Pneumococcal conjugate vaccine preparation
A vaccine formulation with 21 to 30 glycoconjugates, a specific buffer, and adjuvant system addresses the sedimentation challenge, improving resuspension and stability, thereby ensuring accurate dosing of pneumococcal vaccines.
Patent Information
- Application Number
- JP2025531017
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-16
- Filing Date
- 2023-11-29
- Publication Date
- 2025-12-23
AI Technical Summary
The challenge of vaccine formulations is the sedimentation of adjuvants and/or active ingredients, such as glycoconjugates, which becomes more pronounced as the number of serotypes in pneumococcal conjugate vaccines increases, making resuspension before administration difficult and affecting dose accuracy.
A vaccine formulation comprising 21 to 30 different glycoconjugates, a succinate or histidine buffer with a pH of 5.0 to 7.5, calcium chloride, sodium chloride, and/or sodium phosphate, a surfactant, and an adjuvant, designed to facilitate resuspension and ensure long-term stability.
The formulation enhances the ease of resuspension and maintains dose accuracy, addressing the sedimentation issue and ensuring stability over time.
Smart Images

Figure 2025541706000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to new vaccine formulations comprising conjugated capsular saccharide antigens (glycoconjugates) and their uses. The formulations of the invention typically comprise glycoconjugates in which the saccharide is derived from a serotype of Streptococcus pneumoniae, in a formulation of buffer, salt solution, surfactant and adjuvant, and are specifically designed to facilitate resuspension of the adjuvant and / or glycoconjugate and to provide long-term vaccine stability. [Background technology]
[0002] Infections caused by Streptococcus pneumoniae are a major cause of morbidity and mortality worldwide. Pneumonia, febrile bacteremia, and meningitis are the most common manifestations of invasive pneumococcal disease, but dissemination of bacteria within the respiratory tract can result in middle ear infections, sinusitis, or recurrent bronchitis. Compared to invasive disease, noninvasive manifestations, although usually less severe, are significantly more common.
[0003] Streptococcus pneumoniae (the pneumococcus), the etiological agent of pneumococcal disease, is a Gram-positive, encapsulated cocci surrounded by a polysaccharide capsule. Differences in the composition of this capsule allow serological differentiation among approximately 91 capsular types, some of which are frequently associated with pneumococcal disease, while others are infrequent. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; common noninvasive manifestations include otitis media, sinusitis, and bronchitis.
[0004] Pneumococcal polysaccharides, particularly capsular polysaccharides, are important immunogens found on the surface of this bacterium. This makes them important components in the design of pneumococcal vaccines. They have proven useful in eliciting immune responses, especially when linked to carrier proteins.
[0005] Pneumococcal conjugate vaccines (PCVs) are pneumococcal vaccines used to protect against disease caused by S. pneumoniae (the pneumococcus). These vaccines are typically composed of several glycoconjugates derived from different serotypes of Streptococcus pneumoniae. Currently, there are six approved PCV vaccines: PREVNAR® (called Prevenar in some countries) (e.g., a 7-valent vaccine containing seven different serotypes), SYNFLORIX® (a 10-valent vaccine), PREVNAR 13® (a 13-valent vaccine), VAXNEUVANCE™ (a 15-valent vaccine), PREVNAR 20™ (a 20-valent vaccine), and PNEUMOVAX 23™ (a 23-valent vaccine). Summary of the Invention [Problem to be solved by the invention]
[0006] One of the challenges of vaccine formulations is the sedimentation of adjuvants and / or active ingredients (e.g., glycoconjugates) when the formulation is stored prior to administration. As the number of serotypes in a pneumococcal conjugate vaccine increases, the overall concentration of active ingredients increases, resulting in different dispersions and sedimentation of the formulation. The formulation must be resuspended by shaking before administration to ensure accuracy of the administered dose. Resuspension of the formulation becomes more difficult as the number of serotypes and / or serotype concentration in the vaccine increase. Thus, there is a need for a vaccine formulation that facilitates easier resuspension of the vaccine for administration. [Means for solving the problem]
[0007] The present invention is based on the seminal discovery of a vaccine formulation for pneumococcal vaccines that facilitates resuspension of particles that settle out of solution to ensure dose accuracy and long-term stability.
[0008] In one embodiment, the present invention provides a formulation comprising at least 21 different glycoconjugates; a succinate or histidine buffer having a pH in the range of 5.0 to 7.5; calcium chloride, sodium chloride, and / or sodium phosphate; a surfactant; and an adjuvant.
[0009] In some embodiments, the formulation comprises at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different glycoconjugates. In some embodiments, the formulation is a 24-valent pneumococcal conjugate composition. In some embodiments, the formulation is a 25-valent pneumococcal conjugate composition. In one embodiment, the glycoconjugate is a pneumococcal polysaccharide protein conjugate.
[0010] In some embodiments, the glycoconjugate comprises at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof. In some embodiments, the carrier protein of the glycoconjugate(s) is a diphtheria cross-reactive material (CRM). 197 ), diphtheria toxoid (DT), tetanus toxoid (TT), C5a peptidase from Streptococcus (SCP) or rhizavidin [aa 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0011] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, wherein the S. pneumoniae serotypes are selected from the group consisting of CRM 197 It is conjugated to
[0012] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 5, and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.
[0013] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0014] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0015] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0016] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.
[0017] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0018] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are CRM 197 In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0019] In some embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B. In some embodiments, the S. pneumoniae serotypes are CRM 197 In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0020] In some embodiments, the formulation comprises at least 25 glycoconjugates, including at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F. In some embodiments, at least two of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, the at least two S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F. In one embodiment, at least 17 of the S. pneumoniae serotypes are CRM 197 In one embodiment, the CRM 197 The at least 17 S. pneumoniae serotypes conjugated to the antibody are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0021] In one embodiment, the pneumococcal glycoconjugate is a CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 1, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 3, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 4, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 5, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6B conjugated to CRM 197Streptococcus pneumoniae (S. pneumoniae) serotype 7F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 8, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 9V conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 10A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 11A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 12F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 14, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 18C conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 24F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to CRM 197S. pneumoniae serotype 35B conjugated to S. pneumoniae serotype 35B, and combinations thereof.
[0022] In one embodiment, the pneumococcal glycoconjugate is a CRM 197 S. pneumoniae serotype 1 conjugated to SCP, S. pneumoniae serotype 3 conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 4, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 5, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 7F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 8, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 9V conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 10A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 11A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 12F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 14, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 18C conjugated to CRM 197Streptococcus pneumoniae (S. pneumoniae) serotype 19A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 24F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to CRM 197 S. pneumoniae serotype 35B conjugated to S. pneumoniae serotype 35B, and combinations thereof.
[0023] In some embodiments, the total polysaccharide concentration is about 1-100 μg per dose. In some embodiments, the polysaccharide concentration for each serotype is about 1-10 μg per dose. In some embodiments, the buffer has a concentration of about 1-50 mM. In some embodiments, the sodium chloride has a concentration of about 1-300 mM. In some embodiments, Formulation C has a calcium chloride concentration of about 1-50 mM. In some embodiments, Formulation D has a sodium phosphate concentration of about 1-50 mM. In some embodiments, the surfactant is a polysorbate or poloxamer having a molecular weight of about 1100 Da to 17,400 Da. In some embodiments, the surfactant is polysorbate 80. In some embodiments, the surfactant is polysorbate 20. In some embodiments, the surfactant concentration is about 0.001% to 1%. In some embodiments, the adjuvant is aluminum phosphate. In some embodiments, the adjuvant concentration is about 0.1% to 1%.
[0024] In one embodiment, the adjuvant is a liposomal adjuvant. In another embodiment, the adjuvant includes monophosphoryl lipid A (MPLA) and saponin. In one embodiment, the adjuvant includes monophosphoryl lipid A phosphorylated hexaacyldisaccharide (PHAD®) and QS-21. In one embodiment, the adjuvant is Liposomal Novel Adjuvant-1 (LiNA-1) described herein. In one embodiment, the adjuvant includes 3D-PHAD® and QS-21. In one embodiment, the adjuvant is Liposomal Novel Adjuvant-2 (LiNA-2) described herein. In another embodiment, the adjuvant is LiNA-2A described herein. In yet another embodiment, the adjuvant is LiNA-2B described herein. In other embodiments, the formulation includes more than one adjuvant. In certain embodiments, the formulation includes aluminum phosphate and LiNA-2.
[0025] In one embodiment, the present invention provides a formulation comprising at least 21 different glycoconjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; calcium chloride; sodium chloride; a surfactant; and an adjuvant.
[0026] In some embodiments, the formulation comprises at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different glycoconjugates. In some embodiments, the formulation is a 24-valent pneumococcal conjugate composition. In some embodiments, the formulation is a 25-valent pneumococcal conjugate composition. In one embodiment, the glycoconjugate is a pneumococcal polysaccharide protein conjugate.
[0027] In some embodiments, the glycoconjugate comprises at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof. In some embodiments, the carrier protein of the glycoconjugate(s) is a diphtheria cross-reactive material (CRM). 197 ), diphtheria toxoid (DT), tetanus toxoid (TT), C5a peptidase from Streptococcus (SCP) or rhizavidin [aa 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0028] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, wherein the S. pneumoniae serotypes are selected from the group consisting of CRM 197 It is conjugated to
[0029] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 5, and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.
[0030] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0031] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0032] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0033] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.
[0034] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0035] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are CRM 197 In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0036] In some embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B. In some embodiments, the S. pneumoniae serotypes are CRM 197 In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0037] In some embodiments, the formulation comprises at least 25 glycoconjugates, including at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F. In some embodiments, at least two of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, the at least two S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F. In one embodiment, at least 17 of the S. pneumoniae serotypes are CRM 197 In one embodiment, the CRM 197The at least 17 S. pneumoniae serotypes conjugated to the antibody are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0038] In one embodiment, the pneumococcal glycoconjugate is a CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 1, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 3, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 4, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 5, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 7F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 8, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 9V conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 10A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 11A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 12F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 14, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15A conjugated to CRM 197Streptococcus pneumoniae (S. pneumoniae) serotype 15B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 18C conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 24F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to CRM 197 S. pneumoniae serotype 35B conjugated to S. pneumoniae serotype 35B, and combinations thereof.
[0039] In one embodiment, the pneumococcal glycoconjugate is a CRM 197 S. pneumoniae serotype 1 conjugated to SCP, S. pneumoniae serotype 3 conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 4, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 5, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6B conjugated to CRM 197Streptococcus pneumoniae (S. pneumoniae) serotype 7F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 8, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 9V conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 10A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 11A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 12F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 14, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 18C conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 24F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to CRM 197S. pneumoniae serotype 35B conjugated to S. pneumoniae serotype 35B, and combinations thereof.
[0040] In some embodiments, the total polysaccharide concentration is about 1-100 μg per dose. In some embodiments, the polysaccharide concentration for each serotype is about 1-10 μg per dose. In some embodiments, the buffer has a concentration of about 1-50 mM. In some embodiments, the sodium chloride has a concentration of about 1-300 mM. In some embodiments, the surfactant is a polysorbate or poloxamer having a molecular weight of about 1100 Da to 17,400 Da. In some embodiments, the surfactant is polysorbate 80. In some embodiments, the surfactant is polysorbate 20. In some embodiments, the surfactant concentration is about 0.001% to 1%. In some embodiments, the adjuvant is aluminum phosphate. In some embodiments, the adjuvant concentration is about 0.1% to 1%. In other embodiments, the adjuvant concentration is between about 0.01% and about 0.1%. In yet another embodiment, the concentration of the adjuvant is between about 0.1 mg / mL and about 1.0 mg / mL. In one embodiment, the concentration of the adjuvant is about 0.025%. In a specific embodiment, the adjuvant is aluminum phosphate at a concentration of about 0.025%.
[0041] In one embodiment, the present invention provides a formulation comprising at least 21 different glycoconjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; sodium chloride; sodium phosphate; a surfactant; and an adjuvant.
[0042] In some embodiments, the formulation comprises at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different glycoconjugates. In some embodiments, the formulation is a 24-valent pneumococcal conjugate composition. In some embodiments, the formulation is a 25-valent pneumococcal conjugate composition. In one embodiment, the glycoconjugate is a pneumococcal polysaccharide protein conjugate.
[0043] In some embodiments, the glycoconjugate comprises at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof. In some embodiments, the carrier protein of the glycoconjugate(s) is a diphtheria cross-reactive material (CRM). 197 ), diphtheria toxoid (DT), tetanus toxoid (TT), C5a peptidase from Streptococcus (SCP) or rhizavidin [aa 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0044] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, wherein the S. pneumoniae serotypes are selected from the group consisting of CRM 197 It is conjugated to
[0045] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 5, and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.
[0046] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0047] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0048] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0049] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.
[0050] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0051] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are CRM 197 In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0052] In some embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B. In some embodiments, the S. pneumoniae serotypes are CRM 197 In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0053] In some embodiments, the formulation comprises at least 25 glycoconjugates, including at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F. In some embodiments, at least two of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, the at least two S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F. In one embodiment, at least 17 of the S. pneumoniae serotypes are CRM 197 In one embodiment, the CRM 197The at least 17 S. pneumoniae serotypes conjugated to the antibody are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0054] In one embodiment, the pneumococcal glycoconjugate is a CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 1, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 3, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 4, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 5, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 7F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 8, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 9V conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 10A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 11A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 12F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 14, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15A conjugated to CRM 197Streptococcus pneumoniae (S. pneumoniae) serotype 15B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 18C conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 24F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to CRM 197 S. pneumoniae serotype 35B conjugated to S. pneumoniae serotype 35B, and combinations thereof.
[0055] In one embodiment, the pneumococcal glycoconjugate is a CRM 197 S. pneumoniae serotype 1 conjugated to SCP, S. pneumoniae serotype 3 conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 4, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 5, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6B conjugated to CRM 197Streptococcus pneumoniae (S. pneumoniae) serotype 7F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 8, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 9V conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 10A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 11A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 12F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 14, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 18C conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 24F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to CRM 197S. pneumoniae serotype 35B conjugated to S. pneumoniae serotype 35B, and combinations thereof.
[0056] In some embodiments, the total polysaccharide concentration is about 1-100 μg per dose. In some embodiments, the polysaccharide concentration for each serotype is about 1-10 μg per dose. In some embodiments, the buffer has a concentration of about 1-50 mM. In some embodiments, the sodium chloride has a concentration of about 1-300 mM. In some embodiments, the calcium chloride concentration is about 1-50 mM. In some embodiments, the surfactant is a polysorbate or poloxamer having a molecular weight of about 1100 Da to 17,400 Da. In some embodiments, the surfactant is polysorbate 80. In some embodiments, the surfactant is polysorbate 20. In some embodiments, the surfactant concentration is about 0.001% to 1%. In some embodiments, the adjuvant is aluminum phosphate. In some embodiments, the adjuvant concentration is about 0.1% to 1%.
[0057] In one embodiment, the present invention provides a formulation comprising at least 21 different glycoconjugates; a histidine buffer having a pH in the range of 5.0 to 7.5; sodium chloride; a surfactant; and an adjuvant.
[0058] In some embodiments, the formulation comprises at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different glycoconjugates. In some embodiments, the formulation is a 24-valent pneumococcal conjugate composition. In some embodiments, the formulation is a 25-valent pneumococcal conjugate composition. In one embodiment, the glycoconjugate is a pneumococcal polysaccharide protein conjugate.
[0059] In some embodiments, the glycoconjugate comprises at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof. In some embodiments, the carrier protein of the glycoconjugate(s) is a diphtheria cross-reactive material (CRM). 197 ), diphtheria toxoid (DT), tetanus toxoid (TT), C5a peptidase from Streptococcus (SCP) or rhizavidin [aa 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0060] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, wherein the S. pneumoniae serotypes are selected from the group consisting of CRM 197 It is conjugated to
[0061] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 5, and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.
[0062] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0063] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0064] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0065] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.
[0066] In certain embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are CRM 197 It is conjugated to
[0067] In one embodiment, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are CRM 197 In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0068] In some embodiments, the formulation comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B. In some embodiments, the S. pneumoniae serotypes are CRM 197 In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0069] In some embodiments, the formulation comprises at least 25 glycoconjugates, including at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and further including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F. In some embodiments, at least two of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, the at least two S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F. In one embodiment, at least 17 of the S. pneumoniae serotypes are CRM 197 In one embodiment, the CRM 197The at least 17 S. pneumoniae serotypes conjugated to the antibody are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0070] In one embodiment, the pneumococcal glycoconjugate is a CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 1, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 3, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 4, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 5, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 7F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 8, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 9V conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 10A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 11A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 12F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 14, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15A conjugated to CRM 197Streptococcus pneumoniae (S. pneumoniae) serotype 15B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 18C conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 24F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to CRM 197 S. pneumoniae serotype 35B conjugated to S. pneumoniae serotype 35B, and combinations thereof.
[0071] In one embodiment, the pneumococcal glycoconjugate is a CRM 197 S. pneumoniae serotype 1 conjugated to SCP, S. pneumoniae serotype 3 conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 4, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 5, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6B conjugated to CRM 197Streptococcus pneumoniae (S. pneumoniae) serotype 7F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 8, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 9V conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 10A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 11A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 12F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 14, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 18C conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 24F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to CRM 197S. pneumoniae serotype 35B conjugated to S. pneumoniae serotype 35B, and combinations thereof.
[0072] In some embodiments, the total polysaccharide concentration is about 1-100 μg per dose. In some embodiments, the polysaccharide concentration for each serotype is about 1-10 μg per dose. In some embodiments, the buffer has a concentration of about 1-50 mM. In some embodiments, the sodium chloride has a concentration of about 1-300 mM. In some embodiments, the sodium phosphate concentration is about 1-50 mM. In some embodiments, the surfactant is a polysorbate or poloxamer having a molecular weight of about 1100 Da to 17,400 Da. In some embodiments, the surfactant is polysorbate 80. In some embodiments, the surfactant is polysorbate 20. In some embodiments, the surfactant concentration is about 0.001% to 1%. In some embodiments, the adjuvant is aluminum phosphate. In some embodiments, the adjuvant concentration is about 0.1% to 1%.
[0073] In one embodiment, the formulation comprises 25 glycoconjugates, 5 mM succinate pH 5.8, 150 mM sodium chloride, 20 mM calcium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.
[0074] In one embodiment, the formulation comprises 25 glycoconjugates, 5 mM succinate pH 5.8, 40 mM sodium phosphate, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.
[0075] In one embodiment, the formulation comprises 25 glycoconjugates, 25 mM histidine pH 5.8, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.
[0076] In one embodiment, the present invention provides a composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase; and at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant have precipitated from the liquid phase to form a precipitate, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase. at a time T2, a further portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, the at least 25 different glycoconjugates being at a concentration C2 in the liquid phase; and the sedimentation rate is measured over time via static multiple light scattering to detect particle movement in the liquid, the measurement head comprising a pulsed near-infrared light source at a wavelength of approximately 880 nm, having synchronous transmission at 180° from a source-detector and backscattering at 45° from the source-detector that moves along the height of a flat-bottom cylindrical glass sample cell, and collecting sediment data every 20 μm.
[0077] In some embodiments, T0 is 0 hours. In some embodiments, T1 is about 0.01 hours to 4 hours. In some embodiments, T1 is about 1 hour to 2 hours. In some embodiments, T2 is about 1 hour to 5 hours. In some embodiments, T2 is about 4 hours. In some embodiments, C0 is higher than C1 and C2. In some embodiments, C1 is higher than C2.
[0078] In some embodiments, the peak thickness of the sedimentation front at T1 is between about 0 mm and 20 mm. In some embodiments, the peak thickness of the sedimentation front at T1 is at least 2 mm. In some embodiments, the peak thickness of the sedimentation front at T2 is between about 2 mm and 25 mm. In some embodiments, the peak thickness of the sedimentation front at T2 is at least 10 mm. In some embodiments, the settling rate of the sedimentation front is less than a peak thickness of 10 mm in about 1 hour and greater than a peak thickness of 18 mm in about 4 hours.
[0079] In some embodiments, the present invention further includes a time T3 during which the sedimentation of the insoluble aluminum phosphate-adsorbed glycoconjugate reaches equilibrium with the liquid phase at T3. In some embodiments, T3 is about 2 to 5 hours. In some embodiments, the peak thickness of the sedimentation front at T3 is about 25 to 35 mm. In some embodiments, the composition has been allowed to stand for about one month. In some embodiments, the composition has been allowed to stand for at least two weeks. In some embodiments, the composition is stored in a container. In some embodiments, the container is a syringe. In some embodiments, after T3, the composition is resuspended with 1 to 10 handshakes. In some embodiments, after T3, the composition is resuspended with a single handshake. In some embodiments, the composition comprises a formulation previously described.
[0080] In one embodiment, the present invention provides a liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase; and at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant have precipitated from the liquid phase to form a precipitate, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase. at time T2, a further portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, the at least 25 different glycoconjugates having a concentration C2 in the liquid phase; and sedimentation velocity is measured over time via static multiple light scattering to detect particle movement in the liquid, the measurement head comprising a pulsed near-infrared light source at a wavelength of approximately 880 nm, having synchronous transmission at 180° from a source-detector and backscattering at 45° from the source-detector that moves along the thickness of a flat-bottom cylindrical glass sample cell, and collecting precipitate data every 20 μm.
[0081] In some embodiments, T0 is 0 hours. In some embodiments, T1 is about 0.01 hours to 4 hours. In some embodiments, T1 is about 1 hour to 2 hours. In some embodiments, T2 is about 1 hour to 5 hours. In some embodiments, T2 is about 4 hours. In some embodiments, C0 is higher than C1 and C2. In some embodiments, C1 is higher than C2.
[0082] In some embodiments, the peak thickness of the subsidence front at T1 is about 0 mm to 20 mm. In some embodiments, the peak thickness of the subsidence front at T1 is at least 2 mm. In some embodiments, the peak thickness of the subsidence front at T2 is about 2 mm to 25 mm. In some embodiments, the peak thickness of the subsidence front at T2 is at least 10 mm.
[0083] In some embodiments, the present invention further includes a time T3 during which the sedimentation of the insoluble aluminum phosphate-adsorbed glycoconjugate reaches equilibrium with the liquid phase at T3. In some embodiments, T3 is about 2 to 5 hours. In some embodiments, the peak thickness of the sedimentation front at T3 is about 25 to 35 mm. In some embodiments, the container has been left undisturbed for about one month. In some embodiments, the container has been left undisturbed for at least two weeks. In some embodiments, the container is a syringe. In some embodiments, after T3, the composition is resuspended with 1 to 10 handshakes. In some embodiments, after T3, the composition is resuspended with a single handshake. In some embodiments, the liquid comprises a formulation previously described. [Brief explanation of the drawings]
[0084] [Figure 1] FIG. 1 shows the sedimentation rate of different vaccine formulations by plotting peak thickness (also known as the sedimentation front) as a function of time (hr). [Figure 2] FIG. 2 shows the area on the graph (shaded) between the 7 and 20 serotype control formulation sedimentation curves. [Figure 3] FIG. 3 shows the area on the graph (shaded) between the 7 and 25 serotype control formulation sedimentation curves. [Figure 4] FIG. 4 shows the sedimentation cake height of different vaccine formulations. [Figure 5] FIG. 5 shows the resuspension of different formulations after standing for 3 days or 2 weeks. [Figure 6] 6 is a graphical representation of the number of handshakes required to resuspend tested samples in pre-filled syringes (PFS) after 2, 7, and 30 days of syringe storage. Tested samples included samples with and without LiNA-2A (as discussed in Example 6). [Figure 7]7 is a graphical representation of the number of handshakes required to resuspend tested samples in pre-filled syringes (PFS) after 0, 7, and 30 days of syringe storage. Tested samples included samples with and without LiNA-1 (as discussed in Example 6). DETAILED DESCRIPTION OF THE INVENTION
[0085] The present invention is based on the seminal discovery of a vaccine formulation for pneumococcal vaccines that facilitates resuspension of particles that have settled out of the liquid phase to ensure dose accuracy and long-term stability.
[0086] Before describing the compositions and methods of the present invention, it is to be understood that the invention is not limited to the particular compositions, methods, and experimental conditions described, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0087] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "the method" includes one or more methods, and / or steps, of the type described herein that will become apparent to those skilled in the art upon reading this disclosure and so forth.
[0088] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0089] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, but it is understood that modifications and variations are encompassed within the spirit and scope of this disclosure. Preferred methods and materials are described herein.
[0090] vaccine preparations In some embodiments, the vaccine formulation of the present disclosure comprises one or more of the following immunogens: naturally occurring or artificially created proteins, recombinant proteins, glycoproteins, peptides, carbohydrates, saccharides, nucleic acids, haptens, whole viruses, bacteria, protozoa, or virus-like particles, or conjugates thereof. Exemplary nucleic acids or polynucleotides of the vaccine formulation include, but are not limited to, ribonucleic acid (RNA), including mRNA, and deoxyribonucleic acid (DNA). In some embodiments, the vaccine formulation comprises DNA encoding a polypeptide described herein or a fragment thereof. In some embodiments, the vaccine formulation comprises RNA encoding a polypeptide described herein or a fragment thereof. In some embodiments, the vaccine formulation comprises an mRNA polynucleotide encoding a polypeptide described herein or a fragment thereof. In some embodiments, the vaccine formulation comprises a modified RNA molecule (modRNA).
