SEQ ID NOs: 1-3) having a linked repressor domain and a gRNA of SEQ ID NOs: 1731-1743 for the PAM sequence.
[0213] c. dCasX variant proteins having domains from multiple source proteins Chimeric dCasX proteins are also contemplated within the scope of the present disclosure. As used herein, "chimeric dCasX protein" refers to both a dCasX protein containing at least two domains from different sources, as well as a dCasX protein containing at least one domain that is itself chimeric. Thus, in some embodiments, the chimeric dCasX protein comprises at least two domains isolated or derived from different sources, such as two different naturally occurring CasX proteins (e.g., two different CasX reference proteins), or two different engineered CasX proteins. In some embodiments, the helix I-I domain and the NTSB domain of the dCasX variant derived from SEQ ID NO: 2 are replaced with the corresponding helix I-I sequence and NTSB sequence derived from SEQ ID NO: 1, resulting in a chimeric dCasX protein. As an example of the foregoing, the chimeric RuvC domain comprises amino acids 660-823 of SEQ ID NO: 1 and amino acids 921-978 of SEQ ID NO: 2. As an alternative example of the foregoing, the chimeric RuvC domain comprises amino acids 647-810 of SEQ ID NO: 2 and amino acids 934-986 of SEQ ID NO: 1.
[0214] In other embodiments, the chimeric dCasX protein contains at least one domain that is a chimeric domain, for example, in some embodiments, a portion of the domain comprises substitutions from different CasX proteins (from a reference CasX protein, or another engineered CasX protein). In some embodiments, at least one chimeric domain can be any of the NTSB, TSL, helix I, helix II, OBD, or RuvC domains described herein. In some embodiments, the helix I-I domain (also referred to as helix I-a) of the dCasX variant derived from SEQ ID NO: 2 is replaced with the corresponding helix I-I sequence derived from SEQ ID NO: 1, resulting in a chimeric dCasX protein.
[0215] The sequences in Table 2 having the NTSB domain and the helix I-II domain from SEQ ID NO: 1, and the helix I-I domain from SEQ ID NO: 2 include dCasX 491, 515, 516, 518 - 520, 522 - 527, 532, 593, 676 (having the L169K substitution in the NTSB domain), and 812 (see Table 2 for SEQ ID NOs). The coordinates of the CasX domains in the reference CasX proteins of SEQ ID NO: 1 and SEQ ID NO: 2 are provided in Table 1 below. One of ordinary skill in the art will understand that the domain boundaries shown in Table 1 below are approximate, and that protein fragments with domain boundaries that differ from those shown in the table by 1, 2, or 3 amino acids may have the same activity as the domains described below. In some embodiments, the present disclosure provides a CasX protein of SEQ ID NOs: 3281 - 3441 or 3444 - 3446 having the NTSB domain and the helix I-II domain from SEQ ID NO: 1 and the helix I-I domain from SEQ ID NO: 2, wherein CasX has additional amino acid changes (i.e., 1, 2, 3, 4, or 5 mismatches) at selected positions relative to the domains of the reference CasX, which results in the loss of catalytic activity by introduction of one or more mutations that inactivate the cleavage activity of the RuvC domain.
Table 1
[0216] In some embodiments, the dCasX variant proteins utilized in the fusion proteins of the present disclosure include the sequences of SEQ ID NOs: 4 to 29 described in Table 2. In other embodiments, the dCasX variant proteins utilized in the fusion proteins of the present disclosure are at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical to the sequences of SEQ ID NOs: 4 to 29 described in Table 2. In certain embodiments, the dCasX variant protein utilized in the fusion protein of the gene repressor system of the present disclosure includes the sequence of SEQ ID NO: 4 (dCasX 491). In another certain embodiment, the dCasX variant protein utilized in the fusion protein of the gene repressor system of the present disclosure includes the sequence of SEQ ID NO: 6 (dCasX 515). In another certain embodiment, the dCasX variant protein utilized in the fusion protein of the gene repressor system of the present disclosure includes the sequence of SEQ ID NO: 29 (dCasX 812).
Table 2-1
Table 2-2
Table 2-3
Table 2-4
Table 2-5
Table 2-6
Table 2-7
Table 2-8
Table 2-9
[0217] In some embodiments, dCasX comprises a sequence selected from the group consisting of SEQ ID NOs: 4-29, or a sequence having at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, dCasX comprises a sequence selected from the group consisting of SEQ ID NOs: 4-29. In some embodiments, dCasX comprises a sequence selected from the group consisting of SEQ ID NOs: 3281-3441 and 3444-3446, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto, the sequence further comprising a mutation in the RuvC domain that allows dCasX to bind to DNA but is not associated with catalytic activity. In some embodiments, one or more mutations are within the RuvC domain and render RuvC catalytically inactive (i.e., unable to cleave DNA). In some embodiments, one or more mutations comprise D659A, E756A, and / or D922A substitutions corresponding to the sequence of SEQ ID NO: 2. A repressor fusion protein comprising dCasX retains the ability to form an RNP with gRNA. In some embodiments, a repressor fusion protein comprising dCasX retains one or more functions of the CasX protein, including but not limited to affinity for gRNA, binding to the target nucleic acid, specificity for the target nucleic acid, unwinding of the target nucleic acid, target strand loading, or any combination thereof.
[0218] d. Affinity for gRNA In some embodiments, dCasX having a linked repressor domain has improved affinity for gRNA compared to a reference dCasX protein, resulting in the formation of a ribonucleoprotein complex. The improved affinity of the repressor fusion protein for gRNA results in, for example, a lower K d for the production of the RNP complex, which in some cases can result in more stable ribonucleoprotein complex formation. In some embodiments, the K d of the repressor fusion protein for gRNA is at least about 1.1, at least about 1.2, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100-fold increased compared to the reference dCasX protein and the attached repressor domain. In some embodiments, the dCasX variant has a binding affinity for gRNA that is increased by about 1.1 to about 10-fold compared to a variant of the reference CasX protein of SEQ ID NO: 2 that lacks catalytic activity.
[0219] In some embodiments, the increased affinity of dCasX having a linked repressor domain for the gRNA results in an increase in the stability of the ribonucleoprotein complex when delivered to mammalian cells, including in vivo delivery to a subject. This increased stability affects the function and utility of the complex in the cells of the subject and can result in improved pharmacokinetic properties in the blood when delivered to the subject. In some embodiments, the increased affinity of the repressor fusion protein and the resulting increased stability of the ribonucleoprotein complex enable a lower dose of the repressor fusion protein to be delivered to the subject or cell while still having the desired activity, such as gene repression and / or epigenetic modification in vivo or in vitro. The increased ability to form and maintain RNPs in a stable form can be evaluated using in vitro assays known in the art.
[0220] In some embodiments, the higher affinity (tighter binding) of the dCasX variant protein and the linked repressor domain for the gRNA enables a greater amount of repression and / or epigenetic modification events when both the dCasX variant protein and the gRNA remain in the RNP complex. The increased repression events can be evaluated using the assays described herein.
[0221] Methods for measuring the repressor fusion protein binding affinity to gRNA include in vitro methods using purified repressor fusion protein and gRNA. When the gRNA or the repressor fusion protein is tagged with a fluorophore, the binding affinity to the repressor fusion protein can be measured by fluorescence polarization. Alternatively or additionally, the binding affinity can be measured by biolayer interferometry, electrophoretic mobility shift assay (EMSA), or filter binding. Additional standard techniques for quantifying the absolute affinity of RNA-binding proteins such as the reference dCasX and variant proteins of the present disclosure to specific gRNAs such as reference gRNAs and their variants include, but are not limited to, isothermal titration calorimetry (ITC), and surface plasmon resonance (SPR).
[0222] e. Improvement in specificity for the target nucleic acid sequence In some embodiments, a repressor fusion protein comprising a dCasX variant protein having a linked repressor domain has improved specificity for a target nucleic acid sequence that is complementary to the targeting sequence of the gRNA as compared to a reference dCasX protein having a linked repressor domain. As used herein, "specificity," sometimes also referred to as "target specificity," refers to the extent to which a CRISPR / Cas-based ribonucleoprotein complex binds to an off-target sequence that is similar but not identical to the target nucleic acid sequence. For example, a repressor fusion protein RNP having a higher degree of specificity shows a reduction in off-target methylation of the sequence as compared to the RNP of a reference dCasX having a linked repressor domain. The specificity of the repressor fusion protein and the reduction of potentially harmful off-target effects can be extremely important for achieving an acceptable therapeutic index for use in mammalian subjects.
[0223] Although not wishing to be bound by theory, amino acid changes in the helix I and II domains that enhance the specificity of the repressor fusion protein for the target nucleic acid strand may be able to enhance the specificity of the repressor fusion protein for the entire target nucleic acid. In some embodiments, amino acid changes that increase the specificity of the repressor fusion protein for the target nucleic acid may also result in a decrease in the affinity of the repressor fusion protein for DNA, but the overall benefit and safety of the composition are enhanced.
[0224] f. Repressor fusion proteins having additional heterologous proteins Within the scope of the present disclosure, repressor fusion proteins are also contemplated that include one or more heterologous proteins fused to the repressor fusion protein. This includes repressor fusion proteins that include N-terminal or C-terminal fusions to heterologous proteins or domains thereof. In some embodiments, the repressor fusion protein is fused to one or more proteins or domains thereof having activities for different purposes.
[0225] In some cases, the heterologous polypeptide (fusion partner) for use with the repressor fusion protein provides intracellular localization, i.e., the heterologous polypeptide includes an intracellular localization sequence (e.g., a nuclear localization signal (NLS) for targeting to the nucleus, a sequence for keeping the fusion protein outside the nucleus, a nuclear export sequence (NES), a sequence for keeping the fusion protein within the cytoplasm, a mitochondrial localization signal for targeting to the mitochondria, a chloroplast localization signal for targeting to the chloroplast, an ER retention signal, etc.).
[0226] In some cases, the repressor fusion protein contains (fused to) a nuclear localization signal (NLS). In some cases, the repressor fusion protein is fused to two or more, three or more, four or more, or five or more, six or more, seven or more, eight or more NLSs. In some cases, one or more NLSs (two or more, three or more, four or more, or five or more NLSs) are positioned at or near (e.g., within 50 amino acids of) the N-terminus and / or C-terminus of the repressor fusion protein. In some cases, one or more NLSs (two or more, three or more, four or more, or five or more NLSs) are positioned at or near (e.g., within 50 amino acids of) the N-terminus of the repressor fusion protein. In some cases, one or more NLSs (two or more, three or more, four or more, or five or more NLSs) are positioned at or near (e.g., within 50 amino acids of) the C-terminus of the repressor fusion protein. In some cases, one or more NLSs (three or more, four or more, or five or more NLSs) are positioned at or near (e.g., within 50 amino acids of) both the N-terminus and C-terminus of the repressor fusion protein. In some cases, one NLS is positioned at the N-terminus of the repressor fusion protein and one NLS is positioned at the C-terminus of the repressor fusion protein. Those skilled in the art will understand that an NLS at or near the N-terminus or C-terminus of a protein can be within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids of the N-terminus or C-terminus. In some embodiments, the NLS linked to the N-terminus of dCasX or the repressor fusion protein is the same as the NLS linked to the C-terminus. In other embodiments, the NLS linked to the N-terminus of dCasX or the repressor fusion protein is different from the NLS linked to the C-terminus. Representative configurations of repressor fusion proteins having NLSs are shown in FIGS. 1 and 2.In some embodiments, an NLS suitable for use with a repressor fusion protein in the systems of the present disclosure comprises a sequence having at least about 85%, at least about 90%, or at least about 95% identity to, or being identical to, a sequence derived from the amino acid sequence PKKKRKV (NLS of simian virus 40 (SV40) large T antigen having SEQ ID NO: 30); an NLS from nucleoplasmin (e.g., the nucleoplasmin bipartite NLS having the sequence KRPAATKKAGQAKKK (SEQ ID NO: 31)); or a sequence having the amino acid sequence PAAKRVKLD (SEQ ID NO: 32) or RQRRNELKRSP (SEQ ID NO: 33) derived from the c-MYC NLS. In some embodiments, the NLS linked to the N-terminus of the repressor fusion protein is selected from the group consisting of the N-terminal sequences set forth in Table 3. In some embodiments, the NLS linked to the C-terminus of the repressor fusion protein is selected from the group consisting of the C-terminal sequences set forth in Table 4. In some embodiments, an NLS suitable for use with a repressor fusion protein in the systems of the present disclosure comprises a sequence having at least about 80%, at least about 90%, or at least about 95% identity to, or being identical to, one or more sequences of Table 3 or Table 4. One of ordinary skill in the art will understand that Tables 3 and 4 present NLS sequences as exemplary embodiments for the N-terminus or C-terminus. Any of the NLSs of Table 3 or 4 can be fused to either the N-terminus or C-terminus of the repressor fusion protein described herein.
Table 3-1
Table 3-2
Table 4
[0227] In some embodiments, one or more NLSs are linked to a repressor fusion protein having a linker peptide or to adjacent NLSs, and the linker peptide is SR, GS, GP, VGS, GGS, (G)n (SEQ ID NO: 98), (GS)n (SEQ ID NO: 99), (GSGGS)n (SEQ ID NO: 100), (GGSGGS)n (SEQ ID NO: 101), (GGGS)n (SEQ ID NO: 102), GGSG (SEQ ID NO: 103), GGSGG (SEQ ID NO: 104), GSGSG (SEQ ID NO: 105), GSGGG (SEQ ID NO: 106), GGGSG (SEQ ID NO: 107), GSSSG (SEQ ID NO: 108), GPGP (SEQ ID NO: 109), GGP, PPP, VPPP, PPAPPA (SEQ ID NO: 110), PPPG (SEQ ID NO: 111), PPPGPPP (SEQ ID NO: 112), PPP(GGGS)n (SEQ ID NO: 113), (GGGS)nPPP (SEQ ID NO: 114), AEAAAKEAAAKEAAAKA (SEQ ID NO: 115), VPPPGGGSGGGSGGGS (SEQ ID NO: 116), TGGGPGGGAAAGSGS (SEQ ID NO: 117), GGGSGGGSGGGSPPP (SEQ ID NO: 118), TPPKTKRKVEFE (SEQ ID NO: 119), GGSGGGS (SEQ ID NO: 120), GSGSGGG (SEQ ID NO: 121), SSGNSNANSRGPSFSSGLVPLSLRGSH (SEQ ID NO: 122), GGPSSGAPPPSGGSPAGSPTSTEEGTSESATPESGPGTSTEPSEGSAPGSPAGSPTSTEEGTSTEPSEGSAPGTSTEPSE (SEQ ID NO: 123), and GGSGGG (SEQ ID NO: 124), where n is from 1 to 5.
[0228] Generally, the NLS (or NLSs) has sufficient strength to promote the accumulation of the LTRP fusion protein in the nucleus of a eukaryotic cell. Detection of nuclear accumulation can be performed by any suitable technique. For example, a detectable marker can be fused to the LTRP fusion protein such that the intracellular location can be visualized. The cell nucleus can also be isolated from the cell, and then its contents can be analyzed by any suitable process for detecting proteins, such as immunohistochemistry, Western blot, or enzyme activity assay. Nuclear accumulation can also be determined indirectly.
[0229] IV. Repressor Domain In some embodiments, the present disclosure provides a repressor fusion protein and a system comprising the same, the repressor fusion protein comprising a DNA-binding protein linked to a plurality of repressor domains (the repressor fusion protein), and the system can bind to a target nucleic acid of PCSK9 and suppress the transcription of the PCSK9 target nucleic acid, including by epigenetic modification of the target nucleic acid. Exemplary DNA-binding proteins for use in the repressor fusion protein include DNA-binding proteins such as zinc finger (ZF), TALE (transcription activator-like effector) proteins, and CRISPR proteins without catalytic activity.
[0230] In some embodiments, the present disclosure provides a repressor fusion protein comprising a CRISPR protein without catalytic activity, such as dCasX, linked to a plurality of repressor domains, and when complexed with a guide ribonucleic acid (gRNA) comprising a targeting sequence complementary to the target nucleic acid sequence of PCSK9, the system can bind to the target nucleic acid of PCSK9 and suppress the transcription and / or epigenetic modification of the PCSK9 target nucleic acid. Examples of gene suppression processes that reduce transcription include those that inhibit the formation of the transcription initiation complex, those that decrease the transcription initiation rate, those that decrease the transcription elongation rate, those that decrease the processability of transcription, and those that antagonize transcription activation (e.g., by blocking the binding of transcription activators), but are not limited thereto. Gene suppression can constitute, for example, the prevention of activation and the inhibition of expression below existing levels. Transcriptional repression includes both reversible and irreversible inactivation of gene transcription, the latter of which can result from epigenetic modification of the target nucleic acid.
[0231] Among repressor domains having the ability to suppress or silence genes, the Kruppel-associated box (KRAB) repressor domain is one of the most potent in the human genomic context (Alerasool, N., et al. An efficient KRAB domain for CRISPRi applications. Nat. Methods 17:1093 (2020)). The KRAB domain can recruit additional repressor domains such as, but not limited to, Trim28 (also known as Kap1 or Tif1-beta) upon binding of dCasX linked to the target nucleic acid, which then assembles protein complexes with chromatin regulators such as CBX5 / HP1α and SETDB1 that induce gene transcription repression in a limited and transient manner, and is present in approximately 400 human zinc finger protein-based transcription factors. Representative non-limiting examples of KRAB domains suitable for use in the systems of the present disclosure include ZIM3 (SEQ ID NO: 128) and ZNF10 (SEQ ID NO: 129). The present disclosure provides additional repressor domains from human and non-human sources that have been found to confer enhanced activity compared to ZIM3 and ZNF10 when incorporated into the repressor fusion proteins described herein.
[0232] In some embodiments, the present disclosure provides a system in which the modifications conferred by the use of a repressor fusion protein:gRNA system are epigenetic, and thus the silencing of the PCSK9 gene is heritable by mechanisms other than replication of the edited target nucleic acid. As used herein, "epigenetic modification" means a modification to either DNA or a histone associated with DNA other than a change in the DNA sequence itself (e.g., substitution, deletion, or rearrangement), where the modification is either a direct modification by a component of the system or an indirect modification by the recruitment of one or more additional cellular components, but the DNA target nucleic acid sequence itself is not edited to change the sequence. For example, DNA methyltransferase 3A (DNMT3A) (or its catalytic domain) directly modifies DNA by methylating it, while KRAB acts as a potent transcriptional repressor and recruits the KAP-1 / TIF1β co-repressor complex, which can further recruit factors associated with DNA methylation and the formation of repressive chromatin, such as heterochromatin protein 1 (HP1), histone deacetylase, and histone methyltransferase (Ying, Y., et al. The Kruppel-associated box repressor domain induces reversible and irreversible regulation of endogenous mouse genes by mediating different chromatin states. Nucleic Acids Res. 43(3):1549 (2015)). Additionally, the catalytically inactive DNMT3L cofactor, together with the cell's endogenous DNMT1, helps to establish heritable methylation patterns after DNA replication.The ATRX-DNMT3-DNMT3L domain (ADD) of DNMT3A is known to have the following two major functions: 1) allosterically regulate the catalytic activity of DNMT3A by functioning as a methyltransferase autoinhibitory domain, 2) specifically interact with the histone H3 tail that is not methylated at lysine (K) 4 and result in preferential methylation of DNA bound to chromatin H3 tails that are not methylated at K4 (Zhang, Y., et al. Chromatin methylation activity of Dnmt3a and Dnmt3a / 3L is guided by interaction of the ADD domain with the histone H3 tail. Nucleic Acids Research 38:4246 (2010)).
[0233] In some embodiments, the repressor fusion protein (or mRNA encoding the repressor fusion protein) comprises a DNA-binding protein linked to first, second, third, and fourth repressor domains, each of the repressor domains being different. In some embodiments, the DNA-binding protein is a TALE that can bind to a target nucleic acid but cannot cleave it. In some embodiments, the DNA-binding protein is a zinc finger protein that can bind to a target nucleic acid but cannot cleave it. In some embodiments, the DNA-binding protein is a CRISPR protein without catalytic activity that can bind to a target nucleic acid but cannot cleave it. In some embodiments, the repressor fusion protein (or mRNA encoding the repressor) comprises a CasX sequence without catalytic activity, a first repressor domain (hereinafter referred to as "RD1" herein), a DNMT3A catalytic domain as a second domain (hereinafter referred to as "DNMT3A" herein), a DNMT3L interaction domain as a third domain (hereinafter referred to as "DNMT3L" herein), and an ATRX-DNMT3-DNMT3L domain as a fourth domain (hereinafter referred to as "ADD" herein). In some embodiments, ADD is fused to the N-terminus of DNMT3A. In some embodiments, the repressor fusion protein comprises the first and second NLSs and one or more linker peptides described herein, and the fusion protein can form an RNP with the gRNA of a system that binds to a target nucleic acid.
