Recombinant Marek's disease virus and uses thereof
The integration of a beta-globin 3' hypersensitive site 1 insulator in rMDVs enhances antigen expression and stability, addressing the challenge of stable foreign antigen delivery in rMDVs, resulting in efficient immune protection and early onset immunity in avian species.
Patent Information
- Application Number
- JP2025528403
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-18
- Filing Date
- 2023-11-17
- Publication Date
- 2026-03-12
AI Technical Summary
Existing recombinant Marek's disease viruses (rMDVs) face challenges in stabilizing the expression of foreign antigens, which affects their ability to confer effective protective immunity against avian pathogens.
Development of rMDVs with an insulator element, such as the beta-globin 3' hypersensitive site 1 (3'HS1) insulator containing a CTCF motif, integrated upstream of a promoter to enhance the expression and stability of foreign genes, allowing for robust antigen production and immune protection.
The rMDVs exhibit stable and strong expression of foreign antigens, leading to efficient immune response and early onset of immunity in avian species, maintaining vaccine stability and efficacy over time.
Smart Images

Figure 2026508736000007 
Figure 2026508736000008 
Figure 2026508736000009
Abstract
Description
[Technical Field]
[0001] The present invention relates to novel recombinant Marek's disease viruses (rMDVs) capable of improving the expression of foreign antigens, and uses thereof. More specifically, the present invention relates to novel rMDVs containing at least one foreign gene, the expression of which is regulated by an insulator element. The present invention further relates to the use of such rMDVs to induce protective immunity against avian pathogens or diseases. [Background technology]
[0002] Poultry meat and eggs are important food sources, and their consumption is constantly increasing due to the growth of the human population and their great quality-price ratio. In order to ensure the health of poultry and food safety and security, poultry vaccine technology has become a global concern.
[0003] Viral vectors expressing pathogen proteins are commonly used as poultry vaccines against target pathogens. Vaccines containing such viral vectors induce the expression of foreign pathogen proteins in infected hosts, which can confer protective immunity.
[0004] Many different classes of viruses have been investigated as candidate vectors for avian vaccination, including adenovirus, AAV, fowlpox virus, avian herpesvirus, etc. In particular, serotypes 1, 2, and 3 of Marek's disease virus (MDV) (also known as herpesvirus of turkey (HVT)) have been used as recombinant vectors to express antigens from various avian pathogens.
[0005] The most common problem encountered with recombinant viruses is the stability of the foreign antigen within the vector and the level of expression of that antigen to confer protective immunity against the corresponding pathogen. Thus, there remains a need for vectors, particularly MDV vectors, that can efficiently and stably express foreign genes and thereby protect avian species against pathogens. Summary of the Invention
[0006] By working to improve vectors suitable for avian vaccination, the present inventors have developed a novel rMDV for the insertion and expression of one or more foreign genes for use as an efficient immune vehicle for protection against various avian pathogens. More specifically, the present inventors have developed a recombinant Marek's disease virus in which at least one foreign gene is associated with a specific insulator suitable for positively influencing gene expression (i.e., improving stability and / or expression level) of the associated foreign gene. More specifically, the present inventors have developed an insulator derived from the beta-globin 3' hypersensitive site 1 (3'HS1) and containing a CTCF motif. An expression cassette containing the insulator associated with a recombinant nucleotide sequence encoding an antigen can be stably introduced into the insertion site of the rMDV, enabling the production of significant amounts of the corresponding foreign antigen and the induction of protective immunity against the corresponding avian pathogen. The rMDV of the present invention is particularly suitable for use in vaccine compositions for immunizing birds, such as poultry, against one or more avian pathogens.
[0007] Therefore, an object of the present invention is to provide a recombinant Marek's disease virus (rMDV) comprising a recombinant nucleotide sequence encoding an antigen inserted into an insertion site and operably linked to a promoter and an insulator, wherein the insulator is located upstream of the promoter.
[0008] Monovalent and polyvalent rMDVs can be developed in which at least one foreign gene is associated with an insulator.
[0009] In particular, the present invention provides an rMDV comprising a first recombinant nucleotide sequence encoding a first antigen inserted into a first insertion site and a second recombinant nucleotide sequence encoding a second antigen inserted into a second insertion site different from the first insertion site, wherein the first recombinant nucleotide sequence encoding the antigen is operably linked to a promoter and an insulator located upstream of the promoter, and the second recombinant nucleotide sequence is operably linked to the promoter. In such a construct, the second recombinant nucleotide sequence is not associated with an insulator.
[0010] Therefore, it is an object of the present invention to provide a polyvalent rMDV in which a single foreign gene is associated with an insulator located upstream of a promoter that drives expression of the foreign gene.
[0011] The present invention further relates to nucleic acid molecules comprising, consisting essentially of or consisting of the genome of a recombinant MDV as defined above, and to vectors (such as plasmids) containing such nucleic acids.
[0012] The present invention further relates to a host cell comprising a recombinant MDV or a nucleic acid or vector as defined above.
[0013] The present invention further relates to a method for producing or replicating a recombinant MDV as defined above, which comprises infecting a competent host cell with a recombinant MDV or nucleic acid molecule as defined above, and harvesting the rMDV.
[0014] A further object of the present invention is a composition, such as a vaccine composition, comprising a recombinant MDV, a nucleic acid and / or a host cell as defined above, and optionally a suitable excipient and / or adjuvant.
[0015] A further object of the present invention is a recombinant MDV, nucleic acid, host cell, composition or vaccine as defined above for use in vaccinating birds, such as poultry, against at least one avian pathogen and / or related disease.