[0091] In some embodiments, the vaccine formulations of the present disclosure comprise a capsular saccharide antigen, and optionally the capsular saccharide is conjugated. Vaccine formulations of the present invention typically comprise conjugated capsular saccharide antigens (also named glycoconjugates), where the saccharide is derived from a serotype of S. pneumoniae.
[0092] Preferably, the number of S. pneumoniae capsular saccharides is at least 25 different serotypes (or "v", valency, "25v"). In one embodiment, there are 21 different serotypes. In one embodiment, there are 22 different serotypes. In one embodiment, there are 23 different serotypes. In one embodiment, there are 24 different serotypes. In one embodiment, there are 25 different serotypes. In one embodiment, there are 26 different serotypes. In one embodiment, there are 27 different serotypes. In one embodiment, there are 28 different serotypes. In one embodiment, there are 29 different serotypes. In one embodiment, there are 30 different serotypes. In one embodiment, there are 31 different serotypes. In one embodiment, there are 32 different serotypes. In one embodiment, there are 32 different serotypes. In one embodiment, there are 33 different serotypes. In one embodiment, there are 34 different serotypes. In one embodiment, there are 35 different serotypes. The capsular saccharide is conjugated to a carrier protein to form a glycoconjugate, as described herein below.
[0093] In a preferred embodiment, the saccharides are each individually conjugated to a different molecule of the protein carrier (each molecule of the protein carrier has only one type of saccharide conjugated to it), in which embodiment the capsular saccharides are said to be individually conjugated to the carrier protein.
[0094] For purposes of the present invention, the term "glycoconjugate" refers to a capsular saccharide that is covalently or via a high affinity interaction linked to a carrier protein. In one embodiment, the capsular saccharide is directly linked to the carrier protein. In a second embodiment, the capsular saccharide is linked to the protein via a spacer / linker.
[0095] Carrier proteins In a preferred embodiment, the carrier protein of the glycoconjugate is selected from the group consisting of: DT (diphtheria toxoid), TT (tetanus toxoid) or fragment C of TT, CRM 197 (a non-toxic but antigenically identical variant of diphtheria toxin), other DT variants (e.g., CRM 176 , CRM 228 , CRM 45 (Uchida et al. (1973) J. Biol. Chem. 218:3838~3844), CRM9, CRM 102 , CRM 103 Or CRM 107and other mutations described by Nicholls and Youle in Genetically Engineered Toxins, Ed: Frankel, Maecel Dekker Inc. (1992); deletion of Glu-148 and / or Ala-158, or mutation of Glu-148 to Asp, Gln, or Ser and / or Ala-158 to Gly, and other mutations disclosed in U.S. Pat. Nos. 4,709,017 and 4,950,740; at least one or more residues Lys516, Lys526, Phe530, and / or Mutations at Lys534 and other mutations disclosed in U.S. Pat. Nos. 5,917,017 and 6,455,673; or fragments disclosed in U.S. Pat. No. 5,843,711, pneumolysin (ply) containing ply detoxified in some manner, such as dPLY-GMBS (WO 2004 / 081515, WO 2006 / 032499) or dPLY-formol (Kuo et al. (1995) Infect. Immun 63:2706-2713), PhtX including PhtA, PhtB, PhtD, and PhtE (the sequences of PhtA, PhtB, PhtD, and PhtE are disclosed in WO00 / 37105 and WO00 / 39299), and fusions of Pht proteins, such as PhtDE fusions, PhtBE fusions, and PhtA-E (WO01 / 98334, WO03 / 054007, WO2009 / 000826), OMPC (meningococcal outer membrane protein) usually extracted from Neisseria meningitidis serogroup B (EP0372501), PorB (N.meningitidis), PD (Haemophilus influenzae protein D; see, e.g., EP 0594610 B) or immunologically functional equivalents thereof, synthetic peptides (EP 0378881, EP 0427347), heat shock proteins (WO 93 / 17712, WO 94 / 03208), pertussis proteins (WO 98 / 58668, EP 0471177), cytokines, lymphokines, growth factors or hormones (WO 91 / 01146), artificial proteins containing multiple human CD4+ T cell epitopes derived from antigens from various pathogens (Falugi et al. (2001) Eur J Immunol 31:3816-3824), e.g., N19 protein (Baraldoi et al. (2004) Infect Immunol 72:4884-4887), pneumococcal surface protein PspA (WO 02 / 091998), iron uptake protein (WO 01 / 72337), Clostridium difficile toxin A or B (WO 00 / 61761), transferrin-binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A (particularly non-toxic mutants thereof, such as exotoxin A bearing a substitution at glutamic acid 553 (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other proteins, such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), or purified protein derivative of tuberculin (PPD), can also be used as carrier proteins. Other suitable carrier proteins include inactivated bacterial toxins such as cholera toxoid (e.g., as described in WO2004 / 083251), Escherichia coli LT, E. coli ST, and Pseudomonas aeruginosa (P.Exotoxin A from Aeruginosa is another suitable carrier protein. Another suitable carrier protein is C5a peptidase (SCP) from Streptococcus. Another suitable carrier protein is rhizavidin [aa45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0096] In a preferred embodiment, the carrier protein of the glycoconjugate is selected from the group consisting of TT, DT, DT variants (e.g., CRM 197 ), H. influenzae protein D, PhtX, PhtD, PhtDE fusions (particularly those described in WO01 / 98334 and WO03 / 054007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, Clostridium difficile toxin A or B, PsaA, C5a peptidase from Streptococcus (SCP), and biotin-strepavidin.
[0097] In one embodiment, the carrier protein of the glycoconjugates of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugates of the invention is TT (tetanus toxoid). In one embodiment, the glycoprotein carrier is C5a peptidase (SCP) from Streptococcus. In another embodiment, the carrier protein of the glycoconjugates of the invention is PD (H. influenzae protein D; see, e.g., EP 0 594 610 B).
[0098] In a preferred embodiment, the capsular saccharide of the present invention is a CRM 197 Conjugated to a protein. CRM 197 The protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. 197CRM is produced by Corynebacterium diphtheriae infected with the nontoxigenic phage β197tox-, which was created by nitrosoguanidine mutagenesis of the toxigenic corynephage beta (Uchida et al. (1971) Nature New Biology 233:8-11). 197 The protein has the same molecular weight as diphtheria toxin but differs from it by a single base change in the structural gene (guanine to adenine). This single base change causes an amino acid substitution in the mature protein (glycine to glutamic acid), eliminating the toxic properties of diphtheria toxin. 197 Proteins are safe and effective T cell-dependent carriers for saccharides. 197 and further details regarding its production can be found, for example, in US Pat. No. 5,614,382.
[0099] In one embodiment, the capsular saccharide of the present invention is a CRM 197 Protein or CRM 197 (See CN103495161). In one embodiment, the capsular saccharide of the present invention is conjugated to the A chain of CRM obtained via expression in recombinant E. coli. 197 (See CN103495161). In one embodiment, all capsular saccharides of the present invention are conjugated to the A chain of CRM 197 In one embodiment, all capsular saccharides of the invention are conjugated to a CRM 197 It is conjugated to the A chain of
[0100] Thus, in frequent embodiments, the glycoconjugates of the invention will contain CRM as the carrier protein. 197 The capsular polysaccharide comprises CRM 197 is covalently linked to
[0101] Capsular saccharides The term "saccharide" as used throughout this specification can refer to either polysaccharides or oligosaccharides, and includes both. In frequent embodiments, the saccharide is a polysaccharide, particularly a S. pneumoniae capsular polysaccharide.
[0102] Capsular polysaccharides are prepared by standard techniques known to those skilled in the art.
[0103] In the present invention, capsular polysaccharides can be prepared or derived from, for example, serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B of S. pneumoniae. Typically, capsular polysaccharides are produced by growing each S. pneumoniae serotype in a medium (e.g., a soy-based medium), and the polysaccharides are then prepared from the bacterial culture. The S. pneumoniae bacterial strains used to make the respective polysaccharides used in the glycoconjugates of the present invention can be obtained from established culture collections or clinical specimens.
[0104] In one embodiment, the formulation comprises at least 21 different polysaccharides. In one embodiment, the formulation comprises at least 22 different polysaccharides. In one embodiment, the formulation comprises at least 23 different polysaccharides. In one embodiment, the formulation comprises at least 24 different polysaccharides. In one embodiment, the formulation comprises at least 25 different polysaccharides. In one embodiment, the formulation comprises at least 26 different polysaccharides. In one embodiment, the formulation comprises at least 27 different polysaccharides. In one embodiment, the formulation comprises at least 28 different polysaccharides. In one embodiment, the formulation comprises at least 29 different polysaccharides. In one embodiment, the formulation comprises at least 30 different polysaccharides. In one embodiment, the formulation comprises at least 31 different polysaccharides. In one embodiment, the formulation comprises at least 32 different polysaccharides. In one embodiment, the formulation comprises at least 33 different polysaccharides. In one embodiment, the formulation comprises at least 34 different polysaccharides. In one embodiment, the formulation comprises at least 35 different polysaccharides.
[0105] Populations of organisms (each S. pneumoniae serovar) are often scaled up from seed vials to seed bottles and passed through one or more seed fermenters of increasing volumes until an industrial-scale fermentation volume is reached. At the end of the growth cycle, the cells are lysed and the lysate broth is then recovered for downstream (purification) processing (see, e.g., WO2006 / 110381, WO2008 / 118752, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).
[0106] Individual polysaccharides are typically purified via centrifugation, precipitation, ultrafiltration and / or column chromatography (see, for example, WO2006 / 110352 and WO2008 / 118752).
[0107] The purified polysaccharides can be activated (e.g., chemically activated) to render them capable of reacting (e.g., with an eTEC spacer), as further described herein, and then incorporated into the glycoconjugates of the invention.
[0108] The S. pneumoniae capsular polysaccharide contains repeating oligosaccharide units that can contain up to eight sugar residues.
[0109] In one embodiment, the capsular saccharide of the invention can be a single oligosaccharide unit or a saccharide chain of repeating oligosaccharide units that is shorter than the native length, hi one embodiment, the capsular saccharide of the invention is a single repeating oligosaccharide unit of the appropriate serotype.
[0110] In one embodiment, the capsular saccharide of the present invention may be an oligosaccharide, which has a low number of repeating units (typically 5-15 repeating units) and is typically derived synthetically or by hydrolysis of a polysaccharide.
[0111] Preferably, however, all of the capsular saccharides of the present invention in the vaccine formulations of the present invention are polysaccharides. High molecular weight capsular polysaccharides can induce a specific antibody immune response due to epitopes present on the antigen surface. Isolation and purification of high molecular weight capsular polysaccharides are preferably contemplated for use in the conjugates, compositions, and methods of the present invention.
[0112] In some embodiments, the purified polysaccharide prior to conjugation has a molecular weight between 10 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 4,000 kDa. In further such embodiments, the polysaccharide has a molecular weight between 50 kDa and 3,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 3,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 2,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 1,750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 1,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 1,250 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 1,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 3,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 3,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 2,500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 1,750 kDa.In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 1,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 1,250 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 1,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 3,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 3,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 2,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 1,750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 1,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 1,250 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 1,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 500 kDa. Any integer within any of the above ranges is contemplated as an embodiment of the present disclosure.
[0113] Polysaccharides may be slightly reduced in size during normal purification procedures. Furthermore, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. Mechanical or chemical sizing may be used. Chemical hydrolysis may be performed using acetic acid. Mechanical sizing may be performed using high-pressure homogenization shear. The molecular weight ranges described above refer to purified polysaccharides prior to conjugation (e.g., prior to activation).
[0114] In a preferred embodiment, the purified polysaccharide is a capsular polysaccharide from S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F or 35B, wherein the capsular polysaccharide has a molecular weight that falls within one of the molecular weight ranges set out herein above.
[0115] As used herein, the term "molecular weight" of a polysaccharide or carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) coupled with a multi-angle laser light scattering detector (MALLS).
[0116] In some embodiments, pneumococcal saccharides from serotypes 9V, 18C, 11A, 15B, 22F and / or 33F of the invention are O-acetylated. In some embodiments, pneumococcal saccharides from serotypes 9V, 11A, 15B, 22F and / or 33F of the invention are O-acetylated.
[0117] The purified polysaccharides described herein are chemically activated to render the saccharide capable of reacting with a carrier protein. These pneumococcal conjugates are prepared by separate processes, briefly described below, and formulated into single-dosage formulations as described in the art.
[0118] Polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F Capsular saccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F can be prepared by standard techniques known to those skilled in the art (see, e.g., WO2006 / 110381). Capsular polysaccharides can be produced by growing each S. pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed, and the lysate broth is then collected for downstream (purification) processing. Individual polysaccharides are typically purified via centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752). The purified polysaccharides can be further processed as further described herein to prepare the glycoconjugates of the present invention.
[0119] Polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotype 8 The polysaccharide repeating unit of serotype 8 consists of a linear tetrasaccharide unit with one glucuronic acid (GlcpA), two glucopyranoses (Glcp), and one galactopyranose (Galp) (Jones et al. (1957) The Journal of the American Chemical Society. 79(11):2787-2793). All four monosaccharides are linked via 1,4-linkages.
[0120] Serotype 8 saccharides can be obtained directly from bacteria using isolation procedures known to those of skill in the art (see, e.g., the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.
[0121] Serotype 8 S. pneumoniae strains can be obtained from established culture collections (such as the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.
[0122] Polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotype 10A The polysaccharide repeating unit of serotype 10A contains two galactofuranose residues (Gal f ), three galactopyranose (Gal p ), one N-acetylgalactosamine (Gal p It consists of a branched chain hexasaccharide repeating unit with a β-GalpNAc moiety and a backbone phosphoribitol (Jones, C. (2005) Carbohydrate Research 269(1):175-181). In the β-GalpNAc moiety, two branched monosaccharides (β-3-Galp and β-6-Galf) are present.
[0123] Serotype 10A saccharides can be obtained directly from bacteria using isolation procedures known to those of skill in the art (see, e.g., the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.
[0124] Serotype 10A S. pneumoniae strains can be obtained from established culture collections (such as the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.
[0125] Polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotype 11A The polysaccharide repeating unit of serotype 11A is a linear tetrasaccharide backbone (two galactopyranose (Gal) p ) and two glucopyranose (Glc p )) and pendant phosphoglycerol (Richards et al. (1988) Adv. Exp. Med. Biol. 228:595-597). The polysaccharide is O-acetylated at multiple positions, and based on data reported in the literature (Calix et al. (2011) J. Bacteriol. 193(19):5271-5278), the total amount of O-acetylation in the 11A polysaccharide is approximately 2.6 O-acetyl groups per polysaccharide repeat unit.
[0126] Serotype 11A saccharides can be obtained directly from bacteria using isolation procedures known to those of skill in the art (see, e.g., the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.
[0127] Serotype 11A S. pneumoniae strains can be obtained from established culture collections (such as the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.
[0128] Polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotype 12F The polysaccharide repeating unit of serotype 12F has two branches: Fuc p Pendant α-galactopyranose (Gal) linked at C3 of NAc p ), and Man p α-Glc linked at C3 of NAcA p -(1→2)-α-Glc p A linear trisaccharide backbone (one N-acetylfucosamine (Fuc)) with disaccharide branches p NAc), one N-acetylgalactosamine (Gal p NAc) and one N-acetylmannuronic acid (Man p NAcA) (Leontein et al. (1983) Carbohydrate Research 114(2):257-266).
[0129] Serotype 12F Streptococcus pneumoniae strains can be obtained from established culture collections (such as the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.
[0130] Polysaccharides from Streptococcus pneumoniae serotype 15A Capsular saccharides from S. pneumoniae serotype 15A can be prepared by standard techniques known to those skilled in the art (see, e.g., WO2019 / 139692). Isolates of S. pneumoniae serotype 15A can be obtained from the American Type Culture Collection (Manassas). Capsular polysaccharides can be produced by growing each S. pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed, and the lysate broth is then collected for downstream (purification) processing. Individual polysaccharides are typically purified via centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752). The purified polysaccharides can be further processed as further described herein to prepare the glycoconjugates of the invention.
[0131] Polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotype 15B The polysaccharide repeating unit of serotype 15B is Glc p αGal linked to the C4 hydroxyl group of NAc p -βGal p A branched trisaccharide backbone (one N-acetylglucosamine (Glc)) with disaccharide branches p NAc), one galactopyranose (Gal p ) and one glucopyranose (Glc p)) Phosphoglycerol is attached to the βGal in the disaccharide branch. p The capsular polysaccharide from serotype 15C has the same backbone structure as serotype 15B but lacks O-acetylation.
[0132] Serotype 15B polysaccharides can be obtained directly from bacteria using isolation procedures known to those of skill in the art (see, e.g., the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). They can also be produced using synthetic protocols known to those of skill in the art.
[0133] Serotype 15B S. pneumoniae strains can be obtained from established culture collections (e.g., American Type Culture Collection (ATCC), Manassas, VA USA) (e.g., deposit strain number ATCC10354) or Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA USA)) or from clinical specimens.
[0134] Polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotype 22F The polysaccharide repeating unit of serotype 22F is βRha p αGlc linked to the C3 hydroxyl group of p Branched chain pentasaccharide backbone (one glucuronic acid (Glc) p A), one glucopyranose (Glc p ), one galactofuranose (Gal f) and two rhamnopyranosides (Rha p )) (Richards et al. (1989) Canadian Journal of Chemistry 67(6):1038-1050). p Approximately 80% of the C2 hydroxyl groups of the residues are O-acetylated.
[0135] Serotype 22F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.
[0136] Serotype 22F S. pneumoniae strains can be obtained from established culture collections (such as the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.
[0137] Polysaccharides from Streptococcus pneumoniae serotypes 23A and 23B Capsular saccharides from S. pneumoniae serotypes 23A and 23B can be prepared by standard techniques known to those skilled in the art (see, e.g., WO2019 / 050814). Isolates of S. pneumoniae serotype 23A can be obtained from the Merck Culture Collection, and serotype 23B can be obtained from the Centers for Disease Control and Prevention (Atlanta, GA). Capsular polysaccharides can be produced by growing each S. pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed, and the lysate broth is then collected for downstream (purification) processing. Individual polysaccharides are typically purified via centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752). The purified polysaccharides can be further processed as further described herein to prepare the glycoconjugates of the present invention.
[0138] Polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotype 24F Capsular saccharides from S. pneumoniae serotype 24F can be prepared by standard techniques known to those skilled in the art (see, e.g., WO2019 / 050815). Isolates of S. pneumoniae serotype 24F can be obtained from the Merck Culture Collection. Capsular polysaccharides can be produced by growing each S. pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed, and the lysate broth is then collected for downstream (purification) processing. Individual polysaccharides are typically purified via centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752). The purified polysaccharides can be further processed as further described herein to prepare the glycoconjugates of the present invention.
[0139] Polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotype 33F The polysaccharide repeating unit of serotype 33F contains αGal in the backbone. p Terminal αGal linked to the C2 hydroxyl group of the residue p A branched pentasaccharide backbone (two galactopyranoses (Gal p ), two galactofuranose (Gal f ) and one glucopyranose (Glc p )) (Lemercinier et al. (2006) Carbohydrate Research 341(1):68-74). f It has been reported in the literature that the C2 hydroxyl group of the residue is O-acetylated.
[0140] Serotype 33F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.
[0141] Serotype 33F S. pneumoniae strains can be obtained from established culture collections (such as the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.
[0142] Polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotype 35B Capsular saccharides from S. pneumoniae serotype 35B can be prepared by standard techniques known to those skilled in the art (see, e.g., WO2020 / 247299). Isolates of S. pneumoniae serotype 35B can be obtained from the Merck Culture Collection. Capsular polysaccharides can be produced by growing each S. pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed, and the lysate broth is then collected for downstream (purification) processing. Individual polysaccharides are typically purified via centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752). The purified polysaccharides can be further processed as further described herein to prepare the glycoconjugates of the present invention.
[0143] Glycoconjugates The purified saccharides are chemically activated to render the saccharides (i.e., activated saccharides) capable of reacting with carrier proteins. Once activated, each capsular saccharide is separately conjugated to a carrier protein to form a glycoconjugate.
[0144] In the present invention, the glycoconjugates may be prepared from or derived from, for example, serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B of S. pneumoniae.
[0145] In one embodiment, the formulation comprises at least 21 different glycoconjugates. In one embodiment, the formulation comprises at least 22 different glycoconjugates. In one embodiment, the formulation comprises at least 23 different glycoconjugates. In one embodiment, the formulation comprises at least 24 different glycoconjugates. In one embodiment, the formulation comprises at least 25 different glycoconjugates. In one embodiment, the formulation comprises at least 26 different glycoconjugates. In one embodiment, the formulation comprises at least 27 different glycoconjugates. In one embodiment, the formulation comprises at least 28 different glycoconjugates. In one embodiment, the formulation comprises at least 29 different glycoconjugates. In one embodiment, the formulation comprises at least 30 different glycoconjugates. In one embodiment, the formulation comprises at least 31 different glycoconjugates. In one embodiment, the formulation comprises at least 32 different glycoconjugates. In one embodiment, the formulation comprises at least 33 different glycoconjugates. In one embodiment, the formulation comprises at least 34 different glycoconjugates. In one embodiment, the formulation comprises at least 35 different glycoconjugates.
[0146] In one embodiment, each capsular saccharide is conjugated to the same carrier protein. Chemical activation of the saccharide and subsequent conjugation to the carrier protein can be achieved by activation and conjugation methods known in the art and briefly described below.
[0147] Glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F Capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of S. pneumoniae are prepared by standard techniques known to those skilled in the art (see, e.g., WO2006 / 110381, WO2008 / 118752, WO2006 / 110352, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).
[0148] In a preferred embodiment, at least one of the capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F of S. pneumoniae is conjugated to a carrier protein by reductive amination (e.g., as described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 0231340, 2007 / 0184071 and 2007 / 0184072, WO2006 / 110381, WO2008 / 079653 and WO2008 / 143709). In a preferred embodiment, capsular polysaccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F are all conjugated to carrier proteins by reductive amination.
[0149] Glycoconjugates from Streptococcus pneumoniae serotypes 8, 11A, 15B, and 22F In certain embodiments, serotype 8, 11A, 15B, and 22F glycoconjugates are obtained by activating polysaccharides with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form cyanate esters. The activated polysaccharides can be coupled to amino groups on carrier proteins directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine, which results in thiolated polysaccharides that can be coupled to carriers via a thioether linkage obtained after reaction with maleimide-activated carrier proteins (e.g., using GMBS) or haloacetylated carrier proteins (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (which may be made by CDAP chemistry) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein using carbodiimide (e.g., EDAC or EDC) chemistry via carboxyl groups on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348, and WO 96 / 129094.
[0150] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation can involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of a saccharide with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with a protein to form a carbamate linkage. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0151] In a preferred embodiment, the serotype 8, 11A, 15B, and 22F glycoconjugates of the invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in individual hexasaccharide units, and (2) coupling of the activated polysaccharide and a carrier protein (e.g., CRM) to form the conjugate. 197 Methods for preparing glycoconjugates from serotypes 8, 11A, 15B and 22F S. pneumoniae are known and described in WO2015110941.
[0152] Glycoconjugates derived from Streptococcus pneumoniae serotype 12F In the glycoconjugates derived from S. pneumoniae serotype 12F of the present invention, the saccharide is selected from the group consisting of polysaccharides and oligosaccharides, and the carrier protein is selected from any suitable carrier described herein or known to those of skill in the art. In some preferred embodiments, the saccharide is a polysaccharide derived from serotype 12F S. pneumoniae.
[0153] In one embodiment, glycoconjugates derived from S. pneumoniae serotype 12F are prepared using CDAP. The polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled to a carrier protein (preferably CRMP). 197 The thiolated polysaccharide is coupled to an amino group on the carrier protein (e.g., directly or via a spacer (linker) group). For example, the spacer can be cystamine or cysteamine, which results in a thiolated polysaccharide that can be coupled to the carrier via a thioether linkage obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, SlAB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (which may be generated by CDAP chemistry) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is coupled to the carrier protein (e.g., CRM) using carbodiimide (e.g., EDAC or EDC) chemistry via carboxyl groups on the protein carrier. 197 ) is conjugated to
[0154] Other techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation can involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of a saccharide with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with a protein to form a carbamate linkage. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0155] In one embodiment, capsular polysaccharides derived from serotype 12F S. pneumoniae are conjugated to carrier proteins by reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate. Methods for preparing glycoconjugates derived from serotype 12F S. pneumoniae are known and are described in WO2015110941.
[0156] Glycoconjugates from Streptococcus pneumoniae serotype 15A Capsular polysaccharide from serotype 15A of S. pneumoniae is prepared by standard techniques known to those skilled in the art (see, e.g., WO2019 / 139692).