[0234] When the use of the foregoing domain is configured in an alternative orientation to dCasX in the repressor fusion protein, when complexed with a gRNA having a targeting sequence complementary to a defined region of the PCSK9 gene, it results in significant epigenetic modification of the PCSK9 target nucleic acid, and the combination of repressor domains functions in concert and has been found to have an additive or synergistic effect on transcriptional silencing of the target gene depending on the configuration. In one such embodiment, the dCasX of the repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NOs: 4-29, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto. In another such embodiment, the repressor domain (RD1) of the repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NOs: 128-1726, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto. In another such embodiment, the RD1 of the repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NOs: 130-224, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto. In another such embodiment, the repressor domain (RD1) of the repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NOs: 130-138, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto.In another such embodiment, the RD1 of the repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 135, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto. In another such embodiment, the RD1 of the repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 131, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto. In another such embodiment, the second repressor domain of the repressor fusion protein is DNMT3A having the sequence of SEQ ID NO: 126, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto. In another such embodiment, the third repressor domain of the repressor fusion protein is DNMT3L having the sequence of SEQ ID NO: 127, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto. In another such embodiment, the fourth repressor domain of the repressor fusion protein is ADD having the sequence of SEQ ID NO: 125, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto.Surprisingly, it has been found that the addition of ADD to a repressor fusion protein containing RD1, DNMT3A, and DNMT3L significantly enhances or increases the long-term repression and / or epigenetic modification of target nucleic acids, as well as the specificity of repression, compared to a repressor fusion protein lacking ADD. Exemplary data of the improved repression and specificity of the repressor fusion protein containing ADD are shown in the examples. An exemplary configuration of the repressor fusion protein containing ADD is shown in FIG. 2.
[0235] In some embodiments, the present disclosure provides a system of a repressor fusion protein comprising first, second, third, and fourth repressor domains operably linked to dCasX comprising the sequence of SEQ ID NO: 4, or a sequence having at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity thereto, wherein RD1 is a) PX1X2X3X4X5X6EX7, where X1 is A, D, E, or N, X2 is L or V, X3 is I or V, X4 is S, T, or F, X5 is H, K, L, Q, R, or W, X6 is L or M, and X7 is G, K, Q, or R, b) X1X2X3X4GX5X6X7X8X9, where X1 is L or V, X2 is A, G, L, T, or V, X3 is A, F, or S, X4 is L or V, X5 is C, F, H, I, L, or Y, X6 is A, C, P, Q, or S, X7 is A, F, G, I, S, or V, X8 is A, P, S, or T, and X9 is K or R, c) QX1X2LYRX3VMX4 (SEQ ID NO: 1727), where X1 is K or R, X2 is A, D, E, G, N, S, or T, X3 is D, E, or S, and X4 is L or R, d) X1X2X3FX4DVX5X6X7FX8X9X 10 X 11(SEQ ID NO: 1728), X1 is A, L, P or S, X2 is L or V, X3 is S or T, X4 is A, E, G, K or R, X5 is A or T, X6 is I or V, X7 is D, E, N or Y, X8 is S or T, X9 is E, P, Q, R or W, X 10 is E or N, and X 11 is E or Q, e) X1X2X3PX4X5X6X7X8X9X 10 , X1 is E, G or R, X2 is E or K, X3 is A, D or E, X4 is C or W, X5 is I, K, L, M, T or V, X6 is I, L, P or V, X7 is D, E, K or V, X8 is E, G, K, P or R, X9 is A, D, R, G, K, Q or V, and X 10 is D, E, G, I, L, R, S or V, f) LYX1X2VMX3EX4X5X6X7X8X9X 10 (SEQ ID NO: 1729), X1 is K or R, X2 is D or E, X3 is L, Q or R, X4 is N or T, X5 is F or Y, X6 is A, E, G, Q, R or S, X7 is H, L or N, X8 is L or V, X9 is A, G, I, L, T or V, and X 10 is A, F or S, g) FX1DVX2X3X4FX5X6X7EWX8 (SEQ ID NO: 1730), X1 is A, E, G, K or R, X2 is A, S or T, X3 is I or V, X4 is D, E, N or Y, X5 is S or T, X6 is E, L, P, Q, R or W, X7 is D or E, and X8 is A, E, G, Q or R, h) X1PX2X3X4X5X6LEX7X8X9X 10 X 11 X 12, X1 is K or R, X2 is A, D, E or N, X3 is I, L, M or V, X4 is I or V, X5 is F, S or T, X6 is H, K, L, Q, R or W, X7 is K, Q or R, X8 is E, G or R, X9 is D, E or K, X 10 is A, D or E, and X 11 is L or P, and X 12 is C or W, and i) X1LX2X3X4QX5X6, where X1 is C, H, L, Q or W, X2 is D, G, N, R or S, X3 is L, P, S or T, X4 is A, S or T, X5 is K or R, and X6 is A, D, E, K, N, S or T, contains one or more motifs selected from the group consisting of, or contains the first and second motifs, the first amino acid sequence motif is, a) LYX1X2VMX3EX4X5X6X7X8X9X 10 (SEQ ID NO: 1729), (i) X1 is K or R, (ii) X2 is D or E, (iii) X3 is L, Q or R, (iv) X4 is N or T, (v) X5 is F or Y, (vi) X6 is A, E, G, Q, R or S, (vii) X7 is H, L or N, (viii) X8 is L or V, (ix) X9 is A, G, I, L, T or V, and (x) X 10is A, F or S, and b) the second amino acid sequence motif is FX1DVX2X3X4FX5X6X7EWX8 (SEQ ID NO: 1730), where (i) X1 is A, E, G, K or R, (ii) X2 is A, S or T, (iii) X3 is I or V, (iv) X4 is D, E, N or Y, (iv) X5 is S or T, (v) X6 is E, L, P, Q, R or W, (vi) X7 is D or E, (vii) X8 is A, E, G, Q or R, or a) DVAVYFSPEEWGCL (SEQ ID NO: 2945), b) X1X2X3QX4X5LY, where (i) X1 is A, D, G, N, R or S, (ii) X2 is P, S or T, (iii) X3 is A, S or T, (iv) X4 is K or R, (v) X5 is A, D, K, N, S or T, c) X1KPX2X3X4X5X6, where (i) X1 is A, P or S, (ii) X2 is A, D or E, (iii) X3 is L, M or V, (iv) X4 is I or V, (v) X5 is F, S or T, (vi) X6 is H, K, L, Q, R or W, d) LEX1X2X3X4X5X6, where (i) X1 is E, K, Q or R, (ii) X2 is E, G or R, (iii) X3 is A, D, E or K, (iv) X4 is A, D or E, (v) X5 is L or P, and (vi) X6 is C or W, and e) X1VMLEX2YX3X4X5X6SX7X8X9 (SEQ ID NO: 2946), where (i) X1 is D or E, (ii) X2 is N or T, (iii) X3 is A, E, G, Q, R or S, (iv) X4 is H or N, (v) X5 is L, M or V, (vi) X6 is A, L or V, (vii) X7 is L or V, (ix) X8 is A, G or V, and (x) X9 is C, F or L, and the second repressor domain comprises the sequence of SEQ ID NO: 126, or at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94% thereof,A DNMT3A sequence comprising an array variant having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity, wherein the third repressor domain is the sequence of SEQ ID NO: 127, or at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. A DNMT3L comprising an array variant having the above identity, and the fourth repressor domain is an ADD comprising the sequence of SEQ ID NO: 125, or at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. The fusion protein comprises one or more linker peptides described herein, and the fusion protein can form gRNA and RNP of a system that binds to a target nucleic acid. In some of the foregoing embodiments, RD1 is the sequence of SEQ ID NOs: 130 to 1726, or at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99 comprising a sequence selected from the group consisting of sequences having % identity, wherein the second repressor domain is the sequence of SEQ ID NO: 126, or a sequence variant having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity thereto, and the DNMT3A sequence comprising the sequence variant, the third repressor domain is the sequence of SEQ ID NO: 127, or a sequence variant having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity thereto, and the DNMT3L sequence comprising the sequence variant, the fourth repressor domain is the sequence of SEQ ID NO: 125, or a sequence variant having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity thereto, and the ADD sequence comprising the sequence variant, the fusion protein comprises one or more linker peptides described herein, and the fusion protein can form a gRNA and RNP of a system that binds to a target nucleic acid. In other embodiments described above, the first RD1 comprises a sequence selected from the group consisting of the sequences of SEQ ID NOs: 130-224, or sequences having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity thereto.In the other embodiments described above, the first RD1 comprises a sequence selected from the group consisting of SEQ ID NOs: 130 to 138, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity thereto. In the other embodiments described above, the first RD1 comprises the sequence of SEQ ID NO: 135, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity thereto. In the other embodiments described above, the first RD1 comprises the sequence of SEQ ID NO: 131, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity thereto. In the embodiments described above, the fusion protein may comprise first and second NLSs comprising a sequence selected from the group consisting of SEQ ID NOs: 30 to 97, and one or more linker peptides comprising a sequence selected from the group consisting of SEQ ID NOs: 98 to 124 shown in Table 5. In the embodiments described above in the paragraph, the repressor fusion protein can form a gRNA and RNP complex of a system capable of binding to the gene target nucleic acid.
[0236] One of ordinary skill in the art will understand that an RD1 protein comprising the above-described motif with one or more conservative substitutions in the motif may also function as an RD1 domain and is contemplated to be within the scope of the present disclosure.
[0237] In some embodiments, the repressor fusion protein comprises, from the N-terminus to the C-terminus, RD1, ADD, DNMT3A, DNMT3L, and a DNA-binding protein. In some embodiments, the repressor fusion protein comprises, from the N-terminus to the C-terminus, RD1, ADD, DNMT3A, DNMT3L, and a CRISPR protein without catalytic activity. In some embodiments, the repressor fusion protein comprises, from the N-terminus to the C-terminus, RD1, ADD, DNMT3A, DNMT3L, and dCasX.
[0238] In some embodiments, the repressor fusion protein comprises, from the N-terminus to the C-terminus, ADD, DNMT3A, DNMT3L, RD1, and a DNA-binding protein. In some embodiments, the repressor fusion protein comprises, from the N-terminus to the C-terminus, ADD, DNMT3A, DNMT3L, RD1, and a CRISPR protein without catalytic activity. In some embodiments, the repressor fusion protein comprises, from the N-terminus to the C-terminus, ADD, DNMT3A, DNMT3L, RD1, and dCasX.
[0239] In some embodiments, the repressor fusion protein has a configuration of NLS-ADD-DNMT3A-DNMT3L-dCasX-RD1-NLS, NLS-dCasX-RD1-NLS-ADD-DNMT3A-DNMT3L, NLS-dCasX-ADD-DNMT3A-DNMT3L-RD1-NLS), NLS-RD-ADD-DNMT3A-DNMT3L-dCasX-NLS, or NLS-ADD-DNMT3A-DNMT3L-RD1-dCasX-NLS from the N-terminus to the C-terminus. In any of the foregoing, a linker peptide may be inserted between one or more of the ADD, DNMT3A, DNMT3L, RD1, or dCasX domains.
[0240] In some embodiments, the repressor fusion protein has an N-terminal to C-terminal configuration of construct 1 (NLS-ADD-DNMT3A-linker 2-DNMT3A-linker 1-linker 3A-dCasX-linker 3B-RD1-NLS), construct 2 (NLS-linker 3A-dCasX-linker 3B-RD1-NLS-linker 1-ADD-DNMT3A-linker 2-DNMT3L), construct 3 (NLS-linker 3A-dCasX-linker 1-ADD-DNMT3A-linker 2-DNMT3L-linker 3B-RD1-NLS), construct 4 (NLS-RD1-linker 3A-ADD-DNMT3A-linker 2-DNMT3L-linker 1-dCasX-linker 3B-NLS), or construct 5 (NLS-ADD-DNMT3A-linker 2-DNMT3L-linker 3A-RD1-linker 1-dCasX-linker 3B-NLS). In some embodiments, the repressor fusion protein has an N-terminal to C-terminal configuration of construct 1' (NLS-DNMT3A-linker 2-DNMT3L-linker 1-linker 3A-dCasX-linker 3B-RD1-NLS), construct 2' (NLS-linker 3A-dCasX-linker 3B-RD1-NLS-linker 1-DNMT3A-linker 2-DNMT3L), construct 3' (NLS-linker 3A-dCasX-linker 1-DNMT3A-linker 2-DNMT3L-linker 3B-RD1-NLS), construct 4' (NLS-RD1-linker 3A-DNMT3A-linker 2-DNMT3L-linker 1-dCasX-linker 3B-NLS), or construct 5' (NLS-DNMT3A-linker 2-DNMT3L-linker 3A-RD1-linker 1-dCasX-linker 3B-NLS). One of ordinary skill in the art will understand that constructs 1' to 5' correspond to constructs 1 to 5 that do not have an ADD domain. In some embodiments of the system, the fusion protein components of the system are configured as schematically shown in FIGS. 1 and 2. In the foregoing embodiments of constructs 1 to 5 or 1' to 5', the NLS comprises a sequence selected from the group consisting of SEQ ID NOs: 30 to 97, and the linker sequences are independently selected from the group consisting of SEQ ID NOs: 98 to 124 set forth in Table 5.In some embodiments, the linker sequence is independently selected from the group consisting of SEQ ID NOs: 120 to 123. In some embodiments, Linker 1 comprises the sequence of SEQ ID NO: 123. In some embodiments, Linker 2 comprises the sequence of SEQ ID NO: 122. In some embodiments, Linker 3A and / or Linker 3B comprises the sequence of SEQ ID NO: 120. In some embodiments, Linker 4 comprises the sequence of SEQ ID NO: 121.
Table 5
[0241] In some embodiments of the repressor fusion protein and systems comprising the same, the repressor fusion protein is composed of a DNA binding protein and a configuration selected from the group consisting of Configuration 1, Configuration 2, Configuration 3, Configuration 4, Configuration 5, Configuration 1', Configuration 2', Configuration 3', Configuration 4', and Configuration 5', and includes first, second, second, and fourth repressor domains. When a gRNA having a targeting sequence complementary to the RNP of the repressor fusion protein and the PCSK9 target nucleic acid binds intracellularly, the target nucleic acid is epigenetically modified and transcription of the PCSK9 gene is suppressed. In some embodiments, when the transcription of the PCSK9 gene is assayed in an in vitro assay including a cell line assay, it is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% suppressed compared to untreated cells or cells treated with a comparative system including a non-targeting spacer. Most preferably, PCSK9 gene repression results in complete inhibition of gene expression such that the gene product is not detected. In some embodiments, transcription of the PCSK9 gene is suppressed in at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, or more of the population of cells targeted by the repressor fusion protein:gRNA system.
[0242] In some embodiments, the suppression of PCSK9 gene transcription is maintained for at least about 8 hours, at least about 1 day, at least about 7 days, at least 2 weeks, at least about 3 weeks, at least about 1 month, or at least about 2 months when assayed in an in vitro assay, including a cell line assay. In some embodiments, when the composition is administered at a therapeutically effective dose, the suppression of PCSK9 gene transcription persists for at least about 7 days, at least 2 weeks, at least about 3 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months, in the target cells of a subject selected from the group consisting of mice, rats, pigs, non-human primates, and humans. In certain embodiments, repressor fusion protein constructs 4 and 5, or 4' and 5', when used in a repressor fusion protein:gRNA system, result in less off-target methylation or off-target activity in an in vitro assay compared to construct 1. In some embodiments, the use of repressor fusion protein constructs 4 and 5, or 4' and 5', when used in a repressor fusion protein:gRNA system, results in less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, or less than about 0.1% less off-target methylation or off-target activity in cells.
[0243] a. An mRNA composition encoding an LTRP fusion protein In another aspect, the present disclosure relates to a messenger RNA (mRNA) composition comprising a sequence encoding a DNA binding protein of the present disclosure (e.g., dCasX) and a linked repressor domain fusion protein (repressor fusion protein). The mRNA composition can be used in the repressor fusion protein:gRNA system of the present disclosure and in certain delivery formulations, such as particles like lipid nanoparticles (LNPs). In some embodiments, the composition is designed to provide one or more of improved expression of the repressor fusion protein, reduced immunogenicity, increased stability, and enhanced manufacturability as compared to the repressor fusion protein encoded by unmodified mRNA. In some embodiments, the repressor fusion protein is designed to effect genetic repression, and repression of the PCSK9 gene persists for at least 1, 2, 3, 4, 5, or 6 or more cell divisions. In some embodiments, the repressor fusion protein effects repression of transcription of the PCSK9 gene and is maintained for at least about 8 hours, at least about 1 day, at least about 7 days, at least 2 weeks, at least about 3 weeks, at least about 1 month, or at least about 2 months when assayed in an in vitro assay. The present disclosure also provides methods utilized to design the composition and formulations for delivering the composition.
[0244] Modifications to the mRNA sequence can affect mRNA stability, protein translation and expression levels, as well as immunogenicity, and thus can significantly impact the effectiveness of mRNA-based delivery. Optimization of the coding sequence and untranslated regions (UTRs) can be particularly significant when delivering mRNA encoding the protein of interest, as opposed to the DNA template transcribed into the mRNA. The DNA template is long-lived, can replicate, and can produce many RNA transcripts over its lifetime. For DNA templates, the efficiency of transcription and mRNA precursor processing are the major determinants of protein expression levels. In contrast, mRNA is generally vulnerable to cytoplasmic degradation and has a much shorter half-life on the order of hours as it cannot produce more copies of itself. Thus, mRNA stability and translation efficiency are determinants of protein expression levels for mRNA-based delivery, and thus specific sequences of the UTRs and coding sequences that determine mRNA stability and translation efficiency can be enhanced to improve the effectiveness of mRNA-based delivery.
[0245] In some embodiments, the present disclosure provides an mRNA encoding dCasX515 (SEQ ID NO: 6) for incorporation into an mRNA encoding a repressor fusion protein, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the present disclosure provides an mRNA encoding dCasX812 (SEQ ID NO: 29) for incorporation into an mRNA encoding a repressor fusion protein, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the present disclosure provides an mRNA sequence encoding dCasX491 (SEQ ID NO: 4) for incorporation into an mRNA encoding a repressor fusion protein of the present disclosure, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the present disclosure provides an mRNA encoding dCasX676 (SEQ ID NO: 28) for incorporation into an mRNA encoding a repressor fusion protein, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the present disclosure provides an mRNA encoding a repressor fusion protein comprising dCasX491 comprising the sequence of SEQ ID NO: 3122.
[0246] mRNA according to the present disclosure may be produced using various natural nucleosides or modified nucleosides. In some embodiments, the mRNA is a natural nucleoside (e.g., adenosine, guanosine, cytidine, uridine); a nucleoside analog (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine, (e.g., N-1-methyl-pseudouridine), 2-thiouridine, and 2-thiocytidine), a chemically modified base, a biologically modified base (e.g., a methylated base), an intercalated base, a modified sugar (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or a modified phosphate group (e.g., phosphorothioate and 5'-N-phosphoramidite linkages), or comprises them. In some embodiments, the mRNA comprises one or more non-standard nucleotide residues. Non-standard nucleotide residues can include, for example, 5-methyl-cytidine ("5mC"), pseudouridine ("ψU"), and / or 2-thio-uridine ("2sU"). In certain embodiments, one or more of the uridine residues of the mRNA of the present disclosure are replaced with N1-methyl-pseudouridine. For example, for consideration of such residues and their incorporation into mRNA, see U.S. Patent Application No. 8,278,036 or International Publication No. 2011012316, which are hereby incorporated by reference herein. In some embodiments, the mRNA encoding CasX 515 has N1-methyl-pseudouridine nucleosides that replace one or more, or all, of the uridines in the sequence. In some embodiments, the mRNA encoding CasX 812 has N1-methyl-pseudouridine nucleosides that replace one or more, or all, of the uridines in the sequence.
[0247] In some embodiments, the mRNA sequence encoding the repressor fusion protein includes 5'UTR and 3'UTR sequences. Those skilled in the art will be able to select appropriate UTR sequences. In some embodiments, the 3'UTR includes the sequence of SEQ ID NO: 3189, 3205-3209, or 3278. In some embodiments, the 5'UTR includes the sequence of SEQ ID NO: 3200-3204 or 3274.
[0248] V. Guide nucleic acid of the system In another aspect, the present disclosure relates to a guide ribonucleic acid (gRNA) comprising a scaffold and a targeting sequence linked thereto that is complementary to (and thus capable of hybridizing with) a target nucleic acid sequence of the PCSK9 gene that is useful for suppressing the transcription of the PCSK9 target nucleic acid in eukaryotic cells. As used herein, the term "gRNA" encompasses native molecules and gRNA variants, including chimeric gRNA variants that include domains from different gRNAs. The gRNA of the present disclosure includes a scaffold and a targeting sequence complementary to the target nucleic acid of the cell.
[0249] In some embodiments, the present disclosure provides a system comprising an mRNA encoding a repressor fusion protein comprising a dCasX protein and one or more gRNAs, as a repressor fusion protein: gRNA system designed to form a gRNA and ribonucleoprotein (RNP) complex upon expression of the dCasX protein in transfected cells. The RNP targets and binds to a specific position in the target nucleic acid sequence of the cell to suppress transcription. The gRNA provides target specificity to the RNP complex by including a targeting sequence (or "spacer") comprising a nucleotide sequence complementary to the sequence of the target nucleic acid sequence. The repressor fusion protein of the system provides site-specific activities such as binding and suppression of the target sequence and is directed (e.g., stabilized) to the target site within the target nucleic acid sequence by engagement with the gRNA in the RNP.