[0016] A further object of the present invention is a recombinant MDV, nucleic acid, host cell, composition or vaccine as defined above for use in inducing early onset immunity in birds, such as poultry, against at least one avian pathogen.
[0017] A further object of the present invention is a recombinant MDV, nucleic acid, host cell, composition or vaccine as defined above for use in inducing protective immunity in birds, such as poultry, against at least one avian pathogen.
[0018] A further object of the present invention is a method for vaccinating avian species, comprising administering to said species a recombinant MDV, vaccine or composition as defined above.
[0019] The present invention further provides a vaccination kit for immunizing birds, such as poultry, against an avian pathogen, comprising the following components: a. an effective amount of a vaccine as defined above, and b. Means for administering the vaccine to the bird.
[0020] The present invention may be used with any bird, particularly poultry such as chickens. [Brief explanation of the drawings]
[0021] [Figure 1(a)] 1 shows the genomic structures of recombinant HVT / IBD according to the prior art (FW169; FW260) and embodiments of the present invention (FW285; FW311). [Figure 1(b)] A diagram of the recombinant HVT / IBD (FW285) genome is shown, showing the portion amplified in the PCR reaction to confirm the genome structure of the virus. [Figure 1(c)]Figure 1 shows the results of PCR analysis of FW285, confirming the expression of IBDV VP2 protein. FW285 was harvested after virus purification and sampled for PCR analysis. M: BioMarker™ 10Kb (BioVentures, Inc., #M10KB), NC: FC126 (negative control), and PC: homology plasmid (positive control). [Figure 2(a)] Western blotting analysis showing the expression of VP2 protein in CEF cells infected with FW285, FW181, or FW169. Three days after infection of CEF with each recombinant HVT at an MOI of 0.1, each sample was harvested and subjected to SDS-PAGE followed by Western blot analysis. To detect VP2 protein, anti-VP2 mouse mAb R63 was used as the primary antibody in Western blots. As shown in Figure 3(a), a protein band of 40 kilodaltons (kDa), the expected size of VP2 protein, was observed in the lanes containing FW285 and FW169. [Figure 2(b)] The relative density of the band from the VP2 protein in the Western blot assay measured for FW169 in Figure 3a is visualized and shown as a bar graph. This quantification was performed by ImageD. The results demonstrate that FW285 exhibits better expression of the VP2 protein compared to FW169. [Figure 3] Figure 1 shows the mean anti-IBDV VP2 antibody titers in blood samples from SPF chickens vaccinated with recombinant HVT / IBD (FW169 or FW285) using a commercially available IBD ELISA kit. NIC: non-infected control. The results also show an earlier onset of immunity and stronger immunity in FW285 (week 2) compared with FW169 (week 3). [Figure 4(a)] A diagram of the recombinant HVT / IBD-LT (FW311) genome is shown, indicating the regions amplified in PCR reactions to confirm the viral genome structure. [Figure 4(b)] shows the results of PCR analysis of FW311. FW311 was harvested after virus purification and sampled for PCR analysis. NC: negative control and PC: positive control. [Figure 4(c)] Western blotting analysis shows the expression of VP2 protein in CEF cells infected with FW260, FW311, FW181, or FW169. Three days after infection of CEF with each recombinant HVT at an MOI of 0.1, each sample was harvested and subjected to SDS-PAGE followed by Western blot analysis. To detect VP2 protein, anti-VP2 mouse mAb R63 was used as the primary antibody in Western blots. As shown in Figure 3(a), a protein band of 40 kilodaltons (kDa), the expected size of VP2 protein, was observed for FW260, FW311, and FW169. [Figure 5] The relative density of the band from the VP2 protein in the Western blot assay measured against the vaccine control, FW169, is visualized in Figure 4(c) and shown as a bar graph. Quantification was performed using ImageJ. The results demonstrate that FW311 exhibits better expression of the VP2 protein compared to both FW169 and FW260. [Figure 6] Figure 1 shows the mean anti-IBDV VP2 antibody titers in blood samples from SPF chickens vaccinated with a bivalent recombinant HVT / IBD-LT (FW311) according to an embodiment of the present invention compared to FW169 and FW260 using a commercially available IBD ELISA kit. NIC: non-infected control. [Figure 7] The genomic structure of a recombinant bivalent HVT / IBD-LT (FW313) according to a further embodiment of the present invention is shown in comparison with the genomic structures of negative and positive control recombinant HVT / LT (FW181; FW261). [Figure 8(a)]Figure 1 shows Western blotting analysis showing the expression of VP2 protein in CEF cells infected with FW313, FW261, or FW181. Three days after infection of CEF with each recombinant HVT at an MOI of 0.1, each sample was harvested and subjected to SDS-PAGE followed by Western blot analysis. To detect VP2 protein, anti-VP2 mouse mAb R63 was used as the primary antibody in Western blots. In the lanes containing FW313 and FW261, a protein band of 40 kilodaltons (kDa), the expected size of VP2 protein, was observed. [Figure 8(b)] The relative density of the band from VP2 protein in the Western blot assay is visualized and shown as a bar graph in Figure 8(a). This quantification was performed using ImageJ. The results demonstrate that FW313 exhibits better expression of VP2 protein compared to FW261. [Figure 9] The genome structure of a recombinant HVT / NDV according to a further embodiment of the present invention (FW348) is shown in comparison with the genome structure of a recombinant HVT / NDV lacking an insulator according to FW26. [Figure 10] NDV-F protein expression assessed by black plaques is shown, where the first antibody is anti-NDV-F mouse mAb (#77-2) and the second antibody is biotinylated anti-mouse IgG. [Figure 11] Western blotting analysis showing the expression of NDV-F protein in CEF cells infected with FW348, FW026, or FW169. Three days after infection of CEF with each recombinant HVT at an MOI of 0.01, each sample was harvested and subjected to SDS-PAGE followed by a Western blot assay. To detect NDV-F protein, anti-NDV-F mouse mAb (#77-2) was used as the primary antibody in Western blotting. In the lanes containing FW348 and FW026, a protein band of 60 kilodaltons (kDa) was observed, which is the expected size of NDV-F protein. DETAILED DESCRIPTION OF THE INVENTION
[0022] The present invention generally relates to recombinant Marek's disease viruses containing an expression cassette comprising a recombinant nucleotide sequence operably linked to a promoter and an insulator sequence, their production, compositions containing them, and their uses, particularly for immunizing avian species against avian pathogens. The rMDVs of the present invention are particularly stable, exhibit good in vitro expression of foreign genes, and provide effective immune protection to avian species. Thus, the rMDVs of the present invention are particularly suitable for the generation of effective vaccines. Indeed, the rMDVs of the present invention exhibit strong expression of foreign genes, allowing for efficient onset of immunization (OOI) while maintaining vaccine stability and efficacy over time.