[0157] In a preferred embodiment, the serotype 15A glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in individual hexasaccharide units, and (2) coupling of the activated polysaccharide and a carrier protein (e.g., CRM) to form the conjugate. 197 Methods for preparing glycoconjugates from serotype 15A S. pneumoniae are known and described in WO2019 / 139692.
[0158] Glycoconjugates from Streptococcus pneumoniae serotypes 23A and 23B Capsular polysaccharides from serotypes 23A and 23B of S. pneumoniae are prepared by standard techniques known to those skilled in the art (see, e.g., WO2019 / 050814).
[0159] In a preferred embodiment, the serotype 23A and 23B glycoconjugates of the invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) coupling of the activated polysaccharide and a carrier protein (e.g., CRM) to form the conjugate. 197 Methods for preparing glycoconjugates from serotypes 23A, 23B, and 24F S. pneumoniae are known and described in WO2019 / 050814.
[0160] Glycoconjugates derived from Streptococcus pneumoniae serotype 24F Capsular polysaccharide from serotype 24F of S. pneumoniae is prepared by standard techniques known to those skilled in the art (see, e.g., WO2019 / 050815).
[0161] In a preferred embodiment, the serotype 24F glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) coupling of the activated polysaccharide and a carrier protein (e.g., CRM) to form the conjugate. 197 Methods for preparing glycoconjugates from serotype 24F S. pneumoniae are known and described in WO2019 / 050815.
[0162] Glycoconjugates derived from Streptococcus pneumoniae serotype 33F In one embodiment, serotype 33F glycoconjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to an amino group on a carrier protein directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine, which results in a thiolated polysaccharide that can be coupled to the carrier via a thioether linkage obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (which may be made by CDAP chemistry) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein using carbodiimide (e.g., EDAC or EDC) chemistry via carboxyl groups on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348, and WO 96 / 129094.
[0163] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation can involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of a saccharide with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with a protein to form a carbamate linkage. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate with an amino group on the protein.
[0164] In certain embodiments, the serotype 33F glycoconjugates of the present invention are prepared using reductive amination. In such embodiments, the serotype 33F glycoconjugates of the present invention can be prepared using reductive amination in an aqueous phase (RAC / aqueous). Reductive amination in an aqueous phase has been successfully applied to produce pneumococcal conjugate vaccines (see, for example, WO2006 / 110381). However, preferably, when using reductive amination, the serotype 33F glycoconjugates are prepared via reductive amination in DMSO (RAC / DMSO). Considering the challenges associated with preserving O-acetyl functional groups using the RAC / aqueous process, reductive amination in DMSO is preferred. RAC / DMSO has been successfully applied to produce pneumococcal conjugate vaccines (see, for example, WO2006 / 110381).
[0165] In a preferred embodiment, the serotype 33F glycoconjugates of the invention are prepared using eTEC conjugation as described in Examples 1, 2 and 3 in WO2014 / 027302 (hereinafter "serotype 33F eTEC-linked glycoconjugates").
[0166] Glycoconjugates from Streptococcus pneumoniae serotype 35B Capsular polysaccharide from serotype 35B of S. pneumoniae is prepared by standard techniques known to those skilled in the art (see, e.g., WO2020 / 247299).
[0167] In a preferred embodiment, the serotype 35B glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in individual hexasaccharide units, and (2) coupling of the activated polysaccharide and a carrier protein (e.g., CRM) to form the conjugate. 197 Methods for preparing glycoconjugates from serotype 35B S. pneumoniae are known and described in WO2020 / 247299.
[0168] Glycoconjugate combinations In certain embodiments, a vaccine formulation of the invention comprises any of the glycoconjugates or combinations of glycoconjugates disclosed herein.
[0169] In one embodiment, the formulation comprises at least 25 glycoconjugates. In one embodiment, the formulation comprises at least 21 glycoconjugates. In one embodiment, the formulation comprises at least 22 glycoconjugates. In one embodiment, the formulation comprises at least 23 glycoconjugates. In one embodiment, the formulation comprises at least 24 glycoconjugates. In one embodiment, the formulation comprises at least 25 glycoconjugates. In one embodiment, the formulation comprises at least 26 glycoconjugates. In one embodiment, the formulation comprises at least 27 glycoconjugates. In one embodiment, the formulation comprises at least 28 glycoconjugates. In one embodiment, the formulation comprises at least 29 glycoconjugates. In one embodiment, the formulation comprises at least 30 glycoconjugates. In one embodiment, the formulation comprises at least 31 glycoconjugates. In one embodiment, the formulation comprises at least 32 glycoconjugates. In one embodiment, the formulation comprises at least 33 glycoconjugates. In one embodiment, the formulation comprises at least 34 glycoconjugates. In one embodiment, the formulation comprises at least 35 glycoconjugates.
[0170] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F.
[0171] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F.
[0172] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 33F.
[0173] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F.
[0174] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F.
[0175] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 4, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.
[0176] In one embodiment, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F.
[0177] In one embodiment, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 22F, and 33F.
[0178] In one embodiment, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 24F, 33F, and 35B.
[0179] In one embodiment, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.
[0180] In one embodiment, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B.
[0181] In certain embodiments, the formulations of the invention comprise at least one glycoconjugate derived from S. pneumoniae serotype 1, a glycoconjugate of S. pneumoniae serotype 3, a glycoconjugate of S. pneumoniae serotype 4, a glycoconjugate of S. pneumoniae serotype 5, a glycoconjugate of S. pneumoniae serotype 6A, a glycoconjugate of S. pneumoniae serotype 6B, or a glycoconjugate of S. pneumoniae serotype 6C. glycoconjugates of Streptococcus pneumoniae serotype 7F, glycoconjugates of Streptococcus pneumoniae serotype 8, glycoconjugates of Streptococcus pneumoniae serotype 9V, glycoconjugates of Streptococcus pneumoniae serotype 10A, glycoconjugates of Streptococcus pneumoniae serotype 11A, glycoconjugates of Streptococcus pneumoniae serotype 12F, glycoconjugates of Streptococcus pneumoniae e) Glycoconjugates of serotype 14, glycoconjugates of S. pneumoniae serotype 15A, glycoconjugates of S. pneumoniae serotype 15B, glycoconjugates of S. pneumoniae serotype 18C, glycoconjugates of S. pneumoniae serotype 19A, glycoconjugates of S. pneumoniae serotype 19F, glycoconjugates of S. pneumoniae serotype 22F glycoconjugates of S. pneumoniae serotype 23A, glycoconjugates of S. pneumoniae serotype 23B, glycoconjugates of S. pneumoniae serotype 23F, glycoconjugates of S. pneumoniae serotype 24F, glycoconjugates of S. pneumoniae serotype 33F, glycoconjugates of S. pneumoniae serotype 35B, and combinations thereof.
[0182] In certain embodiments, the formulation comprises a glycoconjugate from S. pneumoniae serotype 1, a glycoconjugate from S. pneumoniae serotype 3, a glycoconjugate from S. pneumoniae serotype 4, a glycoconjugate from S. pneumoniae serotype 5, a glycoconjugate from S. pneumoniae serotype 6A, a glycoconjugate from S. pneumoniae serotype 6B, a glycoconjugate from S. pneumoniae serotype 6C, a glycoconjugate from S. pneumoniae serotype 6D, a glycoconjugate from S. pneumoniae serotype 6E, a glycoconjugate from S. pneumoniae serotype 6F, a glycoconjugate from S. pneumoniae serotype 6G, a glycoconjugate from S. pneumoniae serotype 6H ... Glycoconjugates of Streptococcus pneumoniae serotype 7F, glycoconjugates of Streptococcus pneumoniae serotype 8, glycoconjugates of Streptococcus pneumoniae serotype 9V, glycoconjugates of Streptococcus pneumoniae serotype 10A, glycoconjugates of Streptococcus pneumoniae serotype 11A, glycoconjugates of Streptococcus pneumoniae serotype 12F, glycoconjugates of Streptococcus pneumoniae Glycoconjugates of Streptococcus pneumoniae serotype 14, glycoconjugates of Streptococcus pneumoniae (S. pneumoniae) serotype 15A, glycoconjugates of Streptococcus pneumoniae (S. pneumoniae) serotype 15B, glycoconjugates of Streptococcus pneumoniae (S. pneumoniae) serotype 18C, glycoconjugates of Streptococcus pneumoniae (S. pneumoniae) serotype 19A, glycoconjugates of Streptococcus pneumoniae (S. pneumoniae) serotype 19F, glycoconjugates of Streptococcus pneumoniae (S. pneumoniae) serotype 22F glycoconjugates of S. pneumoniae serotype 23A, glycoconjugates of S. pneumoniae serotype 23B, glycoconjugates of S. pneumoniae serotype 23F, glycoconjugates of S. pneumoniae serotype 24F, glycoconjugates of S. pneumoniae serotype 33F, and glycoconjugates of S. pneumoniae serotype 35B.
[0183] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, wherein the glycoconjugates are selected from the group consisting of CRM 197 It is conjugated to
[0184] In one embodiment, a formulation of the invention comprises at least glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F. In one embodiment, the glycoconjugates of S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, the glycoconjugate of S. pneumoniae serotype 18C is conjugated to TT, and the glycoconjugate of S. pneumoniae serotype 19F is conjugated to DT.
[0185] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 33F, wherein the glycoconjugates of the S. pneumoniae serotypes are selected from the group consisting of CRM 197 It is conjugated to
[0186] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F, wherein the glycoconjugates of the S. pneumoniae serotypes are selected from the group consisting of CRM 197 It is conjugated to
[0187] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F, wherein the glycoconjugates of the S. pneumoniae serotypes are selected from the group consisting of CRM 197 It is conjugated to
[0188] In one embodiment, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F, wherein the glycoconjugates of the S. pneumoniae serotypes are selected from the group consisting of CRM 197 It is conjugated to
[0189] In one embodiment, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 22F, and 33F. In one embodiment, the glycoconjugates of S. pneumoniae serotypes are CRM 197 In one embodiment, glycoconjugates of S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM. 197 and the glycoconjugate of S. pneumoniae serotype 3 is conjugated to SCP.
[0190] In one embodiment, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23B, 24F, 33F, and 35B. In one embodiment, the glycoconjugates of S. pneumoniae serotypes are CRM 197 In one embodiment, glycoconjugates of S. pneumoniae serotypes 1, 2, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23B, 24F, 33F, and 35B are conjugated to a CRM. 197 and the glycoconjugate of S. pneumoniae serotype 3 is conjugated to SCP.
[0191] In certain embodiments, the formulations of the invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 24F, 33F, and 35B. In certain embodiments, at least two of the glycoconjugates of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, the at least two glycoconjugates of the S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F. In one embodiment, at least 17 of the glycoconjugates of S. pneumoniae serotypes are CRM 197 In one embodiment, the CRM 197The at least 17 glycoconjugates of S. pneumoniae serotypes conjugated to are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0192] In one embodiment, a formulation of the invention comprises at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the glycoconjugates of S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, the glycoconjugates of S. pneumoniae serotype 18C are conjugated to TT, and the glycoconjugates of S. pneumoniae serotype 19F are conjugated to DT.
[0193] In one embodiment, the formulation of the present invention comprises a CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 1, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 3, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 4, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 5, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 6B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 7F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 8, CRM conjugated to197 Streptococcus pneumoniae (S. pneumoniae) serotype 9V conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 10A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 11A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 12F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 14, CRM conjugated to 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 15B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 18C conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 19F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23A conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23B conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 23F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 24F conjugated to CRM 197 Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to CRM 197 and combinations thereof.
[0194] Preferably, all glycoconjugates of the vaccine formulation are individually conjugated to a carrier protein.
[0195] dosage The amount of glycoconjugate(s) in each dose is selected to induce an immunoprotective response without significant adverse side effects in a typical vaccine, and such amount will vary depending on the specific immunogen used and how it is presented.
[0196] Amount of glycoconjugate The amount of a particular glycoconjugate in a vaccine formulation can be calculated based on the total polysaccharide (conjugated and unconjugated) for that conjugate. For example, a glycoconjugate with 20% free polysaccharide will have approximately 80 μg of conjugated polysaccharide and approximately 20 μg of unconjugated polysaccharide in a 100 μg polysaccharide dose. The amount of glycoconjugate can vary depending on the pneumococcal serotype. Saccharide concentration can be determined by uronic acid assay.
[0197] The "immunogenic amounts" of the different polysaccharide components in the vaccine formulation may vary and may each comprise about 1 μg, about 2 μg, about 3 μg, about 4 μg, about 5 μg, about 6 μg, about 7 μg, about 8 μg, about 9 μg, about 10 μg, about 15 μg, about 20 μg, about 30 μg, about 40 μg, about 50 μg, about 60 μg, about 70 μg, about 80 μg, about 90 μg or about 100 μg of any particular polysaccharide antigen.
[0198] Generally, each dose contains between 0.1 μg and 100 μg of polysaccharide for a given serotype, particularly between 0.5 μg and 20 μg, more particularly between 1.0 μg and 10 μg, and even more particularly between 2.0 μg and 5.0 μg. Any integer within any of the above ranges is contemplated as an embodiment of the present disclosure.
[0199] In some embodiments, each dose contains about 1.0 μg to about 6.0 μg of polysaccharide for each specific glycoconjugate. In some embodiments, each dose contains about 1.5 μg to about 5.0 μg of polysaccharide for each specific glycoconjugate. In preferred embodiments, each dose contains about 2.0 μg to about 4.0 μg of polysaccharide for each specific glycoconjugate. In more preferred embodiments, each dose contains about 2.0 μg to about 3.0 μg of polysaccharide for each specific glycoconjugate. In some embodiments, each dose contains about 1.0 μg of polysaccharide for each specific glycoconjugate. In some embodiments, each dose contains about 1.2 μg of polysaccharide for each specific glycoconjugate. In some embodiments, each dose contains about 1.4 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 1.6 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 1.8 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 2.0 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 2.2 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 2.4 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 2.6 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 2.8 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 3.0 μg of polysaccharide for each specific glycoconjugate. In some embodiments, each dose contains about 3.2 μg of polysaccharide for each particular glycoconjugate. In some embodiments, each dose contains about 3.4 μg of polysaccharide for each particular glycoconjugate. In some embodiments, each dose contains about 3.6 μg of polysaccharide for each particular glycoconjugate.In certain embodiments, each dose contains about 3.8 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 4.0 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 4.2 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 4.4 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 4.6 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 4.8 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 5.0 μg of polysaccharide for each specific glycoconjugate. In certain embodiments, each dose contains about 5.2 μg of polysaccharide for each specific glycoconjugate. In some embodiments, each dose contains about 5.4 μg of polysaccharide for each particular glycoconjugate. In some embodiments, each dose contains about 5.6 μg of polysaccharide for each particular glycoconjugate. In some embodiments, each dose contains about 5.8 μg of polysaccharide for each particular glycoconjugate. In some embodiments, each dose contains about 6.0 μg of polysaccharide for each particular glycoconjugate.
[0200] In one embodiment, each dose contains about 1.0 μg to about 3.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 1.5 μg to about 3.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In a preferred embodiment, each dose contains about 2.0 μg to about 3.0 μg of polysaccharides for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In a more preferred embodiment, each dose contains about 2.5 μg to about 3.0 μg of polysaccharides for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 1.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In one embodiment, each dose contains about 1.1 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 1.2 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 1.3 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 1.4 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 1.5 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 1.6 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In one embodiment, each dose contains about 1.7 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In certain embodiments, each dose contains about 1.8 polysaccharides for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In certain embodiments, each dose contains about 1.9 polysaccharides for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 2.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 2.1 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 2.2 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In one embodiment, each dose contains about 2.3 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 2.4 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 2.5 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 2.6 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 2.7 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In certain embodiments, each dose contains about 2.8 polysaccharides for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In certain embodiments, each dose contains about 2.9 polysaccharides for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains about 3.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.
[0201] Amount of carrier Generally, each dose comprises 10 μg to 150 μg of carrier protein, particularly 15 μg to 100 μg of carrier protein, more particularly 25 μg to 75 μg of carrier protein, and even more particularly 50 μg to 70 μg of carrier protein. 197 In one embodiment, the carrier protein is SCP.
[0202] In some embodiments, each dose contains about 25 μg of carrier protein. In some embodiments, each dose contains about 26 μg of carrier protein. In some embodiments, each dose contains about 27 μg of carrier protein. In some embodiments, each dose contains about 28 μg of carrier protein. In some embodiments, each dose contains about 29 μg of carrier protein. In some embodiments, each dose contains about 30 μg of carrier protein. In some embodiments, each dose contains about 31 μg of carrier protein. In some embodiments, each dose contains about 32 μg of carrier protein. In some embodiments, each dose contains about 33 μg of carrier protein. In some embodiments, each dose contains about 34 μg of carrier protein. In some embodiments, each dose contains about 35 μg of carrier protein. In some embodiments, each dose contains about 36 μg of carrier protein. In some embodiments, each dose contains about 37 μg of carrier protein. In some embodiments, each dose contains about 38 μg of carrier protein. In some embodiments, each dose contains about 39 μg of carrier protein. In some embodiments, each dose contains about 40 μg of carrier protein. In some embodiments, each dose contains about 41 μg of carrier protein. In some embodiments, each dose contains about 42 μg of carrier protein. In some embodiments, each dose contains about 43 μg of carrier protein. In some embodiments, each dose contains about 44 μg of carrier protein. In some embodiments, each dose contains about 45 μg of carrier protein. In some embodiments, each dose contains about 46 μg of carrier protein. In some embodiments, each dose contains about 47 μg of carrier protein. In some embodiments, each dose contains about 48 μg of carrier protein. In some embodiments, each dose contains about 49 μg of carrier protein. In some embodiments, each dose contains about 50 μg of carrier protein. In some embodiments, each dose contains about 51 μg of carrier protein. In some embodiments, each dose contains about 52 μg of carrier protein. In some embodiments, each dose contains about 53 μg of carrier protein. In some embodiments, each dose contains about 54 μg of carrier protein. In some embodiments, each dose contains about 55 μg of carrier protein. In some embodiments, each dose contains about 56 μg of carrier protein.In some embodiments, each dose contains about 57 μg of carrier protein. In some embodiments, each dose contains about 58 μg of carrier protein. In some embodiments, each dose contains about 59 μg of carrier protein. In some embodiments, each dose contains about 60 μg of carrier protein. In some embodiments, each dose contains about 61 μg of carrier protein. In some embodiments, each dose contains about 62 μg of carrier protein. In some embodiments, each dose contains about 63 μg of carrier protein. In some embodiments, each dose contains about 64 μg of carrier protein. In some embodiments, each dose contains about 65 μg of carrier protein. In some embodiments, each dose contains about 66 μg of carrier protein. In some embodiments, each dose contains about 67 μg of carrier protein. In some embodiments, each dose contains about 68 μg of carrier protein. In some embodiments, each dose contains about 69 μg of carrier protein. In some embodiments, each dose contains about 70 μg of carrier protein. In some embodiments, each dose contains about 71 μg of carrier protein. In some embodiments, each dose contains about 72 μg of carrier protein. In some embodiments, each dose contains about 73 μg of carrier protein. In some embodiments, each dose contains about 74 μg of carrier protein. In some embodiments, each dose contains about 75 μg of carrier protein.
[0203] In certain embodiments, each dose comprises between about 60 μg and 70 μg of carrier protein.
[0204] Further antigens In some embodiments, the vaccine formulations disclosed herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or more antigens. In some embodiments, the vaccine formulation comprises more than one antigen specific to a particular viral or bacterial species. In certain embodiments, the vaccine formulation comprises more than one antigen specific to Streptococcus pneumoniae (S. pneumoniae). In other embodiments, the vaccine formulation comprises antigens specific for a combination of two or more bacterial species. In yet other embodiments, the vaccine formulation comprises antigens specific for a combination of two or more viral species. In some embodiments, the vaccine formulation comprises antigens specific for a combination of at least one viral species and at least one bacterial species.
[0205] In some embodiments, the selected antigen is selected from chickenpox or shingles, human respiratory syncytial virus (RSV), cytomegalovirus (CMV), human metapneumovirus, human parainfluenza virus type 1 or 3, Lyme disease, Streptococcus pneumonia, Clostridioides difficile, coronavirus, Escherichia coli, Klebsiella pneumoniae, influenza, HIV-1, hepatitis A, hepatitis B, human papillomavirus, meningococcal meningitis A, meningococcal meningitis B, meningococcal meningitis C, meningococcal meningitis W, meningococcal meningitis Y, tetanus, diphtheria, pertussis, polio, Haemophilus influenzae influenza B, dengue, hand, foot and mouth disease, typhoid, pneumococcus, Japanese encephalitis virus, anthrax, shingles, malaria, norovirus, or cancer.
[0206] The vaccine formulations of the present invention comprise conjugated S. pneumoniae saccharide antigens (glycoconjugates). These may also comprise additional antigens from other pathogens, particularly bacteria and / or viruses. Preferred additional antigens are selected from the following: diphtheria toxoid (D), tetanus toxoid (T), pertussis antigen (P), which is typically acellular (Pa), hepatitis B virus (HBV) surface antigen (HBsAg), hepatitis A virus (HAV) antigen, conjugated Haemophilus influenzae type b capsular saccharide (Hib), inactivated poliovirus vaccine (IPV).
[0207] In one embodiment, a vaccine formulation of the invention comprises DT-Pa. In one embodiment, a vaccine formulation of the invention comprises DT-Pa-Hib, DT-Pa-IPV, or DT-Pa-HBsAg. In one embodiment, a vaccine formulation of the invention comprises DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In one embodiment, a vaccine formulation of the invention comprises DT-Pa-HBsAg-IPV-Hib.
[0208] Pertussis antigens: Bordetella pertussis causes whooping cough. Pertussis antigens in vaccines are either cellular (whole cells, in the form of inactivated B. pertussis cells) or acellular. The preparation of cellular pertussis antigens has been well documented (e.g., they can be obtained by heat inactivation of Phase I cultures of B. pertussis). Preferably, however, the present invention uses acellular antigens. When acellular antigens are used, it is preferred to use one, two, or (preferably) three of the following antigens: (1) detoxified pertussis toxin (pertussis toxoid, or PT); (2) filamentous hemagglutinin (FHA); and (3) pertactin (also known as a 69-kilodalton outer membrane protein). FHA and pertactin can be treated with formaldehyde before use in accordance with the present invention. PT is preferably detoxified by treatment with formaldehyde and / or glutaraldehyde. Acellular pertussis antigens are preferably adsorbed onto one or more aluminum salt adjuvants. Alternatively, they can be added in an unadsorbed state. When pertactin is added, it is preferably already adsorbed onto aluminum hydroxide adjuvant. PT and FHA can be adsorbed onto aluminum hydroxide adjuvant or aluminum phosphate adjuvant. Adsorption of all of PT, FHA and pertactin onto aluminum hydroxide is most preferred.
[0209] Inactivated poliovirus vaccine: Poliovirus causes acute poliomyelitis. Rather than using an oral poliovirus vaccine, a preferred embodiment of the present invention uses IPV. Before administration to a patient, the poliovirus must be inactivated, which can be achieved by treatment with formaldehyde. Acute poliomyelitis can be caused by one of three types of poliovirus. While these three types are similar and cause identical symptoms, they are antigenically distinct, and infection with one type does not protect against infection with the others. Therefore, the present invention preferably uses the following three poliovirus antigens: poliovirus type 1 (e.g., Mahoney strain), poliovirus type 2 (e.g., MEF-1 strain), and poliovirus type 3 (e.g., Saukett strain). The viruses are preferably grown, purified, and inactivated individually and then combined to obtain a bulk trivalent mixture for use with the present invention.
[0210] Diphtheria toxoid: Corynebacterium diphtheriae causes diphtheria. Diphtheria toxin can be treated (e.g., using formalin or formaldehyde) to remove toxicity while retaining the ability to induce specific antitoxin antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferred diphtheria toxoids are those prepared by formaldehyde treatment. Diphtheria toxoids can be obtained by growing C. diphtheriae in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The toxoided material can then be processed by processes including sterile filtration and / or dialysis. Diphtheria toxoid is preferably adsorbed onto an aluminum hydroxide adjuvant.
[0211] Tetanus toxoid: Clostridium tetani causes tetanus. Tetanus toxoid can be processed to obtain a protective toxoid. The toxoid is used in tetanus vaccines. A preferred tetanus toxoid is one prepared by formaldehyde treatment. Tetanus toxoid can be obtained by growing C. tetani in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The material can then be processed by processes including sterile filtration and / or dialysis.
[0212] Hepatitis A virus antigen: Hepatitis A virus (HAV) is one of the known agents that causes viral hepatitis. Preferred HAV components are based on inactivated viruses, and inactivation can be achieved by formalin treatment.
[0213] Hepatitis B virus (HBV) is one of the known agents that cause viral hepatitis. The major component of the capsid is a protein known as HBV surface antigen, or more commonly HBsAg, which is a 226 amino acid polypeptide typically having a molecular weight of approximately 24 kDa. All existing hepatitis B vaccines contain HBsAg, which, when administered to vaccinated normal individuals, stimulates the production of anti-HBsAg antibodies that protect against HBV infection.