[0250] Embodiments of gRNAs for use in the inhibition and / or epigenetic modification of PCSK9 target nucleic acids, as well as formulations of mRNA and gRNA, are described below.
[0251] a. Reference gRNAs and gRNA variants As used herein, "reference gRNA" refers to a CRISPR guide ribonucleic acid comprising the wild-type sequence of a naturally occurring gRNA. In some embodiments, the gRNA scaffolds of the present disclosure may be subjected to one or more mutagenesis methods such as the mutagenesis methods described in International Publication No. WO 2022 / 120095A1 and International Publication No. WO 2020 / 247882A1, which are incorporated herein by reference, including deep mutagenesis evolution (DME), deep mutational scanning (DMS), error-prone PCR, cassette mutagenesis, random mutagenesis, staggered extension PCR, gene shuffling, domain swapping, or chemical modification, to produce one or more gRNA variants having enhanced or altered properties relative to the modified gRNA scaffold. The activity of the gRNA scaffold from which the gRNA variant is derived can be used as a benchmark against which the activity of the gRNA is compared, thereby measuring improvements in the function or other characteristics of the gRNA scaffold.
[0252] Table 6 provides the sequences of the reference gRNA tracr and scaffold sequences. In some embodiments, the present disclosure provides a gRNA sequence, wherein the gRNA has a scaffold comprising a sequence having one or more nucleotide modifications relative to any one of the reference gRNA sequences of SEQ ID NOs: 1731 to 1743 in Table 6. [Table 6]
[0253] b. gRNA domains and their functions The gRNA of the present disclosure comprises two segments: a targeting sequence and a protein-binding segment. The targeting segment of the gRNA is complementary to (and thus hybridizes with) a specific sequence (target site) within a target nucleic acid sequence (e.g., a strand of double-stranded target DNA, target ssRNA, target ssDNA, etc.), which is fully described below, and comprises a nucleotide sequence (referred to interchangeably as a spacer, targeting element, or targeting sequence). The targeting sequence of the gRNA can bind to a coding sequence, the complement of a coding sequence, a target nucleic acid sequence comprising a non-coding sequence, and associated elements in the context of the present disclosure. The protein-binding segment of the gRNA (or “activator” or “protein-binding sequence”) interacts with (e.g., binds to) the CasX protein as a complex to form an RNP (fully described below). As used herein, “scaffold” refers to all parts of the guide except for the targeting sequence, which consists of several regions fully described below. The properties and characteristics of both wild-type and variant CasX gRNAs are described in International Publication No. WO 2020 / 247882 A1, U.S. Patent Publication No. 2022 / 0220508 A1, and International Publication No. WO 2022 / 120095 A1, which are incorporated herein by reference.
[0254] In the case of a reference gRNA, the gRNA occurs naturally as a dual guide RNA (dgRNA), and the target factor portion and the activator factor portion each have complementarity to each other and hybridize to each other to form a double-stranded duplex (the dsRNA duplex of the gRNA) having a double-stranded forming segment. As used herein, the term "target factor" or "target factor RNA" is used to refer to the crRNA-like molecule (crRNA: "CRISPR RNA") of the CasX dual guide RNA (and thus of the CasX single guide RNA when the "activator factor" and the "target factor" are linked together, for example, by intervening nucleotides). The crRNA has a 5' region that anneals to the nucleotides of the targeting sequence following the tracrRNA. In the case of a gRNA for use in the disclosed system, the scaffold contains the activator factor moiety and the target factor moiety covalently bound to each other (rather than hybridizing to each other) and is designed to contain a single molecule and may be referred to as a "single molecule gRNA", "single guide RNA", "single molecule guide RNA", "one molecule guide RNA", or "sgRNA". All gRNA variants of the disclosed system for use in the system are single molecule versions.
[0255] Collectively, the assembled gRNAs of the present disclosure have distinct structured regions or domains, namely, RNA triplexes, scaffold stem-loops, extended stem-loops, pseudoknots, and, in embodiments of the present disclosure, targeting sequences that are specific to the target nucleic acid and located at the 3’ end of the gRNA. The RNA triplexes, scaffold stem-loops, pseudoknots, and extended stem-loops, together with the unstructured triplex loop that crosslinks the triplex portions together, are referred to as the “scaffold” of the gRNA. In some cases, the scaffold stem further includes a bubble. In other cases, the scaffold further includes a triplex loop region. In still other cases, the scaffold further includes a 5’ unstructured region. In some embodiments, the gRNA scaffold of the present disclosure for use in a repressor fusion protein:gRNA system has a scaffold stem-loop having the sequence CCAGCGACUAUGUCGUAGUGG (SEQ ID NO: 1822), or a sequence having at least 1, 2, 3, 4, or 5 mismatches thereto.
[0256] Each of the structured domains is important for establishing the global RNA folding of the guide and retaining the functionality of the guide, particularly the ability to properly complex with the dCasX protein. For example, while the guide scaffold stem interacts with the helix I domain of the dCasX protein, residues within the triplex, triplex loop, and pseudoknot stem interact with the OBD of the dCasX protein. Collectively, these interactions confer the ability of the guide to bind dCasX and form an RNP that retains stability, while the spacer (or targeting sequence) directs and defines the specificity of the RNP for binding to a specific sequence of DNA.
[0257] Site-specific binding of a target nucleic acid sequence (e.g., genomic DNA) by the dCasX protein can occur at one or more positions (e.g., the sequence of the target nucleic acid) determined by base pair complementarity between the targeting sequence of the gRNA and the target nucleic acid sequence. Thus, for example, the gRNAs of the present disclosure have complementarity to a target nucleic acid adjacent to a sequence complementary to a TC protospacer adjacent motif (PAM) motif or PAM sequence, e.g., ATC, CTC, GTC, or TTC, and can thus hybridize thereto. Since the targeting sequence of the guide sequence hybridizes to the sequence of the target nucleic acid sequence, the targeting sequence can be modified by the user to hybridize to a specific target nucleic acid sequence as long as the position of the PAM sequence is taken into account. In some embodiments, for the design of the targeting sequence, the target nucleic acid contains a PAM sequence located 5' to the targeting sequence and has at least one nucleotide separating the PAM from the first nucleotide of the target nucleic acid that is complementary to the first nucleotide of the targeting sequence. In some embodiments, the PAM is located on the non-target strand of the target region, i.e., the strand complementary to the target nucleic acid. In some embodiments, the targeting sequence of the gRNA is complementary to a target nucleic acid sequence that is 1 nucleotide away from the ATC PAM sequence. In some embodiments, the targeting sequence of the gRNA is complementary to a target nucleic acid sequence that is 1 nucleotide away from the CTC PAM sequence. In some embodiments, the targeting sequence of the gRNA is complementary to a target nucleic acid sequence that is 1 nucleotide away from the GTC PAM sequence. In some embodiments, the targeting sequence of the gRNA is complementary to a target nucleic acid sequence that is 1 nucleotide away from the TTC PAM sequence. By selection of the targeting sequence of the gRNA, sequences surrounding a defined region of the target nucleic acid sequence or a specific position within the target nucleic acid can be repressed using the repressor fusion protein:gRNA system described herein. In some embodiments, the targeting sequence of the gRNA has 15-20 consecutive nucleotides. In some embodiments, the targeting sequence has 15, 16, 17, 18, 19, or 20 consecutive nucleotides. In some embodiments, the targeting sequence consists of 20 consecutive nucleotides.In some embodiments, the targeting sequence consists of 19 consecutive nucleotides. In some embodiments, the targeting sequence consists of 18 consecutive nucleotides. In some embodiments, the targeting sequence consists of 17 consecutive nucleotides. In some embodiments, the targeting sequence consists of 16 consecutive nucleotides. In some embodiments, the targeting sequence consists of 15 consecutive nucleotides. By selection of the targeting sequence of the gRNA, a defined region of the target nucleic acid sequence can be repressed and / or epigenetically modified using the repressor fusion protein:gRNA system described herein.
[0258] The gene repressor system of the present disclosure can be designed to target any region of the PCSK9 gene or any region of the region of the PCSK9 gene where transcriptional repression is desired, or any region proximal thereto. When the entire gene is repressed, it is contemplated by the present disclosure to design a guide having a targeting sequence that encompasses the transcription start site (TSS) or is complementary to the sequence proximal thereto. TSS selection occurs at different positions within the promoter region depending on the promoter sequence and the concentration of the initiating substrate. The core promoter functions as a binding platform for the transcription machinery, including Pol II and its associated general transcription factors (GTFs) (Haberle, V. et al. Eukaryotic core promoters and the functional basis of transcription initiation (Nat Rev Mol Cell Biol. 19(10):621 (2018)). Variability in TSS selection has been proposed to involve DNA "scrunching" and "anti-scrunching", characterized by (i) forward and reverse movement of the leading edge rather than the trailing edge of RNA polymerase relative to DNA, and (ii) expansion and contraction of the transcription bubble. In some embodiments, the target nucleic acid sequence bound by the RNP of the repressor fusion protein:gRNA system is within 1 kb of the transcription start site (TSS) in the PCSK9 gene. In some embodiments, the target nucleic acid sequence bound by the RNP of the system is within 20 bp, 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 500 bp, 1 kb, or 1.5 kb upstream of the TSS of the PCSK9 gene. In some embodiments, the target nucleic acid sequence bound by the RNP of the system is within 20 bp, 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 500 bp, 1 kb, or 1.5 kb downstream of the TSS of the PCSK9 gene. In some embodiments, the target nucleic acid sequence bound by the RNP of the system is within 1.5 kb upstream to 1.5 kb downstream, 1 kb upstream to 1 kb downstream, 500 bps upstream to 500 bps downstream, or 300 bp upstream to 300 bp downstream, or 100 bp upstream to 100 bp downstream of the TSS of the PCSK9 gene.In some embodiments, the target nucleic acid sequence bound by the RNP of the system is within 20 bp, 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 500 bp, 1 kb, or 1.5 kb of an enhancer of the PCSK9 gene. In some embodiments, the target nucleic acid sequence bound by the RNP of the system of the present disclosure is within 1 kb of the 3' to 5' untranslated region of the PCSK9 gene. In other embodiments, the target nucleic acid sequence bound by the RNP of the system is within the open reading frame of the PCSK9 gene including introns (if any). In some embodiments, the targeting sequence of the gRNA of the system of the present disclosure is designed to be specific for an exon of the PCSK9 gene. In certain embodiments, the targeting sequence of the gRNA of the system of the present disclosure is designed to be specific for exon 1 of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system of the present disclosure is designed to be specific for an intron of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system of the present disclosure is designed to be specific for an intron-exon junction of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system of the present disclosure is designed to be specific for a regulatory element of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system of the present disclosure is designed to be complementary to the sequence of the intergenic region of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system of the present disclosure is specific for the junction of an exon, intron, and / or regulatory element of the PCSK9 gene. When the targeting sequence is specific for a regulatory element, such regulatory elements include, but are not limited to, promoter regions, enhancer regions, intergenic regions, 5' untranslated regions (5' UTRs), 3' untranslated regions (3' UTRs), conserved elements, and regions containing cis-regulatory elements. The promoter region is intended to encompass nucleotides within 5 kb from the start point of the coding sequence, or in the case of gene enhancer elements or conserved elements, may be thousands of bp, hundreds of thousands of bp, or even millions of bp away from the coding sequence of the PCSK9 gene.As described above, the target is intended such that the target code PCSK9 gene is suppressed so that the PCSK9 gene product is not expressed in cells or is expressed at a lower level. In some embodiments, when the RNP of the system of the present disclosure binds to the binding position of the target nucleic acid, the system can suppress the transcription of the PCSK9 gene 5' to the binding position of the RNP. In other embodiments, when the RNP of the system binds to the binding position of the target nucleic acid, the system can suppress the transcription of the PCSK9 gene 3' to the binding position of the RNP.
[0259] In some embodiments, the target nucleic acid includes a PAM sequence located 5' to the targeting sequence and has at least a single nucleotide separating the PAM from the first nucleotide of the targeting sequence. In some embodiments, the PAM is located on the non-target strand of the target region, i.e., the strand complementary to the target nucleic acid. Representative but non-limiting examples of targeting sequences for wild-type PCSK9 nucleic acids are presented as SEQ ID NOs: 1824-2944, shown as Table 7 below, and represent the targeting sequences of PCSK9 target nucleic acids for binding to the gRNA scaffolds of the present disclosure, such as gRNA 174, 235, 316, or chemically modified versions thereof. In some embodiments, the targeting sequence of the gRNA includes a sequence having at least about 65%, at least about 75%, at least about 85%, or at least about 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1824-2944. In some embodiments, the PAM sequence is TTC. In some embodiments, the targeting sequence of the TTC PAM includes SEQ ID NOs: 1824-2944, or a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NOs: 1824-2944. In some embodiments, the targeting sequence of the TTC PAM is selected from the group consisting of SEQ ID NOs: 1824-2944.
[0260] In some embodiments, the targeting sequence of the gRNA for use in the repressor fusion protein:gRNA system of the present disclosure comprises a sequence selected from the group consisting of SEQ ID NOs: 1824 to 2545. In certain embodiments, the targeting sequence of the gRNA for use in the repressor fusion protein:gRNA system of the present disclosure consists of a sequence selected from the group consisting of SEQ ID NOs: 1824 to 1890, 1910, 1925, 2672, 2675, 2694, and 2714. In some embodiments, the targeting sequence consists of SEQ ID NO: 1834. In some embodiments, the targeting sequence consists of SEQ ID NO: 2009. In some embodiments, the targeting sequence consists of SEQ ID NO: 2341. In some embodiments, the targeting sequence consists of SEQ ID NO: 1841. In some embodiments, the targeting sequence consists of SEQ ID NO: 1842. In some embodiments, the targeting sequence consists of SEQ ID NO: 1844. In some embodiments, the targeting sequence consists of SEQ ID NO: 1845. In some embodiments, the targeting sequence consists of SEQ ID NO: 2672. In some embodiments, the targeting sequence consists of SEQ ID NO: 1884. In some embodiments, the targeting sequence consists of SEQ ID NO: 1851. In some embodiments, the targeting sequence consists of SEQ ID NO: 1849. In some embodiments, the targeting sequence consists of SEQ ID NO: 1852. In some embodiments, the targeting sequence consists of SEQ ID NO: 1853. In some embodiments, the targeting sequence consists of SEQ ID NO: 1855. In some embodiments, the targeting sequence consists of SEQ ID NO: 1856. In some embodiments, the targeting sequence consists of SEQ ID NO: 1857. In some embodiments, the targeting sequence consists of SEQ ID NO: 1858. In some embodiments, the targeting sequence consists of SEQ ID NO: 1859. In some embodiments, the targeting sequence consists of SEQ ID NO: 1860. In some embodiments, the targeting sequence consists of SEQ ID NO: 1862. In some embodiments, the targeting sequence consists of SEQ ID NO: 1863. In some embodiments, the targeting sequence consists of SEQ ID NO: 1867. In some embodiments, the targeting sequence consists of SEQ ID NO: 1869. In some embodiments, the targeting sequence consists of SEQ ID NO: 1870.In some embodiments, the targeting sequence consists of SEQ ID NO: 1872. In some embodiments, the targeting sequence consists of SEQ ID NO: 1875. In some embodiments, the targeting sequence consists of SEQ ID NO: 1830. In any of the foregoing, the targeting sequence may have 1, 2, 3, 4, or 5 nucleotides removed from the 3' end of the targeting sequence.
Table 7
Table 8
[0261] c. gRNA modification In another aspect, the disclosure relates to a gRNA (also referred to herein as a gRNA variant) that includes a modification to a reference gRNA from which the gRNA is derived. The gRNA can be used in the systems of the disclosure. In some embodiments, the gRNA variant includes a region in which one or more nucleotide substitutions, insertions, deletions, or exchanges have been made to a reference gRNA sequence that improves a property relative to the reference gRNA. Exemplary regions and exchange regions or domains for modification include RNA triple helices, pseudoknots, scaffold stem loops, and extended stem loops. In some embodiments, the gRNA variant includes at least a first exchange region from a different gRNA, resulting in a chimeric gRNA. A representative example of such a chimeric gRNA is Guide 316 (SEQ ID NO: 1746), in which the extended stem loop of gRNA scaffold 235 is replaced with the extended stem loop of gRNA scaffold 174, and the resulting 316 variant retains the ability to form an RNP with a repressor fusion protein and exhibits improved properties compared to the parental 235 when evaluated in in vitro or in vivo assays under equivalent conditions.
[0262] gRNA scaffold variants are all gRNAs that have one or more improved functions, features, or add one or more new functions when compared to the gRNA scaffold from which they were derived, and are assumed to be within the scope of the present disclosure while retaining the functional property of being able to form a complex with a repressor fusion protein and direct the ribonucleoprotein holo RNP complex to a target nucleic acid. In some embodiments, the gRNA has improved properties selected from the group consisting of an increase in pseudoknot stem stability, an increase in triple-stranded region stability, an increase in scaffold stem stability, elongation stem stability, reduction of off-target folding intermediates, an increase in binding affinity for the repressor fusion protein, and an increase in inhibitory activity when complexed with the repressor fusion protein, or any combination thereof. In some of the foregoing cases, the improvement in the feature is evaluated in an in vitro assay, including the assays of the examples. In other of the foregoing cases, the improvement in the feature is evaluated in vivo.
[0263] Table 9 provides exemplary gRNA variant scaffold sequences for gRNA generation. The gRNAs can be used in the repressor fusion protein:gRNA systems of the present disclosure. In some embodiments, the gRNA variant scaffold comprises any one of the sequences listed in Table 9, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto, and the gRNA variant retains the ability to form an RNP with dCasX of the present disclosure. In other embodiments, the gRNA variant scaffold comprises any one of the sequences listed in Table 9, and the gRNA variant retains the ability to form an RNP with the repressor fusion protein of the present disclosure. In these embodiments where the vector comprises the DNA coding sequence of the gRNA, it will be understood that the thymine (T) base can be substituted for the uracil (U) base of any of the gRNA sequence embodiments described herein. In some embodiments, the present disclosure provides chemically modified gRNA variants of Table 9 as described below.
Table 9
[0264] Additional gRNA scaffold variants contemplated for use of the gRNAs of the present disclosure and in the repressor fusion protein:gRNA systems are selected from the group consisting of SEQ ID NOs: 1747-1821.
[0265] d. gRNA scaffold 316 The guide scaffold can be made by several methods, including recombinant or solid-phase RNA synthesis. However, the length of the scaffold can affect manufacturability when using solid-phase RNA synthesis, and longer lengths can result in increased manufacturing costs, decreased purity and yield, and a higher synthesis failure rate. For particulate formulations such as lipid nanoparticle (LNP) formulations, solid-phase RNA synthesis of the scaffold is preferred to generate the amounts required for commercial development. In previous experiments, it was confirmed that gRNA scaffold 235 had enhanced properties compared to gRNA scaffold 174, but the increase in its length (in nucleotides) made its use in LNP formulations problematic due to synthetic manufacturing constraints. Therefore, alternative sequences were sought. In some embodiments, the present disclosure provides a gRNA variant scaffold with improved manufacturability compared to the gRNA scaffold from which it is derived. In some embodiments, the present disclosure provides a gRNA having a sequence of less than about 115 nucleotides, less than about 110 nucleotides, or less than about 100 nucleotides for the gRNA scaffold and the linked targeting sequence.
[0266] In some embodiments, the gRNA scaffold was designed and modified by introducing one or more mutations at positions selected from the group consisting of U11, U24, A29, and A87 in the scaffold 174 (SEQ ID NO: 1744) sequence. In some embodiments, the gRNA comprises a sequence having at least about 70% sequence identity thereto, comprising the sequence of SEQ ID NO: 1744, or the extended stem-loop sequence of SEQ ID NO: 49739 and one or more mutations at positions selected from the group consisting of U11, U24, A29, and A87. In one embodiment described above, the mutations consist of U11C, U24C, A29C, and A87G, resulting in the sequence of SEQ ID NO: 1746.
[0267] In another embodiment, the scaffold 235 array was modified by domain swapping in which the extended stem loop of scaffold 174 was replaced with the extended stem loop of 235 scaffolds, resulting in the design of a chimeric gRNA scaffold 316 (SEQ ID NO: 1746) having 89 nucleotides as compared to 99 nucleotides of the gRNA scaffold 235. The resulting 316 scaffold has the further advantage that the extended stem loop does not contain a CpG motif, which is an enhanced property that reduces the potential to induce an immune response. In some embodiments, the shorter sequence length of the 316 scaffold results in an improved higher fidelity in the ability to synthetically generate a guide with an accurate and complete sequence, as well as an enhanced ability to be successfully incorporated into the LNP. In some embodiments, the present disclosure provides chemically modified gRNA 316 variants, as described below.