[0023] definition The invention will be best understood by reference to the following definitions. The term "recombinant" in reference to a sequence refers to a sequence, nucleic acid or entity that does not occur in nature and / or that has been manipulated using recombinant DNA techniques (also called genetic or molecular cloning).
[0024] In the context of viruses, the term "recombinant" refers to the genome of a virus that has been altered by the insertion of at least one nucleotide sequence (e.g., DNA such as a gene) that is not naturally found in the genome of that virus, or that is naturally found in the genome of that virus but in a different form or location. It will be understood that recombinant viruses can be produced by a variety of methods, including the recombinant DNA techniques described therein, and that once produced, they can be replicated without further use of recombinant DNA techniques.
[0025] As used herein, the terms "nucleic acid," "nucleic acid sequence," and "nucleotide sequence" refer to a nucleic acid molecule having a determined sequence, which may be deoxyribonucleotides and / or ribonucleotides. A nucleotide sequence may be initially prepared, for example, by recombinant, enzymatic, and / or chemical techniques, and then replicated in a host cell or in vitro system. A nucleotide sequence preferably contains an open reading frame encoding a molecule (e.g., a peptide or protein). A nucleotide sequence may contain additional sequences, such as, for example, a promoter, a transcription terminator, a signal peptide, an IRES, etc.
[0026] As used herein, the terms "polypeptide," "peptide," and "protein" refer to any molecule comprising a polymer of at least 10 consecutive amino acids.
[0027] An "immunogenic fragment" or "antigenic fragment" of a protein, peptide, or antigen refers to any fragment capable of eliciting an immune response, preferably any fragment containing an epitope, preferably an antigen-specific epitope. Immunogenic fragments generally contain 5-50, such as 5-40, or 10-40, or 10-30, 10-25, or 10-20, consecutive amino acid residues of the antigen.
[0028] The term "bird" or "avian species" is intended to encompass birds of the avian class, i.e., all types of birds, including feathered, winged, bipedal, endothermic, and egg-laying vertebrates. In the context of the present invention, birds or avian species refer more specifically to birds of economic and / or agricultural interest, such as poultry (such as chickens and turkeys), waterfowl (such as ducks and geese), and ornamental birds (such as swans and parrots).
[0029] As used herein, the term "vaccine" or "vaccine composition" refers to an agent that can be used to induce, stimulate, or amplify an immune response in an organism.
[0030] The term "multivalent" as used herein with respect to a recombinant virus or vaccine refers to a recombinant virus or vaccine that comprises at least two recombinant nucleotide sequences or antigens; The sequences or antigens may be the same or different and may be derived from the same or different pathogens.
[0031] Recombinant MDV Marek's disease viruses of the present invention include, but are not limited to, serotype 1 Marek's disease viruses, preferably strain CV1988 / Rispens, serotype 2 Marek's disease viruses, preferably strain SB1, and serotype 3 Marek's disease viruses, preferably herpesvirus of turkeys (HVT). Preferred Marek's disease viruses of the present invention are derived from serotypes or strains that are non-pathogenic to the target avian species.
[0032] An object of the present invention is to provide an rMDV comprising a recombinant nucleotide sequence encoding an antigen inserted into an insertion site, wherein the recombinant nucleotide sequence is operably linked to a promoter and an insulator, and the insulator is located upstream of the promoter.
[0033] The presence of an insulator located upstream of a promoter driving the expression of a recombinant nucleotide sequence makes it possible to support the expression of said recombinant nucleotide sequence resulting in strong expression of the corresponding antigen.
[0034] The rMDV of the present invention allows for increased production of antigens compared to the production of the same antigens by rMDV lacking the insulator.
[0035] In certain embodiments, an earlier and / or stronger onset of immunity is observed in birds vaccinated with the rMDV of the present invention, particularly compared to the onset of immunity in birds vaccinated with the same vector lacking such an insulator.