[0214] For vaccine production, HBsAg has been produced in two ways: by purification of the antigen in particulate form from the plasma of chronic hepatitis B carriers, or by expression of the protein by recombinant DNA techniques (e.g., recombinant expression in yeast cells). Unlike native HBsAg (i.e., like the product purified from plasma), yeast-expressed HBsAg is generally not glycosylated, and this is the most preferred form of HBsAg for use with the present invention.
[0215] Conjugated Haemophilus influenzae type b antigens: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are typically based on capsular saccharide antigens, the preparation of which has been well documented. The Hib saccharide can be conjugated to a carrier protein to enhance its immunogenicity, especially in children. Typical carrier proteins are tetanus toxoid, diphtheria toxoid, CRM 197 , H. influenzae protein D, and an outer membrane protein complex from serogroup B Neisseria meningitidis. The saccharide portion of the conjugate may comprise full-length polyribosylribitol phosphate (PRP) prepared from Hib bacteria and / or fragments of full-length PRP. The Hib conjugate may or may not be adsorbed to an aluminum salt adjuvant.
[0216] In one embodiment, the vaccine formulation of the invention further comprises a conjugated N. meningitidis serogroup Y capsular saccharide (MenY), and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).
[0217] In certain embodiments, the vaccine formulation of the invention further comprises a conjugated N. meningitidis serogroup A capsular saccharide (MenA), a conjugated N. meningitidis serogroup W135 capsular saccharide (MenW135), a conjugated N. meningitidis serogroup Y capsular saccharide (MenY), and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).
[0218] In certain embodiments, the vaccine formulation of the invention further comprises a conjugated N. meningitidis serogroup W135 capsular saccharide (MenW135), a conjugated N. meningitidis serogroup Y capsular saccharide (MenY), and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).
[0219] formulation The formulations of the present invention can be in liquid form (i.e., solution or suspension) or lyophilized form. Liquid formulations can advantageously be administered directly from their packaged form and are therefore ideal for injection without the need for reconstitution in an aqueous medium, as would normally be required for the lyophilized compositions of the present invention.
[0220] The formulation of the compositions of the present invention can be achieved using art-recognized methods. For example, individual pneumococcal conjugates can be formulated with physiologically acceptable vehicles to prepare compositions. Examples of such vehicles include, but are not limited to, water, buffer solutions, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol) and dextrose solutions.
[0221] The present disclosure provides formulations comprising any of the glycoconjugates disclosed herein in combination with a pharmaceutically acceptable excipient, carrier, or diluent.
[0222] In certain embodiments, the vaccine formulations of the present invention are in liquid form, preferably in aqueous liquid form.
[0223] The vaccine formulations of the present disclosure may include one or more of a buffer, a salt, a divalent cation, a non-ionic detergent, a cryoprotectant, e.g., a sugar, and an antioxidant, e.g., a free radical scavenger or chelator, or any combination thereof.
[0224] In one embodiment, the vaccine formulation of the present invention comprises a buffer. In one embodiment, the buffer has a pKa of about 3.5 to about 7.5. In some embodiments, the buffer is phosphate, succinate, histidine, or citrate. In a specific embodiment, the buffer is succinate at a final concentration of 1 mM to 10 mM. In one particular embodiment, the final concentration of the succinate buffer is about 5 mM.
[0225] In some embodiments, the buffer is a succinate or histidine buffer. In some embodiments, the buffer is at a concentration of about 1 mM to 30 mM. In a preferred embodiment, the buffer is a succinate buffer having a final concentration of 1 mM to 10 mM. In a more preferred embodiment, the buffer is a succinate buffer having a final concentration of about 5 mM to 9 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 1 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 2 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 3 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 4 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 5 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 6 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 7 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 8 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 9 mM. In some embodiments, the buffer is a succinate buffer having a final concentration of about 10 mM. In a preferred embodiment, the buffer is a succinate buffer having a final concentration of about 5 mM.
[0226] In one embodiment, the buffer is a histidine buffer. In one embodiment, the histidine buffer has a final concentration of about 1 mM to 30 mM. In a preferred embodiment, the buffer has a final concentration of about 10 mM to 30 mM. In a more preferred embodiment, the buffer has a final concentration of about 20 mM to 30 mM. In one embodiment, the buffer has a final concentration of about 1 mM. In one embodiment, the buffer has a final concentration of about 2 mM. In one embodiment, the buffer has a final concentration of about 3 mM. In one embodiment, the buffer has a final concentration of about 4 mM. In one embodiment, the buffer has a final concentration of about 5 mM. In one embodiment, the buffer has a final concentration of about 6 mM. In one embodiment, the buffer has a final concentration of about 7 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 8 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 9 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 10 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 11 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 12 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 13 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 14 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 15 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 16 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 17 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 18 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 19 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 20 mM.In some embodiments, the buffer is a histidine buffer having a final concentration of about 21 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 22 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 23 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 24 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 25 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 26 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 27 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 28 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 29 mM. In some embodiments, the buffer is a histidine buffer having a final concentration of about 30 mM.
[0227] In a preferred embodiment, the buffer is a histidine buffer having a final concentration of 25 mM. In some embodiments, the buffer has a pH of about 5.0 to 7.5. In preferred embodiments, the buffer has a pH of about 5.0 to 6.5. In more preferred embodiments, the buffer has a pH of about 5.5 to 6.0. In some embodiments, the buffer has a pH of about 5.0. In some embodiments, the buffer has a pH of about 5.1. In some embodiments, the buffer has a pH of about 5.2. In some embodiments, the buffer has a pH of about 5.3. In some embodiments, the buffer has a pH of about 5.4. In some embodiments, the buffer has a pH of about 5.5. In some embodiments, the buffer has a pH of about 5.6. In some embodiments, the buffer has a pH of about 5.7. In some embodiments, the buffer has a pH of about 5.8. In some embodiments, the buffer has a pH of about 5.9. In some embodiments, the buffer has a pH of about 6.0. In some embodiments, the buffer has a pH of about 6.1. In some embodiments, the buffer has a pH of about 6.2. In some embodiments, the buffer has a pH of about 6.3. In some embodiments, the buffer has a pH of about 6.4. In some embodiments, the buffer has a pH of about 6.5. In some embodiments, the buffer has a pH of about 6.6. In some embodiments, the buffer has a pH of about 6.7. In some embodiments, the buffer has a pH of about 6.8. In some embodiments, the buffer has a pH of about 6.9. In some embodiments, the buffer has a pH of about 7.0. In some embodiments, the buffer has a pH of about 7.1. In some embodiments, the buffer has a pH of about 7.2. In some embodiments, the buffer has a pH of about 7.3. In some embodiments, the buffer has a pH of about 7.4. In some embodiments, the buffer has a pH of about 7.5. In a preferred embodiment, the buffer is a succinate or histidine buffer having a pH of 5.8.
[0228] In some embodiments, the formulation of the present invention comprises a salt. In some embodiments, the salt is selected from the group consisting of sodium phosphate, calcium chloride, magnesium chloride, potassium chloride, sodium chloride, and combinations thereof. In a specific embodiment, the salt is sodium chloride. In a specific embodiment, the vaccine formulation of the present invention comprises 150 mM sodium chloride.
[0229] In some embodiments, the salt is sodium phosphate, calcium chloride, sodium chloride, or a combination thereof. In some embodiments, the salt has a concentration of about 1 mM to 300 mM. In some embodiments, the salt is sodium chloride. In some embodiments, the salt is sodium chloride having a concentration of about 50 mM to 300 mM. In some embodiments, the salt is sodium chloride having a concentration of about 100 mM to 200 mM. In preferred embodiments, the salt is sodium chloride having a concentration of about 200 mM to 300 mM. In more preferred embodiments, the salt is sodium chloride having a concentration of about 150 mM to 250 mM. In some embodiments, the salt is sodium chloride having a concentration of about 50 mM. In some embodiments, the salt is sodium chloride having a concentration of about 75 mM. In some embodiments, the salt is sodium chloride having a concentration of about 100 mM. In some embodiments, the salt is sodium chloride having a concentration of about 125 mM. In some embodiments, the salt is sodium chloride having a concentration of about 150 mM. In some embodiments, the salt is sodium chloride having a concentration of about 175 mM. In some embodiments, the salt is sodium chloride having a concentration of about 200 mM. In some embodiments, the salt is sodium chloride having a concentration of about 225 mM. In some embodiments, the salt is sodium chloride having a concentration of about 250 mM. In some embodiments, the salt is sodium chloride having a concentration of about 275 mM. In some embodiments, the salt is sodium chloride having a concentration of about 300 mM. In some embodiments, the salt is sodium chloride having a concentration of about 125 mM. In some embodiments, the salt is sodium chloride having a concentration of about 130 mM. In some embodiments, the salt is sodium chloride having a concentration of about 135 mM. In some embodiments, the salt is sodium chloride having a concentration of about 140 mM. In some embodiments, the salt is sodium chloride having a concentration of about 145 mM. In some embodiments, the salt is sodium chloride having a concentration of about 150 mM. In some embodiments, the salt is sodium chloride having a concentration of about 155 mM. In some embodiments, the salt is sodium chloride having a concentration of about 160 mM. In some embodiments, the salt is sodium chloride having a concentration of about 165 mM.In some embodiments, the salt is sodium chloride having a concentration of about 170 mM. In some embodiments, the salt is sodium chloride having a concentration of about 175 mM. In some embodiments, the salt is sodium chloride having a concentration of about 225 mM. In some embodiments, the salt is sodium chloride having a concentration of about 230 mM. In some embodiments, the salt is sodium chloride having a concentration of about 235 mM. In some embodiments, the salt is sodium chloride having a concentration of about 240 mM. In some embodiments, the salt is sodium chloride having a concentration of about 245 mM. In some embodiments, the salt is sodium chloride having a concentration of about 250 mM. In some embodiments, the salt is sodium chloride having a concentration of about 255 mM. In some embodiments, the salt is sodium chloride having a concentration of about 260 mM. In some embodiments, the salt is sodium chloride having a concentration of about 265 mM. In some embodiments, the salt is sodium chloride having a concentration of about 270 mM. In some embodiments, the salt is sodium chloride having a concentration of about 275 mM. In certain embodiments, the salt is sodium chloride having a concentration of 150 mM. In certain embodiments, the salt is sodium chloride having a concentration of 245 mM.
[0230] In one embodiment, the salt is magnesium chloride. In one embodiment, the salt is magnesium chloride having a concentration of about 10 mM to 50 mM. In a preferred embodiment, the salt is magnesium chloride having a concentration of about 20 mM to 50 mM. In a more preferred embodiment, the salt is magnesium chloride having a concentration of about 30 mM to 50 mM. In a specific embodiment, the salt is magnesium chloride having a concentration of about 35 mM to 45 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 10 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 15 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 20 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 25 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 30 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 35 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 40 mM. In some embodiments, the salt is magnesium chloride having a concentration of about 45 mM. In some embodiments, the salt is magnesium chloride having a concentration of about 50 mM. In certain embodiments, the salt is magnesium chloride having a concentration of about 40 mM.
[0231] In one embodiment, the salt is calcium chloride. In one embodiment, the salt is calcium chloride having a concentration of about 1 mM to 50 mM. In a specific embodiment, the salt is calcium chloride. In a preferred embodiment, the salt is calcium chloride having a concentration of about 10 mM to 30 mM. In a more preferred embodiment, the salt is calcium chloride having a concentration of about 15 mM to 25 mM. In one embodiment, the salt is calcium chloride having a concentration of about 5 mM. In one embodiment, the salt is calcium chloride having a concentration of about 10 mM. In one embodiment, the salt is calcium chloride having a concentration of about 15 mM. In one embodiment, the salt is calcium chloride having a concentration of about 20 mM. In one embodiment, the salt is calcium chloride having a concentration of about 25 mM. In one embodiment, the salt is calcium chloride having a concentration of about 30 mM. In one embodiment, the salt is calcium chloride having a concentration of about 35 mM. In one embodiment, the salt is calcium chloride having a concentration of about 40 mM. In a preferred embodiment, the salt is calcium chloride having a concentration of 20 mM.
[0232] In one embodiment, the salt is sodium phosphate. In one embodiment, the salt is sodium phosphate having a concentration of about 1 mM to 50 mM. In a preferred embodiment, the salt is sodium phosphate having a concentration of about 20 mM to 50 mM. In a more preferred embodiment, the salt is sodium phosphate having a concentration of about 35 mM to 45 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 5 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 10 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 15 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 20 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 25 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 30 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 35 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 35 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 40 mM. In some embodiments, the salt is sodium phosphate having a concentration of about 45 mM. In some embodiments, the salt is sodium phosphate having a concentration of about 50 mM. In a preferred embodiment, the salt is sodium phosphate having a concentration of 20 mM. In a preferred embodiment, the salt is sodium phosphate having a concentration of 40 mM.
[0233] In one embodiment, the salts are sodium phosphate and sodium chloride. In one embodiment, the sodium phosphate has a concentration of about 1 mM to 50 mM, and the sodium chloride has a concentration of about 50 mM to 300 mM. In one embodiment, the sodium phosphate has a concentration of about 10 mM to 30 mM, and the sodium chloride has a concentration of about 100 mM to 300 mM. In a preferred embodiment, the sodium phosphate has a concentration of about 15 mM to 25 mM, and the sodium chloride has a concentration of about 200 to 300 mM. In a preferred embodiment, the sodium phosphate has a concentration of about 30 mM to 50 mM, and the sodium chloride has a concentration of about 200 to 300 mM. In one embodiment, the sodium phosphate has a concentration of about 5 mM. In one embodiment, the sodium phosphate has a concentration of about 10 mM. In one embodiment, the sodium phosphate has a concentration of about 15 mM. In some embodiments, the sodium phosphate has a concentration of about 20 mM. In some embodiments, the sodium phosphate has a concentration of about 25 mM. In some embodiments, the sodium phosphate has a concentration of about 35 mM. In some embodiments, the sodium phosphate has a concentration of about 40 mM. In some embodiments, the sodium phosphate has a concentration of about 45 mM. In some embodiments, the sodium phosphate has a concentration of about 50 mM. In some embodiments, the sodium chloride has a concentration of about 125 mM. In some embodiments, the sodium chloride has a concentration of about 130 mM. In some embodiments, the sodium chloride has a concentration of about 135 mM. In some embodiments, the sodium chloride has a concentration of about 140 mM. In some embodiments, the sodium chloride has a concentration of about 145 mM. In some embodiments, the sodium chloride has a concentration of about 150 mM. In some embodiments, the sodium chloride has a concentration of about 155 mM. In some embodiments, the sodium chloride has a concentration of about 160 mM.In some embodiments, the sodium chloride has a concentration of about 165 mM. In some embodiments, the sodium chloride has a concentration of about 170 mM. In some embodiments, the sodium chloride has a concentration of about 175 mM. In some embodiments, the sodium chloride has a concentration of about 180 mM. In some embodiments, the sodium chloride has a concentration of about 185 mM. In some embodiments, the sodium chloride has a concentration of about 190 mM. In some embodiments, the sodium chloride has a concentration of about 200 mM. In some embodiments, the sodium chloride has a concentration of about 205 mM. In some embodiments, the sodium chloride has a concentration of about 210 mM. In some embodiments, the sodium chloride has a concentration of about 215 mM. In some embodiments, the sodium chloride has a concentration of about 220 mM. In some embodiments, the sodium chloride has a concentration of about 225 mM. In some embodiments, the sodium chloride has a concentration of about 230 mM. In some embodiments, the sodium chloride has a concentration of about 235 mM. In some embodiments, the sodium chloride has a concentration of about 240 mM. In some embodiments, the sodium chloride has a concentration of about 245 mM. In some embodiments, the sodium chloride has a concentration of about 250 mM. In some embodiments, the sodium chloride has a concentration of about 255 mM. In some embodiments, the sodium chloride has a concentration of about 260 mM. In some embodiments, the sodium chloride has a concentration of about 265 mM. In some embodiments, the sodium chloride has a concentration of about 270 mM. In some embodiments, the sodium chloride has a concentration of about 275 mM. In certain embodiments, the sodium phosphate has a concentration of about 20 mM and the sodium chloride has a concentration of about 150 mM. In certain embodiments, the salt is sodium phosphate having a concentration of 20 mM and sodium chloride having a concentration of 245 mM. In certain embodiments, the salt is sodium phosphate having a concentration of 40 mM and sodium chloride having a concentration of 245 mM.
[0234] In one embodiment, the salts are sodium chloride and calcium chloride. In one embodiment, the sodium chloride has a concentration of about 50 to 300 mM, and the calcium chloride has a concentration of about 1 mM to 50 mM. In a preferred embodiment, the sodium chloride has a concentration of about 100 to 250 mM, and the calcium chloride has a concentration of about 20 mM to 30 mM. In a more preferred embodiment, the sodium chloride has a concentration of about 100 to 200 mM, and the calcium chloride has a concentration of about 15 mM to 25 mM. In one embodiment, the sodium chloride has a concentration of about 125 mM. In one embodiment, the sodium chloride has a concentration of about 130 mM. In one embodiment, the sodium chloride has a concentration of about 135 mM. In one embodiment, the sodium chloride has a concentration of about 140 mM. In one embodiment, the sodium chloride has a concentration of about 145 mM. In one embodiment, the sodium chloride has a concentration of about 150 mM. In some embodiments, the sodium chloride has a concentration of about 155 mM. In some embodiments, the sodium chloride has a concentration of about 160 mM. In some embodiments, the sodium chloride has a concentration of about 165 mM. In some embodiments, the sodium chloride has a concentration of about 170 mM. In some embodiments, the sodium chloride has a concentration of about 175 mM. In some embodiments, the calcium chloride has a concentration of about 10 mM. In some embodiments, the calcium chloride has a concentration of about 5 mM. In some embodiments, the calcium chloride has a concentration of about 10 mM. In some embodiments, the calcium chloride has a concentration of about 15 mM. In some embodiments, the calcium chloride has a concentration of about 20 mM. In some embodiments, the calcium chloride has a concentration of about 25 mM. In some embodiments, the calcium chloride has a concentration of about 30 mM. In some embodiments, the calcium chloride has a concentration of about 35 mM. In some embodiments, the calcium chloride has a concentration of about 40 mM. In a particular embodiment, the sodium chloride has a concentration of about 150 mM and the calcium chloride has a concentration of about 20 mM.
[0235] In one embodiment, the salts are sodium chloride and magnesium chloride. In one embodiment, the sodium chloride has a concentration of about 50 to 300 mM, and the magnesium chloride has a concentration of 1 mM to 50 mM. In a preferred embodiment, the sodium chloride has a concentration of about 100 to 250 mM, and the magnesium chloride has a concentration of 10 mM to 30 mM. In a more preferred embodiment, the sodium chloride has a concentration of about 100 to 200 mM, and the magnesium chloride has a concentration of 15 mM to 25 mM. In one embodiment, the sodium chloride has a concentration of about 125 mM. In one embodiment, the sodium chloride has a concentration of about 130 mM. In one embodiment, the sodium chloride has a concentration of about 135 mM. In one embodiment, the sodium chloride has a concentration of about 140 mM. In one embodiment, the sodium chloride has a concentration of about 145 mM. In one embodiment, the sodium chloride has a concentration of about 150 mM. In some embodiments, the sodium chloride has a concentration of about 155 mM. In some embodiments, the sodium chloride has a concentration of about 160 mM. In some embodiments, the sodium chloride has a concentration of about 165 mM. In some embodiments, the sodium chloride has a concentration of about 170 mM. In some embodiments, the sodium chloride has a concentration of about 175 mM. In some embodiments, the magnesium chloride has a concentration of about 5 mM. In some embodiments, the magnesium chloride has a concentration of about 10 mM. In some embodiments, the magnesium chloride has a concentration of about 15 mM. In some embodiments, the magnesium chloride has a concentration of about 20 mM. In some embodiments, the magnesium chloride has a concentration of about 25 mM. In some embodiments, the magnesium chloride has a concentration of about 30 mM. In some embodiments, the magnesium chloride has a concentration of about 35 mM. In some embodiments, the magnesium chloride has a concentration of about 40 mM. In a particular embodiment, the sodium chloride has a concentration of about 150 mM and the magnesium chloride has a concentration of about 20 mM.
[0236] In some embodiments, the vaccine formulation of the invention comprises a surfactant selected from the group consisting of polysorbate 20 (TWEEN™ 20), polysorbate 40 (TWEEN™ 40), polysorbate 60 (TWEEN™ 60), polysorbate 65 (TWEEN™ 65), polysorbate 80 (TWEEN™ 80), polysorbate 85 (TWEEN™ 85), TRITON™ N-101, TRITON™ X-100, oxtoxynol 40, nonoxynol-9, triethanolamine, triethanolamine polypeptide oleate, polyoxyethylene-660 hydroxystearate (PEG-15, Solutol H 15), polyoxyethylene-35-ricinoleate (CREMOPHOR® EL), soy lecithin, and poloxamer.
[0237] In one particular embodiment, the surfactant is polysorbate 80. In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% polysorbate 80 weight to weight (w / w). In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% polysorbate 80 weight to weight (w / w). In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% polysorbate 80 weight to weight (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.01% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.02% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.03% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.04% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.05% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.06% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.07% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.08% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.09% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.1% polysorbate 80 (w / w). In another embodiment, the final concentration of polysorbate 80 in the formulation is 1% polysorbate 80 (w / w).
[0238] In one particular embodiment, the surfactant is polysorbate 20. In some such embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.0001% to 10% polysorbate 20 weight to weight (w / w). In some such embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.001% to 1% polysorbate 20 weight to weight (w / w). In some such embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.001% to 1% polysorbate 20 weight to weight (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.01% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.02% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.03% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.04% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.05% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.06% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.07% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.08% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.09% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.1% polysorbate 20 (w / w). In another embodiment, the final concentration of polysorbate 20 in the formulation is 1% polysorbate 20 (w / w).
[0239] In certain embodiments, the formulations of the invention include an adjuvant. Formulation adjuvants are described in more detail below.
[0240] In one embodiment, the formulation of the present invention has a total glycoconjugate concentration of about 10 to 500 μg / ml. In one embodiment, the total glycoconjugate concentration is about 20 to 400 μg / ml. In one embodiment, the total glycoconjugate concentration is about 30 to 300 μg / ml. In a preferred embodiment, the total glycoconjugate concentration is about 50 to 200 μg / ml. In a more preferred embodiment, the total glycoconjugate concentration is about 100 to 150 μg / ml.
[0241] In some embodiments, the total glycoconjugate concentration is about 115 μg / ml. In some embodiments, the total glycoconjugate concentration is about 120 μg / ml. In some embodiments, the total glycoconjugate concentration is about 115 μg / ml. In some embodiments, the total glycoconjugate concentration is about 119 μg / ml.
[0242] In certain embodiments, the vaccine formulations of the invention have a pH of 5.5 to 7.5, more preferably a pH of 5.6 to 7.0, and even more preferably a pH of 5.8 to 6.0.
[0243] In one embodiment, the present invention provides a formulation comprising at least 21 different polysaccharide-protein conjugates; a succinic acid or histidine buffer having a pH in the range of 5.0 to 7.5; calcium chloride, sodium chloride, calcium chloride and / or sodium phosphate; a surfactant; and an adjuvant. In one embodiment, the present invention provides a formulation comprising at least 21 different polysaccharide-protein conjugates; a succinic acid buffer having a pH in the range of 5.0 to 7.5; calcium chloride; sodium chloride; a surfactant; and an adjuvant. In one embodiment, the present invention provides a formulation comprising at least 21 different polysaccharide-protein conjugates; a succinic acid buffer having a pH in the range of 5.0 to 7.5; sodium chloride; sodium phosphate; a surfactant; and an adjuvant. In one embodiment, the present invention provides a formulation comprising at least 21 different polysaccharide-protein conjugates; a histidine buffer having a pH in the range of 5.0 to 7.5; sodium chloride; a surfactant; and an adjuvant. In a preferred embodiment, the surfactant is polysorbate 80 or polysorbate 20. In a more preferred embodiment, the surfactant is polysorbate 80.
[0244] In one embodiment, the formulation comprises 25 polysaccharide-protein conjugates, 5 mM succinate pH 5.8, 150 mM sodium chloride, 20 mM calcium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 polysaccharide-protein conjugates comprise one or more of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.
[0245] In one embodiment, the formulation comprises 25 polysaccharide-protein conjugates, 5 mM succinate pH 5.8, 40 mM sodium phosphate, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 polysaccharide-protein conjugates comprise one or more of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.
[0246] In one embodiment, the formulation comprises 25 polysaccharide-protein conjugates, 25 mM histidine pH 5.8, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 polysaccharide-protein conjugates comprise one or more of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.
[0247] In one embodiment, the present invention provides a container filled with any of the vaccine formulations disclosed herein. In one embodiment, the container is selected from the group consisting of a vial, a syringe, a flask, a fermenter, a bioreactor, a bag, a jar, an ampoule, a cartridge, and a disposable pen. In certain embodiments, the container is siliconized.