[0268] e. Chemically Modified gRNA In some embodiments, the gRNA has one or more chemical modifications. In some embodiments, the chemical modification is the addition of a 2’O-methyl group to one or more nucleotides of the sequence. In some embodiments, the chemical modification is the substitution of a phosphorothioate bond between two or more nucleotides of the sequence. In some embodiments, the first 1, 2, or 3 nucleosides (i.e., A, C, and U in the case of gRNAs 174, 235, and 316) at the 5’ end of the scaffold are modified by the addition of a 2’O-methyl group, and each of the modified nucleosides is linked to the adjacent nucleoside by a phosphorothioate bond. Similarly, the last 1, 2, or 3 nucleotides at the 3’ end of the targeting sequence linked to the 3’ end of the scaffold are likewise modified. In some embodiments, the present disclosure provides a chemical modification to the gRNA selected from the group consisting of SEQ ID NOs: 2948 - 2956, 2958 - 2966, and 2968 - 2976 shown in Table 25, or sequences having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto. In some embodiments, the gRNA having a chemical modification comprises a scaffold of the sequences of SEQ ID NOs: 2948 - 2956, 2958 - 2966, and 2968 - 2976, i.e., the sequences of SEQ ID NOs: 2948 - 2956, 2958 - 2966, and 2968 - 2976, excluding the spacers represented as undefined nucleotides in the foregoing sequences. One of ordinary skill in the art will understand that the foregoing 20 3’-terminal undefined sequences represent non-targeting sequences and can be replaced with any suitable targeting sequence complementary to the target nucleic acid of the PCSK9 gene, e.g., a targeting sequence selected from the group consisting of SEQ ID NOs: 1824 - 2944. In some embodiments, the chemically modified gRNA comprises the sequence of SEQ ID NO: 2968. Schematic diagrams of the structures of gRNA variants 174, 235, and 316 are shown in FIGS. 19A - 19C, respectively. In some embodiments, the gRNA having a chemical modification exhibits improved stability compared to a gRNA having no chemical modification.
[0269] f. Complex formation using a repressor fusion protein Upon delivery or expression of the components of the system in target cells, the gRNA variant can complex as an RNP with a repressor fusion protein comprising a CRISPR protein without catalytic activity and bind to the target nucleic acid of the PCSK9 gene. In some embodiments, the gRNA variant has an improved ability to form an RNP complex with the repressor fusion protein as compared to a reference gRNA or another gRNA variant from which it is derived. In some embodiments, the improvement in ribonucleoprotein complex formation can improve the efficiency with which a functional RNP is assembled. In some embodiments, more than 90%, more than 93%, more than 95%, more than 96%, more than 97%, more than 98%, or more than 99% of the RNP comprising the gRNA variant and its targeting sequence is effective for gene silencing of the target nucleic acid.
[0270] VI. Polynucleotides and vectors In another aspect, the disclosure relates to a repressor fusion protein useful for the repression and epigenetic modification of the PCSK9 gene, and in some embodiments, a polynucleotide encoding a gRNA.
[0271] The repressor fusion protein or the mRNA encoding the repressor fusion protein of the disclosure can be prepared by in vitro synthesis using conventional methods known in the art. Various commercially available synthesis apparatuses, for example, automated synthesis apparatuses by Applied Biosystems, Inc., Beckman, etc. are available. By using a synthesis apparatus, naturally occurring amino acids or nucleotides (where applicable) can be replaced with non-natural amino acids or nucleotides. The specific sequence and preparation method are determined by convenience, economy, required purity, etc. The gRNA can also be generated synthetically, for example, by using a T7 RNA polymerase system known in the art.
[0272] The repressor fusion protein and / or gRNA can also be recombinantly produced from a polynucleotide sequence encoding any of the repressors or gRNAs of the embodiments described herein, and can be prepared by incorporating the coding gene into an expression vector suitable for a host cell using recombinant techniques known in the art. For the production of any of the encoded repressor fusion proteins and / or gRNAs of the embodiments described herein, the method includes transforming a suitable host cell with an expression vector containing the coding polynucleotide, and culturing the host cell under conditions that allow for expression or transcription in, or that enable, the resulting repressor or gRNA-transformed host cell, which is recovered by the methods described herein, or by standard purification methods known in the art, or as described in the examples. Standard recombinant techniques in molecular biology are used to generate the polynucleotides and expression vectors of the present disclosure.
[0273] The repressor fusion proteins and / or gRNAs of the present disclosure can also be isolated and purified according to conventional methods of recombinant synthesis. The lysate can be prepared from the expression host, and the lysate can be purified using high performance liquid chromatography (HPLC), size exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification techniques. In most cases, the compositions used contain at least 50% by weight, more generally at least 75% by weight, preferably at least 95% by weight, and usually at least 99.5% by weight of the desired product, with respect to the method of preparation of the product and contaminants associated with its purification. Usually, the percentages are based on total protein. Thus, in some cases, the repressor fusion proteins or gRNAs of the present disclosure are at least 80% pure, at least 85% pure, at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure (e.g., free of contaminants or other macromolecules, etc.).
[0274] Furthermore, the present disclosure provides a vector comprising a repressor fusion protein and, optionally, a polynucleotide encoding a gRNA described herein. In some cases, the vector is utilized for the expression and recovery of the CasX and gRNA components of the repressor fusion protein:gRNA system. In other cases, the vector is utilized for the delivery of the encoding polynucleotide to target cells for the repression and / or epigenetic modification of a target nucleic acid, as described more fully below. In some embodiments, the sequences encoding the repressor fusion protein and the gRNA are encoded by the same vector. In some embodiments, the sequences encoding the repressor fusion protein and the gRNA are encoded by sequences on different vectors. Suitable vectors are described, for example, in International Publication No. WO 2022120095A1 and International Publication No. WO 2020247882A1, which are incorporated herein by reference. Depending on the host / vector system utilized, as described in International Publication No. WO 2022120095A1 and International Publication No. WO 2020247882A1, any of several suitable transcriptional and translational control elements, including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators, etc., may be used in the expression vector.
[0275] In some embodiments, the present disclosure provides a polynucleotide sequence encoding a repressor fusion protein comprising the repressor fusion proteins of SEQ ID NOs: 3131-3132 as set forth in Table 20, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the present disclosure provides an isolated polynucleotide sequence encoding a gRNA variant. In some embodiments, the present disclosure provides a polynucleotide encoding a gRNA comprising a scaffold sequence of SEQ ID NOs: 1744-1746 and 2947-2976, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto, wherein the expressed gRNA variant retains the ability to form an RNP with the repressor fusion protein. In some embodiments, the present disclosure provides a polynucleotide sequence encoding a gRNA comprising a targeting sequence of SEQ ID NOs: 1824-2944, or a sequence having at least about 65%, at least about 75%, at least about 85%, or at least about 95% identity thereto. In some embodiments, the present disclosure provides a polynucleotide sequence encoding a gRNA comprising a targeting sequence of SEQ ID NOs: 1824-1890, 1910, 1925, 2672, 2675, 2694, and 2714, or a sequence having at least about 65%, at least about 75%, at least about 85%, or at least about 95% identity thereto.
[0276] In some embodiments, the present disclosure relates to methods for generating polynucleotide sequences encoding a repressor fusion protein or gRNA, including variants thereof, and methods for expressing a protein or RNA transcribed by the polynucleotide sequence. Generally, the methods include generating a polynucleotide sequence encoding a repressor fusion protein or gRNA of any of the embodiments described herein, and incorporating the coding gene into an expression vector. In some embodiments, the vector is designed for transduction of cells for suppression and / or epigenetic modification of a PCSK9 target nucleic acid. Such vectors include retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated virus (AAV) vectors, herpes simplex virus (HSV) vectors, plasmids, minicircles, nanoplasmids, DNA vectors, and RNA vectors. In other embodiments, the expression vector is designed for production of a repressor fusion protein, an mRNA encoding a repressor fusion protein, or a gRNA in either a cell-free system or a host cell. For production of any of the encoded repressor fusion proteins or gRNAs of the embodiments described herein in a host cell, the method includes transforming a suitable host cell with an expression vector containing the coding polynucleotide, and culturing the host cell under conditions that allow expression or transcription of, or enable, any of the resulting repressor fusion proteins or gRNAs of the embodiments described herein in the transformed host cell, thereby producing a repressor fusion protein or gRNA, which is recovered by the methods described herein (e.g., as described in the following examples) or by standard purification methods known in the art. Standard recombinant techniques in molecular biology are used to generate the polynucleotides and expression vectors of the present disclosure.
[0277] According to the present disclosure, a nucleic acid sequence encoding a repressor fusion protein or gRNA of any of the embodiments described herein is used to generate a recombinant DNA molecule that induces expression in a suitable host cell. Several cloning strategies are suitable for practicing the present disclosure, and many of them are used to generate constructs containing a gene encoding a composition of the present disclosure or its complement. In some embodiments, the cloning strategy is used to generate a gene encoding a construct containing nucleotides encoding a repressor fusion protein or gRNA that is used to transform a host cell for expression of the composition.
[0278] In one approach, first, a construct containing a DNA sequence encoding a repressor fusion protein or gRNA is prepared. Exemplary methods for the preparation of such constructs are described in the Examples. The construct is then used to generate an expression vector suitable for transforming a host cell, such as a prokaryotic or eukaryotic host cell for expression and recovery of the protein construct, in the case of a repressor fusion protein or gRNA. If desired, the host cell is E. coli. In other embodiments, the cell is a eukaryotic cell. Eukaryotic host cells can be selected from baby hamster kidney fibroblast (BHK) cells, human embryonic kidney 293 (HEK293), human embryonic kidney 293T (HEK293T), NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, hybridoma cells, NIH3T3 cells, CV-1 (monkey) (COS) derived from SV40 genetic material, HeLa, Chinese hamster ovary (CHO), yeast cells, or other eukaryotic cells known in the art suitable for the production of recombinant products. Exemplary methods for the generation of the expression vector, transformation of the host cell, and expression and recovery of the repressor fusion protein or gRNA are described in the Examples.
[0279] Genes encoding repressor fusion proteins or gRNA constructs can be made in one or more steps either completely synthetically or by synthesis in combination with enzymatic processes such as restriction enzyme-mediated cloning, PCR, and overlap extension, including the methods fully described in the examples. The methods disclosed herein can be used, for example, to ligate the sequences of polynucleotides encoding various components to a gene of a desired sequence. Genes encoding polypeptide compositions are assembled from oligonucleotides using standard techniques of gene synthesis.
[0280] In some embodiments, the nucleotide sequence encoding the repressor fusion protein is codon-optimized. This type of optimization can involve mutations of the coding nucleotide sequence to mimic the codon preference of the intended host organism or cell while encoding the same protein. Thus, the codons can be changed, but the encoded protein remains unchanged. For example, if the intended target cells of the repressor fusion protein are human cells, a human codon-optimized repressor fusion protein coding nucleotide sequence can be used. As another non-limiting example, if the intended host cells are mouse cells, a mouse codon-optimized repressor fusion protein coding nucleotide sequence can be generated. Gene design can be carried out using algorithms that optimize the codon usage and amino acid composition appropriate for the host cells utilized for the production of the repressor fusion protein or gRNA. In one method of the present disclosure, as described above, a library of polynucleotides encoding the components of the construct is generated and then assembled. The resulting gene is then assembled and the resulting gene is used to transform host cells and produce and recover repressor fusion protein or gRNA compositions for use in the evaluation of their properties or the modification of PCSK9 target nucleic acids, as described herein.
[0281] In some embodiments, the nucleotide sequence encoding the gRNA is operably linked to a control element, such as a transcriptional control element, e.g., a promoter. In some embodiments, the nucleotide sequence encoding the repressor fusion protein is operably linked to a control element, such as a transcriptional control element, e.g., a promoter. In some cases, the promoter is a constitutively active promoter. In some cases, the promoter is a regulatable promoter. In some cases, the promoter is an inducible promoter. In some cases, the promoter is a tissue-specific promoter. In some cases, the promoter is a cell type-specific promoter. In some cases, the transcriptional control element (e.g., a promoter) is functional in a target cell type or target cell population. For example, in some cases, the transcriptional control element can be functional in eukaryotic cells, e.g., hepatocytes or liver sinusoidal endothelial cells.
[0282] Non-limiting examples of Pol II promoters operably linked to a polynucleotide encoding a repressor fusion protein of the present disclosure include EF-1 alpha, EF-1 alpha core promoter, Jens Tornoe (JeT), a promoter derived from cytomegalovirus (CMV), CMV immediate early (CMVIE), CMV enhancer, herpes simplex virus (HSV) thymidine kinase, early and late simian virus 40 (SV40), SV40 enhancer, long terminal repeat (LTR) derived from retrovirus, mouse metallothionein-I, adenovirus major late promoter (Ad MLP), CMV promoter full-length promoter, minimal CMV promoter, chicken beta-actin promoter (CBA), CBA hybrid (CBh), chicken beta-actin promoter having a cytomegalovirus enhancer (CB7), chicken beta-actin promoter and rabbit beta-globin splice acceptor site fusion (CAG), Rous sarcoma virus (RSV) promoter, HIV-Ltr promoter, hPGK promoter, HSVTK promoter, 7SK promoter, Mini-TK promoter, human synapsin I (SYN) promoter conferring neuron-specific expression, beta-actin promoter, supercore promoter 1 (SCP1), Mecp2 promoter for selective expression in neurons, minimal IL-2 promoter, Rous sarcoma virus enhancer / promoter (single), spleen focus-forming virus long terminal repeat (LTR) promoter, TBG promoter, promoter from the human thyroxine-binding globulin gene (liver-specific), PGK promoter, human ubiquitin C promoter (UBC), UCOE promoter (promoter of HNRPA2B1-CBX3), synthetic CAG promoter, histone H2 promoter, histone H3 promoter, U1a1 small nuclear RNA promoter (226 nt), U1a1 small nuclear RNA promoter (226 nt), U1b2 small nuclear RNA promoter (246 nt)26, GUSB promoter, CBh promoter, rhodopsin (Rho) promoter, spleen focus-forming virus (SFFV) promoter susceptible to silencing, human H1 promoter (H1), POL1 promoter, TTR minimal enhancer / promoter, b-kinetin promoter, mouse mammary tumor virus long terminal repeat (LTR) promoter, human eukaryotic initiation factor 4A (EIF4A1) promoter, ROSA26 promoter, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter, tRNA promoter, and shortened versions and sequence variants thereof as described above, but not limited thereto. In certain embodiments, the Pol II promoter is EF-1 alpha, and the promoter enhances transfection efficiency, transgene transcription or expression of CRISPR nuclease, the percentage of expression-positive clones, and the copy number of episomal vectors in long-term culture.
[0283] Non-limiting examples of Pol III promoters linked to a polynucleotide encoding a gRNA variant of the present disclosure include U6, mini-U6, U6 short promoter, 7SK, and H1 variants, BiH1 (bidirectional H1 promoter), BiU6, Bi7SK, BiH1 (bidirectional U6, 7SK, and H1 promoters), gorilla U6, rhesus U6, human 7SK, human H1 promoter, and shortened versions and sequence variants thereof, but are not limited thereto. In the foregoing embodiments, the pol III promoter enhances the transcription of the gRNA. In certain embodiments, the Pol III promoter is U6 and the promoter enhances the expression of the gRNA. In another specific embodiment, the promoter linked to the gene encoding the tropism factor is the CMV promoter. Experimental details and data for the use of such promoters are provided in the examples.
[0284] The selection of suitable vectors and promoters is well within the ordinary skill in the art with respect to the control of expression. The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also include a nucleotide sequence encoding a protein tag (e.g., 6xHis tag, hemagglutinin tag, fluorescent protein, etc.) that is fused to a repressor fusion protein and thus results in a chimeric protein used for purification or detection.
[0285] The recombinant expression vectors of the present disclosure can also contain elements that promote robust expression of the proteins and gRNAs of the present disclosure. For example, the recombinant expression vector can contain one or more of post-transcriptional regulatory elements such as polyadenylation (poly(A)), intron sequences, or woodchuck hepatitis post-transcriptional regulatory element (PTRE). Exemplary poly(A) sequences include hGH poly(A) signal (short), HSV TK poly(A) signal, synthetic polyadenylation signal, SV40 poly(A) signal, β-globin poly(A) signal, etc. (e.g., SEQ ID NO: 3459, etc.). Those skilled in the art will be able to select suitable elements for inclusion in the recombinant expression vectors described herein.
[0286] The polynucleotide encoding the repressor fusion protein or gRNA sequence can be cloned individually into the expression vector. The selection of appropriate vectors and promoters is well within the scope of those skilled in the art, for example, because it is relevant to the control of expression for suppressing the expression and / or epigenetic modification of the PCSK9 gene. The expression vector can also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector can also contain appropriate sequences for amplifying the expression.
[0287] Nucleic acid sequences are inserted into vectors by various procedures. Generally, DNA is inserted into appropriate restriction endonuclease sites using techniques known in the art. Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, enhancer elements, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques known to those of skill in the art. Such techniques are well known in the art and are fully described in scientific and patent literature. A variety of vectors are publicly available. The vector may be in the form of, for example, a plasmid, cosmid, viral particle, or phage that is conveniently used in recombinant DNA procedures, and the choice of vector often depends on the host cell into which it is introduced. Thus, the vector may be a vector that replicates autonomously, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., plasmid. Alternatively, the vector may be one that integrates into the host cell genome when introduced into the host cell and is replicated along with the chromosome into which it is integrated. When introduced into a suitable host cell, the expression of the repressor fusion protein can be determined using any nucleic acid or protein assay known in the art. For example, the presence of the transcribed mRNA of the repressor fusion protein can be detected and / or quantified by conventional hybridization assays (e.g., Northern blot analysis), amplification procedures (e.g., RT-PCR), SAGE (U.S. Patent No. 5,695,937), and array-based technologies (see, e.g., U.S. Patents Nos. 5,405,783, 5,412,087, and 5,445,934) using a probe complementary to any region of the CasX polynucleotide.
[0288] In some embodiments, vectors are created for the transcription of the repressor fusion protein gene, and the resulting expression and recovery of the encoded mRNA. In some embodiments, the mRNA is generated by in vitro transcription (IVT) using a PCR product or linearized plasmid DNA template and T7 RNA polymerase, and the plasmid contains a T7 promoter. When using a PCR product, the DNA sequence encoding the candidate mRNA is cloned into a plasmid containing a T7 promoter, the plasmid DNA template is linearized, and then used to perform an IVT reaction for the expression of the mRNA. Exemplary methods for generating such vectors, as well as the production and recovery of the mRNA, are provided in the following examples.
[0289] VII. Particles for Delivery of Repressor Fusion Protein In another aspect, the present disclosure provides a particle composition for delivery of a repressor fusion protein to a subject for modification of a cell or the PCSK9 gene. In some embodiments, the particle composition delivers a repressor fusion protein:gRNA system to a cell or a subject for repression of the PCSK9 gene, for example, when the repressor fusion protein comprises a CRISPR protein without catalytic activity such as dCasX. In some embodiments, the present disclosure provides synthetic nanoparticles encapsulating an mRNA encoding a repressor fusion protein comprising a gRNA variant and a dCasX protein of any of the embodiments described herein. In some embodiments, materials for generating biodegradable polymeric nanoparticles (PNPs) include polylactide, poly(lactic-co-glycolic acid) (PLGA), poly(ethyl cyanoacrylate), poly(butyl cyanoacrylate), poly(isobutyl cyanoacrylate), and poly(isohexyl cyanoacrylate), polyglutamic acid (PGA), poly(ε-caprolactone) (PCL), cyclodextrin, and natural polymers such as chitosan, albumin, gelatin, and alginate, which are the most utilized polymers for PNP synthesis (Production and clinical development of nanoparticles for gene delivery. Molecular Therapy-Methods & Clinical Development 3:16023:doi:10.1038(2016)). In some embodiments, the present disclosure provides virus-like particles for delivery of a repressor fusion protein comprising a dCasX protein and a gRNA variant (see International Publication No. WO 2021 / 113772A1, which is incorporated herein by reference). In other embodiments, the present disclosure provides lipid nanoparticles encapsulating an mRNA encoding a gRNA variant and a repressor fusion protein comprising any of the dCasX proteins of the embodiments described herein, as more fully described below.
[0290] a. Lipid nanoparticles (LNP) In another aspect, the present disclosure provides lipid nanoparticles (LNPs) for delivering the repressor fusion protein:gRNA system of the present disclosure to cells or a subject for transcriptional repression of the PCSK9 gene. In some embodiments, the LNPs of the present disclosure are tissue or organ specific (e.g., liver), have excellent biocompatibility, and can deliver the system with high efficiency, and thus can be usefully used for repression of the PCSK9 gene.
[0291] Nucleic acid polymers are unstable in biological fluids and cannot penetrate the cytoplasm of target cells in their native forms and thus require delivery systems. Lipid nanoparticles (LNPs) have proven useful for both protection of nucleic acids and delivery of nucleic acids to tissues and cells. Furthermore, the use of mRNA in LNPs for encoding CRISPR nucleases eliminates the possibility of undesirable genomic integration compared to DNA vectors. Additionally, mRNA exerts its function in the cytoplasmic compartment and thus does not require entry into the nucleus, enabling efficient translation of proteins in both mitotic and non-mitotic cells. LNPs as a delivery platform offer the additional advantage of being able to co-formulate both nuclease-encoding mRNA and gRNA into a single LNP particle.
[0292] Accordingly, in various embodiments, the present disclosure encompasses lipid nanoparticles and compositions that can be used for various purposes, including delivery of encapsulated or associated (e.g., complexed) therapeutic agents, such as nucleic acids, to cells both in vitro and in vivo. In certain embodiments, the present disclosure provides a method of treating or preventing a disease or disorder in a subject in need thereof by complexing the subject with a suitable therapeutic agent encapsulated or associated with a lipid nanoparticle that is complexed through various physical, chemical, or electrostatic interactions among one or more of the lipid components used in the composition to make the LNP. In some embodiments, the suitable therapeutic agent includes the repressor fusion protein:gRNA system described herein.