[0036] In the context of the present invention, "onset of immunity (OOI)" refers to the time point, usually described in days or weeks after vaccination, at which active immunity is obtained that allows vaccinated birds to be protected against avian pathogens or diseases. "Early onset of immunity" refers to protection achieved at least 2 days earlier, preferably at least 4 days earlier, 6 days earlier, and more preferably at least 1 week earlier than the OOI achieved with a reference vaccine (e.g., the same vector, same antigen, same insertion site, but lacking the insulator). For example, early OOI with rMDV / ND according to the present invention may correspond to immunity acquired approximately 3 weeks after vaccination, whereas the corresponding reference vaccine requires 4 weeks to induce full protection (Palya V, et al. Vet Immunol Immunopathol. 2014. PMID: 24368086).
[0037] According to the present invention, the rMDV may comprise one or more recombinant nucleotide sequences.
[0038] In a specific embodiment, the rMDV comprises a first recombinant nucleotide sequence encoding a first antigen inserted into a first insertion site and a second recombinant nucleotide sequence encoding a second antigen inserted into a second insertion site different from the first insertion site, wherein the first recombinant nucleotide sequence encoding the antigen is operably linked to a promoter and an insulator located upstream of the promoter, and the second recombinant nucleotide sequence is operably linked to the promoter, i.e., the second recombinant nucleotide sequence is not associated with an insulator.
[0039] The polyvalent rMDV of the present invention allows for efficient and stable expression of both recombinant nucleotide sequences.
[0040] insulator According to the present invention, the rMDV comprises at least one insulator associated with a recombinant nucleotide sequence of interest, said insulator being located upstream of a promoter that drives expression of said recombinant nucleotide sequence.
[0041] Indeed, by working on the development of an improved rMDV capable of stably expressing a recombinant antigen, the present inventors have shown that an insulator can be advantageously associated with a recombinant nucleotide sequence to provide efficient expression of the corresponding antigen. The present inventors have developed an rMDV incorporating an insulator that expresses the associated recombinant nucleotide sequence in a stable manner, i.e., even after 10 passages in cell culture, preferably even after 15 or 20 passages.
[0042] As used herein, the term "insulator" or "insulator element" refers to a DNA sequence that insulates the transcription of a gene placed within its range of action, thereby protecting the transcription of the gene from negative effects such as enhancer-blocking activity and chromatin positioning effects. Insulators can protect a gene of interest from inappropriate signals arising from the surrounding environment by acting as a physical barrier or boundary. A nucleotide sequence or gene "associated with" an insulator refers to a nucleotide sequence or gene located within the range of action of the insulator.
[0043] In the context of the present invention, "located upstream" means located at or towards the 5' end of the gene of interest in the coding strand, with respect to the direction of transcription. When considering double-stranded DNA, "upstream" usually refers to the 5' end of the coding strand of the gene of interest, and "downstream" refers to the 3' end. Some genes of the same DNA molecule may be transcribed in opposite directions. This means that the upstream and downstream regions of a DNA molecule may vary depending on the gene of interest.
[0044] The insulator of the present invention is a DNA sequence introduced into an expression cassette upstream of a promoter driving the expression of a recombinant nucleotide sequence of interest to prevent or reduce interference of the viral genome and / or other recombinant expression cassettes with the expression of the recombinant nucleotide sequence of interest. The insulator can further contribute to protecting the recombinant nucleotide sequence from integration side effects mediated by cis-acting elements present in the viral genome, which may result in deregulated expression of the transferred sequence. In particular, the insulator makes it possible to prevent viral sequences from potentially interfering with promoter activity without interfering with its activity.
[0045] In a particular embodiment, the insulator of the invention makes it possible to stabilize and / or increase the expression of the antigen with which it is associated.
[0046] Preferably, the insulator is not obtained or derived from an avian insulator, more preferably the insulator is obtained or derived from a mammalian insulator, preferably a non-human mammalian insulator such as a mouse insulator.
[0047] Advantageously, the insulator comprises one or more CCCTC-binding factor (CTCF) motifs. In certain embodiments, the insulator comprises a single CTCF motif.
[0048] According to the present invention, the insulator is preferably derived from the 3' hypersensitive site 1 (3'HS1) insulator of the beta globin locus. More specifically, the insulator may be derived from the 3'HS1 insulator element described by Farrell (Farell et al., Molecular and Cellular Biology, 2002, vol. 22(11), pp. 3820-3831).
[0049] Preferably, the insulator comprises or consists of a functional fragment of the mouse 3' hypersensitive site 1 (m3'HS1) insulator. In the context of the present invention, a "functional fragment of an insulator" refers to a fragment that retains insulator activity. Those skilled in the art know how to confirm the insulator activity of an insulator fragment. For example, two rHVTs expressing VP2 protein are constructed, each of which either has an insulator fragment sequence at its 5' end (e.g., linked to a Bac promoter driving VP2 protein expression) or does not have the insulator fragment sequence (i.e., a negative control). The expression levels of VP2 protein by these two rHVTs are compared. If VP2 expression by the rHVT containing the insulator fragment is higher than that by the rHVT lacking the insulator fragment, the insulator activity of the insulator fragment is confirmed. A functional fragment of m3'HS1 advantageously comprises, consists essentially of or consists of the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 4 and retaining insulator activity. Advantageously, a functional fragment of m3'HS1 comprises at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 4 including the CTCF motif and retaining insulator activity. In a particular embodiment, the insulator comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 4.
[0050] SEQ ID NO:4 GGAGAGGAGGGCGGAAATCAGTGGAACACTTCTGCCCCCTACTGGTATGCAAC AGGATCATTAGAGAAATGA
[0051] The insulator set forth in SEQ ID NO:4 comprises 72 nucleotides (hereinafter referred to as "3'HS1-72 insulator"), and the CTCF motif is located between positions 30 and 45 of SEQ ID NO:4.