[0248] In certain embodiments, containers of the present invention are made of glass, metal (eg, steel, stainless steel, aluminum, etc.) and / or polymer (eg, thermoplastic, elastomer, thermoplastic-elastomer).
[0249] In some embodiments, the containers of the present invention are made of glass.
[0250] stability In certain instances, it may be difficult to resuspend a composition or formulation that contains a significant number of glycoconjugates and has been left undisturbed for a period of time (e.g., stored on a shelf). Excessive settling or too dense settling (e.g., too short a "cake height," as described in detail below) can prevent resuspension of the glycoconjugates, rendering the composition or formulation unusable or injectable. Furthermore, if settling occurs too rapidly, it can interfere with the manufacture and creation of useful dosage forms (e.g., the composition begins to settle before transfer to a container). As described in detail herein, in compositions or formulations containing a significant number of glycoconjugates, embodiments of the present invention detail settling rates that provide compositions that can be more easily manufactured for sale and / or more easily resuspended for use.
[0251] Sedimentation velocity can be measured as described in the art. One method for measuring sedimentation velocity uses Turbiscan® TOWER. Turbiscan® TOWER uses static multiple light scattering to detect particle movement in liquid dispersions. The measurement head is equipped with a pulsed near-infrared light source (λ=880 nm) and synchronous transmission (180° from the light source) and backscattering (45° from the light source) detectors that move along the height of a flat-bottom cylindrical glass sample cell, collecting data every 20 μm.
[0252] In certain embodiments, measurements were performed at room temperature using approximately 20 mL of sample. The sample was vortexed to resuspend immediately before measurement. In certain embodiments, measurements were taken after the time between vortexing the sample and placing it in the scanner. The settling onset time was defined as the time the sample reached 45% clarification at the meniscus and was obtained from the transmission data. The settling velocity was reported as the slope of the change in the settling front position as a function of time.
[0253] In one embodiment, the present invention provides a composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase; and at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant have precipitated from the liquid phase to form a precipitate, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase. at a time T2, a further portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, the at least 25 different glycoconjugates being at a concentration C2 in the liquid phase; and the sedimentation rate is measured over time via static multiple light scattering to detect particle movement in the liquid, the measurement head comprising a pulsed near-infrared light source at a wavelength of approximately 880 nm, having synchronous transmission at 180° from a source-detector and backscattering at 45° from the source-detector that moves along the height of a flat-bottom cylindrical glass sample cell, and collecting sediment data every 20 μm.
[0254] In one embodiment, the composition comprises at least 21 different glycoconjugates. In one embodiment, the composition comprises at least 22 different glycoconjugates. In one embodiment, the composition comprises at least 23 different glycoconjugates. In one embodiment, the composition comprises at least 24 different glycoconjugates. In one embodiment, the composition comprises at least 25 different glycoconjugates. In one embodiment, the composition comprises at least 26 different glycoconjugates. In one embodiment, the composition comprises at least 27 different glycoconjugates. In one embodiment, the composition comprises at least 28 different glycoconjugates. In one embodiment, the composition comprises at least 29 different glycoconjugates. In one embodiment, the composition comprises at least 30 different glycoconjugates. In one embodiment, the composition comprises at least 31 different glycoconjugates. In one embodiment, the composition comprises at least 32 different glycoconjugates. In one embodiment, the composition comprises at least 33 different glycoconjugates. In one embodiment, the composition comprises at least 34 different glycoconjugates. In one embodiment, the composition comprises at least 35 different glycoconjugates.
[0255] In some embodiments, T0 is 0 hours. In some embodiments, T1 is about 0.01 hours to 4 hours. In some embodiments, T1 is about 1 hour to 2 hours. In preferred embodiments, T1 is about 0.01 hours to 4 hours. In some embodiments, T1 is about 0.1 hours. In some embodiments, T1 is about 0.2 hours. In some embodiments, T1 is about 0.3 hours. In some embodiments, T1 is about 0.4 hours. In some embodiments, T1 is about 0.5 hours. In some embodiments, T1 is about 0.6 hours. In some embodiments, T1 is about 0.7 hours. In some embodiments, T1 is about 0.8 hours. In some embodiments, T1 is about 0.9 hours. In some embodiments, T1 is about 1.0 hours. In some embodiments, T1 is about 1.1 hours. In some embodiments, T1 is about 1.2 hours. In some embodiments, T1 is about 1.3 hours. In some embodiments, T1 is about 1.4 hours. In some embodiments, T1 is about 1.5 hours. In some embodiments, T1 is about 1.6 hours. In some embodiments, T1 is about 1.7 hours. In some embodiments, T1 is about 1.8 hours. In some embodiments, T1 is about 1.9 hours. In some embodiments, T1 is about 2.0 hours. In some embodiments, T1 is about 2.1 hours. In some embodiments, T1 is about 2.2 hours. In some embodiments, T1 is about 2.3 hours. In some embodiments, T1 is about 2.4 hours. In some embodiments, T1 is about 2.5 hours. In some embodiments, T1 is about 2.6 hours. In some embodiments, T1 is about 2.7 hours. In some embodiments, T1 is about 2.8 hours. In some embodiments, T1 is about 2.9 hours. In some embodiments, T1 is about 3.0 hours. In some embodiments, T1 is about 3.1 hours. In some embodiments, T1 is about 3.2 hours. In some embodiments, T1 is about 3.3 hours. In some embodiments, T1 is about 3.4 hours. In some embodiments, T1 is about 3.5 hours. In some embodiments, T1 is about 3.6 hours. In some embodiments, T1 is about 3.7 hours. In some embodiments, T1 is about 3.8 hours. In some embodiments, T1 is about 3.9 hours.In one embodiment, T1 is about 4.0 hours.
[0256] In some embodiments, T2 is about 1 to 5 hours. In preferred embodiments, T2 is about 1 to 3 hours. In more preferred embodiments, T2 is about 1 to 2 hours. In certain embodiments, T2 is about 4 hours. In some embodiments, T2 is about 1.0 hour. In some embodiments, T2 is about 1.1 hour. In some embodiments, T2 is about 1.2 hours. In some embodiments, T2 is about 1.3 hours. In some embodiments, T2 is about 1.4 hours. In some embodiments, T2 is about 1.5 hours. In some embodiments, T2 is about 1.6 hours. In some embodiments, T2 is about 1.7 hours. In some embodiments, T2 is about 1.8 hours. In some embodiments, T2 is about 1.9 hours. In some embodiments, T2 is about 2.0 hours. In some embodiments, T2 is about 2.1 hours. In some embodiments, T2 is about 2.2 hours. In some embodiments, T2 is about 2.3 hours. In some embodiments, T2 is about 2.4 hours. In some embodiments, T2 is about 2.5 hours. In some embodiments, T2 is about 2.6 hours. In some embodiments, T2 is about 2.7 hours. In some embodiments, T2 is about 2.8 hours. In some embodiments, T2 is about 2.9 hours. In some embodiments, T2 is about 3.0 hours. In some embodiments, T2 is about 3.1 hours. In some embodiments, T2 is about 3.2 hours. In some embodiments, T2 is about 3.3 hours. In some embodiments, T2 is about 3.4 hours. In some embodiments, T2 is about 3.6 hours. In some embodiments, T2 is about 3.7 hours. In some embodiments, T2 is about 3.8 hours. In some embodiments, T2 is about 3.9 hours. In some embodiments, T2 is about 4.0 hours. In some embodiments, T2 is about 4.1 hours. In some embodiments, T2 is about 4.2 hours. In some embodiments, T2 is about 4.3 hours. In some embodiments, T2 is about 4.4 hours. In some embodiments, T2 is about 4.5 hours. In some embodiments, T2 is about 4.6 hours. In some embodiments, T2 is about 4.7 hours. In some embodiments, T2 is about 4.8 hours. In some embodiments, T2 is about 4.9 hours.In one embodiment, T2 is about 5 hours.
[0257] In some embodiments, C0 is higher than C1 and C2. In some embodiments, C1 is higher than C2. In one embodiment, C0 is higher than C1 and C2. In one embodiment, C1 is higher than C2.
[0258] In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2. In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2. In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2.
[0259] In one embodiment, the peak thickness of the settling front at T1 is about 0 mm to 20.0 mm. In a preferred embodiment, the peak thickness of the settling front at T1 is about 1 mm to 10.0 mm. In a preferred embodiment, the peak thickness of the settling front at T1 is about 1 mm to 5.0 mm. In a more preferred embodiment, the peak thickness of the settling front at T1 is at least 2 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.1 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.2 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.3 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.4 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.5 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.6 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.7 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.8 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.9 mm. In some embodiments, the peak thickness of the settling front at T1 is about 1.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 2.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 3.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 4.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 5.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 6.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 7.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 8.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 9.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 10.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 11.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 12.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 13.0 mm.In some embodiments, the peak thickness of the settling front at T1 is about 14.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 15.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 16.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 17.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 18.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 19.0 mm. In some embodiments, the peak thickness of the first solid phase precipitate at T1 is about 20.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 20.0 mm.
[0260] In some embodiments, the peak thickness of the settling front at T2 is about 2 mm to 25.0 mm. In preferred embodiments, the peak thickness of the settling front at T2 is about 5 mm to 20.0 mm. In more preferred embodiments, the peak thickness of the settling front at T2 is about 5 mm to 15.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 10 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 1.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 2.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 3.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 4.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 5.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 6.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 7.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 8.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 9.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 10.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 11.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 12.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 13.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 14.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 15.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 16.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 17.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 18.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 19.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 20.0 mm.In some embodiments, the peak thickness of the settling front at T2 is at least 21.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 22.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 23.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 24.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 25.0 mm.
[0261] In some embodiments, the settling rate of the settling front is less than 10 mm peak thickness in about 1 hour and greater than 18 mm peak thickness in about 4 hours.
[0262] In one embodiment, the present invention further includes a time T3 during which the precipitation of the insoluble aluminum phosphate-adsorbed glycoconjugate is in equilibrium with the liquid phase at T3. In one embodiment, T3 is about 2 hours to 5 hours. In a preferred embodiment, T3 is about 3 hours to 5 hours. In a more preferred embodiment, T3 is about 4 hours to 5 hours. In one embodiment, T3 is about 2.0 hours. In one embodiment, T3 is about 2.1 hours. In one embodiment, T3 is about 2.2 hours. In one embodiment, T3 is about 2.3 hours. In one embodiment, T3 is about 2.4 hours. In one embodiment, T3 is about 2.5 hours. In one embodiment, T3 is about 2.6 hours. In one embodiment, T3 is about 2.7 hours. In one embodiment, T3 is about 2.8 hours. In one embodiment, T3 is about 2.9 hours. In one embodiment, T3 is about 3.0 hours. In some embodiments, T3 is about 3.1 hours. In some embodiments, T3 is about 3.2 hours. In some embodiments, T3 is about 3.3 hours. In some embodiments, T3 is about 3.4 hours. In some embodiments, T3 is about 3.5 hours. In some embodiments, T3 is about 3.6 hours. In some embodiments, T3 is about 3.7 hours. In some embodiments, T3 is about 3.8 hours. In some embodiments, T3 is about 3.9 hours. In some embodiments, T3 is about 4.0 hours. In some embodiments, T3 is about 4.1 hours. In some embodiments, T3 is about 4.2 hours. In some embodiments, T3 is about 4.4 hours. In some embodiments, T3 is about 4.5 hours. In some embodiments, T3 is about 4.6 hours. In some embodiments, T3 is about 4.7 hours. In some embodiments, T3 is about 4.8 hours. In some embodiments, T3 is about 4.9 hours. In some embodiments, T3 is about 5 hours.
[0263] In some embodiments, the settling front at T3 is about 25 mm to 40 mm. In a preferred embodiment, the settling front at T3 is about 30 mm to 40 mm. In a more preferred embodiment, the settling front at T3 is about 35 mm to 40 mm. In some embodiments, T3 is about 25.0 mm. In some embodiments, T3 is about 26 mm. In some embodiments, T3 is about 27 mm. In some embodiments, T3 is about 28 mm. In some embodiments, T3 is about 29 mm. In some embodiments, T3 is about 30 mm. In some embodiments, T3 is about 31 mm. In some embodiments, T3 is about 2 mm. In some embodiments, T3 is about 33 mm. In some embodiments, T3 is about 34 mm. In some embodiments, T3 is about 35 mm. In some embodiments, T3 is about 36 mm. In some embodiments, T3 is about 37 mm. In some embodiments, T3 is about 38 mm. In some embodiments, T3 is about 39 mm. In some embodiments, T3 is about 40 mm.
[0264] In some embodiments, the composition has been left standing for about one month. In some embodiments, the composition has been left standing for at least two weeks. In some embodiments, the composition is stored in a container. In some embodiments, the container is a syringe.
[0265] In some embodiments, after T3, the composition is resuspended with about 1 to 10 handshakes. In preferred embodiments, after T3, the composition is resuspended with about 1 to 5 handshakes. In more preferred embodiments, after T3, the composition is resuspended with about 1 to 3 handshakes. In some embodiments, after T3, the composition is resuspended with about 1 handshake. In some embodiments, after T3, the composition is resuspended with about 2 handshakes. In some embodiments, after T3, the composition is resuspended with about 3 handshakes. In some embodiments, after T3, the composition is resuspended with about 4 handshakes. In some embodiments, after T3, the composition is resuspended with about 5 handshakes. In some embodiments, after T3, the composition is resuspended with about 6 handshakes. In some embodiments, after T3, the composition is resuspended with about 7 handshakes. In some embodiments, after T3, the composition is resuspended with about 8 handshakes. In some embodiments, after T3, the composition is resuspended with about 9 handshakes. In some embodiments, after T3, the composition is resuspended with about 10 handshakes. In certain embodiments, the composition comprises a formulation previously described.
[0266] In one embodiment, the present invention provides a liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase; and at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant have precipitated from the liquid phase to form a precipitate, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase. at time T2, a further portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, the at least 25 different glycoconjugates having a concentration C2 in the liquid phase; and sedimentation velocity is measured over time via static multiple light scattering to detect particle movement in the liquid, the measurement head comprising a pulsed near-infrared light source at a wavelength of approximately 880 nm, having synchronous transmission at 180° from a source-detector and backscattering at 45° from the source-detector that moves along the thickness of a flat-bottom cylindrical glass sample cell, and collecting precipitate data every 20 μm.
[0267] In one embodiment, the container comprises at least 21 different glycoconjugates. In one embodiment, the container comprises at least 22 different glycoconjugates. In one embodiment, the container comprises at least 23 different glycoconjugates. In one embodiment, the container comprises at least 24 different glycoconjugates. In one embodiment, the container comprises at least 25 different glycoconjugates. In one embodiment, the container comprises at least 26 different glycoconjugates. In one embodiment, the container comprises at least 27 different glycoconjugates. In one embodiment, the container comprises at least 28 different glycoconjugates. In one embodiment, the container comprises at least 29 different glycoconjugates. In one embodiment, the container comprises at least 30 different glycoconjugates. In one embodiment, the container comprises at least 31 different glycoconjugates. In one embodiment, the container comprises at least 32 different glycoconjugates. In one embodiment, the container comprises at least 33 different glycoconjugates. In one embodiment, the container contains at least 34 different glycoconjugates. In one embodiment, the container contains at least 35 different glycoconjugates.
[0268] In some embodiments, T0 is 0 hours. In some embodiments, T1 is about 0.01 hours to 4 hours. In preferred embodiments, T1 is about 1 hour to 3 hours. In more preferred embodiments, T1 is about 1 hour to 2 hours. In some embodiments, T1 is about 0.1 hours. In some embodiments, T1 is about 0.2 hours. In some embodiments, T1 is about 0.3 hours. In some embodiments, T1 is about 0.4 hours. In some embodiments, T1 is about 0.5 hours. In some embodiments, T1 is about 0.6 hours. In some embodiments, T1 is about 0.7 hours. In some embodiments, T1 is about 0.8 hours. In some embodiments, T1 is about 0.9 hours. In some embodiments, T1 is about 1.0 hours. In some embodiments, T1 is about 1.1 hours. In some embodiments, T1 is about 1.2 hours. In some embodiments, T1 is about 1.3 hours. In some embodiments, T1 is about 1.4 hours. In some embodiments, T1 is about 1.5 hours. In some embodiments, T1 is about 1.6 hours. In some embodiments, T1 is about 1.7 hours. In some embodiments, T1 is about 1.8 hours. In some embodiments, T1 is about 1.9 hours. In some embodiments, T1 is about 2.0 hours. In some embodiments, T1 is about 2.1 hours. In some embodiments, T1 is about 2.2 hours. In some embodiments, T1 is about 2.3 hours. In some embodiments, T1 is about 2.4 hours. In some embodiments, T1 is about 2.5 hours. In some embodiments, T1 is about 2.6 hours. In some embodiments, T1 is about 2.7 hours. In some embodiments, T1 is about 2.8 hours. In some embodiments, T1 is about 2.9 hours. In some embodiments, T1 is about 3.0 hours. In some embodiments, T1 is about 3.1 hours. In some embodiments, T1 is about 3.2 hours. In some embodiments, T1 is about 3.3 hours. In some embodiments, T1 is about 3.4 hours. In some embodiments, T1 is about 3.5 hours. In some embodiments, T1 is about 3.6 hours. In some embodiments, T1 is about 3.7 hours. In some embodiments, T1 is about 3.8 hours. In some embodiments, T1 is about 3.9 hours.In one embodiment, T1 is about 4.0 hours.
[0269] In some embodiments, T2 is about 1 hour to 5 hours. In preferred embodiments, T2 is about 1 hour to 3 hours. In more preferred embodiments, T2 is about 1 hour to 2 hours. In certain embodiments, T2 is about 4 hours. In some embodiments, T2 is about 1.0 hour. In some embodiments, T2 is about 1.1 hour. In some embodiments, T2 is about 1.2 hours. In some embodiments, T2 is about 1.3 hours. In some embodiments, T2 is about 1.4 hours. In some embodiments, T2 is about 1.5 hours. In some embodiments, T2 is about 1.6 hours. In some embodiments, T2 is about 1.7 hours. In some embodiments, T2 is about 1.8 hours. In some embodiments, T2 is about 1.9 hours. In some embodiments, T2 is about 2.0 hours. In some embodiments, T2 is about 2.1 hours. In some embodiments, T2 is about 2.2 hours. In some embodiments, T2 is about 2.3 hours. In some embodiments, T2 is about 2.4 hours. In some embodiments, T2 is about 2.5 hours. In some embodiments, T2 is about 2.6 hours. In some embodiments, T2 is about 2.7 hours. In some embodiments, T2 is about 2.8 hours. In some embodiments, T2 is about 2.9 hours. In some embodiments, T2 is about 3.0 hours. In some embodiments, T2 is about 3.1 hours. In some embodiments, T2 is about 3.2 hours. In some embodiments, T2 is about 3.3 hours. In some embodiments, T2 is about 3.4 hours. In some embodiments, T2 is about 3.6 hours. In some embodiments, T2 is about 3.7 hours. In some embodiments, T2 is about 3.8 hours. In some embodiments, T2 is about 3.9 hours. In some embodiments, T2 is about 4.0 hours. In some embodiments, T2 is about 4.1 hours. In some embodiments, T2 is about 4.2 hours. In some embodiments, T2 is about 4.3 hours. In some embodiments, T2 is about 4.4 hours. In some embodiments, T2 is about 4.5 hours. In some embodiments, T2 is about 4.6 hours. In some embodiments, T2 is about 4.7 hours. In some embodiments, T2 is about 4.8 hours. In some embodiments, T2 is about 4.9 hours.In one embodiment, T2 is about 5 hours.
[0270] In some embodiments, C0 is higher than C1 and C2. In some embodiments, C1 is higher than C2. In one embodiment, C0 is higher than C1 and C2. In one embodiment, C1 is higher than C2.
[0271] In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2. In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2. In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2.
[0272] In some embodiments, the peak thickness of the settling front at T1 is about 0 mm to 20.0 mm. In preferred embodiments, the peak thickness of the settling front at T1 is about 1 mm to 10.0 mm. In more preferred embodiments, the peak thickness of the settling front at T1 is about 1 mm to 5.0 mm. In certain embodiments, the peak thickness of the settling front at T1 is at least 2 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.1 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.2 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.3 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.4 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.5 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.6 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.7 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.8 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.9 mm. In some embodiments, the peak thickness of the settling front at T1 is about 1.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 2.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 3.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 4.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 5.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 6.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 7.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 8.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 9.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 10.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 11.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 12.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 13.0 mm.In some embodiments, the peak thickness of the settling front at T1 is about 14.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 15.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 16.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 17.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 18.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 19.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 20.0 mm.
[0273] In some embodiments, the peak thickness of the settling front at T2 is about 2 mm to 25.0 mm. In preferred embodiments, the peak thickness of the settling front at T2 is about 5 mm to 20.0 mm. In more preferred embodiments, the peak thickness of the settling front at T2 is about 5 mm to 15.0 mm. In certain embodiments, the peak thickness of the settling front at T2 is at least 10 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 1.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 2.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 3.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 4.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 5.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 6.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 7.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 8.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 9.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 10.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 11.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 12.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 13.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 14.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 15.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 16.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 17.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 18.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 19.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 20.0 mm.In some embodiments, the peak thickness of the settling front at T2 is at least 21.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 22.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 23.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 24.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 25.0 mm.
[0274] In some embodiments, the settling rate of the settling front is less than 10 mm peak thickness in about 1 hour and greater than 18 mm peak thickness in about 4 hours.
[0275] In one embodiment, the present invention further includes a time T3 during which the precipitation of the insoluble aluminum phosphate-adsorbed glycoconjugate is in equilibrium with the liquid phase at T3. In one embodiment, T3 is about 2 hours to 5 hours. In a preferred embodiment, T3 is about 3 hours to 5 hours. In a more preferred embodiment, T3 is about 4 hours to 5 hours. In one embodiment, T3 is about 2.0 hours. In one embodiment, T3 is about 2.1 hours. In one embodiment, T3 is about 2.2 hours. In one embodiment, T3 is about 2.3 hours. In one embodiment, T3 is about 2.4 hours. In one embodiment, T3 is about 2.5 hours. In one embodiment, T3 is about 2.6 hours. In one embodiment, T3 is about 2.7 hours. In one embodiment, T3 is about 2.8 hours. In one embodiment, T3 is about 2.9 hours. In one embodiment, T3 is about 3.0 hours. In some embodiments, T3 is about 3.1 hours. In some embodiments, T3 is about 3.2 hours. In some embodiments, T3 is about 3.3 hours. In some embodiments, T3 is about 3.4 hours. In some embodiments, T3 is about 3.5 hours. In some embodiments, T3 is about 3.6 hours. In some embodiments, T3 is about 3.7 hours. In some embodiments, T3 is about 3.8 hours. In some embodiments, T3 is about 3.9 hours. In some embodiments, T3 is about 4.0 hours. In some embodiments, T3 is about 4.1 hours. In some embodiments, T3 is about 4.2 hours. In some embodiments, T3 is about 4.4 hours. In some embodiments, T3 is about 4.5 hours. In some embodiments, T3 is about 4.6 hours. In some embodiments, T3 is about 4.7 hours. In some embodiments, T3 is about 4.8 hours. In some embodiments, T3 is about 4.9 hours. In some embodiments, T3 is about 5 hours.
[0276] In some embodiments, the settling front at T3 is about 25 mm to 40 mm. In a preferred embodiment, the settling front at T3 is about 30 mm to 40 mm. In a more preferred embodiment, the settling front at T3 is about 35 mm to 40 mm. In some embodiments, T3 is about 25.0 mm. In some embodiments, T3 is about 26 mm. In some embodiments, T3 is about 27 mm. In some embodiments, T3 is about 28 mm. In some embodiments, T3 is about 29 mm. In some embodiments, T3 is about 30 mm. In some embodiments, T3 is about 31 mm. In some embodiments, T3 is about 2 mm. In some embodiments, T3 is about 33 mm. In some embodiments, T3 is about 34 mm. In some embodiments, T3 is about 35 mm. In some embodiments, T3 is about 36 mm. In some embodiments, T3 is about 37 mm. In some embodiments, T3 is about 38 mm. In some embodiments, T3 is about 39 mm. In some embodiments, T3 is about 40 mm.
[0277] In some embodiments, the composition has been left standing for about one month. In some embodiments, the composition has been left standing for at least two weeks. In some embodiments, the composition is stored in a container. In some embodiments, the container is a syringe.
[0278] In some embodiments, after T3, the composition is resuspended with about 1 to 10 handshakes. In preferred embodiments, after T3, the composition is resuspended with about 1 to 5 handshakes. In more preferred embodiments, after T3, the composition is resuspended with about 1 to 3 handshakes. In some embodiments, after T3, the composition is resuspended with about 1 handshake. In some embodiments, after T3, the composition is resuspended with about 2 handshakes. In some embodiments, after T3, the composition is resuspended with about 3 handshakes. In some embodiments, after T3, the composition is resuspended with about 4 handshakes. In some embodiments, after T3, the composition is resuspended with about 5 handshakes. In some embodiments, after T3, the composition is resuspended with about 6 handshakes. In some embodiments, after T3, the composition is resuspended with about 7 handshakes. In some embodiments, after T3, the composition is resuspended with about 8 handshakes. In some embodiments, after T3, the composition is resuspended with about 9 handshakes. In some embodiments, after T3, the composition is resuspended with about 10 handshakes. In certain embodiments, the composition comprises a formulation previously described.