[0293] In certain embodiments, the lipid nanoparticles are useful for delivery of nucleic acids comprising, for example, mRNA encoding a repressor fusion protein of the present disclosure, and gRNA variants of the present disclosure comprising the sequences of SEQ ID NOs: 1744-1746 and 2947-2976. In some embodiments, the present disclosure provides LNPs in which the gRNA and the mRNA encoding the repressor fusion protein are incorporated into a single LNP particle. In other embodiments, the present disclosure provides LNPs in which the gRNA and the mRNA encoding the repressor fusion protein are incorporated into separate populations of LNPs, which can be formulated together at various ratios for administration. In some embodiments, the mRNA for incorporation into the LNPs of the present disclosure encodes any of the repressor fusion proteins described herein. In some embodiments, the gRNA for use with the LNPs comprises the sequences of SEQ ID NOs: 1744-1746 and 2947-2976.
[0294] The lipid nanoparticles and systems of certain embodiments of the present disclosure may be used to induce the expression of a desired protein both in vitro and in vivo by contacting a cell with a lipid nanoparticle comprising one or more of the novel ionizable cationic lipids or permanently charged cationic lipids described herein, and the lipid nanoparticle encapsulates or is associated with a nucleic acid that is expressed to produce the desired protein (e.g., messenger RNA encoding the CasX protein). In some embodiments, the lipid nanoparticles and systems may be used to decrease the expression of the PCKS9 target gene both in vitro and in vivo by contacting a cell with a lipid nanoparticle comprising one or more of the novel ionizable / cationic lipids described herein, and the lipid nanoparticle encapsulates or is associated with the nucleic acid of the CasX:gRNA system that reduces target gene expression. The lipid nanoparticles and systems of embodiments of the present disclosure may also be used separately or in combination for the co-delivery of different nucleic acids (e.g., mRNA, gRNA, siRNA, saRNA, mcDNA, and plasmid DNA) and may be useful for providing effects that require co-localization of different nucleic acids (e.g., mRNA encoding a suitable gene-modifying enzyme and gRNA for targeting of a target nucleic acid).
[0295] In some embodiments, the LNPs and LNP compositions described herein comprise at least one cationic lipid, at least one conjugate lipid, at least one steroid or derivative thereof, at least one helper lipid, or any combination thereof. Alternatively, the lipid compositions of the present disclosure may include ionizable lipids such as ionizable cationic lipids, helper lipids (usually phospholipids), cholesterol, and polyethylene glycol lipid conjugates (PEG lipids) to reduce specific absorption of plasma proteins and improve colloidal stability in biological environments by forming a hydration layer on the nanoparticles. Such lipid compositions are formulated at typical molar ratios of IL:HL:sterol:PEG-lipid of 50:10:37-39:1-3 or 20-50:8-65:15-70:1-3.0 and are modified to include or exclude one or more of the components in the conventional four-component system within the LNP and to adjust the individual properties.
[0296] The LNPs and LNP compositions of the present disclosure are configured to protect the encapsulated payload of the systems of the present disclosure and deliver it to tissues and cells both in vitro and in vivo. Various embodiments of the LNPs and LNP compositions of the present disclosure are described in more detail herein.
[0297] Cationic lipid In some embodiments, the LNPs and LNP compositions of the present disclosure comprise at least one cationic lipid. The term "cationic lipid" refers to lipid species having a net positive charge. In some embodiments, the cationic lipid is an ionizable cationic lipid that has a net positive charge at a selected pH < pKa of the ionizable lipid. In some embodiments, the ionizable cationic lipid has a pKa of less than about 7 such that the LNPs and LNP compositions achieve efficient encapsulation of the payload at a relatively low pH below the pKa of each lipid. In some embodiments, the cationic lipid has a pKa of about 5 to about 8, about 5.5 to about 7.5, about 6 to about 7, or about 6.5 to about 7. In some embodiments, the cationic lipid may be protonated at a pH below the pKa of the cationic lipid, which may be substantially neutral at a pH above the pKa. The LNP compositions can be safely delivered in vivo to target organs (e.g., liver, lung, heart, spleen, and tumors) and / or cells (such as hepatocytes, LSECs, heart cells, cancer cells, etc.) and exhibit a positive charge for releasing the encapsulated payload via electrostatic interaction with the anionic lipids of the endosomal membrane when the pH decreases below the pKa of the ionizable lipid during endocytosis.
[0298] Initial formulations of LNPs utilizing permanently cationic lipids resulted in LNPs with a positive surface charge that was shown to be toxic in vivo and were rapidly removed by phagocytic cells. By changing to a tertiary amine, particularly an ionizable cationic lipid with a pKa of less than 7, the LNPs achieve efficient encapsulation of the nucleic acid polymer at low pH by electrostatically interacting with the negative charge of the phosphate backbone of the mRNA, which also results in a system that is predominantly neutral at physiological pH values and thus reduces the problems associated with permanently charged cationic lipids.
[0299] As used herein, "ionizable lipid" means an amine-containing lipid that can be readily protonated, which can be a lipid whose charge state changes depending on the ambient pH. The ionizable lipid may be protonated (positively charged) at a pH below the pKa of the cationic lipid, which can be substantially neutral at a pH above the pKa. In one example, the LNP may contain a protonated ionizable lipid and / or an ionizable lipid that exhibits neutralization. In some embodiments, the LNP has a pKa of 5-8, 5.5-7.5, 6-7, or 6.5-7. The pKa of the LNP is important for in vivo stability in the target cell or organ and the release of the nucleic acid payload of the LNP. In some embodiments, the LNP having the aforementioned pKa range can be safely delivered to target organs (e.g., liver, lung, heart, spleen, and tumors) and / or target cells (such as hepatocytes, LSEC, heart cells, cancer cells, etc.) in vivo and exhibits a positive charge for releasing the encapsulated payload via electrostatic interaction with the anionic lipids of the endosomal membrane within the endosome.
[0300] An ionizable lipid is generally an ionizable compound having characteristics similar to those of lipids and can play a role in encapsulating a nucleic acid payload into the LNP with high efficiency through electrostatic interaction with a nucleic acid (e.g., the mRNA of the present disclosure).
[0301] Depending on the type of amine and tail group contained in the ionizable lipid, (i) the nucleic acid encapsulation efficiency, (ii) the PDI (polydispersity index), and / or (iii) the nucleic acid delivery efficiency of the LNP to the tissues and / or cells constituting an organ (e.g., hepatocytes or liver sinusoidal endothelial cells in the liver) may vary. In certain embodiments, the ionizable lipid is an ionizable cationic lipid and contains about 25 mol% to about 66 mol% of the total lipids present in the particle.
[0302] LNPs containing ionizable lipids containing amines can have one or more of the following characteristics: (1) the ability to encapsulate nucleic acids with high efficiency, (2) the uniform size of the prepared particles (or having a low PDI value), and / or (3) excellent nucleic acid delivery efficiency to organs such as the liver, lung, heart, spleen, bone marrow, and tumors, and / or cells constituting such organs (e.g., hepatocytes, LSEC, heart cells, cancer cells, etc.).
[0303] In certain embodiments, the cationic lipid form plays an important role in both nucleic acid encapsulation through electrostatic interactions and intracellular release by disrupting the endosomal membrane. Nucleic acid payloads are encapsulated within the LNP by the ionic interactions they form with positively charged cationic lipids. Non-limiting examples of ionizable cationic lipid components utilized in the LNPs of the present disclosure are DLin-MC3-DMA (heptatriaconta-6,9,28,31-tetraene-19-yl 4-(dimethylamino)butanoate), DLin-KC2-DMA (2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane), and those selected from TNT (1,3,5-triazinane-2,4,6-trione) and TT (N1,N3,N5-tris(2-aminoethyl)benzene-1,3,5-tricarboxamide). Non-limiting examples of helper lipids utilized in the LNPs of the present disclosure are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), PQC (2-oleoyl-1-palmitoyl-sn-glycero-3-phosphocholine), and DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) DOPG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), sphingolipids, and ceramides. Cholesterol and PEG-DMG ((R)-2,3-bis(octadecyloxy)propyl-1-(methoxypolyethylene glycol 2000) carbamate), PEG-DSG (1,2-distearoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000), or DSPE-PEG2k (1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000]) are components utilized in the LNPs of the present disclosure for LNP stability, circulation, and size.
[0304] In some embodiments, the cationic lipid in the LNP of the present disclosure contains a tertiary amine. In some embodiments, the tertiary amine contains an alkyl chain connected to the N of a tertiary amine having an ether bond. In some embodiments, the alkyl chain contains a C12-C30 alkyl chain having 0 to 3 double bonds. In some embodiments, the alkyl chain contains a C16-C22 alkyl chain. In some embodiments, the alkyl chain contains a C18 alkyl chain. Some cationic lipids and related analogs are described in US Patent Publications Nos. 20060083780, 20060240554, 20110117125, 20190336608, 20190381180, and 20200121809, US Patents Nos. 5,208,036, 5,264,618, 5,279,833, 5,283,185, 5,753,613, 5,785,992, 9,738,593, 10,106,490, 10,166,298, 10,221,127, and 11,219,634, and International Publication No. 96 / 10390, the disclosures of which are hereby incorporated by reference in their entireties.
[0305] In some embodiments, the cationic lipid in the LNP of the present disclosure may include, for example, one or more ionizable cationic lipids, and the ionizable cationic lipid is a dialkyl lipid. In other embodiments, the ionizable cationic lipid is a tetraalkyl lipid.
[0306] In some embodiments, the cationic lipid in the LNP of the present disclosure is 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA), 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxolane (DLin-K-C3-DMA), 2,2-dilinoleyl-4-(4-dimethylaminobutyl)-[1,3]-dioxolane (DLin-K-C4-DMA), 2,2-dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6-DMA), 2,2-dilinoleyl-4-N-methylpepiazino-[1,3]-dioxolane (DLin-K-MPZ), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyoxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.(Cl), 1,2-dilinoleyl-oxy-3-(N-methylpiperazino)propane (DLin-MPZ), 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxy-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 1,2-distearyloxy-N,N-dimethylaminopropane (DSDMA), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), 3-(N-(N’,N’-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), 2,3-dioleyloxy-N-[2(spemine-carboxamide)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), dioctadecylamidoglycyl spermine (DOGS), 3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-octadecadienooxy)propane (CLinDMA), 2-[5’-(cholest-5-en-3-beta-oxy)-3’-oxapentoxy)-3-dimethyl-1-(cis,cis-9’,1-2’-octadecadienooxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N’-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 1,2-N,N’-dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), and are selected from any combination of the foregoing.
[0307] In some embodiments, the cationic lipid in the LNP of the present disclosure is selected from heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), (1,3,5-triazinane-2,4,6-trione) (TNT), N1,N3,N5-tris(2-aminoethyl)benzene-1,3,5-tricarboxamide (TT), and any combination of the foregoing.
[0308] In some embodiments, the N / P ratio (nitrogen from cationic / ionizable lipid and phosphate from nucleic acid) in the LNP of the present disclosure is in the range of about 3:1 to 7:1, or about 4:1 to 6:1, or is 3:1, or 4:1, or 5:1, or 6:1, or 7:1, or 8:1, or 9:1.
[0309] Conjugated lipid In some embodiments, the LNP and LNP compositions of the present disclosure include at least one conjugated lipid. In some embodiments, the conjugated lipid can be selected from polyethylene glycol (PEG)-lipid conjugates, polyamide (ATTA)-lipid conjugates, cationic polymer lipid conjugates (CPL), and any combination of the foregoing. In some cases, the conjugated lipid can inhibit the aggregation of the LNP of the present disclosure.
[0310] In some embodiments, the conjugate lipid of the LNP of the present disclosure comprises a pegylated lipid. The terms "polyethylene glycol (PEG)-lipid conjugate", "pegylated lipid", "lipid-PEG conjugate", "lipid-PEG", "PEG-lipid", "PEG-lipid", or "lipid-PEG" are used interchangeably herein and refer to a lipid conjugated to a polyethylene glycol (PEG) polymer, which is a hydrophilic polymer. The pegylated lipid contributes to the stability of the LNP and LNP compositions and reduces the aggregation of the LNP. In other embodiments, the lipid of the LNP comprises a peptide-modified PEG lipid used to target cell surface receptors, such as DSPE-PEG-RGD, DSPE-PEG-transferrin, DSPE-PEG-cholesterol.
[0311] Since the PEG-lipid can form the surface lipid, the size of the LNP can be easily varied by changing the ratio of the surface (PEG) lipid to the core (ionizable cationic) lipid. In some embodiments, the PEG-lipid of the LNP of the present disclosure can vary by about 1-5 mol% to modify particle properties such as size, stability, and circulation time.
[0312] The lipid-PEG conjugate contributes to the particle stability of the nanoparticles in serum within the LNP and plays a role in preventing aggregation between the nanoparticles. Furthermore, the lipid-PEG conjugate protects nucleic acids such as the mRNA encoding the repressor fusion protein of the present disclosure or the gRNA of the present disclosure from degrading enzymes during in vivo delivery of the nucleic acid, enhances the stability of the nucleic acid in vivo, and can increase the half-life of the delivered nucleic acid encapsulated in the nanoparticles. Examples of PEG-lipid conjugates include, but are not limited to, PEG-DAG conjugates, PEG-DAA conjugates, and mixtures thereof. In certain embodiments, the PEG-lipid conjugate is selected from the group consisting of PEG-diacylglycerol (PEG-DAG) conjugates, PEG-dialkyloxypropyl (PEG-DAA) conjugates, PEG-phospholipid conjugates, PEG-ceramide (PEG-Cer) conjugates, and mixtures thereof.
[0313] In some embodiments, the pegylated lipid of the LNP of the present disclosure is selected from PEG-ceramide, PEG-diacylglycerol, PEG-dialkyloxypropyl, PEG-dialkoxypropyl carbamate, PEG-phosphatidylethanoloamine, PEG-phospholipid, PEG-diacylglycerol succinate, and any combination of the foregoing.
[0314] In some embodiments, the pegylated lipid of the LNP of the present disclosure is PEG-dialkyloxypropyl. In some embodiments, the pegylated lipid is selected from PEG-didecyloxypropyl (C10), PEG-dilauroxypropyl (C12), PEG-dimyristyloxypropyl (C14), PEG-dipalmityloxypropyl (C16), PEG-distearyloxypropyl (C18), and any combination of the foregoing.
[0315] In other embodiments, the lipid-PEG conjugate of the LNP of the present disclosure can be PEG conjugated to phosphatidylethanolamine (PEG-PE), PEG conjugated to ceramide (PEG-CER, ceramide-PEG conjugate, ceramide-PEG, cholesterol, or a derivative thereof conjugated to PEG, PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE (DSPE-PEG), and mixtures thereof, i.e., PEG conjugated to a phospholipid, and can be, for example, C16-PEG2000 ceramide (N-palmitoyl-sphingosine-1-{succinyl[methoxy(polyethylene glycol)2000]}), DMG-PEG2000, 14:0 PEG2000 PE.
[0316] In some embodiments, the PEGylated lipids of the LNPs of the present disclosure are selected from 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoyl glycerol, 4-O-(2’,3’-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoxy)propyl)carbamate, 2,3-di(tetradecanoxy)propyl-N-(ω-methoxy(polyethoxy)ethyl)carbamate, and any combination of the foregoing.
[0317] In some embodiments, the PEGylated lipids of the LNPs of the present disclosure are selected from mPEG2000-1,2-di-O-alkyl-sn3-carbomoyl glyceride (PEG-C-DOMG), 1-[8’-(1,2-dimyristoyl-3-propanoxy)-carboxamido-3’,6’-dioxaoctanyl]carbamoyl-ω-methyl-poly(ethylene glycol) (2KPEG-DMG), and any combination of the foregoing.
[0318] In some embodiments, the PEG is directly attached to the lipid of the PEGylated lipid. In other embodiments, the PEG is attached to the lipid of the PEGylated lipid by a linker moiety selected from a linker moiety that does not contain an ester or an ester-containing linker moiety. Non-limiting examples of linker moieties that do not contain an ester include amide (-C(O)NH-), amino (-NR-), carbonyl (-C(O)-), carbamate (-NHC(O)O-), urea (-NHC(O)NH-), disulfide (-S-S-), ether (-O-), succinyl (-(O)CCH2CH2C(O)-), succinamidyl (-NHC(O)CH2CH2C(O)NH-), ether, disulfide, and combinations thereof. For example, the linker may contain a carbamate linker moiety and an amide linker moiety. Non-limiting examples of ester-containing linker moieties include carbonate (-OC(O)O-), succinoyl, phosphate ester (-O-(O)POH-O-), sulfonate ester, and combinations thereof.
[0319] The PEG moiety of the pegylated lipid of the LNP described in this specification can have an average molecular weight in the range of about 550 Daltons to about 10,000 Daltons. In certain embodiments, the PEG moiety has an average molecular weight of about 750 Daltons to about 5,000 Daltons, about 1,000 Daltons to about 4,000 Daltons, about 1,500 Daltons to about 3,000 Daltons, about 750 Daltons to about 3,000 Daltons, or about 1750 Daltons to about 2,000 Daltons.
[0320] In some embodiments, the conjugate lipid (e.g., pegylated lipid) comprises about 1 mol% to about 60 mol%, about 2 mol% to about 50 mol%, about 5 mol% to about 40 mol%, or about 5 mol% to about 20 mol% of the total lipids present in the LNP and / or LNP composition. In certain embodiments, the conjugate lipid constitutes about 0.5 mol% to about 3 mol% of the total lipids present in the particle.
[0321] In additional embodiments, the conjugate lipid (e.g., pegylated lipid) of the LNP of the present disclosure comprises at least about 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 mol% of the total lipids present in the LNP and / or LNP composition, or includes any intermediate range of the foregoing.
[0322] For the lipids in the lipid-PEG conjugate of the LNP of the present disclosure, any lipid that can bind to polyethylene glycol can be used without limitation, and phospholipids and / or cholesterol, which are other elements of the LNP, can also be used. In some embodiments, the lipid in the lipid-PEG conjugate can be, but is not limited to, ceramide, dimyristoyl glycerol (DMG), succinoyl-diacyl glycerol (s-DAG), distearoyl phosphatidylcholine (DSPC), distearoyl phosphatidylethanolamine (DSPE), or cholesterol.
[0323] In the lipid-PEG conjugate of the LNP of the present disclosure, PEG can be directly conjugated to the lipid or linked to the lipid via a linker moiety. Any linker moiety suitable for binding PEG to the lipid can be used, including, for example, linker moieties that do not contain esters and linker moieties that contain esters. Linker moieties that do not contain esters include, but are not limited to, amide (-C(O)NH-), amino (-NR-), carbonyl (-C(O)-), carbamate (-NHC(O)O-), urea (-NHC(O)NH-), disulfide (-S-S-), ether (-O-), succinyl (-(O)CCH2CH2C(O)-), succinamidyl (-NHC(O)CH2CH2C(O)NH-), ether, disulfide, as well as combinations thereof (for example, a linker containing both a carbamate linker moiety and an amide linker moiety). Linker moieties that contain esters include, but are not limited to, carbonate (-OC(O)O-), succinoyl, phosphate ester (-O-(O)POH-O-), sulfonate ester, and combinations thereof.
[0324] Steroid In some embodiments, the LNPs and LNP compositions of the present disclosure include at least one steroid or a derivative thereof. In some embodiments, the steroid includes cholesterol. In some embodiments, the LNPs and LNP compositions include cholesterol derivatives selected from cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, and any combination of the foregoing.
[0325] In some embodiments, the steroid (e.g., cholesterol) of the LNPs of the present disclosure comprises from about 1 mol% to about 65 mol%, from about 2 mol% to about 50 mol%, from about 5 mol% to about 40 mol%, or from about 5 mol% to about 20 mol% of the total lipids present in the LNPs and / or LNP compositions. In other embodiments, the steroid (e.g., cholesterol) of the LNPs of the present disclosure comprises at least about 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 mol% of the total lipids present in the LNPs and / or LNP compositions, or any intermediate range therebetween.
[0326] Helper lipid / helper lipid or structural lipid In some embodiments, the LNPs and LNP compositions of the present disclosure comprise at least one helper lipid. In some embodiments, the helper lipid is a non-cationic lipid selected from anionic lipids, neutral lipids, or both. In some embodiments, the helper lipid comprises at least one phospholipid. In some embodiments, the phospholipid is selected from anionic phospholipids, neutral phospholipids, or both. The phospholipids of the elements of the LNPs and LNP compositions may serve to cover and protect the core of the LNPs formed by the interaction of the cationic lipids and nucleic acids in the LNPs, and may promote cell membrane permeation and endosomal escape during intracellular delivery of the nucleic acids by binding to the phospholipid bilayer of the target cells. The phospholipids that can promote fusion of the LNPs with the cells may include, but are not limited to, any of the phospholipids selected from the group described below.