[0052] The present inventors have demonstrated that the 3'HS1-72 insulator derived from the mouse beta globin locus can be used to successfully improve recombinant nucleotide sequence expression in cells. The 3'HS1-72 insulator has been shown to block the action of enhancer elements in addition to functioning as a physical boundary that can prevent the spread of gene silencing.
[0053] The 3'HS1-72 insulator is particularly suitable for use in rHVTs. Accordingly, an object of the present invention is to provide a rHVT comprising a recombinant nucleotide sequence inserted into an insertion site, encoding a promoter and an antigen operably linked to the insulator, wherein the insulator is located upstream of the promoter and comprises or consists of a nucleotide sequence having at least 90%, preferably at least 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO:4, and retains insulator activity.
[0054] Regulatory sequences According to the present invention, an rMDV vector, such as an rHVT vector, comprises one or more insulators described herein. The insulator is located upstream of a promoter that drives expression of at least one recombinant nucleotide sequence placed under the control of the promoter. The insulator element can be directly linked to the promoter sequence.
[0055] The promoter may be a synthetic or natural promoter, an endogenous promoter, or a heterologous promoter. In principle, any promoter may be used as long as it can function effectively in the target cell or host. In this regard, the promoter may be a eukaryotic, prokaryotic, viral, or synthetic promoter capable of directing gene transcription in avian cells in conjunction with the recombinant vector.
[0056] When the rMDV comprises two or more recombinant nucleotide sequences, each recombinant nucleotide sequence can be operably linked to a promoter that can be the same or different from each other. In certain embodiments, each recombinant nucleotide sequence is operably linked to a different promoter.
[0057] Preferentially, the promoter is selected from the Pec promoter, the Cytomegalovirus (CMV) immediate early 1 (ie1) promoter, in particular the Murine Cytomegalovirus (Mcmv) ie1 promoter or the Human Cytomegalovirus (Hcmv) promoter, the Chicken beta-actin (Bac) promoter, the Simian virus 40 (SV40) promoter, and the Rous Sarcoma virus (RSV) promoter, or any fragment thereof that retains promoter activity.
[0058] The recombinant nucleotide sequence may further be operably linked to a regulatory sequence, such as a polyadenylation signal. The insulator may then be directly linked to the polyadenylation signal. In this particular embodiment, the insulator is located downstream of the polyadenylation signal.
[0059] The polyadenylation signal may be synthetic or natural, endogenous or heterologous. In principle, any polyadenylation signal may be used as long as it can function effectively in the target cell or host. In this regard, the polyadenylation signal may be a eukaryotic, prokaryotic, viral, or synthetic polyadenylation signal that can stabilize mRNA and enhance transcription termination in avian cells.
[0060] When the rMDV comprises two or more recombinant nucleotide sequences, each recombinant nucleotide sequence can be operably linked to a polyadenylation signal that can be the same or different from each other.
[0061] The polyadenylation signal sequence is a base sequence containing AATAAA, ATTAAA, or a modified sequence thereof. Preferably, the polyadenylation signal is derived from bovine growth hormone, simian virus 40 late and early regions, rabbit beta globin, mouse or human immunoglobulin, or polyoma virus late region.
[0062] Recombinant nucleotide sequence encoding the antigen The recombinant nucleotide sequence can encode any polypeptide of interest, such as, for example, an antigen, cytokine, hormone, or adjuvant.
[0063] In particular, the recombinant nucleotide sequence may encode an antigen or an antigenic fragment thereof derived from an avian pathogen.
[0064] The recombinant nucleotide sequence can be derived from or obtained from any pathogenic organism capable of causing infection in avian species. Examples of pathogens that cause infection in birds include viruses, bacteria, fungi, and protozoa.
[0065] The antigen may be any immunogenic peptide or protein of a pathogen, for example a peptide or protein selected from or derived from a surface, secreted or structural protein of the pathogen, or an antigenic fragment thereof.
[0066] Preferred recombinant nucleotide sequences for use in the present invention encode antibodies derived from avian influenza virus, avian paramyxovirus type 1 (also known as Newcastle disease virus (NDV)), avian metapneumovirus, Marek's disease virus, Gumboro disease virus (also known as infectious bursal disease virus (IBDV)), infectious laryngotracheitis virus (ILVT), infectious bronchitis virus (IBV), Escherichia coli, Salmonella, Pasteurella multocida, Liemerella anatipestifa, Ornithobacterium rhinotracheale, Mycoplasma gallisepticum, Mycoplasma synoviae, mycoplasma organisms infecting avian species, and / or coccidia.
[0067] Preferentially, the antigen is selected from the F protein of NDV, the VP2 protein of IBDV, the gB protein of ILTV, the 40K protein of Mycoplasma gallisepticum, and the surface protein hemagglutinin (HA) of avian influenza viruses, or immunogenic fragments thereof.
[0068] When two or more recombinant nucleotide sequences are inserted into the rMDV, various combinations of antigens can be considered. Preferably, the two or more recombinant nucleotide sequences encode different antigens, more preferably antigens from different pathogens.
[0069] In one embodiment, the recombinant MDV of the present invention contains a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an immunogenic fragment thereof.
[0070] In another embodiment, the recombinant MDV of the present invention comprises a nucleotide sequence encoding the VP2 protein or an immunogenic fragment thereof of IBDV, and a nucleotide sequence encoding the gB protein or an immunogenic fragment thereof of ILTV.