[0279] In one embodiment, the present invention provides a composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase; and at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant have precipitated from the liquid phase to form a precipitate, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase. at a time T2, a further portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, the at least 25 different glycoconjugates being at a concentration C2 in the liquid phase; and the sedimentation rate is measured over time via static multiple light scattering to detect particle movement in the liquid, the measurement head comprising a pulsed near-infrared light source at a wavelength of approximately 880 nm, having synchronous transmission at 180° from a source-detector and backscattering at 45° from the source-detector that moves along the height of a flat-bottom cylindrical glass sample cell, and collecting sediment data every 20 μm.
[0280] In one embodiment, the composition comprises at least 21 different glycoconjugates. In one embodiment, the composition comprises at least 22 different glycoconjugates. In one embodiment, the composition comprises at least 23 different glycoconjugates. In one embodiment, the composition comprises at least 24 different glycoconjugates. In one embodiment, the composition comprises at least 25 different glycoconjugates. In one embodiment, the composition comprises at least 26 different glycoconjugates. In one embodiment, the composition comprises at least 27 different glycoconjugates. In one embodiment, the composition comprises at least 28 different glycoconjugates. In one embodiment, the composition comprises at least 29 different glycoconjugates. In one embodiment, the composition comprises at least 30 different glycoconjugates. In one embodiment, the composition comprises at least 31 different glycoconjugates. In one embodiment, the composition comprises at least 32 different glycoconjugates. In one embodiment, the composition comprises at least 33 different glycoconjugates. In one embodiment, the composition comprises at least 34 different glycoconjugates. In one embodiment, the composition comprises at least 35 different glycoconjugates.
[0281] In some embodiments, T0 is 0 hours. In some embodiments, T1 is about 0.01 to 4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1 to 2 hours after the sample reaches 45% clarity at the meniscus. In preferred embodiments, T1 is about 0.01 to 4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.3 hours. In some embodiments, T1 is about 0.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.9 hours after the sample reaches 45% clarity at the meniscus.In some embodiments, T1 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 4.0 hours after the sample reaches 45% clarity at the meniscus.
[0282] In some embodiments, T2 is about 1 to 5 hours after the sample reaches 45% clarity at the meniscus. In preferred embodiments, T2 is about 1 to 3 hours after the sample reaches 45% clarity at the meniscus. In more preferred embodiments, T2 is about 1 to 2 hours after the sample reaches 45% clarity at the meniscus. In certain embodiments, T2 is about 4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.0 hour after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.1 hour after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.7 hours after the sample reaches 45% clarity at the meniscus.In some embodiments, T2 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 5 hours after the sample reaches 45% clarity at the meniscus.
[0283] In some embodiments, C0 is higher than C1 and C2. In some embodiments, C1 is higher than C2. In one embodiment, C0 is higher than C1 and C2. In one embodiment, C1 is higher than C2.
[0284] In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2. In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2. In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2.
[0285] In one embodiment, the peak thickness of the settling front at T1 is about 0 mm to 20.0 mm. In a preferred embodiment, the peak thickness of the settling front at T1 is about 1 mm to 10.0 mm. In a preferred embodiment, the peak thickness of the settling front at T1 is about 1 mm to 5.0 mm. In a more preferred embodiment, the peak thickness of the settling front at T1 is at least 2 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.1 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.2 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.3 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.4 mm. In one embodiment, the peak thickness of the settling front at T1 is about 0.5 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.6 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.7 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.8 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.9 mm. In some embodiments, the peak thickness of the settling front at T1 is about 1.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 2.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 3.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 4.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 5.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 6.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 7.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 8.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 9.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 10.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 11.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 12.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 13.0 mm.In some embodiments, the peak thickness of the settling front at T1 is about 14.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 15.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 16.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 17.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 18.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 19.0 mm. In some embodiments, the peak thickness of the first solid phase precipitate at T1 is about 20.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 20.0 mm.
[0286] In some embodiments, the peak thickness of the settling front at T2 is about 2 mm to 25.0 mm. In preferred embodiments, the peak thickness of the settling front at T2 is about 5 mm to 20.0 mm. In more preferred embodiments, the peak thickness of the settling front at T2 is about 5 mm to 15.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 10 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 1.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 2.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 3.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 4.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 5.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 6.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 7.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 8.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 9.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 10.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 11.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 12.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 13.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 14.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 15.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 16.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 17.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 18.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 19.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 20.0 mm.In some embodiments, the peak thickness of the settling front at T2 is at least 21.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 22.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 23.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 24.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 25.0 mm.
[0287] In one embodiment, the settling velocity of the settling front is less than 10 mm peak thickness after about 1 hour when the sample reaches 45% clarification at the meniscus, and greater than 18 mm peak thickness after about 4 hours when the sample reaches 45% clarification at the meniscus.
[0288] In one embodiment, the present invention further includes a time T3 during which the precipitation of the insoluble aluminum phosphate-adsorbed glycoconjugate is in equilibrium with the liquid phase at T3. In one embodiment, T3 is about 2 to 5 hours after the sample reaches 45% clarity at the meniscus. In a preferred embodiment, T3 is about 3 to 5 hours after the sample reaches 45% clarity at the meniscus. In a more preferred embodiment, T3 is about 4 to 5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.6 hours after the sample reaches 45% clarity at the meniscus.In some embodiments, T3 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 5 hours after the sample reaches 45% clarity at the meniscus.
[0289] In some embodiments, the settling front at T3 is about 25 mm to 40 mm. In a preferred embodiment, the settling front at T3 is about 30 mm to 40 mm. In a more preferred embodiment, the settling front at T3 is about 35 mm to 40 mm. In some embodiments, T3 is about 25.0 mm. In some embodiments, T3 is about 26 mm. In some embodiments, T3 is about 27 mm. In some embodiments, T3 is about 28 mm. In some embodiments, T3 is about 29 mm. In some embodiments, T3 is about 30 mm. In some embodiments, T3 is about 31 mm. In some embodiments, T3 is about 2 mm. In some embodiments, T3 is about 33 mm. In some embodiments, T3 is about 34 mm. In some embodiments, T3 is about 35 mm. In some embodiments, T3 is about 36 mm. In some embodiments, T3 is about 37 mm. In some embodiments, T3 is about 38 mm. In some embodiments, T3 is about 39 mm. In some embodiments, T3 is about 40 mm.
[0290] In some embodiments, the composition has been left standing for about one month. In some embodiments, the composition has been left standing for at least two weeks. In some embodiments, the composition is stored in a container. In some embodiments, the container is a syringe.
[0291] In some embodiments, after T3, the composition is resuspended with about 1 to 10 handshakes. In preferred embodiments, after T3, the composition is resuspended with about 1 to 5 handshakes. In more preferred embodiments, after T3, the composition is resuspended with about 1 to 3 handshakes. In some embodiments, after T3, the composition is resuspended with about 1 handshake. In some embodiments, after T3, the composition is resuspended with about 2 handshakes. In some embodiments, after T3, the composition is resuspended with about 3 handshakes. In some embodiments, after T3, the composition is resuspended with about 4 handshakes. In some embodiments, after T3, the composition is resuspended with about 5 handshakes. In some embodiments, after T3, the composition is resuspended with about 6 handshakes. In some embodiments, after T3, the composition is resuspended with about 7 handshakes. In some embodiments, after T3, the composition is resuspended with about 8 handshakes. In some embodiments, after T3, the composition is resuspended with about 9 handshakes. In some embodiments, after T3, the composition is resuspended with about 10 handshakes. In certain embodiments, the composition comprises a formulation previously described.
[0292] In one embodiment, the present invention provides a liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase; and at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant have precipitated from the liquid phase to form a precipitate, the at least 25 different glycoconjugates being at a concentration C0 in the liquid phase. at time T2, a further portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, the at least 25 different glycoconjugates having a concentration C2 in the liquid phase; and sedimentation velocity is measured over time via static multiple light scattering to detect particle movement in the liquid, the measurement head comprising a pulsed near-infrared light source at a wavelength of approximately 880 nm, having synchronous transmission at 180° from a source-detector and backscattering at 45° from the source-detector that moves along the thickness of a flat-bottom cylindrical glass sample cell, and collecting precipitate data every 20 μm.
[0293] In one embodiment, the container comprises at least 21 different glycoconjugates. In one embodiment, the container comprises at least 22 different glycoconjugates. In one embodiment, the container comprises at least 23 different glycoconjugates. In one embodiment, the container comprises at least 24 different glycoconjugates. In one embodiment, the container comprises at least 25 different glycoconjugates. In one embodiment, the container comprises at least 26 different glycoconjugates. In one embodiment, the container comprises at least 27 different glycoconjugates. In one embodiment, the container comprises at least 28 different glycoconjugates. In one embodiment, the container comprises at least 29 different glycoconjugates. In one embodiment, the container comprises at least 30 different glycoconjugates. In one embodiment, the container comprises at least 31 different glycoconjugates. In one embodiment, the container comprises at least 32 different glycoconjugates. In one embodiment, the container comprises at least 33 different glycoconjugates. In one embodiment, the container contains at least 34 different glycoconjugates. In one embodiment, the container contains at least 35 different glycoconjugates.
[0294] In some embodiments, T0 is 0 hours. In some embodiments, T1 is about 0.01 to 4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1 to 2 hours after the sample reaches 45% clarity at the meniscus. In preferred embodiments, T1 is about 0.01 to 4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.3 hours. In some embodiments, T1 is about 0.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 0.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 1.9 hours after the sample reaches 45% clarity at the meniscus.In some embodiments, T1 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T1 is about 4.0 hours after the sample reaches 45% clarity at the meniscus.
[0295] In some embodiments, T2 is about 1 to 5 hours after the sample reaches 45% clarity at the meniscus. In preferred embodiments, T2 is about 1 to 3 hours after the sample reaches 45% clarity at the meniscus. In more preferred embodiments, T2 is about 1 to 2 hours after the sample reaches 45% clarity at the meniscus. In certain embodiments, T2 is about 4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.0 hour after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.1 hour after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 1.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.7 hours after the sample reaches 45% clarity at the meniscus.In some embodiments, T2 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 4.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T2 is about 5 hours after the sample reaches 45% clarity at the meniscus.
[0296] In some embodiments, C0 is higher than C1 and C2. In some embodiments, C1 is higher than C2. In one embodiment, C0 is higher than C1 and C2. In one embodiment, C1 is higher than C2.
[0297] In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2. In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2. In an embodiment, C0 is higher than C1 and C2. In an embodiment, C1 is higher than C2.
[0298] In some embodiments, the peak thickness of the settling front at T1 is about 0 mm to 20.0 mm. In preferred embodiments, the peak thickness of the settling front at T1 is about 1 mm to 10.0 mm. In more preferred embodiments, the peak thickness of the settling front at T1 is about 1 mm to 5.0 mm. In certain embodiments, the peak thickness of the settling front at T1 is at least 2 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.1 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.2 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.3 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.4 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.5 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.6 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.7 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.8 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0.9 mm. In some embodiments, the peak thickness of the settling front at T1 is about 1.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 2.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 3.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 4.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 5.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 6.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 7.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 8.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 9.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 10.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 11.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 12.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 13.0 mm.In some embodiments, the peak thickness of the settling front at T1 is about 14.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 15.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 16.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 17.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 18.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 19.0 mm. In some embodiments, the peak thickness of the settling front at T1 is about 20.0 mm.
[0299] In some embodiments, the peak thickness of the settling front at T2 is about 2 mm to 25.0 mm. In preferred embodiments, the peak thickness of the settling front at T2 is about 5 mm to 20.0 mm. In more preferred embodiments, the peak thickness of the settling front at T2 is about 5 mm to 15.0 mm. In certain embodiments, the peak thickness of the settling front at T2 is at least 10 mm. In some embodiments, the peak thickness of the settling front at T1 is about 0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 1.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 2.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 3.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 4.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 5.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 6.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 7.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 8.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 9.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 10.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 11.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 12.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 13.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 14.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 15.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 16.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 17.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 18.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 19.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 20.0 mm.In some embodiments, the peak thickness of the settling front at T2 is at least 21.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 22.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 23.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 24.0 mm. In some embodiments, the peak thickness of the settling front at T2 is at least 25.0 mm.
[0300] In one embodiment, the settling velocity of the settling front is less than 10 mm peak thickness after about 1 hour when the sample reaches 45% clarification at the meniscus, and greater than 18 mm peak thickness after about 4 hours when the sample reaches 45% clarification at the meniscus.
[0301] In one embodiment, the present invention further includes a time T3 during which the precipitation of the insoluble aluminum phosphate-adsorbed glycoconjugate is in equilibrium with the liquid phase at T3. In one embodiment, T3 is about 2 to 5 hours after the sample reaches 45% clarity at the meniscus. In a preferred embodiment, T3 is about 3 to 5 hours after the sample reaches 45% clarity at the meniscus. In a more preferred embodiment, T3 is about 4 to 5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.6 hours after the sample reaches 45% clarity at the meniscus.In some embodiments, T3 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.0 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.1 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.2 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.3 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.4 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.5 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.6 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.7 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.8 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 4.9 hours after the sample reaches 45% clarity at the meniscus. In some embodiments, T3 is about 5 hours after the sample reaches 45% clarity at the meniscus.
[0302] In some embodiments, the settling front at T3 is about 25 mm to 40 mm. In a preferred embodiment, the settling front at T3 is about 30 mm to 40 mm. In a more preferred embodiment, the settling front at T3 is about 35 mm to 40 mm. In some embodiments, T3 is about 25.0 mm. In some embodiments, T3 is about 26 mm. In some embodiments, T3 is about 27 mm. In some embodiments, T3 is about 28 mm. In some embodiments, T3 is about 29 mm. In some embodiments, T3 is about 30 mm. In some embodiments, T3 is about 31 mm. In some embodiments, T3 is about 2 mm. In some embodiments, T3 is about 33 mm. In some embodiments, T3 is about 34 mm. In some embodiments, T3 is about 35 mm. In some embodiments, T3 is about 36 mm. In some embodiments, T3 is about 37 mm. In some embodiments, T3 is about 38 mm. In some embodiments, T3 is about 39 mm. In some embodiments, T3 is about 40 mm.
[0303] In some embodiments, the composition has been left standing for about one month. In some embodiments, the composition has been left standing for at least two weeks. In some embodiments, the composition is stored in a container. In some embodiments, the container is a syringe.
[0304] In some embodiments, after T3, the composition is resuspended with about 1 to 10 handshakes. In preferred embodiments, after T3, the composition is resuspended with about 1 to 5 handshakes. In more preferred embodiments, after T3, the composition is resuspended with about 1 to 3 handshakes. In some embodiments, after T3, the composition is resuspended with about 1 handshake. In some embodiments, after T3, the composition is resuspended with about 2 handshakes. In some embodiments, after T3, the composition is resuspended with about 3 handshakes. In some embodiments, after T3, the composition is resuspended with about 4 handshakes. In some embodiments, after T3, the composition is resuspended with about 5 handshakes. In some embodiments, after T3, the composition is resuspended with about 6 handshakes. In some embodiments, after T3, the composition is resuspended with about 7 handshakes. In some embodiments, after T3, the composition is resuspended with about 8 handshakes. In some embodiments, after T3, the composition is resuspended with about 9 handshakes. In some embodiments, after T3, the composition is resuspended with about 10 handshakes. In certain embodiments, the composition comprises a formulation previously described.
[0305] Figures 1-3 provide sedimentation curves for comparative formulations and formulations of the present invention. In one embodiment, the sedimentation rate of the first solid-phase precipitate is less than the sedimentation rate of the second solid-phase precipitate. The formulations of the present invention sediment at an appropriate rate to enable manufacture, resuspension, and use. In certain embodiments, the formulations of the present invention have a faster sedimentation rate than the 20-serotype control formulation. In certain embodiments, the formulations of the present invention have a sedimentation rate that falls between the sedimentation curves of the 7-serotype control formulation and the 20-serotype control formulation (shaded area in Figures 1 and 2). In certain embodiments, the formulations of the present invention have a sedimentation rate that falls between the sedimentation curves of the 7-serotype control formulation and the 25-serotype control formulation (shaded area in Figures 1 and 3). In certain embodiments, the formulations of the present invention have a sedimentation rate that falls within the shaded area in Figures 2 or 3, as exemplified by several matrices detailed in Table 1 below.
[0306] In one embodiment, the present invention provides a syringe filled with any of the vaccine formulations disclosed herein. In certain embodiments, the syringe is siliconized and / or made of glass.
[0307] A typical dose of the vaccine formulation of the invention for injection has a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, even more preferably a volume of about 0.5 mL.
[0308] Thus, a container or syringe as defined above is filled with a volume of between 0.1 mL and 2 mL, more preferably between 0.2 mL and 1 mL, and even more preferably a volume of about 0.5 mL of any of the vaccine formulations as defined herein.
[0309] Adjuvants In some embodiments, the vaccine formulations disclosed herein may further comprise at least one, two, or three adjuvants. In some embodiments, the vaccine formulations disclosed herein may further comprise at least one adjuvant. In some embodiments, the vaccine formulations disclosed herein may further comprise one adjuvant. In some embodiments, the vaccine formulations disclosed herein may further comprise two adjuvants. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An antigen may act primarily as a delivery system, primarily as an immunomodulator, or have strong characteristics of both. Suitable adjuvants include those suitable for use in mammals, including humans.
[0310] Examples of known suitable delivery system-type adjuvants that can be used in humans include, but are not limited to, alum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween™ 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as Montanide, and poly(D,L-lactide-co-glycolide) (PLG) microparticles or nanoparticles.
[0311] In some embodiments, the formulations disclosed herein include an aluminum salt (alum) (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide) as an adjuvant. In preferred embodiments, the vaccine formulations disclosed herein include aluminum phosphate or aluminum hydroxide as an adjuvant. In preferred embodiments, the vaccine formulations disclosed herein include aluminum phosphate as an adjuvant.
[0312] Additional exemplary adjuvants for enhancing the effectiveness of the vaccine formulations disclosed herein include, but are not limited to: (1) oil-in-water emulsion formulations (with or without other specific immunostimulants, e.g., muramyl peptides (see below) or bacterial cell wall components), such as (a) 10% squalene, either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion; (b) SAF containing 0.4% Tween™ 80, 5% pluronic block polymer L121 and thr-MDP, and (b) RIBI™ Adjuvant System (RAS), (Ribi Immunochem, Hamilton, MT) containing 2% squalene, 0.2% Tween™ 80, and one or more bacterial cell wall components, e.g., monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOX™); (2) saponin adjuvants, e.g., QS21, STIMULON™ (Cambridge Bioscience, Worcester, MA), ABISCO® (Isconova, Sweden), or ISCOMATRIX® (Commonwealth Serum). (2) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (3) cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g., WO 99 / 44636)), interferons (e.g., gamma interferon), macrophage colony-stimulating factor (M-CSF), tumor necrosis factor (TNF), and the like;(5) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL), optionally in the substantial absence of alum when used in conjunction with pneumococcal saccharides (see, e.g., WO 00 / 56358); (6) 3dMPL in combination with, for example, QS21 and / or oil-in-water emulsions (see, e.g., EP 0 835 318, EP 0 735 898, EP 0 761 231); (7) polyoxyethylene ethers or polyoxyethylene esters (see, e.g., WO 99 / 52549); (8) polyoxyethylene sorbitan in combination with octoxynol. Ester surfactants (e.g., WO01 / 21207), or polyoxyethylene alkyl ether or ester surfactants in combination with at least one additional non-ionic surfactant, such as octoxynol (e.g., WO01 / 21152); (9) saponin and immunostimulatory oligonucleotides (e.g., CpG oligonucleotides) (e.g., WO00 / 62800); (10) particles of immunostimulants and metal salts (see, e.g., WO00 / 23105); (11) saponin and oil-in-water emulsions (e.g., WO99 / 11241); (12) saponin (e.g., QS21) + 3dMPL + IM2 (optionally + sterol) (e.g., WO98 / 57659);(13) Other substances that act as immunostimulants to enhance the effectiveness of the composition. Muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25 acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE), and the like. In some embodiments of the present invention, the vaccine formulations disclosed herein contain a CpG oligonucleotide as an adjuvant. As used herein, CpG oligonucleotide refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and therefore these terms are used interchangeably unless otherwise specified. Immunostimulatory CpG oligodeoxynucleotides contain one or more immunostimulatory CpG motifs, which are unmethylated cytosine-guanine dinucleotides, optionally within a specific preferred base context. The methylation state of a CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. Immunostimulatory oligonucleotides containing at least one unmethylated CpG dinucleotide contain an unmethylated 5' cytosine linked to a 3' guanine by a phosphate bond and activate the immune system through binding to Toll-like receptor 9 (TLR-9). In another embodiment, immunostimulatory oligonucleotides may contain one or more methylated CpG dinucleotides and activate the immune system through TLR9, but not as strongly as if the CpG motif(s) were unmethylated. CpG immunostimulatory oligonucleotides may contain one or more palindromes, which in turn may encompass a CpG dinucleotide. CpG oligonucleotides are disclosed in U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116;and 6,339,068, and are described in several issued patents, published patent applications and other publications.
[0313] In one embodiment of the present invention, the vaccine formulation disclosed herein comprises any of the CpG oligonucleotides described on page 3, line 22 to page 12, line 36 of WO2010 / 125480.
[0314] Different classes of CpG immunostimulatory oligonucleotides have been identified. These are referred to as the A, B, C, and P classes and are described in further detail in WO2010 / 125480, page 3, line 22 to page 12, line 36. The methods of the present invention encompass the use of these different classes of CpG immunostimulatory oligonucleotides.
[0315] In certain embodiments of the present invention, the vaccine formulations disclosed herein comprise an A-class CpG oligonucleotide. Preferably, the "A-class" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5' GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1). Some non-limiting examples of A-class oligonucleotides include: 5' GGGGACGACGTCGTGGGGGGG 3' * G * G_G_A_C_G_A_C_G_T_C_G_T_G_G * G * G * G * G * G 3' (SEQ ID NO: 2); * " refers to a phosphorothioate bond and "_" refers to a phosphodiester bond.
[0316] In certain embodiments of the present invention, the vaccine formulations disclosed herein comprise a B class CpG oligonucleotide. In one embodiment, the CpG oligonucleotide for use in the present invention is at least a B class CpG oligonucleotide having the following formula:
[0317] 5' X1X2CGX3X4 3', wherein X1, X2, X3, and X4 are nucleotides. In one embodiment, X2 is adenine, guanine, or thymine. In another embodiment, X3 is cytosine, adenine, or thymine.
[0318] The B-class CpG oligonucleotide sequences of the present invention are those broadly described above and those disclosed in WO96 / 02555, WO98 / 18810 and U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116 and 6,339,068.Exemplary sequences include, but are not limited to, those disclosed in these latter applications and patents.
[0319] In one embodiment, the "B class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5'TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO: 3), or 5'TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO: 4), or 5'TCGTCGTTTTGTCGTTTTGTCGTT 3' (SEQ ID NO: 5), or 5'TCGTCGTTTCGTCGTTTTGTCGTT 3' (SEQ ID NO: 6), or 5'TCGTCGTTTTGTCGTTTTTTTCGA 3' (SEQ ID NO: 7)
[0320] In any of these sequences, all linkages can be phosphorothioate bonds. In another embodiment, in any of these sequences, one or more of the linkages can be phosphodiester, preferably between the "C" and "G" of the CpG motif, resulting in a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or halogen can replace the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.
[0321] Some non-limiting examples of B class oligonucleotides include: 5'T * C * G * T * C * G * T * T * T * T * T * C * G * G * T * G * C * T * T * T * T 3' (SEQ ID NO: 8), or 5'T * C * G * T * C * G * T * T * T * T * T * C * G * G * T * C * G * T * T * T * T 3' (SEQ ID NO: 9), or 5'T * C * G * T * C * G * T * T * T * T * G * T * C * G * T * T * T * T * G * T * C * G * T *T 3' (SEQ ID NO: 10), or 5'T * C * G * T * C * G * T * T * T * C * G * T * C * G * T * T * T * T * G * T * C * G * T * T 3' (SEQ ID NO: 11), or 5'T * C * G * T * C * G * T * T * T * T * G * T * C * G * T * T * T * T * T * T * T * C * G * A 3' (SEQ ID NO: 12) During the ceremony, `` * " refers to a phosphorothioate linkage.