[0327] In some embodiments, the LNPs and LNP compositions include, but are not limited to, at least one phospholipid selected from dipalmitoyl-phosphatidylcholine (DPPC), distearoyl-phosphatidylcholine (DSPC), dioleoyl-phosphatidylethanolamine (DOPE), dioleoyl-phosphatidylcholine (DOPC), dioleoyl-phosphatidylglycerol (DOPG), palmitoyloleoyl-phosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), palmitoyloleyol-phosphatidylglycerol (POPG), dipalmitoyl-phosphatidylethanolamine (DPPE), dipalmitoyl-phosphatidylglycerol (DPPG), dimyristoyl-phosphatidylethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine, dielaidoyl-phosphatidylethanolamine (DEPE), stearoyloleoyl-phosphatidylethanolamine (SOPE), egg phosphatidylcholine (EPC), phosphatidylethanolamine (PE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-[phospho-L-serine] (DOPS), 1,2-dioleoyl-sn-glycero-3-[phospho-L-serine], and any combination of the foregoing. In one example, LNPs containing DOPE can be effective in mRNA delivery (excellent drug delivery efficacy).
[0328] In some embodiments, the helper lipid (e.g., phospholipid) of the LNP of the present disclosure comprises from about 1 mol% to about 60 mol%, from about 2 mol% to about 50 mol%, from about 5 mol% to about 40 mol%, or from about 5 mol% to about 20 mol% of the total lipids present in the LNP and / or the LNP composition. In other embodiments, the helper lipid (e.g., phospholipid) of the LNP of the present disclosure comprises at least about 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 mol% of the total lipids present in the LNP and / or the LNP composition, or any intermediate range therebetween.
[0329] The total lipids present in the LNP and / or the LNP composition are derived from LNP formulations that contain individual or multiple components, including but not limited to one, two, three, four, and five components, and include cationic lipids or ionizable cationic lipids, conjugate lipids (e.g., pegylated lipids), peptide-conjugated PEG lipids, steroids (e.g., cholesterol), peptide-conjugated structural lipids (e.g., DSPE-cRGD), and lipids combined with structural lipids (e.g., phospholipids).
[0330] The LNP and / or the LNP composition can be prepared by dissolving the total lipids (or a portion thereof) in an organic solvent (e.g., ethanol) and subsequently mixing it with a payload (e.g., the nucleic acid of the system) dissolved in an acidic buffer (e.g., pH 1.0 - 6.5) through a micromixer. At this pH, the ionizable cationic lipid becomes positively charged and interacts with the negatively charged nucleic acid polymer. The resulting nanostructures containing the nucleic acid are then converted to neutral LNPs when dialyzed against a neutral buffer that also includes the removal of the organic solvent (e.g., ethanol) during the exchange of the LNP into a physiologically relevant buffer. The LNPs and / or the LNP composition thus formed have a distinct electron density nanostructured core that is organized into inverse micelles around the payload encapsulated with the cationic lipid, in contrast to the conventional bilayer liposome structure. In another embodiment, the LNP can form a vesicle-like structure having the nucleic acid within an aqueous pocket along a non-electron density lipid core.
[0331] b. Lipid nanoparticle characteristics The LNP and / or LNP composition can be prepared by dissolving the total lipid (or a portion thereof) in an organic solvent (e.g., ethanol), followed by mixing through a micromixer with a payload (e.g., the nucleic acid of the system) dissolved in an acidic buffer (e.g., pH 1.0 - 6.5). At this pH, the ionizable cationic lipid is positively charged and interacts with the negatively charged nucleic acid polymer. The resulting nanostructure containing the nucleic acid is then converted to a neutral LNP when dialyzed against a neutral buffer including removal of the organic solvent (e.g., ethanol) during the exchange of the LNP into a physiologically relevant buffer. The LNP and / or LNP composition thus formed has a distinct electron density nanostructure core that is organized into inverse micelles around the payload encapsulated with the cationic lipid, in contrast to the conventional bilayer liposome structure. In another embodiment, the LNP can form a vesicle-like structure having the nucleic acid within an aqueous pocket along a non-electron density lipid core.
[0332] In some embodiments, the LNP and / or LNP composition of the present disclosure comprises cationic lipid:helper lipid (e.g., phospholipid):steroid (e.g., cholesterol):conjugate lipid (e.g., pegylated lipid) in a molar ratio of 20 - 50:10 - 30:30 - 60:0.5 - 5, in a molar ratio of 25 - 45:10 - 25:40 - 50:0.5 - 3, in a molar ratio of 25 - 45:10 - 20:40 - 55:0.5 - 3, or in a molar ratio of 25 - 45:10 - 20:40 - 55:1.0 - 1.5.
[0333] In some embodiments, the LNP and / or LNP composition of the present disclosure has a total lipid:payload ratio (mass / mass) of about 1 to about 100. In some embodiments, the total lipid:payload ratio is about 1 to about 50, about 2 to about 25, about 3 to about 20, about 4 to about 15, or about 5 to about 10. In some embodiments, the total lipid:payload ratio is about 5 to about 15, e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or any intermediate range therebetween.
[0334] In certain embodiments, the LNPs of the present disclosure comprise a total lipid:nucleic acid mass ratio of from about 5:1 to about 15:1. In some embodiments, the weight ratio of the cationic lipid to the nucleic acid included in the LNP can be from 1 to 20:1, 1 to 15:1, 1 to 10:1, 5 to 20:1, 5 to 15:1, 5 to 10:1, 7.5 to 20:1, 7.5 to 15:1, or 7.5 to 10:1.
[0335] In some embodiments, the LNPs of the present disclosure can include 20 to 50 parts by weight of a cationic lipid, 10 to 30 parts by weight of a phospholipid, 20 to 60 parts by weight (or 20 to 60 parts by weight) of cholesterol, and 0.1 to 10 parts by weight (or 0.25 to 10 parts by weight, 0.5 to 5 parts by weight) of a lipid-PEG conjugate. Alternatively, the LNP can include, based on the total nanoparticle weight, 20 to 50 wt% of a cationic lipid, 10 to 60 wt% of a phospholipid, 20 to 60 wt% (or 30 to 60 wt%) of cholesterol, and 0.1 to 10 wt% (or 0.25 to 10 wt%, 0.5 to 5 wt%) of a lipid-PEG conjugate. As a further alternative, the LNP can include, based on the total nanoparticle weight, 25 to 50 wt% of a cationic lipid, 10 to 20 wt% of a phospholipid, 35 to 55 wt% of cholesterol, and 0.1 to 10 wt% (or 0.25 to 10 wt%, 0.5 to 5 wt%) of a lipid-PEG conjugate.
[0336] In some embodiments, the LNPs of the present disclosure have an average diameter that includes about 20 to 200 nm, 20 to 180 nm, 20 to 170 nm, 20 to 150 nm, 20 to 120 nm, 20 to 100 nm, 20 to 90 nm, 30 to 200 nm, 30 to 180 nm, 30 to 170 nm, 30 to 150 nm, 30 to 120 nm, 30 to 100 nm, 30 to 90 nm, 40 to 200 nm, 40 to 180 nm, 40 to 170 nm, 40 to 150 nm, 40 to 120 nm, 40 to 100 nm, 40 to 90 nm, 40 to 80 nm, 40 to 70 nm, 50 to 200 nm, 50 to 180 nm, 50 to 170 nm, 50 to 150 nm, 50 to 120 nm, 50 to 100 nm, 50 to 90 nm, 60 to 200 nm, 60 to 180 nm, 60 to 170 nm, 60 to 150 nm, 60 to 120 nm, 60 to 100 nm, 60 to 90 nm, 70 to 200 nm, 70 to 180 nm, 70 to 170 nm, 70 to 150 nm, 70 to 120 nm, 70 to 100 nm, 70 to 90 nm, 80 to 200 nm, 80 to 180 nm, 80 to 170 nm, 80 to 150 nm, 80 to 120 nm, 80 to 100 nm, 80 to 90 nm, 90 to 200 nm, 90 to 180 nm, 90 to 170 nm, 90 to 150 nm, 90 to 120 nm, or 90 to 100 nm, or any intermediate range among the foregoing.
[0337] In some embodiments, the LNPs and / or LNP compositions of the present disclosure have a positive charge at acidic pH and can encapsulate a payload (e.g., a therapeutic agent) by electrostatic interactions generated by the negative charge of the payload (e.g., a therapeutic agent). The term "encapsulation" means a mixture of lipids that forms an LNP and surrounds and embeds the payload (e.g., a therapeutic agent) under physiological conditions. The term "encapsulation efficiency" as used herein is the ratio of the amount of payload (e.g., a therapeutic agent) encapsulated by the LNP. This is a measure of the payload (e.g., a therapeutic agent) in bulk before disruption of the LNP divided by the total amount of payload (e.g., a therapeutic agent) measured in bulk after disruption of the LNP using a surfactant-based reagent such as 1-2% Triton X-100. The encapsulation efficiency of the LNPs and LNP compositions can be 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 94% or more, or 95% or more. In other embodiments, the encapsulation efficiency of the LNPs and / or LNP compositions is about 80%-99%, about 85%-98%, about 88%-95%, about 90%-95%, or the payload (e.g., the nucleic acid of the system) is completely encapsulated within the lipid portion of the LNP composition and thereby protected from enzymatic degradation. In some embodiments, the payload (e.g., a therapeutic agent) is not substantially degraded after exposing the LNP and / or the LNP and LNP composition to a nuclease for at least about 20, 30, 45, or 60 minutes, or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours at 37°C. In some embodiments, the payload (e.g., the nucleic acid of the system) is complexed with the lipid portion of the LNP and / or LNP composition. The LNPs and / or LNP compositions of the present disclosure are non-toxic to mammals such as humans.
[0338] The term "fully encapsulated" indicates that the payload (e.g., the nucleic acid of the system) in the LNP and / or LNP composition is not significantly degraded after exposure to conditions that significantly degrade free DNA, RNA, or protein. In a fully encapsulated system, less than about 25%, more preferably less than about 10%, and most preferably less than about 5% of the payload (e.g., the nucleic acid of the system) in the LNP and / or LNP composition is degraded by conditions that degrade 100% of the unencapsulated payload. "Fully encapsulated" also indicates that the LNP and / or LNP composition is serum stable and protects the payload until the endosome escapes and releases it into the cytoplasm of the cell, without degrading into its component parts immediately after exposure to serum proteins after in vivo administration.
[0339] In some embodiments, the amount of the LNP and / or LNP composition having a payload (e.g., a therapeutic agent) encapsulated therein is about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 90% to about 100%, about 30% to about 95%, about 40% to about 95%, about 50% to about 95%, about 60% to about 95%, %, about 70% to about 95%, about 80% to about 95%, about 85% to about 95%, about 90% to about 95%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 80% to about 90%, or at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any intermediate range of the foregoing.
[0340] In some embodiments, the amount of payload (e.g., nucleic acid) encapsulated within the LNP and / or LNP composition is from about 30% to about 100%, from about 40% to about 100%, from about 50% to about 100%, from about 60% to about 100%, from about 70% to about 100%, from about 80% to about 100%, from about 90% to about 100%, from about 30% to about 95%, from about 40% to about 95%, from about 50% to about 95%, from about 60% to about 95%, from about 70% to about 95%, from about 80% to about 95%, from about 85% to about 95%, from about 90% to about 95%, from about 30% to about 90%, from about 40% to about 90%, from about 50% to about 90%, from about 60% to about 90%, from about 70% to about 90%, from about 80% to about 90%, or at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any intermediate range among the foregoing.
[0341] In some embodiments, the nucleic acids of the present disclosure, such as mRNA encoding a repressor fusion protein and / or gRNA, can be provided in a solution mixed with a lipid solution such that the nucleic acid can be encapsulated in lipid nanoparticles. Suitable nucleic acid solutions can be any aqueous solution containing nucleic acids encapsulated at various concentrations. For example, suitable nucleic acid solutions can contain nucleic acids at a concentration of about 0.01 mg / ml, 0.05 mg / ml, 0.06 mg / ml, 0.07 mg / ml, 0.08 mg / ml, 0.09 mg / ml, 0.1 mg / ml, 0.15 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 1.0 mg / ml, 1.25 mg / ml, 1.5 mg / ml, 1.75 mg / ml, or 2.0 mg / ml or higher. In some embodiments, the nucleic acid comprises an mRNA solution encoding a repressor fusion protein, and a suitable mRNA solution can contain mRNA at a concentration in the range of about 0.01 - 2.0 mg / ml, 0.01 - 1.5 mg / ml, 0.01 - 1.25 mg / ml, 0.01 - 1.0 mg / ml, 0.01 - 0.9 mg / ml, 0.01 - 0.8 mg / ml, 0.01 - 0.7 mg / ml, 0.01 - 0.6 mg / ml, 0.01 - 0.5 mg / ml, 0.01 - 0.4 mg / ml, 0.01 - 0.3 mg / ml, 0.01 - 0.2 mg / ml, 0.01 - 0.1 mg / ml, 0.05 - 1.0 mg / ml, 0.05 - 0.9 mg / ml, 0.05 - 0.8 mg / ml, 0.05 - 0.7 mg / ml, 0.05 - 0.6 mg / ml, 0.05 - 0.5 mg / ml, 0.05 - 0.4 mg / ml, 0.05 - 0.3 mg / ml, 0.05 - 0.2 mg / ml, 0.05 - 0.1 mg / ml, 0.1 - 1.0 mg / ml, 0.2 - 0.9 mg / ml, 0.3 - 0.8 mg / ml, 0.4 - 0.7 mg / ml, or 0.5 - 0.6 mg / ml.In some embodiments, a suitable mRNA solution may contain mRNA at a concentration of up to about 5.0 mg / ml, 4.0 mg / ml, 3.0 mg / ml, 2.0 mg / ml, 1.0 mg / ml, 0.9 mg / ml, 0.8 mg / ml, 0.7 mg / ml, 0.6 mg / ml, 0.5 mg / ml, 0.4 mg / ml, 0.3 mg / ml, 0.2 mg / ml, 0.1 mg / ml, 0.05 mg / ml, 0.04 mg / ml, 0.03 mg / ml, 0.02 mg / ml, 0.01 mg / ml, or 0.05 mg / ml. In some embodiments, a suitable gRNA solution may contain gRNA at a concentration of up to about 5.0 mg / ml, 4.0 mg / ml, 3.0 mg / ml, 2.0 mg / ml, 1.0 mg / ml, 0.9 mg / ml, 0.8 mg / ml, 0.7 mg / ml, 0.6 mg / ml, 0.5 mg / ml, 0.4 mg / ml, 0.3 mg / ml, 0.2 mg / ml, 0.1 mg / ml, 0.05 mg / ml, 0.04 mg / ml, 0.03 mg / ml, 0.02 mg / ml, 0.01 mg / ml, or 0.05 mg / ml.
[0342] In some embodiments, the LNP may have an average diameter of 20 nm to 200 nm, 20 to 180 nm, 20 nm to 170 nm, 20 nm to 150 nm, 20 nm to 120 nm, 20 nm to 100 nm, 20 nm to 90 nm, 30 nm to 200 nm, 30 to 180 nm, 30 nm to 170 nm, 30 nm to 150 nm, 30 nm to 120 nm, 30 nm to 100 nm, 30 nm to 90 nm, 40 nm to 200 nm, 40 to 180 nm, 40 nm to 170 nm, 40 nm to 150 nm, 40 nm to 120 nm, 40 nm to 100 nm, 40 nm to 90 nm, 40 nm to 80 nm, 40 nm to 70 nm, 50 nm to 200 nm, 50 to 180 nm, 50 nm to 170 nm, 50 nm to 150 nm, 50 nm to 120 nm, 50 nm to 100 nm, 50 nm to 90 nm, 60 nm to 200 nm, 60 to 180 nm, 60 nm to 170 nm, 60 nm to 150 nm, 60 nm to 120 nm, 60 nm to 100 nm, 60 nm to 90 nm, 70 nm to 200 nm, 70 to 180 nm, 70 nm to 170 nm, 70 nm to 150 nm, 70 nm to 120 nm, 70 nm to 100 nm, 70 nm to 90 nm, 80 nm to 200 nm, 80 to 180 nm, 80 nm to 170 nm, 80 nm to 150 nm, 80 nm to 120 nm, 80 nm to 100 nm, 80 nm to 90 nm, 90 nm to 200 nm, 90 to 180 nm, 90 nm to 170 nm, 90 nm to 150 nm, 90 nm to ily introduced into liver tissue, hepatocytes and / or LSECs (liver sinusoidal endothelial cells). The LNP can be sized for easy introduction into organs or tissues including, but not limited to, the liver, lung, heart, spleen, and tumors. When the size of the LNP is smaller than the above range, as the surface area of the LNP increases excessively, it becomes difficult to maintain stability, and thus the delivery to the target tissue and / or the drug effect may be reduced. The LNP can specifically target liver tissue. While not wishing to be bound by theory, one mechanism by which therapeutic agents can be delivered using LNP is through mimicking the metabolic behavior of natural lipoproteins, and thus it is believed that LNP can be usefully delivered to a subject through the lipid metabolic process performed by the liver.During the delivery of drugs to hepatocytes and / or LSECs (liver sinusoidal endothelial cells), since the diameter of the fenestrations connecting the sinusoidal lumen to hepatocytes and LSECs is about 140 nm in mammals and about 100 nm in humans, an LNP composition for the delivery of therapeutic agents having LNPs with diameters in the above range can have excellent delivery efficiency to hepatocytes and LSECs compared to LNPs having diameters outside the above range.
[0343] According to one example, the LNPs of the LNP composition can contain ionizable cationic lipid: phospholipid: cholesterol: lipid-PEG conjugate in the above range, or in a molar ratio of 20-50:10-30:30-60:0.5-5, in a molar ratio of 25-45:10-25:40-50:0.5-3, in a molar ratio of 25-45:10-20:40-55:0.5-3, or in a molar ratio of 25-45:10-20:40-55:1.0-1.5. LNPs containing components in the above range of molar ratios can have excellent delivery efficiency of therapeutic agents specific to the cells of the target organ.
[0344] In certain embodiments, the LNP can exhibit a pKa of 5-8, 5.5-7.5, 6-7, or 6.5-7, show a positive charge under acidic pH conditions, and easily form a complex with a therapeutic agent such as a nucleic acid showing a negative charge by electrostatic interaction with the nucleic acid, thereby encapsulating the nucleic acid with high efficiency. In such a case, the LNP can be usefully used as a composition for intracellular or in vivo delivery of a therapeutic agent (e.g., nucleic acid).
[0345] As used herein, "encapsulate" or "encapsulation" refers to incorporating a therapeutic agent by efficiently enclosing it within a lipid envelope, i.e., surrounding it by the particle surface, and / or embedding it within particles made of various lipids that self-assemble when the polarity of the surrounding solvent increases. Encapsulation efficiency means the content of the therapeutic agent encapsulated in the LNP relative to the measured total therapeutic agent content per given volume of the LNP formulation measured after disruption of the LNP.
[0346] Encapsulation of the nucleic acid of the composition into the LNP can be 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 94% or more, or 95% or more of the LNP in the composition encapsulating the nucleic acid. In some embodiments, encapsulation of the nucleic acid of the composition into the LNP is 80% - 99%, 80% - 97%, 80% - 95%, 85% - 95%, 87% - 95%, 90% - 95%, 91% or more - 95% or less, 91% or more - 94% or less, more than 91% - 95% or less, 92% - 99%, 92% - 97%, or 92% - 95% of the LNP in the composition encapsulating the nucleic acid. In some embodiments, the mRNA encoding any repressor fusion protein and / or gRNA of any of the embodiments of the present disclosure is completely encapsulated within the LNP.
[0347] Target organs to which nucleic acids are delivered by LNP include, but are not limited to, the liver, lung, heart, spleen, and tumors. An example LNP is liver tissue-specific, has excellent biocompatibility, and can deliver the nucleic acid of the composition with high efficiency, and thus, it can be effectively used in related technical fields such as lipid nanoparticle-mediated gene therapy. In certain embodiments, the target cells to which the nucleic acid is delivered by an example LNP can be hepatocytes and / or LSECs in vivo. In other embodiments, the present disclosure provides an LNP formulated for delivering the nucleic acid of the embodiment to cells ex vivo.
[0348] The present disclosure provides a pharmaceutical composition comprising a plurality of LNPs containing nucleic acids such as mRNA encoding the repressor fusion protein and / or gRNA variant described herein, and a pharmaceutically acceptable carrier.
[0349] In certain specific embodiments, the LNP containing the nucleic acid has a core with a high electron density.
[0350] The present disclosure provides an LNP comprising one or more nucleic acids comprising: (a) an mRNA encoding a repressor fusion protein and / or gRNA variant described herein; (b) one or more cationic or ionizable cationic lipids or salts thereof comprising from about 20 mol% to about 60 mol% of the total lipids present in the LNP; (c) one or more non-cationic lipids comprising from about 13 mol% to about 49.5 mol% of the total lipids present in the LNP; and (d) one or more conjugate lipids that inhibit aggregation of the LNP comprising from about 0.5 mol% to about 2 mol% of the total lipids present in the particles. In another embodiment, the present disclosure provides an LNP comprising one or more nucleic acids comprising: (a) an mRNA encoding a repressor fusion protein and / or gRNA variant described herein; (b) one or more cationic or ionizable cationic lipids or salts thereof comprising from about 22 mol% to about 85 mol% of the total lipids present in the LNP; (c) one or more non-cationic / phospholipids comprising from about 10 mol% to about 70 mol% of the total lipids present in the LNP; (d) from 15 mol% to about 50 mol% sterol; and (d) from about 1 mol% to about 5 mol% lipid-PEG or lipid-PEG-peptide in the particles. In certain embodiments, the repressor fusion protein mRNA and the gRNA can be present in the same nucleic acid-lipid particle or in different nucleic acid-lipid particles.