[0071] In one embodiment, the recombinant MDV of the present invention contains a recombinant nucleotide sequence encoding the F protein of NDV or an immunogenic fragment thereof.
[0072] In another embodiment, the recombinant MDV expresses two or more antigens from the same pathogen, which antigens may be the same or different.
[0073] In further embodiments, the recombinant nucleotide sequence encodes an active molecule such as a cytokine or immunomodulator, an adjuvant, a hormone, an antiparasitic agent, an antibacterial agent, etc., and other recombinant nucleotide sequences encode antigens as defined above.
[0074] According to a further embodiment, three or more recombinant nucleotide sequences may be inserted into the viral genome.
[0075] Insertion site According to the present invention, a recombinant nucleotide sequence, a promoter and optionally an insulator are inserted into the insertion site of MDV.
[0076] Preferably, the insertion site is located in a non-coding region of the viral genome.
[0077] The term "non-coding region" is well known in the art and refers to any region of the viral genome that does not code for a protein.
[0078] Preferably, the insertion site may be selected from the non-coding regions between UL43 and UL47, between UL55 and SORF4, and between US1 and US3. In particular, the insertion site may be selected from the non-coding regions located between UL44 and UL45, between UL45 and UL46, between UL55 and SORF4, between US10 and SORF3, and between SORF3 and US2. In particular, the insertion site may be selected from the non-coding regions located between UL44 and UL45, between UL45 and UL46, and between SORF3 and US2.
[0079] The recombinant MDV of the present invention can be prepared from any MDV, preferably a non-pathogenic HVT. In particular, the rMDV is a recombinant HVT. An example of a suitable HVT is the FC126 strain. The genome sequence of the FC126 strain is available in the art (Afonso et al., supra; Kingham et al., supra), which reports the nucleotide sequence of the FC126 reference strain and the locations of most of the ORFs within the genome.
[0080] With reference to the FC126 complete genome (GenBank: AF291866.1), the non-coding region between UL44 (HVT052) and UL45 (HVT053) preferably corresponds to nucleotides 94243 to 94683 of the HVT genome, the non-coding region between UL45 (HVT053) and UL46 (HVT054) preferably corresponds to nucleotides 95323 to 95443 of the HVT genome, and the non-coding region between UL55 (HVT065) and UL46 (HVT066) preferably corresponds to nucleotides 95323 to 95443 of the HVT genome. The non-coding region between ORF4 (HVT066) corresponds to nucleotides 112010 to 112207 of the HVT genome, the non-coding region between US10 (HVT086) and SORF3 (HVT087) corresponds to nucleotides 138688 to 138825 of the HVT genome, and the non-coding region between SORF3 (HVT087) and US2 (HVT088) corresponds to nucleotides 139867 to 140064 of the HVT genome.
[0081] Univalent constructs The present invention relates to an rMDV comprising a single foreign antigen operably linked to a promoter and an insulator located upstream of the promoter, i.e., the present invention relates to an rMDV comprising a single recombinant nucleotide sequence encoding a single foreign antigen.
[0082] Advantageously, a single insulator is placed upstream of the promoter. However, it is possible to use two, three or more insulators associated with the same antigen. Preferably, the insulators are grouped and placed one after the other, all upstream of the promoter.
[0083] Advantageously, the recombinant nucleic acid sequence (i.e., recombinant antigen, promoter and insulator) is inserted into an insertion site located in the non-coding region between UL45 and UL46, or between UL44 and UL45, or between SORF3 and US2.
[0084] In a specific embodiment, the recombinant nucleic acid sequence is inserted into an insertion site located in the non-coding region between UL45 and UL46.
[0085] Advantageously, the foreign antigen encodes an antigenic peptide selected from the F protein of NDV, the VP2 protein of IBDV, the gB protein of ILTV, the 40K protein of Mycoplasma gallisepticum, and the surface protein HA of avian influenza viruses, or antigenic fragments thereof.
[0086] Among multiple possible embodiments based on the preferred insertion site and the preferred recombinant nucleotide sequence, the present inventors surprisingly found that a construct containing a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof exhibits a high level of stability and allows for large expression of the antigen. The present inventors further showed that such a construct can enable early onset of immunity against the corresponding pathogen.
[0087] Therefore, the object of the present invention is to propose a monovalent rMDV, preferably an rHVT, comprising, at an insertion site selected from the non-coding region between UL45 and UL46 and the non-coding region between UL44 and UL45, a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter and to the m3'HS1 insulator or a functional fragment thereof located upstream of the promoter.
[0088] In a specific embodiment, the rHVT comprises, at an insertion site located in the non-coding region between UL45 and UL46, a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof operably linked to a Bac promoter and a functional fragment of the m3'HS1 insulator located upstream of the Bac promoter, wherein the functional fragment of the m3'HS1 insulator preferably comprises or consists of a nucleotide sequence having a CTCF motif and at least 90%, preferably at least 95%, 96%, 97%, 98%, or 99%, identity to the full-length sequence set forth in SEQ ID NO: 4, and retains insulator activity.
[0089] In another embodiment, the rHVT comprises, at an insertion site located between UL44 and UL45, a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof operably linked to the murine cytomegalovirus (Mcmv) immediate-early (ie)1 promoter and a functional fragment of the m3'HS1 insulator located upstream of the Mcmv(ie)1 promoter, wherein the functional fragment of the m3'HS1 insulator preferably comprises or consists of a nucleotide sequence having a CTCF motif and at least 90%, preferably at least 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 4, and retains insulator activity.