[0322] In certain embodiments of the invention, the vaccine formulations disclosed herein comprise a C-class CpG oligonucleotide. In certain embodiments, the "C-class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5'TCGCGTCGTTCGGCGCGCGCCG 3' (SEQ ID NO: 13), or 5'TCGTCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 14), or 5'TCGGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 15), or 5'TCGGACGTTCGGCGCGCCG 3' (SEQ ID NO: 16), or 5'TCGCGTCGTTCGGCGCGCCG 3' (SEQ ID NO: 17), or 5'TCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 18), or 5'TCGACGTTCGGCGCGCCG 3' (SEQ ID NO: 19), or 5'TCGCGTCGTTCGGCGCCG 3' (SEQ ID NO: 20), or 5'TCGCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 21), or 5'TCGTCGTTTTCGGCGCGCGCCG 3' (SEQ ID NO: 22), or 5'TCGTCGTTTTCGGCGGCCGCCG 3' (SEQ ID NO: 23), or 5'TCGTCGTTTTACGGCGCCGTGCCG 3' (SEQ ID NO: 24), or 5'TCGTCGTTTTCGGCGCGCGCCGT 3' (SEQ ID NO: 25)
[0323] In any of these sequences, all of the linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more of the linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif, resulting in a semi-flexible CpG oligonucleotide.
[0324] Some non-limiting examples of C class oligonucleotides include: 5'T * C_G * C_G * T * C_G * T * T * C_G * G * C* G * C_G * C * G * C * C * G 3' (SEQ ID NO: 26), or 5'T * C_G * T * C_G * A * C_G * T * T * C_G * G * C * G * C_G * C * G * C * C * G 3' (SEQ ID NO: 27), or 5'T * C_G * G * A * C_G * T * T * C_G * G * C * G * C_G * C * G * C * C * G 3' (SEQ ID NO: 28), or 5'T * C_G * G * A * C_G * T * T * C_G * G * C * G * C * G * C * C * G 3' (SEQ ID NO: 29), or 5'T * C_G * C_G * T * C_G * T* T * C_G * G * C * G * C * G * C * C * G 3' (SEQ ID NO: 30), or 5'T * C_G * A * C_G * T * T * C_G * G * C * G * C_G * C * G * C * C * G 3' (SEQ ID NO: 31), or 5'T * C_G * A * C_G * T * T * C_G * G * C * G * C * G * C * C * G 3' (SEQ ID NO: 32), or 5'T * C_G * C_G * T * C_G * T * T * C_G * G * C * G * C * C * G 3' (SEQ ID NO: 33), or 5'T * C_G * C_G * A * C_G * T * T * C_G * G* C * G * C_G * C * G * C * C * G 3' (SEQ ID NO: 34), or 5'T * C * G * T * C * G * T * T * T * T * C * G * G * C * G * C * G * C * G * C * C * G 3' (SEQ ID NO: 35), or 5'T * C * G * T * C * G * T * T * T * T * C * G * G * C * G * G * C * C * G * C * C * G 3' (SEQ ID NO: 36), or 5'T * C * G * T * C_G * T * T * T * T * A * C_G * G * C * G * C* C_G * T * G * C * C * G 3' (SEQ ID NO: 37), or 5'T * C_G * T * C * G * T * T * T * T * C * G * G * C * G * C * G * C * G * C * C * G * T 3' (SEQ ID NO: 38) During the ceremony, `` * " refers to a phosphorothioate bond and "_" refers to a phosphodiester bond.
[0325] In any of these sequences, ethyl-uridine or a halogen may be substituted for the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.
[0326] In one embodiment of the invention, the vaccine formulations disclosed herein comprise a P-class CpG oligonucleotide. In one embodiment, the CpG oligonucleotide for use in the invention is a P-class CpG oligonucleotide containing a 5' TLR activation domain and at least two palindromic regions, one of which is a 5' palindromic region at least 6 nucleotides in length connected, either directly or via a spacer, to a 3' palindromic region at least 8 nucleotides in length, and the oligonucleotide contains at least one YpR dinucleotide. In one embodiment, the oligonucleotide is a T * C_G * T *C_G * A * C_G * T * T * C_G * G * C * G * C_G * C * G * C * C * In one embodiment, the P class CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In yet another embodiment, the TLR activation domain is within the 5' palindrome region. In another embodiment, the TLR activation domain is immediately 5' to the 5' palindrome region.
[0327] In one embodiment, a "P class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5' TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).
[0328] In this sequence, all linkages may be phosphorothioate bonds. In another embodiment, one or more of the linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif, resulting in a semi-flexible CpG oligonucleotide. In any of these sequences, ethyl-uridine or halogen may replace the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.
[0329] Non-limiting examples of P class oligonucleotides include: 5'T * C_G * T * C_G * A * C_G * A * T* C_G * G * C * G * C_G * C * G * C * C * G 3' (SEQ ID NO: 40) During the ceremony, `` * " refers to a phosphorothioate bond and "_" refers to a phosphodiester bond.
[0330] In one embodiment, the oligonucleotide comprises at least one phosphorothioate linkage. In another embodiment, all internucleotide linkages of the oligonucleotide are phosphorothioate linkages. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like linkage. In another embodiment, the phosphodiester-like linkage is a phosphodiester linkage. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.
[0331] In some embodiments, all internucleotide linkages of the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides described in WO2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention are rendered resistant to degradation (e.g., stabilized). A "stabilized oligonucleotide" refers to an oligonucleotide that is relatively resistant to in vivo degradation (e.g., via exo- or endo-nucleases). Nucleic acid stabilization can be achieved through backbone modifications. Oligonucleotides with phosphorothioate linkages provide maximum activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases.
[0332] Immunostimulatory oligonucleotides can have a chimeric backbone that has a combination of phosphodiester linkages and phosphorothioate linkages.For the purpose of the present invention, chimeric backbone refers to a partially stabilized backbone, in which at least one internucleotide linkage is phosphodiester or phosphodiester-like, and at least one other internucleotide linkage is stabilized internucleotide linkage, and at least one phosphodiester or phosphodiester-like linkage and at least one stabilized linkage are different.If phosphodiester linkages are preferentially located within CpG motifs, such molecules are called "semi-flexible", as described in WO2007 / 026190.
[0333] Other modified oligonucleotides contain combinations of phosphodiester, phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, and / or p-ethoxy linkages.
[0334] Mixed backbone-modified ODNs can be synthesized as described in WO2007 / 026190.
[0335] The size of the CpG oligonucleotide (i.e., the number of nucleotide residues along the length of the oligonucleotide) can also contribute to the stimulatory activity of the oligonucleotide. To facilitate uptake into cells, the CpG oligonucleotides of the present invention preferably have a minimum length of six nucleotide residues. Because larger oligonucleotides are degraded inside the cell, oligonucleotides of any size larger than six nucleotides (even multi-kb long) can induce an immune response if sufficient immunostimulatory motifs are present. In certain embodiments, the CpG oligonucleotide is 6-100 nucleotides in length, preferentially 8-30 nucleotides in length. In important embodiments, the nucleic acids and oligonucleotides of the present invention are not plasmids or expression vectors.
[0336] In certain embodiments, the CpG oligonucleotides disclosed herein contain substitutions or modifications, eg, in the base and / or sugar, as described in paragraphs 134-147 of WO2007 / 026190.
[0337] In some embodiments, the CpG oligonucleotide of the present invention is chemically modified.Examples of chemical modifications are known to those skilled in the art, and are described, for example, in Uhlmann et al. (1990) Chem.Rev.90:543; S.Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke et al. (1996) Annu.Rev.Pharmacol.Toxicol.36:107-129; and Hunziker et al. (1995) Mod.Synth.Methods 7:331-417.The oligonucleotide according to the present invention can have one or more modifications, and each modification is located in a specific phosphodiester internucleoside bridge and / or a specific β-D-ribose unit and / or a specific natural nucleoside base position compared with the oligonucleotide of the same sequence that is composed of natural DNA or RNA.
[0338] In some embodiments of the present invention, the CpG-containing nucleic acid may simply be mixed with the immunogenic carrier according to methods known to those skilled in the art (see, eg, WO03 / 024480).
[0339] In specific embodiments of the present invention, any of the vaccine formulations disclosed herein contains 2 μg to 100 mg of CpG oligonucleotide. In specific embodiments of the present invention, any of the vaccine formulations of the present invention contains 0.1 mg to 50 mg of CpG oligonucleotide, preferably 0.2 mg to 10 mg of CpG oligonucleotide, and more preferably 0.3 mg to 5 mg of CpG oligonucleotide. In specific embodiments of the present invention, any of the vaccine formulations of the present invention contains 0.3 mg to 5 mg of CpG oligonucleotide. Even more preferably, any of the vaccine formulations of the present invention may contain 0.5 to 2 mg of CpG oligonucleotide. Most preferably, any of the vaccine formulations of the present invention may contain 0.75 to 1.5 mg of CpG oligonucleotide. In a preferred embodiment, any of the vaccine formulations disclosed herein may contain approximately 1 mg of CpG oligonucleotide.
[0340] Liposomal adjuvants In one embodiment, the adjuvant comprises a liposome. As used herein, "liposome" refers to a closed bilayer membrane containing an enclosed aqueous volume. Liposomes can also be unilamellar vesicles, which have a single membrane bilayer, or multilamellar vesicles, which have multiple membrane bilayers, each separated from the next by an aqueous layer. The resulting membrane bilayer structure is such that the hydrophobic (non-polar) tails of the lipids are oriented toward the center of the bilayer, and the hydrophilic (polar) heads are oriented toward the aqueous phase. Suitable hydrophilic polymers for surrounding liposomes include, without limitation, PEG, polyvinylpyrrolidone, polyvinylmethylether, polymethyloxazoline, polyethyloxazoline, polyhydroxypropyloxazoline, polyhydroxypropylmethacrylamide, polymethacrylamide, polydimethylacrylamide, polyhydroxypropylmethacrylate, polyhydroxyethylacrylate, hydroxymethylcellulose, hydroxyethylcellulose, polyethylene glycol, polyaspartamide, and hydrophilic peptide sequences, as described in U.S. Patent Nos. 6,316,024; 6,126,966; 6,056,973; and 6,043,094.Liposomes can be made without hydrophilic polymers.Therefore, liposome adjuvants may or may not contain hydrophilic polymers.Liposomes can be made from any lipid or lipid combination known in the art. For example, the vesicle-forming lipids can be naturally occurring or synthetic lipids, including phospholipids, such as phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol, and sphingomyelin, as described in U.S. Pat. Nos. 6,056,973 and 5,874,104.
[0341] Liposomal adjuvants include liposomes. When liposomal adjuvants are used in vaccine formulations, water-soluble antigens, such as proteins, peptides, nucleic acids, or carbohydrates, are encapsulated in the internal aqueous volume of the liposomes (see Tretiakova et al., Liposomes as Adjuvants and Vaccine Delivery Systems. Biochem (Mosc) Suppl Ser A Membr Cell Biol. 2022;16(1):1-20). Alternatively, when liposomal adjuvants are combined with lipophilic / amphiphilic substances, such as lipopeptides and glycolipids, these agents are embedded in the lipid bilayer (ibid.). Depending on the type of molecule combined with the liposomal adjuvant, further interactions may include association with the surface of the liposome by adsorption or covalent bonding (ibid.). Thus, in some embodiments, the liposomal adjuvant includes a water-soluble antigen, which is encapsulated in the internal aqueous volume of the liposomes. In some embodiments, the water-soluble antigen is a protein, peptide, nucleic acid, or carbohydrate. In some embodiments, the liposome adjuvant is combined with lipophilic or amphiphilic molecules, and these molecules are embedded in the lipid bilayer. In some embodiments, the lipophilic or amphiphilic molecules embedded in the lipid bilayer of the liposome comprise cholesterol, fatty acids, or lipids. In some embodiments, the lipophilic or amphiphilic molecules embedded in the lipid bilayer are lipidated.
[0342] Any liposomal adjuvant is contemplated herein. In one embodiment, the liposomal adjuvant is AS01. AS01 comprises 3-O-deacylated monophosphoryl lipid A (3D-MPL) and cholesterol "quenched form" QS21 (see U.S. Pat. No. 10,039,823). In AS01, the lipid bilayer is composed of a "non-crystalline" neutral lipid at room temperature, such as dioleoylphosphatidylcholine, cholesterol, MPLA, and QS-21 (see U.S. Pat. No. 10,039,823 and WO1996 / 033739). During the production of AS01, small unilamellar liposomal vesicles (SUVs) are first created, and then purified QS-21 is added to the SUVs. QS-21 confers unique properties in that it binds to cholesterol in liposomes, at which point it causes perforations (holes) or other permanent structural changes in the liposomes (see, e.g., Paepenmuller et al., 2014, Int. J. Pharm., 475:138-46). Reduced amounts of free QS-21 likely resulted in reduced local injection pain often caused by free QS-21 (see, e.g., Waite et al., 2001, Vaccine, 19:3957-67; Mbawuike et al., 2007, Vaccine, 25:3263-69). In some embodiments, AS01 contains a molar percent concentration of cholesterol (sterol) between about 1% (mol / mol) and about 50% (mol / mol), preferably between about 20% (mol / mol) and about 25% (mol / mol) (see U.S. Patent No. 10,039,823). In some embodiments, AS01 (including, for example, AS01A, AS01B, AS01C, AS01D, AS01E, and AS015) comprises dioleoylphosphatidylcholine (DOPC), cholesterol, MPLA, such as 3D-MPL, and QS-21. In further embodiments, the liposomal adjuvant is selected from the group consisting of AS01A, AS01B, AS01C, AS01D, AS01E, and AS015. In one embodiment, the liposomal adjuvant is AS01A.In some embodiments, AS01A comprises 3D-MPL, a toll-like receptor 4 agonist, and QS-21. In one embodiment, the liposomal adjuvant is AS01B. In some embodiments, AS01B comprises 1000 μg / dose DOPC, 250 μg / dose cholesterol, 50 μg / dose 3D-MPL, 50 μg / dose QS21, phosphate NaCl buffer, and water to a volume of 0.5 ml (see U.S. Patent No. 10,039,823). In one embodiment, the liposomal adjuvant is AS01E. In some embodiments, AS01E comprises the same components as AS01B but at lower concentrations. In some embodiments, AS01E comprises 500 μg / dose dioleoylphosphatidylcholine (DOPC), 125 μg / dose cholesterol, 25 μg / dose 3D-MPL, 25 μg / dose QS21, phosphate NaCl buffer, and water to a volume of 0.5 ml (see U.S. Patent No. 10,039,823). In one embodiment, the liposome adjuvant is AS015. In some embodiments, AS015 comprises dioleoylphosphatidylcholine (DOPC), cholesterol, 3D-MPL, QS-21, and CpG.
[0343] In one embodiment, the liposomal adjuvant is LiNA-1. In some embodiments, LiNA-1 comprises MPLA and saponin. In some embodiments, LiNA-1 comprises MPLA and QS-21. In other embodiments, LiNA-1 comprises phosphorylated hexaacyl disaccharide (PHAD®) (i.e., monophosphoryl lipid A (synthetic) available from Avanti® polar lipids) and QS-21. In another specific embodiment, LiNA-1 comprises PHAD®, QS-21, cholesterol, and DOPC. In another specific embodiment, LiNA-1 comprises 3D-PHAD®, QS-21, cholesterol, and DOPC. In another specific embodiment, LiNA-1 contains the following components per 0.5 mL dose: (i) 50 μg MPLA (i.e., 3D-PHAD®), (ii) 250 μg cholesterol, (iii) 50 μg QS-21, and (iv) 1000 μg DOPC. In another specific embodiment, LiNA-1 contains the following components per 0.5 mL dose: (i) 50 μg MPLA (i.e., PHAD®), (ii) 250 μg cholesterol, (iii) 50 μg QS-21, and (iv) 1000 μg DOPC. In some embodiments, the LiNA-1 formulation may be 0.0625x concentrated LiNA-1 (0.0625x LiNA-1), 0.125x concentrated LiNA-1 (0.125x LiNA-1), 0.25x concentrated LiNA-1 (0.25x LiNA-1), 0.5x concentrated LiNA-1 (0.5x LiNA-1), 1x concentrated LiNA-1 (1x LiNA-1), 2x concentrated LiNA-1 (2x LiNA-1), 3x concentrated LiNA-1 (3x LiNA-1), or 4x concentrated LiNA-1 (4x LiNA-1).
[0344] In certain embodiments, the liposome adjuvant is ALFQ. In some embodiments, the ALFQ comprises MPLA and saponin (see U.S. Pat. No. 10,434,167). In some embodiments, the ALFQ comprises a lipid bilayer comprising a phospholipid whose carbohydrate chain has a melting temperature in water of ≧23° C. In further embodiments, the ALFQ comprises cholesterol at a molar percent concentration greater than about 50% (mol / mol). In certain embodiments, the ALFQ comprises between about 55% (mol / mol) and about 71% (mol / mol) cholesterol. In certain embodiments, the ALFQ comprises about 55% (mol / mol) cholesterol. In some embodiments, the ALFQ comprises MPLA and QS-21. In other embodiments, ALFQ comprises monophosphoryl 3-deacyl lipid A phosphorylated hexaacyldisaccharide (3D-PHAD®) (i.e., monophosphoryl 3-deacyl lipid A (synthetic) available from Avanti® polar lipids) and saponin. In another specific embodiment, ALFQ comprises 3D-PHAD®, QS-21, dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), and cholesterol. In another specific embodiment, ALFQ comprises (i) 7.0 mg / mL DMPC, (ii) 0.78 mg / ml DMPG, (iii) 5.4 mg / ml cholesterol, (iv) 0.2 mg / mL MPLA (3D-PHAD®), and (v) 0.1 mg / ml QS-21.
[0345] In certain embodiments, the liposome adjuvant is LiNA-2. In some embodiments, LiNA-2 comprises MPLA and saponin. In some embodiments, LiNA-2 comprises a lipid bilayer comprising a phospholipid whose carbohydrate chain has a melting temperature in water of ≥23°C. In further embodiments, LiNA-2 comprises cholesterol at a molar percent concentration greater than about 50% (mol / mol). In certain embodiments, LiNA-2 comprises between about 55% (mol / mol) and about 71% (mol / mol) cholesterol. In certain embodiments, LiNA-2 comprises about 55% (mol / mol) cholesterol. In some embodiments, LiNA-2 comprises MPLA and QS-21. In other embodiments, LiNA-2 comprises monophosphoryl 3-deacyl lipid A phosphorylated hexaacyldisaccharide (3D-PHAD®) and saponin. In another specific embodiment, LiNA-2 comprises 3D-PHAD®, QS-21, dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), and cholesterol.
[0346] In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer. In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer at a concentration between about 1 mM and about 100 mM. In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer at a concentration between about 1 mM and about 10 mM. In some embodiments, the LiNA-2 adjuvant comprises about 5 mM, about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, or about 50 mM phosphate buffer. In a specific embodiment, the LiNA-2 adjuvant comprises about 10 mM phosphate buffer. In another specific embodiment, the LiNA-2 adjuvant comprises 3D-PHAD®, QS-21, DMPC, DMPG, cholesterol, and a phosphate buffer. In a further specific embodiment, the LiNA-2 adjuvant comprises 3D-PHAD®, QS-21, DMPC, DMPG, cholesterol and 10 mM phosphate buffer.
[0347] In some embodiments, the LiNA-2 adjuvant comprises sodium chloride. In some embodiments, the LiNA-2 adjuvant comprises between about 50 mM and about 500 mM sodium chloride. In other embodiments, the LiNA-2 adjuvant comprises about 25 mM, about 50 mM, about 75 mM, about 100 mM, about 125 mM, about 150 mM, about 175 mM, about 200 mM, about 225 mM, or about 250 mM sodium chloride. In a particular aspect, the LiNA-2 adjuvant comprises about 150 mM sodium chloride. In one embodiment, the LiNA-2 adjuvant comprises 3D-PHAD®, QS-21, DMPC, DMPG, cholesterol, sodium chloride, and a phosphate buffer. In a further specific embodiment, the LiNA-2 adjuvant comprises 3D-PHAD®, QS-21, DMPC, DMPG, cholesterol, 150 mM sodium chloride and 10 mM phosphate buffer.
[0348] In one embodiment, the adjuvant formulation is 0.5x LiNA-2 (also known as ALFQ), which comprises (i) 7.0 mg / mL DMPC, (ii) 0.78 mg / ml DMPG, (iii) 5.4 mg / ml cholesterol, (iv) 0.2 mg / mL MPLA (3D-PHAD®), and (v) 0.1 mg / ml QS-21, and can be homogeneous or heterogeneous. In another embodiment, the adjuvant formulation is 1× LiNA-2, which comprises (i) 14±7 mg / mL DMPC, (ii) 1.6±0.8 mg / ml DMPG, (iii) 11±6 mg / ml cholesterol, (iv) 0.40±0.20 mg / mL MPLA (3D-PHAD®), and (v) 0.20±0.10 mg / ml QS-21, and can be homogeneous or heterogeneous. In a further embodiment, the adjuvant formulation is 2x LiNA-2, which comprises (i) 28±14 mg / mL DMPC, (ii) 3.2±1.6 mg / ml DMPG, (iii) 22±11 mg / ml cholesterol, (iv) 0.80±0.40 mg / mL MPLA (3D-PHAD®), and (v) 0.40±0.20 mg / ml QS-21, and can be homogeneous or heterogeneous. In some embodiments, the homogeneous or heterogeneous adjuvant formulation of LiNA-2 can be 0.0625× LiNA-2 (0.0625× LiNA-2), 0.125× LiNA-2 (0.125× LiNA-2), 0.25× LiNA-2 (0.25× LiNA-2), 0.5× LiNA-2 (0.5× LiNA-2), 1× LiNA-2 (1× LiNA-2), 2× LiNA-2 (2× LiNA-2), 3× LiNA-2 (3× LiNA-2), or 4× LiNA-2 (4× LiNA-2).
[0349] In some embodiments, the liposomal adjuvant is CAF09 (see Korsholm et al., Induction of CD8+ T-cell responses against subunit antigens by the novel cationic liposomal CAF09 adjuvant, Vaccine, Vol. 32, No. 31, 2014, pp. 3927-3935). In some embodiments, the liposomal adjuvant CAF09 comprises dimethyldioctadecylammonium (DDA), monomycoloyl glycerol (MMG)-1, and polyinosinic-polycytidylic acid (poly I:C).
[0350] Phosphatidylcholine phospholipid (PC) / phosphatidylglycerol phospholipid (PG): In one embodiment in which the adjuvant comprises a liposome, the liposome comprises a phosphatidylcholine phospholipid (PC). In some embodiments, the PC is selected from the group consisting of dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), and distearyl phosphatidylcholine (DSPC). In one embodiment in which the adjuvant comprises a liposome, the liposome comprises a phosphatidylglycerol phospholipid (PG). In some embodiments, the PG is selected from the group consisting of dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl phosphatidylglycerol (DPPG), and distearyl phosphatidylglycerol (DSPG). In a further embodiment, the adjuvant comprises a combination of: (i) a phosphatidylcholine phospholipid (PC) selected from the group consisting of dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC) and distearylphosphatidylcholine (DSPC), and (ii) a phosphatidylglycerol phospholipid (PG) selected from the group consisting of dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG) and distearylphosphatidylglycerol (DSPG). In some embodiments, the adjuvant liposomal composition has a PC to PG ratio (mol / mol) of about 0.5:1, about 1:1, about 2:1, about 3:1, about 4:1, about 5:1, about 6:1, about 7:1, about 8:1, about 9:1, about 10:1, about 11:1, about 12:1, about 13:1, about 14:1, or about 15:1. In certain embodiments, the adjuvant liposomal composition comprises PC and PG, with a PC to PG molar ratio (mol / mol) of about 9:1, wherein PC is dimyristoylphosphatidylcholine (DMPC) and PG is dimyristoylphosphatidylglycerol (DMPG).
[0351] Cholesterol: In some embodiments in which the adjuvant comprises liposomes, the liposomes of the adjuvant comprise cholesterol. In one embodiment, the liposome composition of the adjuvant formulation comprises cholesterol at a molar percent concentration of greater than 50% (mol / mol), e.g., about 55% (mol / mol) to about 71% (mol / mol). In a specific embodiment, the adjuvant comprises liposomes comprising about 55% (mol / mol) cholesterol.
[0352] Cholesterol and Phospholipid: In some embodiments in which the adjuvant comprises liposomes, the liposomes of the adjuvant comprise cholesterol and phospholipids. In some embodiments, the molar ratio of cholesterol (b) to phospholipid (a) is about 55:45 to about 71:29. In one embodiment, the molar ratio of cholesterol (b) to phospholipid (a) is about 55:50, about 55:45, about 55:40, about 55:35, or about 55:30. In a specific embodiment, the molar ratio of cholesterol (b) to phospholipid (a) is about 55:45.
[0353] Vesicle species: In some embodiments in which the adjuvant comprises liposomes, the liposomes comprise multilamellar vesicles (MLVs) or small unilamellar vesicles (SUVs), where small unilamellar vesicles are about 50 to about 100 nm in diameter and multilamellar vesicles are about 1 to about 4 μm in diameter.