[0351] The present disclosure provides an LNP comprising one or more nucleic acids, comprising: (a) an mRNA encoding a repressor fusion protein described herein; (b) a cationic lipid or a salt thereof comprising about 52 mol% to about 62 mol% of the total lipids present in the LNP; (c) a mixture of a phospholipid and cholesterol or a derivative thereof comprising about 36 mol% to about 47 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate comprising about 1 mol% to about 2 mol% of the total lipids present in the LNP. In certain embodiments, the formulation is a four-component system comprising about 1.4 mol% of a PEG-lipid conjugate (e.g., PEG2000-C-DMA), about 57.1 mol% of a cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, about 7.1 mol% of DPPC (or DSPC), and about 34.3 mol% of cholesterol (or a derivative thereof).
[0352] In other embodiments, an LNP comprising one or more nucleic acids comprises: (a) an mRNA encoding a repressor fusion protein and / or a gRNA of any of the embodiments described herein; (b) a cationic lipid or a salt thereof comprising about 46.5 mol% to about 66.5 mol% of the total lipids present in the LNP; (c) cholesterol or a derivative thereof comprising about 31.5 mol% to about 42.5 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate comprising about 1 mol% to about 2 mol% of the total lipids present in the LNP. In certain embodiments, the formulation is a three-component system that does not contain phospholipids and comprises about 1.5 mol% of a PEG-lipid conjugate (e.g., PEG2000-C-DMA), about 61.5 mol% of a cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, and about 36.9 mol% of cholesterol (or a derivative thereof).
[0353] Additional formulations are described in International Publication No. WO 09 / 127060 and U.S. Patent Application Publication Nos. 2011 / 0071208 A1 and 2011 / 0076335 A1, the disclosures of which are incorporated herein by reference in their entirety.
[0354] In other embodiments, the LNP containing one or more nucleic acids comprises: (a) an mRNA encoding a repressor fusion protein and a gRNA variant of any of the embodiments described herein; (b) one or more cationic or ionizable cationic lipids or salts thereof, comprising from about 2 mol% to about 50 mol% of the total lipids present in the LNP; (c) one or more non-cationic lipids or ionizable cationic lipids, comprising from about 5 mol% to about 90 mol% of the total lipids present in the LNP; and (d) one or more conjugate lipids that inhibit aggregation of the particles, comprising from about 0.5 mol% to about 20 mol% of the total lipids present in the LNP.
[0355] In other embodiments, the LNP containing one or more nucleic acids comprises: (a) an mRNA encoding a repressor fusion protein and / or a gRNA of any of the embodiments described herein; (b) a cationic lipid or salt thereof, comprising from about 30 mol% to about 50 mol% of the total lipids present in the LNP; (c) a mixture of phospholipids and cholesterol or derivatives thereof, comprising from about 47 mol% to about 69 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate, comprising from about 1 mol% to about 3 mol% of the total lipids present in the LNP. In certain embodiments, the formulation is a four-component system comprising about 2 mol% PEG-lipid conjugate (e.g., PEG2000-C-DMA), about 40 mol% cationic lipid (e.g., DLin-K-C2-DMA) or salt thereof, about 10 mol% DPPC (or DSPC), and about 48 mol% cholesterol (or derivative thereof).
[0356] In other embodiments, the LNP comprising one or more nucleic acids comprises: (a) an mRNA encoding a repressor fusion protein and a gRNA variant of any of the embodiments described herein; (b) one or more cationic or ionizable cationic lipids or salts thereof comprising from about 50 mol% to about 65 mol% of the total lipids present in the LNP; (c) one or more non-cationic lipids or ionizable cationic lipids comprising from about 25 mol% to about 45 mol% of the total lipids present in the LNP; and (d) one or more conjugate lipids that inhibit particle aggregation comprising from about 5 mol% to about 10 mol% of the total lipids present in the LNP.
[0357] In other embodiments, the LNP comprising one or more nucleic acids comprises: (a) an mRNA encoding a repressor fusion protein and / or a gRNA of any of the embodiments described herein; (b) a cationic lipid or salt thereof comprising from about 50 mol% to about 60 mol% of the total lipids present in the LNP; (c) a mixture of phospholipids and cholesterol or derivatives thereof comprising from about 35 mol% to about 45 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate comprising from about 5 mol% to about 10 mol% of the total lipids present in the LNP.
[0358] In certain embodiments, the non-cationic lipid mixture in the formulation comprises: (i) phospholipids in an amount of from about 10 mol% to about 70 mol% of the total lipids present in the LNP; (ii) cholesterol or derivatives thereof in an amount of from about 15 mol% to about 50 mol% of the total lipids present in the LNP; and 1-5% lipid-PEG or lipid-PEG-peptide. In certain embodiments, the formulation is a four-component system comprising about 7 mol% PEG-lipid conjugate (e.g., PEG750-C-DMA), about 54 mol% cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, about 7 mol% DPPC (or DSPC), and about 32 mol% cholesterol (or a derivative thereof).
[0359] In other embodiments, the LNP containing one or more nucleic acids comprises: (a) an mRNA encoding a repressor fusion protein and / or gRNA of any of the embodiments described herein; (b) a cationic lipid or a salt thereof, comprising about 55 mol% to about 65 mol% of the total lipids present in the LNP; (c) cholesterol or a derivative thereof, comprising about 30 mol% to about 40 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate, comprising about 5 mol% to about 10 mol% of the total lipids present in the LNP. In certain embodiments, the formulation does not contain phospholipids and is a three-component system comprising about 7 mol% of a PEG-lipid conjugate (e.g., PEG750-C-DMA), about 58 mol% of a cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, and about 35 mol% of cholesterol (or a derivative thereof).
[0360] In other embodiments, the LNP containing one or more nucleic acids comprises: (a) an mRNA encoding a repressor fusion protein and / or gRNA of any of the embodiments described herein; (b) a cationic lipid or a salt thereof, comprising about 48 mol% to about 62 mol% of the total lipids present in the LNP; (c) a mixture of phospholipids and cholesterol or a derivative thereof, wherein the phospholipids comprise about 7 mol% to about 17 mol% of the total lipids present in the LNP and the cholesterol or a derivative thereof comprises about 25 mol% to about 40 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate, comprising about 0.5 mol% to about 3.0 mol% of the total lipids present in the LNP.
[0361] VIII. Systems and Methods for Modifying PCSK9 Target Nucleic Acids In another aspect, the present disclosure provides a repressor fusion protein comprising a catalytically inactive CRISPR protein for use in suppressing a target nucleic acid of the PCSK9 gene in a population of cells, and one or more gRNAs (repressor fusion protein:gRNA system). The systems provided herein are useful for a variety of applications including therapy, diagnosis, and research. To effect the methods of the present disclosure, to effect suppression or silencing of the PCSK9 gene, a programmable repressor fusion protein:gRNA system is provided herein. The programmable nature of the systems provided herein allows for precise targeting to achieve a desired effect in one or more regions of interest within the PCSK9 gene target nucleic acid. In some embodiments, it may be desirable to reduce or eliminate the expression of PCSK9 protein in a subject comprising a mutation, such as a dominant mutation leading to hypercholesterolemia or familial or autosomal dominant hypercholesterolemia. In some embodiments, it may be desirable to reduce or eliminate the expression of PCSK9 protein in a subject having elevated cholesterol levels that are not the result of a mutation in the PCSK9 gene.
[0362] In some embodiments, the present disclosure provides a system specifically designed for use in a method of suppressing or silencing the transcription of a target nucleic acid of the PCSK9 gene in eukaryotic cells, either in vitro, ex vivo, or in vivo in a subject. Generally, any portion of a gene can be targeted using the programmable systems and methods provided herein. In one embodiment, the present disclosure provides a method of suppressing a target nucleic acid sequence of the PCSK9 gene in a population of cells, the method comprising introducing into each cell of the population: i) a repressor fusion protein:gRNA system comprising a repressor fusion protein and a gRNA of any of the embodiments described herein; ii) a nucleic acid encoding a repressor fusion protein and a gRNA of any of the embodiments described herein; iii) a vector selected from the group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated virus (AAV) vector, and a herpes simplex virus (HSV) vector, the vector comprising the nucleic acid of (iv); v) an LNP or synthetic nanoparticle comprising an mRNA encoding a repressor fusion protein; or vi) a combination of two or more of (i)-(v), wherein the transcription of the target nucleic acid sequence of the cell targeted by the gRNA is suppressed by the repressor fusion protein. In some embodiments of the method, contacting the cells with the repressor fusion protein:gRNA system of the embodiment results in suppression of at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60% or more of the PCSK9 target nucleic acid in the population of cells.In some embodiments of the method, the PCSK9 gene in a population of cells is suppressed or silenced such that expression of the PCSK9 gene is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% compared to cells in which the PCSK9 gene is not targeted. In some embodiments, suppression of transcription of the PCSK9 gene in a population of cells is maintained for at least about 8 hours, at least about 1 day, at least about 7 days, at least about 2 weeks, at least about 3 weeks, at least about 1 month, or at least about 2 months when assayed in an in vitro assay. In some embodiments, suppression of transcription of the PCSK9 gene in a population of cells is heritable and the suppression of the PCKS9 gene persists through at least 1, 2, 3, 4, 5, or 6 or more cell divisions.
[0363] In some embodiments of the method, the suppression of the cells occurs in vitro. In some embodiments of the method, the suppression of the cells occurs ex vivo. In some embodiments, the suppression occurs in vitro within the cells prior to introduction of the cells into a subject. In some embodiments, the cells are autologous or allogeneic to the subject. In some embodiments of the method, the suppression of the cells occurs in vivo in a subject administered any of the repressor fusion proteins of the embodiments disclosed herein. In some embodiments of the method, the cells are eukaryotic cells. In some embodiments of the method, the cells are eukaryotic cells selected from the group consisting of rodent cells, mouse cells, rat cells, primate cells, and non-human primate cells. In some embodiments of the method, the eukaryotic cells are human cells. In some embodiments of the method, the cells are embryonic stem cells, induced pluripotent stem cells, germ cells, fibroblasts, oligodendrocytes, glial cells, hematopoietic stem cells, neuronal progenitor cells, neurons, astrocytes, muscle cells, bone cells, hepatocytes, pancreatic cells, retinal cells, cancer cells, T cells, B cells, NK cells, fetal cardiomyocytes, myofibroblasts, mesenchymal stem cells, autologous expanded cardiomyocytes, adipocytes, totipotent cells, pluripotent cells, blood stem cells, myoblasts, bone marrow cells, mesenchymal cells, parenchymal cells, epithelial cells, endothelial cells, mesothelial cells, fibroblasts, osteoblasts, chondrocytes, hematopoietic stem cells, bone marrow-derived progenitor cells, cardiomyocytes, skeletal cells, fetal cells, undifferentiated cells, multipotent progenitor cells, unipotent progenitor cells, monocytes, cardiomyoblasts, skeletal myoblasts, macrophages, capillary endothelial cells, heterologous cells, allogeneic cells, or postnatal stem cells.
[0364] In some embodiments, the present disclosure provides a method of reversing the inhibition of the PCSK9 gene in a population of cells resulting from a repressor fusion protein:gRNA system. In some embodiments, the inhibition is reversible by introducing an inhibitor of DNMT into the cells of the population. In some embodiments of the method, the inhibition is reversible by use of a cytidine analog inhibitor of DNMT. In some embodiments, the inhibition is reversible by use of an inhibitor selected from the group consisting of azacitidine, decitabine, clofarabine, and zebularine. In some embodiments, the inhibition is reversible by use of an inhibitor at a concentration of 0.1 μM to 40 μM, or any intermediate concentration. In some embodiments, the method comprises administering a therapeutically effective dose of an inhibitor of DNMT to a subject treated with the system of the present disclosure, thereby reversing the inhibition of PCSK9 by the system.
[0365] In some embodiments, the repressor fusion protein:gRNA system comprises a repressor fusion protein comprising the sequences of SEQ ID NOs: 3131-3132 described in Table 20, or a sequence that is at least 60% identical, at least 70% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical thereto; a gRNA scaffold comprising SEQ ID NOs: 1744-1746 or 2947-2976, or a sequence that is at least 65% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical thereto; and a gRNA having a targeting sequence of SEQ ID NOs: 1824-2944, or a sequence that is at least 65% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical thereto, and having 15-20 amino acids. In some embodiments of the system, the gRNA comprises the targeting sequences of SEQ ID NOs: 1824-2944 described in Table 7.In certain embodiments, the repressor fusion protein of the system comprises a sequence selected from the group consisting of SEQ ID NOs: 3131 - 3132, the gRNA scaffold comprises a sequence selected from the group consisting of SEQ ID NOs: 1744 - 1746 and 2947 - 2976, and the targeting sequence of the gRNA of the repressor fusion protein:gRNA system is selected from the group consisting of the sequences of SEQ ID NOs: 1824 - 2545. In certain embodiments, the repressor fusion protein comprises a sequence selected from the group consisting of the sequences of SEQ ID NOs: 3131 - 3132, the gRNA scaffold comprises a sequence selected from the group consisting of SEQ ID NOs: 1744 - 1746 and 2947 - 2976, and the targeting sequence of the gRNA is selected from the group consisting of the sequences of SEQ ID NOs: 1824 - 1890, 1910, 1925, 2672, 2675, 2694, and 2714 as set forth in Table 8. In certain embodiments, the system is formulated in LNP, the repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NOs: 3131 - 3132, is encoded by mRNA, the gRNA scaffold comprises the sequence of SEQ ID NO: 1746, and the targeting sequence of the gRNA is selected from the group consisting of SEQ ID NOs: 1824 - 1890, 1910, 1925, 2672, 2675, 2694, and 2714.
[0366] In some embodiments, the system comprises mRNA comprising one or more sequences selected from the group consisting of SEQ ID NOs: 3105, 3109, and 3115-3128, or sequences that are at least 60% identical, at least 65% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical thereto. In some embodiments, the system comprises mRNA comprising one or more sequences selected from the group consisting of SEQ ID NOs: 3105, 3109, and 3115-3128. In certain embodiments, the system is formulated in an LNP encapsulating an mRNA sequence comprising one or more sequences selected from the group consisting of SEQ ID NOs: 3105, 3109, and 3115-3128 and a gRNA selected from the group consisting of SEQ ID NOs: 2948-2956, 2958-2966, and 2968-2976, wherein the targeting sequence of the gRNA is selected from the group consisting of SEQ ID NOs: 1824-1890, 1910, 1925, 2672, 2675, 2694, and 2714. In some embodiments, the mRNA comprises a sequence in which at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the uridine nucleosides of the sequence are replaced with N1-methylpseudouridine. In some embodiments, the mRNA further comprises a 5' untranslated region (UTR) and a 3' untranslated region (UTR).
[0367] In one embodiment of the method, the system is introduced into cells using an LNP comprising an mRNA encoding a repressor fusion protein and a gRNA variant of any of the embodiments disclosed herein. In some embodiments, the LNP comprises an mRNA encoding a repressor fusion protein selected from the group consisting of SEQ ID NO: 3105, 3109, 3115-3128, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some of the foregoing embodiments, the LNP comprises a gRNA variant of the present disclosure having a targeting sequence complementary to the PCSK9 target nucleic acid. In some embodiments, the LNP comprises an mRNA encoding a repressor fusion protein, the mRNA comprising a sequence selected from SEQ ID NO: 3129-3130. In some embodiments, the LNP comprises the gRNA variant scaffold 174 (SEQ ID NO: 1744). In some embodiments, the LNP comprises the gRNA variant scaffold 235 (SEQ ID NO: 1745). In some embodiments, the LNP comprises the gRNA variant scaffold 316 (SEQ ID NO: 1746). In some embodiments, the LNAP comprises the gRNA variant scaffold 316 having chemical modifications comprising the sequences of SEQ ID NO: 2968-2976, or modifications described in a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto.In certain embodiments, the LNP comprises an mRNA encoding a repressor fusion protein comprising dCasX 491 (SEQ ID NO: 4), and a gRNA variant 316 having a chemical modification selected from the group consisting of SEQ ID NOs: 2968-2976, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto, the gRNA variant 316 having a bound targeting sequence selected from the group consisting of the chemically modified sequences of SEQ ID NOs: 1824-2944. In certain embodiments, the LNP comprises an mRNA encoding a repressor fusion protein comprising dCasX 491 (SEQ ID NO: 4), and a gRNA variant scaffold 316 having a chemical modification comprising the sequence of SEQ ID NO: 2968, the gRNA variant scaffold 316 having a bound targeting sequence selected from the group consisting of the chemically modified sequences of SEQ ID NOs: 1824-2944. In some embodiments of the method, the cells to be modified are selected from the group consisting of rodent cells, mouse cells, rat cells, and non-human primate cells. In other embodiments of the method, the cells to be modified are human cells. In some embodiments of the method, transcriptional repression of the cell population occurs in vivo in a subject, the subject being selected from the group consisting of rodents, mice, rats, non-human primates, and humans. In some embodiments of the method, the modified cells are hepatocytes, or cells of the arterial wall such as the intestine, kidney, central nervous system, smooth muscle cells, macrophages, or endothelium.
[0368] The LNP can be administered by an administration route selected from the group consisting of intravenous, intraarterial, portal vein injection, intraperitoneal, intramuscular, intracerebroventricular, intrathecal, subarachnoid, intracranial, intralumbar, intraocular, subcutaneous, and oral routes.
[0369] In some embodiments of the method for suppressing the PCSK9 gene, the gene repressor system of the present disclosure can be designed to target any region or its proximal region of the PCSK9 gene or region of the PCSK9 gene where transcriptional repression is desired. When the entire gene is suppressed, it is contemplated by the present disclosure to design a guide having a targeting sequence complementary to the sequence encompassing or proximal to the transcription start site (TSS). TSS selection occurs at different positions within the promoter region depending on the promoter sequence and the initiating substrate concentration. The core promoter functions as a binding platform for the transcription machinery including Pol II and its associated general transcription factors (GTFs) (Haberle, V. et al. Eukaryotic core promoters and the functional basis of transcription initiation (Nat Rev Mol Cell Biol. 19(10):621(2018)). Variability in TSS selection has been proposed to involve DNA "scrunching" and "anti-scrunching", which are characterized by (i) forward and reverse movement of the leading edge rather than the trailing edge of RNA polymerase relative to DNA, and (ii) expansion and contraction of the transcription bubble. In some embodiments, the target nucleic acid sequence bound by the RNP of the repressor fusion protein:gRNA system is within 1 kb of the transcription start site (TSS) in the PCSK9 gene. In some embodiments, the target nucleic acid sequence bound by the RNP of the system is within 20 bp, 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 500 bp, or 1 kb upstream of the TSS of the PCSK9 gene. In some embodiments, the target nucleic acid sequence bound by the RNP of the system is within 20 bp, 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 500 bp, or 1 kb downstream of the TSS of the PCSK9 gene. In some embodiments, the target nucleic acid sequence bound by the RNP of the system is within 500 bp upstream to 500 bp downstream, or within 300 bp upstream to 300 bp downstream of the TSS of the PCSK9 gene.In some embodiments, the target nucleic acid sequence bound by the RNP of the system is within 20 bp, 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 500 bp, or 1 kb of the enhancer of the PCSK9 gene. In some embodiments, the target nucleic acid sequence bound by the repressor fusion protein:gRNA RNP is within 1 kb of the 3' - 5' untranslated region of the PCSK9 gene. In other embodiments, the target nucleic acid sequence bound by the RNP of the system is within the open reading frame of the PCSK9 gene including the intron (if present). In some embodiments, the targeting sequence of the gRNA of the system is designed to be specific to the exon of the PCSK9 gene. In certain embodiments, the targeting sequence of the gRNA of the system is designed to be specific to exon 1 of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system is designed to be specific to the intron of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system is designed to be specific to the intron-exon junction of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system is designed to be specific to the regulatory element of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system is designed to be complementary to the sequence of the intergenic region of the PCSK9 gene. In other embodiments, the targeting sequence of the gRNA of the system is specific to the junction of the exon, intron, and / or regulatory element of the PCSK9 gene. When the targeting sequence is specific to a regulatory element, such regulatory elements include, but are not limited to, promoter regions, enhancer regions, intergenic regions, 5' untranslated regions (5'UTR), 3' untranslated regions (3'UTR), conserved elements, and regions containing cis-regulatory elements. In some embodiments, the targeting sequence of the gRNA of the present system is complementary to the gene target nucleic acid sequence within 1 kb of the enhancer of the PCSK9 gene. In some embodiments, the targeting sequence of the gRNA of the present system is complementary to the gene target nucleic acid sequence within the 3' untranslated region of the PCSK9 gene.The promoter region is intended to encompass nucleotides within 5 kb from the start point of the coding sequence, or in the case of gene enhancer elements or conserved elements, may be thousands, hundreds of thousands, or even millions of base pairs away from the coding sequence of the PCSK9 gene. As described above, the target is intended to be suppressed and / or epigenetically modified such that the encoded PCSK9 gene is not expressed or is expressed at a lower level in the cell. In some embodiments, when the RNP of the system binds to the binding position of the target nucleic acid, the system can suppress the transcription of the PCSK9 gene 5' to the binding position of the RNP. In other embodiments, when the RNP of the system binds to the binding position of the target nucleic acid, the system can suppress the transcription of the PCSK9 gene 3' to the binding position of the RNP.