[0090] Another object of the present invention is to propose an rMDV, particularly an rHVT, comprising, in an insertion site located between SORF3 and US2, a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter, particularly the Mcmvie1 promoter, and to a functional fragment of the m3'HS1 insulator located upstream of the promoter, wherein the functional fragment of the m3'HS1 insulator preferably comprises or consists of a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 4, and retaining insulator activity.
[0091] A particular object of the present invention is a nucleotide sequence encoding the VP2 protein of IBDV, preferably the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 1, which is under the control of a Bac promoter, preferably the promoter of SEQ ID NO: 2 or a promoter having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 2, and which comprises at its 5' end an insulator sequence of SEQ ID NO: 4 or a sequence The object of the present invention is to provide a rHVT flanked at its 3' end by an SV40 polyadenylation signal, preferably the SV40 polyadenylation signal of SEQ ID NO: 3, or an SV40 polyadenylation signal having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 3, inserted into the intergenic region between HVT053 (UL45) and HVT054 (UL46) (FW285), flanked at its 3' end by an insulator sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 3.
[0092] Another object of the present invention is to propose a monovalent rMDV, preferably an rHVT, comprising, at an insertion site selected from the non-coding region between UL45 and UL46 and the non-coding region between UL44 and UL45, a recombinant nucleotide sequence encoding the F protein of NDV or an antigenic fragment thereof, operably linked to a promoter and to the m3'HS1 insulator or a functional fragment thereof located upstream of the promoter.
[0093] In a specific embodiment, the rHVT comprises, at an insertion site located in the non-coding region between UL45 and UL46, a recombinant nucleotide sequence encoding the F protein of NDV or an antigenic fragment thereof operably linked to a Bac promoter and a functional fragment of the m3'HS1 insulator located upstream of the Bac promoter, wherein the functional fragment of the m3'HS1 insulator preferably comprises or consists of a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 4, and retaining insulator activity.
[0094] A particular object of the present invention is a nucleotide sequence encoding the F protein of NDV, preferably the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 17, which is under the control of a Bac promoter, preferably the promoter of SEQ ID NO: 2 or a promoter having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 2, and which comprises at its 5' end an insulator sequence of SEQ ID NO: 4 or a sequence The object of the present invention is to provide a rHVT flanked at its 3' end by an SV40 polyadenylation signal, preferably the SV40 polyadenylation signal of SEQ ID NO: 3, or an SV40 polyadenylation signal having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in sequence number 4, inserted into the intergenic region between HVT053 (UL45) and HVT054 (UL46) (FW348).
[0095] Multivalent constructs A further object of the present invention relates to a polyvalent rMDV comprising two or more recombinant nucleotide sequences encoding antigens, at least one of which is associated with an insulator as described above. Preferably, the insulator has at least 90%, 95%, 98%, 99% of the nucleotide sequence set forth in SEQ ID NO: 4, including its CTCF motif, and retains insulator activity, or comprises or consists of a functional fragment of the m3'HS1 insulator having exactly the nucleotide sequence set forth in SEQ ID NO: 4.
[0096] Two or more recombinant nucleotide sequences may be associated with the insulator. In particular, each recombinant nucleotide sequence may be associated with the insulator. Preferably, only one of the multiple recombinant nucleotide sequences is associated with the insulator.
[0097] Preferably, the two or more recombinant nucleotide sequences encode different antigens, more preferably, the two or more recombinant nucleotide sequences encode different antigens from different pathogens.
[0098] Two or more recombinant nucleotide sequences can be inserted into the same insertion site or different insertion sites. Preferably, two or more recombinant nucleotide sequences are inserted into at least two different insertion sites. More preferably, each recombinant nucleotide sequence is inserted into a different insertion site.
[0099] In particular, the combination of insertion sites is selected from the non-coding regions located between UL44 and UL45, between UL45 and UL46, between UL55 and SORF4, between US10 and SORF3, and between SORF3 and US2, preferably from the non-coding regions located between UL44 and UL45, between UL45 and UL46, and between SORF3 and US2.
[0100] In certain embodiments, a polyvalent rMDV comprising one or more recombinant nucleotide sequences encoding antigens comprises only one expression cassette comprising an insulator as described above, i.e., only one recombinant nucleotide sequence encoding an antigen is associated with the insulator.
[0101] Therefore, an object of the present invention is to propose an rMDV, particularly an rHVT, comprising a first recombinant nucleotide sequence encoding a first antigen inserted into a first insertion site and a second recombinant nucleotide sequence encoding a second antigen inserted into a second insertion site different from the first insertion site, wherein the first recombinant nucleotide sequence encoding the antigen is operably linked to a promoter and an insulator located upstream of the promoter, and the second recombinant nucleotide sequence is operably linked to the promoter. The second expression cassette comprising the second recombinant nucleotide sequence does not contain an insulator (i.e., is insulator-free). Advantageously, the first recombinant nucleotide sequence encodes the first antigen, and the second recombinant nucleotide sequence encodes a second antigen different from the first antigen.
[0102] The polyvalent rMDV may comprise a first recombinant nucleotide sequence inserted into the non-coding region located between UL44 and UL45 and a second recombinant nucleotide sequence inserted into the non-coding region located between UL45 and UL46, or vice versa.
[0103] Alternatively, the polyvalent rMDV may comprise a first recombinant nucleotide sequence inserted into the non-coding region located between UL44 and UL45 and a second recombinant nucleotide sequence inserted into the non-coding region located between SORF3 and US2, or vice versa.