[0354] MPLA: In another embodiment, where the adjuvant comprises liposomes, the liposome composition comprises lipid A. In another embodiment, where the adjuvant comprises liposomes, the liposome composition comprises monophosphoryl lipid A (MPLA). In one embodiment, the liposome composition comprises pentaacylated MPLA (P-MPLA). In another embodiment, the liposome composition comprises monophosphoryl lipid A phosphorylated hexaacyldisaccharide (PHAD®). In a specific embodiment, the MPLA is monophosphoryl 3-deacyl lipid A phosphorylated hexaacyldisaccharide (3D-PHAD®). In one embodiment, the liposome composition is about 5 mg or less, about 4 mg or less, about 3 mg or less, about 2 mg or less, about 1 mg or less, about 0.9 mg or less, about 0.8 mg or less, about 0.7 mg or less, about 0.6 mg or less, about 0.5 mg or less, about 0.4 mg or less, about 0.3 mg or less, about 0.2 mg or less, about 0.1 mg or less or less, about 0.09 mg or less, about 0.08 mg or less, about 0.07 mg or less, about 0.06 mg or less, about 0.05 mg or less, about 0.04 mg or less, about 0.03 mg or less, about 0.02 mg or less, or about 0.01 mg or less of MPLA, PHAD®, or 3D-PHAD®, etc. (total weight per ml of liposome suspension).
[0355] MPLA and Phospholipid: In one embodiment, the adjuvant comprises liposomes, the liposomes comprise MPLA and phospholipids. In another embodiment, the adjuvant comprises liposomes, the liposomes comprise PHAD® or 3D-PHAD® and phospholipids. In one embodiment, the liposome composition of the adjuvant has an MPLA:phospholipid molar ratio of about 1:5.6 to about 1:880, or about 1:88 to about 1:220. In one embodiment, the liposome composition of the adjuvant has an MPLA:phospholipid molar ratio of about 1:220, about 1:88, or about 1:5.6, particularly 1:88, and comprises PC and PG, where PC is dimyristoylphosphatidylcholine (DMPC) and PG is dimyristoylphosphatidylglycerol (DMPG). In one embodiment, the liposome composition of the adjuvant comprises DMPC, DMPG, and 3D-PHAD® and has a 3D-PHAD®:phospholipid molar ratio of between about 1:5 and about 1:6, e.g., 1:5.6. In one embodiment, the liposome composition of the adjuvant comprises DMPC, DMPG, and 3D-PHAD® and has a 3D-PHAD®:phospholipid molar ratio of between about 1:200 and about 1:240, e.g., 1:220. In another embodiment, the liposome composition of the adjuvant comprises DMPC, DMPG, and 3D-PHAD® and has a 3D-PHAD®:phospholipid molar ratio of between about 1:80 and about 1:95. In another specific embodiment, the liposome composition of the adjuvant formulation comprises DMPC, DMPG, and 3D-PHAD® and has a 3D-PHAD®:phospholipid molar ratio of about 1:88.
[0356] Saponin: In another embodiment, the adjuvant comprises a liposome comprising a saponin. In some embodiments, the saponin is Quil A, a derivative thereof, or any purified component thereof (e.g., QS-7, QS-18, QS-21, or a mixture thereof). In certain embodiments, the adjuvant comprises a liposome comprising QS-21. In some embodiments, the adjuvant formulation has a saponin content of about 1 mg or less, about 0.9 mg or less, about 0.8 mg or less, about 0.7 mg or less, about 0.6 mg or less, about 0.5 mg or less, about 0.4 mg or less, about 0.3 mg or less, about 0.2 mg or less, about 0.1 mg or less, about 0.09 mg or less, about 0.08 mg or less, about 0.07 mg or less, about 0.06 mg or less, about 0.05 mg or less, about 0.04 mg or less, about 0.03 mg or less, about 0.02 mg or less, or about 0.01 mg or less (total weight per ml of liposome suspension). In certain embodiments, the adjuvant formulation contains a saponin content of about 0.15-0.4 mg / ml.
[0357] MPLA and saponin: In another embodiment, the adjuvant comprises a liposome, the adjuvant comprises an MPLA-containing liposome composition and at least one saponin (e.g., QS-21). In another embodiment, the adjuvant comprises a monophosphoryl lipid A (MPLA)-containing liposome composition and at least one saponin, the liposome composition comprising i) a lipid bilayer comprising phospholipid...
Claims
1. (i) at least 21 different glycoconjugates; (ii) a succinate or histidine buffer having a pH in the range of 5.0 to 7.5; (iii) calcium chloride, sodium chloride, calcium chloride and / or sodium phosphate; (iv) a surfactant; and (v) adjuvant A formulation comprising:
2. (i) at least 21 different glycoconjugates; (ii) a succinate buffer having a pH in the range of 5.0 to 7.5; (iii) calcium chloride; (iv) sodium chloride; (v) a surfactant; and (vi) adjuvant A formulation comprising:
3. (i) at least 21 different glycoconjugates; (ii) a succinate buffer having a pH in the range of 5.0 to 7.5; (iii) sodium chloride; (iv) sodium phosphate (iv) a surfactant; and (v) adjuvant A formulation comprising:
4. (i) at least 21 different glycoconjugates; (ii) a histidine buffer having a pH in the range of 5.0 to 7.5; (iii) sodium chloride; (iv) a surfactant; and (v) adjuvant A formulation comprising:
5. 5. The formulation of claim 1, comprising 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 different glycoconjugates.
6. 6. The formulation of claim 1, comprising 24 different glycoproteins.
7. 7. The formulation of claim 1, comprising 25 different glycoproteins.
8. 8. The formulation of claim 1, wherein the glycoconjugate is a pneumococcal polysaccharide glycoconjugate.
9. 9. The formulation of any of claims 1 to 8, wherein the glycoconjugate comprises at least one glycoconjugate derived from a S. pneumoniae serotype selected from the group consisting of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof.
10. The glycoconjugate is a diphtheria cross-reactive material (CRM) 197 10. The formulation of claim 1, comprising diphtheria toxin (DT), tetanus toxoid (TT), sterol carrier protein (SCP), H. influenzae protein D (PD) or resavidin (CP1).
11. 11. The formulation of claim 1, wherein the at least 21 glycoconjugates include at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F.
12. The Streptococcus pneumoniae (S. pneumoniae) serotype is CRM 197 The formulation of claim 11 , wherein the compound is conjugated to
13. 12. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 5, and 7F.
14. 14. The formulation of claim 13, wherein S. pneumoniae serotypes 1, 4, 5, 7F, 9V and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.
15. 12. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A.
16. The Streptococcus pneumoniae (S. pneumoniae) serotype is CRM 197 The formulation of claim 15, wherein the compound is conjugated to
17. 12. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F, and 33F.
18. The Streptococcus pneumoniae (S. pneumoniae) serotype is CRM 197 18. The formulation of claim 17, wherein the
19. 12. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F.
20. The Streptococcus pneumoniae (S. pneumoniae) serotype is CRM 197 20. The formulation of claim 19, wherein the
21. 12. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.
22. 12. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.
23. The Streptococcus pneumoniae (S. pneumoniae) serotype is CRM 197 23. The formulation of claim 22, wherein the
24. 12. The formulation of claim 11, wherein the at least 25 glycoconjugates further comprise glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B.
25. The Streptococcus pneumoniae (S. pneumoniae) serotype is CRM 197 25. The formulation of claim 24, wherein the formulation is conjugated to
26. CRMs include S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B. 197 and S. pneumoniae serotype 3 is conjugated to an SCP.
27. 12. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F.
28. 28. The formulation of claim 27, wherein at least two of the S. pneumoniae serotypes are conjugated to TT.
29. 29. The formulation of claim 28, wherein the at least two S. pneumoniae serotypes conjugated to TT are selected from the group consisting of S. pneumoniae serotypes 1, 3, 5, 15B and 22F.
30. At least 17 of the S. pneumoniae serotypes are CRM 197 29. The formulation of claim 28, wherein the
31. CRM 197 29. The formulation of claim 28, wherein the at least 17 S. pneumoniae serotypes conjugated to said antibody are selected from the group consisting of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
32. The pneumococcal glycoconjugate is a CRM 197 S. pneumoniae serotype 1 conjugated to CRM 197 S. pneumoniae serotype 3 conjugated to CRM 197 S. pneumoniae serotype 4 conjugated to CRM 197 S. pneumoniae serotype 5 conjugated to CRM 197 S. pneumoniae serotype 6A conjugated to CRM 197 S. pneumoniae serotype 6B conjugated to CRM 197 S. pneumoniae serotype 7F conjugated to CRM 197 S. pneumoniae serotype 8 conjugated to CRM 197 S. pneumoniae serotype 9V conjugated to CRM 197 S. pneumoniae serotype 10A conjugated to CRM 197 S. pneumoniae serotype 11A conjugated to CRM 197 S. pneumoniae serotype 12F conjugated to CRM 197 S. pneumoniae serotype 14 conjugated to CRM 197 S. pneumoniae serotype 15A conjugated to CRM 197 S. pneumoniae serotype 15B conjugated to CRM 197 S. pneumoniae serotype 18C conjugated to CRM 197 S. pneumoniae serotype 19A conjugated to CRM 197 S. pneumoniae serotype 19F conjugated to CRM 197 S. pneumoniae serotype 22F conjugated to CRM 197 S. pneumoniae serotype 23A conjugated to CRM 197 S. pneumoniae serotype 23B conjugated to CRM 197 S. pneumoniae serotype 23F conjugated to CRM 197 S. pneumoniae serotype 24F conjugated to CRM 197 S. pneumoniae serotype 33F conjugated to CRM 197 11. The formulation of claim 1, wherein the glycoconjugate is selected from the group consisting of glycoconjugates derived from S. pneumoniae serotype 35B conjugated to Streptococcus pneumoniae (S. pneumoniae) serotype 35B and combinations thereof.
33. 33. The formulation of any of claims 1 to 32, wherein the total glycoconjugate concentration is in the range of 1 to 100 μg.
34. 34. The formulation of any of claims 1 to 33, wherein the concentration of each polysaccharide-protein conjugate is in the range of 1 to 10 μg.
35. 34. The formulation of any of claims 1 to 33, wherein the buffer has a concentration in the range of 1 to 50 mM.
36. 33. The formulation of any of claims 1 to 32, wherein the sodium chloride has a concentration of 1 to 300 mM.
37. 37. The formulation of any of claims 1-2 and 5-36, wherein the calcium chloride has a concentration of 1-50 mM.
38. 38. The formulation of any of claims 1 to 3 and 5 to 37, wherein the sodium phosphate has a concentration of 1 to 50 mM.
39. 37. The formulation of any of claims 1 to 36, wherein the surfactant is a polysorbate or poloxamer having a molecular weight in the range of 1100 Da to 17,400 Da.
40. 40. The formulation of any of claims 1 to 39, wherein the surfactant is polysorbate 80.
41. 41. A formulation according to any preceding claim, wherein the concentration of the surfactant is in the range of 0.001% to 1%.
42. 42. The formulation of any of claims 1 to 41, wherein the adjuvant is aluminum phosphate.
43. 43. The formulation of any preceding claim, wherein the concentration of the adjuvant is in the range of 0.01% to 0.1%.
44. 10. The formulation of claim 1 comprising 25 glycoconjugates, 5 mM succinate pH 5.8, 150 mM sodium chloride, 20 mM calcium chloride, 0.02% polysorbate 80 and 0.25 mg / ml aluminum phosphate.
45. 10. The formulation of claim 1 comprising 25 glycoconjugates, 5 mM succinate pH 5.8, 40 mM sodium phosphate, 245 mM sodium chloride, 0.02% polysorbate 80 and 0.25 mg / ml aluminum phosphate.
46. 10. The formulation of claim 1 comprising 25 glycoconjugates, 25 mM histidine pH 5.8, 245 mM sodium chloride, 0.02% polysorbate 80 and 0.25 mg / ml aluminum phosphate.
47. 47. The formulation of any of claims 44-46, wherein the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof.
48. 1. A composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, Time T 0 wherein substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase as a fully dispersed liquid suspension or are adsorbed to the insoluble aluminum adjuvant, and the at least 25 different glycoconjugates are present in the liquid phase at a concentration C 0 and Time T 1 a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the at least 25 different glycoconjugates are present in the liquid phase at a concentration C 1 and Time T 2 and a further portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the at least 25 different glycoconjugates are present in the liquid phase at a concentration C 2 and 1. A composition wherein sedimentation velocity is measured over time via static multiple light scattering to detect particle movement within said liquid, the measurement head comprising a pulsed near-infrared light source at a wavelength of approximately 880 nm with synchronous transmission at 180° from a source-detector and backscattering at 45° from the source-detector that moves along the height of a flat-bottom cylindrical glass sample cell, collecting sediment data every 20 μm.
49. T 0 49. The composition of claim 48, wherein is 0 hours.
50. T 1 49. The composition of claim 48, wherein the time is from about 0.01 hours to 4 hours.
51. T 1 51. The composition of claim 50, wherein the heating time is from about 1 hour to 2 hours.
52. T 2 49. The composition of claim 48, wherein the heating time is from about 1 hour to about 5 hours.
53. T 2 is about 4 hours.
54. C 0 But C 1 and C 2 49. The composition of claim 48, wherein the
55. C 1 But C 2 49. The composition of claim 48, wherein the
56. T 1 49. The composition of claim 48, wherein the peak thickness of the settling front is between about 0 mm and 20 mm.
57. T 1 57. The composition of claim 56, wherein the peak thickness of the settling front is at least 2 mm.
58. T 2 49. The composition of claim 48, wherein the peak thickness of the settling front is between about 2 mm and 25 mm.
59. T 2 59. The composition of claim 58, wherein the peak thickness of the settling front is at least 10 mm.
60. 49. The composition of claim 48, wherein the settling velocity of the settling front is less than 10 mm peak thickness in about 1 hour and greater than 18 mm peak thickness in about 4 hours.
61. The precipitation of the insoluble aluminum phosphate-adsorbed glycoconjugates is 3 At time T 3 49. The composition of claim 48, further comprising:
62. T 3 62. The composition of claim 61, wherein the heating time is from about 2 hours to about 5 hours.
63. T 3 62. The composition of claim 61, wherein the peak thickness of the subsidence front is about 25 mm to 35 mm.
64. 49. The composition of claim 48, which has been left undisturbed for about one month.
65. 49. The composition of claim 48, which has been left undisturbed for at least two weeks.
66. 49. The composition of claim 48 stored in a container.
67. 67. The composition of claim 66, wherein the container is a syringe.
68. T 3 62. The composition of claim 61, wherein the composition is resuspended by shaking hands 1 to 10 times.
69. T 3 69. The composition of claim 68, wherein the composition is resuspended with a single handshake after the first step.
70. 49. The composition of claim 48, comprising a formulation according to any one of claims 1 to 47.
71. 1. A liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, Time T 0 wherein substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase as a fully dispersed liquid suspension or are adsorbed to the insoluble aluminum adjuvant, and the at least 25 different glycoconjugates are present in the liquid phase at a concentration C 0 and Time T 1 a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the at least 25 different glycoconjugates are present in the liquid phase at a concentration C 1 having Time T 2 and a further portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the at least 25 different glycoconjugates are present in the liquid phase at a concentration C 2 and A vessel in which sedimentation velocity is measured over time via static multiple light scattering to detect particle movement within the liquid, the measurement head comprising a pulsed near-infrared light source at a wavelength of approximately 880 nm with synchronous transmission at 180° from a source-detector and backscattering at 45° from the source-detector that moves along the height of a flat-bottomed cylindrical glass sample cell, collecting sediment data every 20 μm.
72. T 0 72. The container of claim 71, wherein is 0 hours.
73. T 1 72. The container of claim 71, wherein the heating time is from about 0.01 hours to 4 hours.
74. T 1 74. The container of claim 73, wherein the heating time is about 1 hour to 2 hours.
75. T 2 72. The container of claim 71, wherein the heating time is about 1 hour to 5 hours.
76. T 2 76. The container of claim 75, wherein the time is about 4 hours.
77. C 0 But C 1 and C 2 72. The container of claim 71, wherein the
78. C 1 But C 2 72. The container of claim 71, wherein the
79. T 1 72. The vessel of claim 71, wherein the peak thickness of the settling front is between about 0 mm and 20 mm.
80. T 1 80. The container of claim 79, wherein the peak thickness of the subsidence front is at least 2 mm.
81. T 2 72. The container of claim 71, wherein the peak thickness of the settling front is between about 2 mm and 25 mm.
82. T 2 82. The vessel of claim 81, wherein the peak thickness of the settling front is at least 10 mm.
83. 72. The container of claim 71, wherein the settling rate of the settling front is less than 10 mm peak thickness in about 1 hour and greater than 18 mm peak thickness in about 4 hours.
84. The precipitation of the insoluble aluminum phosphate-adsorbed glycoconjugates is 3 At time T 3 72. The container of claim 71, further comprising:
85. T 3 85. The container of claim 84, wherein the heating time is about 2 hours to 5 hours.
86. T 3 86. The vessel of claim 85, wherein the settling front is between about 25 mm and 35 mm.
87. 72. The container of claim 71, which has been left undisturbed for about one month.
88. 72. The container of claim 71, which has been left undisturbed for at least two weeks.
89. 89. The container of claim 88, which is a syringe.
90. T 3 85. The container of claim 84, wherein after the step of (a), the composition is resuspended with 1 to 10 handshakes.
91. T 3 91. The container of claim 90, wherein after step a, the composition is resuspended with a single handshake.
92. 72. The container of claim 71, wherein the liquid comprises a formulation according to any one of claims 1 to 47.
93. 1. A composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, Time T 0 wherein substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase as a fully dispersed liquid suspension or are adsorbed to the insoluble aluminum adjuvant, and the at least 25 different glycoconjugates are present in the liquid phase at a concentration C 0 and Time T 1 a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the at least 25 different glycoconjugates are present in the liquid phase at a concentration C 1 and Time T 2 and a further portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the at least 25 different glycoconjugates are present in the liquid phase at a concentration C 2 and 1. A composition wherein sedimentation velocity is measured over time via static multiple light scattering to detect particle movement within said liquid, the measurement head comprising a pulsed near-infrared light source at a wavelength of approximately 880 nm with synchronous transmission at 180° from a source-detector and backscattering at 45° from the source-detector that moves along the height of a flat-bottom cylindrical glass sample cell, collecting sediment data every 20 μm.
94. T 0 94. The composition of claim 93, wherein is 0 hours.
95. T 1 is about 0.01 hours to 4 hours after the sample has reached 45% clarification at the meniscus.
96. T 1 is about 1 hour to 2 hours after the sample has reached 45% clarity at the meniscus.
97. T 2 is about 1 hour to 5 hours after the sample has reached 45% clarity at the meniscus.
98. T 2 is about 4 hours after the sample has reached 45% clarity at the meniscus.
99. C 0 But C 1 and C 2 99. The composition of any one of claims 93 to 98, wherein the
100. C 1 But C 2 99. The composition of any one of claims 93 to 98, wherein the
101. T 1 and the peak thickness of the settling front is from about 0 mm to 20 mm.
102. T 1 102. The composition of claim 101, wherein the peak thickness of the settling front is at least 2 mm.
103. T 2 and the peak thickness of the settling front is between about 2 mm and 25 mm.
104. T 2 104. The composition of claim 103, wherein the peak thickness of the settling front is at least 10 mm.
105. 104. The composition of claim 103, wherein the settling velocity of the settling front is less than 10 mm peak thickness in about 1 hour and greater than 18 mm peak thickness in about 4 hours.
106. The precipitation of the insoluble aluminum phosphate-adsorbed glycoconjugates is 3 At time T 3 106. The composition of any one of claims 93 to 105, further comprising:
107. T 3 is about 2 to 5 hours after the sample has reached 45% clarity at the meniscus.
108. T 3 and the peak thickness of the settling front is between about 25 mm and 35 mm.
109. 109. The composition of any one of claims 93 to 108, which has been left undisturbed for about one month.
110. 109. The composition of any one of claims 93 to 108, which has been left to stand for at least two weeks.
111. 111. The composition of any one of claims 93 to 110, stored in a container.
112. 112. The composition of claim 111, wherein the container is a syringe.
113. T 3 and then resuspended with 1 to 10 handshakes.
114. T 3 114. The composition of claim 113, wherein the composition is resuspended with a single handshake after the first step.
115. 115. A composition according to any one of claims 93 to 114, comprising a formulation according to any one of claims 1 to 47.
116. 48. The formulation of any one of claims 1 to 47, further comprising a liposomal adjuvant.
117. A liposomal adjuvant for use in resuspending components of an immunogenic composition, wherein the components in suspension in said immunogenic composition settle over time.
118. 118. The adjuvant of claim 117, wherein the immunogenic composition comprises a formulation of any one of claims 1 to 47.
119. 119. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises MPLA and saponin.
120. 119. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises MPLA, dioleoylphosphatidylcholine (DOPC), cholesterol and QS-21.
121. 119. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises LiNA-1.
122. 119. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises monophosphoryl 3-deacyl lipid A phosphorylated hexaacyldisaccharide (3D-PHAD®) and a saponin.
123. 119. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises 3D-PHAD®, QS-21, 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dimyristoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DMPG) and cholesterol.
124. 119. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises LiNA-2.
125. 119. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant is 0.0625x LiNA-2, 0.125x LiNA-2, 0.25x LiNA-2, 0.5x LiNA-2, 1x LiNA-2 or 2x LiNA-2.
126. 126. The adjuvant of any one of claims 117 to 125, wherein the immunogenic composition is stored in a syringe.
127. 127. The adjuvant of any one of claims 117 to 126, wherein at time TO, substantially all of the components in the immunogenic composition are in suspension, substantially all of the components in the immunogenic composition are completely dispersed, and / or the immunogenic composition is substantially completely homogenous.
128. 128. The adjuvant of claim 127, wherein the composition comprises aluminum.
129. 129. The adjuvant of claim 127 or 128, wherein at time T1, at least about 80%, about 85%, about 90% or about 95% of the components in the immunogenic composition have settled out of suspension.
130. 130. The adjuvant of claim 129, wherein T1 is between about 1 day and about 30 days, or longer.
131. 130. The adjuvant of claim 129, wherein T1 is about 2 days and the adjuvant reduces the number of handshakes required to resuspend the immunogenic composition at T1 by between about 20 and about 30 handshakes, or more, compared to the composition without the adjuvant.
132. 130. The adjuvant of claim 129, wherein T1 is about 7 days and the adjuvant reduces the number of handshakes required to resuspend the immunogenic composition at T1 by between about 2 and about 45 handshakes, or more, compared to the composition without the adjuvant.
133. 130. The adjuvant of claim 129, wherein T1 is about 7 days, the adjuvant is LiNA-1, and the adjuvant reduces the number of handshakes required to resuspend the immunogenic composition at T1 by about 3 or about 4 handshakes.
134. 130. The adjuvant of claim 129, wherein T1 is about 7 days, the adjuvant is LiNA-2B, and the adjuvant reduces the number of handshakes required to resuspend the immunogenic composition at T1 by between about 6 and about 8 handshakes.
135. 130. The adjuvant of claim 129, wherein T1 is about 7 days, the adjuvant is LiNA-2A, and the adjuvant reduces the number of handshakes required to resuspend the immunogenic composition at T1 by between about 41 and about 43 handshakes.
136. 130. The adjuvant of claim 129, wherein T1 is about 30 days and the adjuvant reduces the number of handshakes required to resuspend the immunogenic composition at T1 by between about 15 and about 70 handshakes, or more, compared to the composition without the adjuvant.
137. 130. The adjuvant of claim 129, wherein T1 is about 30 days, the adjuvant is LiNA-1, and the adjuvant reduces the number of handshakes required to resuspend the immunogenic composition at T1 by about 19 or about 20 handshakes.
138. 130. The adjuvant of claim 129, wherein T1 is about 30 days, the adjuvant is LiNA-2B, and the adjuvant reduces the number of handshakes required to resuspend the immunogenic composition at T1 by between about 27 and about 29 handshakes.
139. 130. The adjuvant of claim 129, wherein T1 is about 30 days, the adjuvant is LiNA-2A, and the adjuvant reduces the number of handshakes required to resuspend the immunogenic composition at T1 by about 64 or about 65 handshakes.
140. 140. The adjuvant of any one of claims 117 to 139, wherein the resuspended immunogenic composition appears homogenous, completely dispersed, and / or uniform in color.
141. 141. The adjuvant of any one of claims 117 to 140, wherein the immunogenic composition comprises a bacterial or viral immunogen.
142. 142. The adjuvant of claim 141, wherein the immunogen is selected from the group consisting of a protein, a nucleic acid, and a saccharide.
143. 142. The adjuvant of claim 141, wherein the immunogen is a glycoconjugate and the immunogenic composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 different glycoconjugates.
144. 144. The adjuvant of claim 143, wherein the glycoconjugate is a pneumococcal polysaccharide glycoconjugate.
145. 145. The adjuvant of claim 144, wherein the glycoconjugate comprises at least one glycoconjugate selected from the group consisting of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof.
146. 145. The adjuvant of claim 144, wherein the glycoconjugate comprises each of the following S. pneumoniae serotypes: 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B.