[0370] The systems and methods described herein can be used in a variety of cells associated with a disease, such as cells of the liver, intestine, kidney, central nervous system, smooth muscle cells, macrophages, or arterial wall, in which the PCSK9 gene is suppressed or silenced. This approach can thus be used, without limitation, for example, in subjects having PCSK9-related disorders such as autosomal dominant hypercholesterolemia (ADH), hypercholesterolemia, elevated total cholesterol levels, dyslipidemia, elevated low-density lipoprotein (LDL) levels, elevated LDL cholesterol levels, reduced high-density lipoprotein levels, fatty liver, coronary artery disease, ischemia, stroke, peripheral vascular disease, thrombosis, type 2 diabetes, hypertension, atherosclerosis, obesity, Alzheimer's disease, neurodegeneration, age-related macular degeneration (AMD), or combinations thereof.
[0371] IX. Treatment Methods The present disclosure provides a method of treating a PCSK9-related disease or disorder in a subject in need thereof, including, but not limited to, autosomal dominant hypercholesterolemia (ADH), hypercholesterolemia, elevated total cholesterol levels, elevated low density lipoprotein (LDL) levels, decreased high density lipoprotein values, fatty liver, atherosclerotic cardiovascular disease, and coronary artery disease, ischemia, stroke, peripheral vascular disease, thrombosis, type 2 diabetes, hypertension, obesity, Alzheimer's disease, neurodegeneration, age-related macular degeneration (AMD), or a combination thereof. In some embodiments, the method of the present disclosure can prevent, treat, and / or ameliorate a subject's PCSK9-related disease or disorder by administering a composition of the present disclosure to the subject. In some embodiments, the PCSK9-related disease is autosomal dominant hypercholesterolemia (ADH), hypercholesterolemia, elevated total cholesterol levels, dyslipidemia, elevated low density lipoprotein (LDL) levels, elevated LDL cholesterol levels, decreased high density lipoprotein levels, fatty liver, coronary artery disease, ischemia, stroke, peripheral vascular disease, thrombosis, type 2 diabetes, hypertension, atherosclerosis, obesity, aortic valve stenosis, elevated PCSK9 levels, or a combination thereof. In some embodiments, the composition administered to the subject further comprises a pharmaceutically acceptable carrier, diluent, or excipient.
[0372] In some cases, the PCSK9 gene of the subject treated by the method of the present disclosure is wild-type, yet the subject has hypercholesterolemia, elevated total cholesterol levels, dyslipidemia, elevated low density lipoprotein (LDL) levels, elevated LDL cholesterol levels, decreased high density lipoprotein levels, fatty liver, coronary artery disease, ischemia, stroke, peripheral vascular disease, thrombosis, type 2 diabetes, hypertension, atherosclerosis, obesity, aortic valve stenosis, elevated PCSK9 levels, or a combination thereof. In such cases, the method of the present disclosure can prevent, treat, and / or ameliorate a subject's PCSK9-related disease or disorder by administering a composition of the present disclosure to the subject.
[0373] In some cases, one or both alleles of the subject PCSK9 gene contain a mutation. In some cases, the PCSK9-related disease or disorder mutation is a gain-of-function mutation including, but not limited to, a mutation encoding an amino acid substitution selected from the group consisting of S127R, D129G, F216L, D374H, and D374Y with respect to the sequence of SEQ ID NO: 1823. In other cases, the PCSK9-related disease mutation is a loss-of-function mutation including, but not limited to, a mutation encoding an amino acid substitution selected from the group consisting of R46L, G106R, Y142X, N157K, R237W, and C679X with respect to the sequence of SEQ ID NO: 1823.
[0374] In some embodiments, the present disclosure provides a method of treating PCSK9 or a related disease or disorder in a subject in need thereof, comprising suppressing or silencing the PCSK9 gene in a target cell of the subject, the method comprising contacting the cell with a therapeutically effective amount of i) a repressor fusion protein:gRNA system comprising a repressor fusion protein and a gRNA, ii) a nucleic acid encoding a repressor fusion protein and a gRNA of any of the embodiments described herein, iii) an LNP or synthetic nanoparticle comprising an mRNA encoding a gRNA and a repressor fusion protein of any one of the embodiments described herein, or iv) a combination of two or more of (i)-(iii), wherein the target nucleic acid sequence of the cell targeted by the gRNA is suppressed or silenced by the repressor fusion protein. In some embodiments of the method, contacting the cell with the repressor fusion protein:gRNA system results in suppression of at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60% or more of the PCSK9 target nucleic acid in the cells of the target organ. In some embodiments of the method, the PCSK9 gene in the cells of the target organ is suppressed such that the expression of the PCSK9 protein is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% compared to untreated cells. In some embodiments of the method, contacting the cells of the target organ with the repressor fusion protein:gRNA system results in heritable suppression of the PCSK9 target nucleic acid in the cells. The treated cells of the subject can be eukaryotic cells selected from the group consisting of rodent cells, mouse cells, rat cells, primate cells, and non-human primate cells. In some embodiments, the eukaryotic cells of the treated subject are human cells.In some embodiments, the cells are cells involved in the production of LDL, including but not limited to hepatocytes, or intestinal cells, kidney, central nervous system, smooth muscle cells, macrophages, retinal cells, or cells of the arterial wall such as endothelium. In some embodiments, the cells are ocular cells. In some embodiments of methods of treating a PCSK9-related disorder in a subject, the subject is selected from the group consisting of mice, rats, pigs, non-human primates, and humans.
[0375] Numerous therapeutic strategies have been used to design systems for use in methods of treating subjects having a PCSK9-related disease or disorder. In some embodiments, the pr...
Claims
1. A system for transcriptional repression of the progenitor protein convertase subtilisin / kexin type 9 (PCSK9) gene, comprising a repressor fusion protein and guide ribonucleic acid (gRNA), wherein the repressor fusion protein is (a) CasX (dCasX) protein without catalytic activity, (b) Repressor domain (RD1), (c) DNMT3A catalytic domain (DNMT3A), and (d) DNMT3L interaction domain (DNMT3L) Includes, The gRNA contains a targeting sequence complementary to the PCSK9 gene target nucleic acid sequence. The repressor fusion protein can form a ribonucleoprotein (RNP) together with the gRNA. If desired, the RNP can bind to the PCSK9 gene target nucleic acid sequence. system.
2. The aforementioned repressor fusion protein is located from the N-terminus to the C-terminus. (a) DNMT3A, (b) DNMT3L, (c) RD1, and (d) dCasX protein, The system according to claim 1, including the following:
3. The aforementioned repressor fusion protein is located from the N-terminus to the C-terminus. (a) DNMT3A, (b) DNMT3L, (c) dCasX protein, and (d) RD1, The system according to claim 1, including the following:
4. A system comprising a repressor fusion protein and gRNA, wherein the repressor fusion protein is (a) dCasX protein, (b) RD1, (c) DNA methyltransferase (DNMT) 3A ATRX-DNMT3-DNMT3L domain (ADD), (d) DNMT3A, and (e) DNMT3L Includes, The gRNA contains a targeting sequence complementary to the PCSK9 gene target nucleic acid sequence. The repressor fusion protein can form a ribonucleoprotein (RNP) together with the gRNA. If desired, the RNP can bind to the PCSK9 gene target nucleic acid sequence. system.
5. The aforementioned repressor fusion protein is located from the N-terminus to the C-terminus. (a) ADD, (b) DNMT3A, (c) DNMT3L, (d) RD1, and (e) dCasX protein, The system according to claim 4, including the system described in claim 4.
6. The aforementioned repressor fusion protein is located from the N-terminus to the C-terminus. (a) ADD, (b) DNMT3A, (c) DNMT3L, (d) dCasX protein, and (e) RD1, The system according to claim 4, including the system described in claim 4.
7. The system according to claim 1 or claim 4, wherein when the RNP binds to the PCSK9 gene target nucleic acid sequence, the transcription of the PCSK9 gene can be suppressed.
8. The system according to claim 1 or claim 4, wherein the dCasX includes a sequence selected from the group consisting of sequence numbers 4 to 29, or a sequence having at least about 90% sequence identity with the full-length sequence.
9. The system according to claim 1 or claim 4, wherein the dCasX includes the sequence of sequence number 4.
10. The aforementioned RD1 is PX1X2X3X4X5X6EX7, in the formula i) X1 is A, D, E, or N, ii) X2 is L or V, iii) X3 is I or V, iv) X4 is S, T, or F, v) X5 is H, K, L, Q, R, or W, vi) X6 is L or M, and vii) X7 is G, K, Q, or R. The system according to claim 1 or claim 4, comprising an amino acid sequence motif.
11. The system according to claim 1 or claim 4, wherein RD1 includes a sequence selected from the group consisting of sequence numbers 130 to 1726, or a sequence having at least about 90% sequence identity with the full-length sequence.
12. The system according to claim 1 or claim 4, wherein RD1 includes a sequence selected from the group consisting of sequence numbers 130 to 224, or a sequence having at least about 90% sequence identity with the full-length sequence.
13. The system according to claim 1 or claim 4, wherein RD1 includes a sequence selected from the group consisting of sequence numbers 135, 137, 139, 140, 142, 143, 168, 194, 1285, and 1785, or a sequence having at least about 90% sequence identity with the full-length sequence.
14. The system according to claim 1 or claim 4, wherein RD1 includes the sequence of sequence number 135, or a sequence having at least about 90% sequence identity with the full-length sequence.
15. The system according to claim 1 or claim 4, wherein the ADD includes the sequence of sequence number 125, or a sequence having at least about 90% sequence identity with the full-length sequence.
16. The system according to claim 1 or claim 4, wherein the DNMT3A includes the sequence of sequence number 126, or a sequence having at least about 90% sequence identity with the full-length sequence.
17. The system according to claim 1 or claim 4, wherein the DNMT3L includes the sequence of sequence number 127, or a sequence having at least about 90% sequence identity with the full-length sequence.
18. The system according to claim 1 or claim 4, wherein the repressor fusion protein comprises one or more linker peptides.
19. The system according to claim 18, wherein at least one of the one or more linker peptides comprises a sequence selected from the group consisting of SEQ ID NOs: 98 to 124.
20. The system according to claim 19, wherein at least one of the one or more linker peptides comprises a sequence selected from the group consisting of SEQ ID NOs: 120 and 122-124.
21. The system according to claim 1 or 4, wherein the repressor fusion protein comprises one or more nuclear localization signals (NLS).
22. The system according to claim 21, wherein at least one of the one or more NLSs includes a sequence selected from the group consisting of sequence numbers 30 to 97.
23. The system according to claim 22, wherein at least one of the one or more NLSs is a simian virus 40 (SV40) NLS, and optionally the SV40 NLS comprises the sequence of sequence number 30.
24. The aforementioned repressor fusion protein is located from the N-terminus to the C-terminus. (a) First NLS, (b) the ADD; (c) The above DNMT3A, (d) First peptide linker, (e) The DNMT3L, (f) Second peptide linker, (g) Third peptide linker, (h) dCasX protein, (i) The fourth peptide linker, (j) RD1, and (k) Second NLS, The system according to claim 4, including the system described in claim 4.
25. The system according to claim 24, wherein the first linker includes the sequence of sequence number 122, the second and fourth linkers include the sequence of sequence number 124, and the third linker includes the sequence of sequence number 123.
26. The aforementioned PCSK9 gene target nucleic acid sequence is (a) Within 1 kilobase (kb) of the transcription start site (TSS) in the PCSK9 gene, (b) within 1 kb of the PCSK9 gene enhancer, (c) Within the 3' untranslated region of the PCSK9 gene, (d) Within the 3' untranslated region of the PCSK9 gene, (e) The system according to claim 1 or claim 4, located within the exon of the PCSK9 gene.
27. The system according to claim 26, wherein the PCSK9 gene target nucleic acid sequence is located in the promoter or exon 1 of the PCSK9 gene.
28. The system according to claim 1 or claim 4, wherein the targeting sequence of the gRNA includes a sequence selected from the group consisting of SEQ ID NOs: 1824 to 2944, or a sequence having at least about 75% identity with the full-length sequence, or the targeting sequence of the gRNA includes a sequence of SEQ ID NOs: 1824 to 2944, wherein 1, 2, 3, 4, or 5 nucleotides are removed from the 3' end of the sequence.
29. The system according to claim 1 or claim 4, wherein the targeting sequence of the gRNA includes a sequence selected from the group consisting of SEQ ID NOs: 1844, 1852, 1853, 1855, 1858, 1859, 1867, 1869, and 1870, or a sequence having at least about 75% identity with the full-length sequence.
30. The system according to claim 1 or claim 4, wherein the gRNA is a single-molecule gRNA (sgRNA) and comprises a scaffold stem loop containing the sequence CCAGCGAGUCUAUGUCGUAGUGG (sequence number 1822), or a sequence having one, two, three, four, or five mismatches therewith.
31. The system according to claim 1 or claim 4, wherein the gRNA includes a scaffold containing a sequence selected from the group consisting of sequence numbers 1744 to 1821, or a sequence having at least about 70% sequence identity with the full-length sequence.
32. The system according to claim 1 or claim 4, wherein the gRNA is a chimeric gRNA.
33. The system according to claim 32, wherein the gRNA includes a scaffold sequence containing sequence number 1746, or a sequence having at least about 70% sequence identity with the full-length sequence.
34. The system according to claim 1 or claim 4, wherein the gRNA is chemically modified.
35. The system according to claim 34, wherein the chemical modification to the gRNA includes the addition of a 2'O-methyl group to one or more nucleotides of the gRNA.
36. The system according to claim 34, wherein the chemical modification to the gRNA includes the substitution of phosphorothioate bonds between two or more nucleosides of the gRNA.
37. The system according to claim 34, wherein the chemically modified gRNA includes a sequence selected from the group consisting of SEQ ID NOs. 2968 to 2976, or a sequence having at least about 70% sequence identity with the full-length sequence.
38. The system according to claim 37, wherein the chemically modified gRNA sequence has a substitution of 20 nucleotides in the 3' end of the gRNA with a targeting sequence complementary to the target nucleic acid of the PCSK9 gene.
39. A system for repressing the transcription of the PCSK9 gene, comprising a repressor fusion protein, (a) A DNA-binding protein capable of binding to the PCSK9 gene target nucleic acid sequence, (b) ADD, and (c) DNMT3A A system that includes this.
40. The system according to claim 39, wherein the ADD is fused to the N-terminus of the DNMT3A.
41. The aforementioned repressor fusion protein (a) Repressor domain (RD1), (b) DNMT3L interaction domain (DNMT3L), and (c) The system according to claim 39, comprising one or more linker peptides.
42. The aforementioned repressor fusion protein is located from the N-terminus to the C-terminus. (a) ADD, (b) DNMT3A, (c) DNMT3L, (d) DNA-binding proteins, and (e) RD1, The system according to claim 41, including the system described in claim 41.
43. The system according to claim 41, wherein one or more linker sequences are selected from the group consisting of sequence numbers 122 to 124 and link any two components selected from RD1, ADD, DNMT3A, DNMT3L, and DNA-binding proteins.
44. The system according to claim 43, comprising gRNA, wherein the gRNA comprises a targeting sequence complementary to the PCSK9 gene target nucleic acid sequence.
45. The system according to claim 44, wherein the gRNA can form a ribonucleoprotein (RNP) complex with the repressor fusion protein, and optionally the RNP can bind to the PCSK9 gene target nucleic acid sequence.
46. The system according to claim 44, wherein when the repressor fusion protein binds to the PCSK9 gene target nucleic acid sequence, the transcription of the PCSK9 gene can be suppressed.
47. The system according to claim 39, wherein the DNA-binding protein comprises dCasX.
48. The system according to claim 47, wherein the dCasX comprises a sequence selected from the group consisting of SEQ ID NOs: 4 to 29, or a sequence having at least about 90% sequence identity with the full-length sequence, and the repressor fusion protein comprising the dCasX retains the ability to form RNPs with gRNA.
49. The system according to claim 48, wherein the dCasX includes the sequence of sequence number 4.
50. The aforementioned RD1 is PX1X2X3X4X5X6EX7, in the formula i) X1 is A, D, E, or N, ii) X2 is L or V, iii) X3 is I or V, iv) X4 is S, T, or F, v) X5 is H, K, L, Q, R, or W, vi) X6 is L or M, and vii) X7 is G, K, Q, or R. The system according to claim 41, comprising an amino acid sequence motif.
51. The system according to claim 41, wherein RD1 includes a sequence selected from the group consisting of sequence numbers 130 to 1726, or a sequence having at least about 90% sequence identity with the full-length sequence.
52. The system according to claim 42, wherein RD1 includes a sequence selected from the group consisting of sequence numbers 135, 137, 139, 140, 142, 143, 168, 194, 1285, and 1785, or a sequence having at least about 90% sequence identity with the full-length sequence.
53. The system according to claim 40, wherein RD1 includes the sequence of sequence number 135, or a sequence having at least about 90% sequence identity with the full-length sequence.
54. The system according to claim 39, wherein the ADD includes the sequence of sequence number 125, or a sequence having at least about 90% sequence identity with the full-length sequence.
55. The system according to claim 39, wherein the DNMT3A includes the sequence of sequence number 126, or a sequence having at least about 90% sequence identity with the full-length sequence.
56. The system according to claim 39, wherein the DNMT3L includes the sequence of sequence number 127, or a sequence having at least about 90% sequence identity with the full-length sequence.
57. A nucleic acid comprising a sequence encoding the gRNA described in claim 1 or claim 4.
58. A nucleic acid comprising a sequence encoding the repressor fusion protein according to claim 1 or claim 4.
59. The nucleic acid according to claim 58, wherein the sequence encoding the repressor fusion protein is codon-optimized for expression in human cells.
60. The nucleic acid according to claim 58, wherein the sequence encoding the repressor fusion protein includes one or more sequences selected from the group consisting of SEQ ID NOs: 3105, 3116-3124, and 3127-3128, or a sequence having at least about 90% sequence identity with the full-length sequence.
61. The nucleic acid according to claim 60, wherein the nucleic acid is messenger RNA (mRNA).
62. The nucleic acid according to claim 61, wherein at least about 70% of the uridine nucleosides in the mRNA sequence are substituted with N1-methylpseudridine.
63. Lipid nanoparticles comprising the nucleic acid described in Claim 61 and a gRNA containing a targeting sequence complementary to the PCSK9 gene target nucleic acid sequence.
64. The lipid nanoparticles according to claim 63, wherein the lipid nanoparticles comprise an ionizable lipid, a helper phospholipid, a polyethylene glycol (PEG) modified lipid, and cholesterol or a derivative thereof.
65. A pharmaceutical composition comprising the lipid nanoparticles described in claim 63, and one or more pharmaceutically suitable excipients.
66. A pharmaceutical composition comprising a plurality of lipid nanoparticles as described in claim 63 and a pharmaceutically acceptable carrier or diluent, wherein the average diameter of the plurality of lipid nanoparticles is preferably about 20 nm to about 200 nm.
67. Use of the system according to claim 1 or 4 for the production of a pharmaceutical composition for repressing the transcription of the PCSK9 gene in vitro or ex vivo in a population of cells, wherein the system according to claim 1 or 4 is introduced into the cells of the population, and the transcription of the PCSK9 gene is repressed by the repressor fusion protein.
68. The use according to claim 67, wherein the transcription of the PCSK9 gene is suppressed in the cells of the population such that the expression of the PCSK9 protein is reduced by at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% compared to cells in which the transcription of the PCSK9 gene is not suppressed.
69. The use according to claim 67, wherein the repression of transcription of the PCSK9 gene in the cells of the population is heritable.
70. Use of the system according to claim 1 or 4 for the manufacture of a pharmaceutical composition for treating a PCSK9-related disease or disorder in a subject requiring treatment for a PCSK9-related disease or disorder, wherein the cells of the subject come into contact with a therapeutically effective dose of the pharmaceutical composition, and the transcription of the PCSK9 gene is suppressed by the repressor fusion protein in the contacted cells.
71. The use according to claim 70, wherein the PCSK9-related disorder is autosomal dominant hypercholesterolemia (ADH), hypercholesterolemia, elevated total cholesterol levels, dyslipidemia, elevated low-density lipoprotein (LDL) levels, elevated LDL cholesterol levels, reduced high-density lipoprotein levels, fatty liver, coronary artery disease, ischemia, stroke, peripheral vascular disease, thrombosis, type 2 diabetes, hypertension, atherosclerosis, obesity, aortic stenosis, elevated PCSK9 levels, or a combination thereof.
72. A kit comprising the system according to claim 1 or 4, and a suitable container, optionally comprising a buffer, an excipient, a nuclease inhibitor, a protease inhibitor, a liposome, a therapeutic agent, a label, a label visualization reagent, instructions for use, or any combination thereof.