[0104] Alternatively, the polyvalent rMDV may comprise a first recombinant nucleotide sequence inserted into the non-coding region located between UL45 and UL46 and a second recombinant nucleotide sequence inserted into the non-coding region located between SORF3 and US2, or vice versa.
[0105] Preferentially, the two or more recombinant nucleotide sequences encoding the antigens are under the control of different promoters.
[0106] Advantageously, one recombinant nucleotide sequence encodes the VP2 protein of IBDV or an antigenic fragment thereof, and another recombinant nucleotide sequence encodes the gB protein of IL-TV or an antigenic fragment thereof.
[0107] In a particular embodiment, the recombinant nucleotide sequence associated with the insulator according to the invention encodes the VP2 protein of IBDV or an antigenic fragment thereof.
[0108] Among the multiple possible embodiments based on the combination of an insertion site, a recombinant nucleotide sequence associated with an insulator, and optionally a preferred promoter, the present inventors surprisingly found that certain combinations result in rMDVs, particularly rHVTs, with high levels of stability and high expression levels of both antigens. Such rMDVs, particularly such rHVTs, are particularly suitable for preparing improved multivalent vaccines. In particular, the present inventors demonstrated that the use of such an insulator in combination with a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof in a multivalent rMDV allows stable and efficient expression of the VP2 antigen without impairing the expression of the second antigen.
[0109] Therefore, an object of the present invention is to provide a polyvalent rMDV, preferably a polyvalent rHVT, comprising, at a first insertion site, a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof operably linked to a promoter and an m3'HS1 insulator or a functional fragment thereof located upstream of the promoter, and at a second insertion site, a second recombinant nucleotide sequence encoding a second antigen different from the VP2 antigen operably linked to the promoter, wherein the first and second insertions are different and are selected from non-regions located between UL45 and UL46, between UL44 and UL45, and between SORF3 and US2.
[0110] In a specific embodiment, the multivalent rHVT comprises, at a first insertion site located in the non-coding region between UL45 and UL46, a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof operably linked to a promoter, preferably a Bac promoter, and an m3'HS1 insulator or a functional fragment thereof located upstream of the Bac promoter; and, at a second insertion site located in the non-coding region between UL44 and UL45, a second recombinant nucleotide sequence encoding the gB protein of ILTV or an antigenic fragment thereof operably linked to a promoter, preferably the McMv ie1 promoter; the functional fragment of the m3'HS1 insulator preferably comprises or consists of a nucleotide sequence having a CTCF motif and at least 90%, preferably at least 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 4, and retaining insulator activity.
[0111] In another embodiment, the multivalent rHVT comprises, at a first insertion site located in the non-coding region between UL45 and UL46, a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof operably linked to a promoter, preferably a Bac promoter, and an m3'HS1 insulator or a functional fragment thereof located upstream of the Bac promoter, and at a second insertion site located in the non-coding region between SORF3 and US2, a second recombinant nucleotide sequence encoding the gB protein of ILTV or an antigenic fragment thereof operably linked to a promoter, preferably the McMv ie1 promoter, wherein the functional fragment of the m3'HS1 insulator preferably comprises or consists of a nucleotide sequence having a CTCF motif and at least 90%, preferably at least 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 4, and retaining insulator activity.
[0112] In another embodiment, the multivalent rHVT comprises, at a first insertion site located in the non-coding region between UL44 and UL45, a first recombinant nucleotide sequence encoding the VP2 protein or an antigenic fragment thereof operably linked to a promoter, preferably the McMv ie1 promoter, and a m3'HS1 insulator or a functional fragment thereof located upstream of the McMv ie1 promoter, and at a second insertion site located in the non-coding region between UL45 and UL46, a second recombinant nucleotide sequence encoding the gB protein or an antigenic fragment thereof operably linked to a promoter, preferably the Pec promoter, wherein the functional fragment of the m3'HS1 insulator preferably comprises or consists of a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 4, and retaining insulator activity.
[0113] In yet another embodiment, the multivalent rHVT comprises, at a first insertion site located in the non-coding region between SORF3 and US2, a first recombinant nucleotide sequence encoding the VP2 protein or an antigenic fragment thereof operably linked to a promoter, preferably the McMv ie1 promoter, and an m3'HS1 insulator or a functional fragment thereof located upstream of the McMv ie1 promoter, and at a second insertion site located in the non-coding region between UL45 and UL46, a second recombinant nucleotide sequence encoding the gB protein or an antigenic fragment thereof operably linked to a promoter, preferably the Pec promoter, wherein the functional fragment of the m3'HS1 insulator preferably comprises or consists of a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 4, and retaining insulator activity.
[0114] The object of the present invention is to provide a first nucleotide sequence encoding the VP2 protein of IBDV, preferably of SEQ ID NO: 1 or having at least 80%, 85%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as set forth in SEQ ID NO: 1, which is under the control of a Bac promoter, preferably of SEQ ID NO: 2 or a promoter having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as set forth in SEQ ID NO: 2, and which is flanked at its 5' end by an insulator sequence of SEQ ID NO: 4 or an insulator sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as set forth in SEQ ID NO: 4. a first nucleotide sequence flanked at its 3' end by an SV40 polyadenylation signal inserted into a first intergenic region between HVT053 (UL45) and HVT054 (UL46), preferably an SV40 polyadenylation signal of SEQ ID NO: 3 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 3; and a second nucleotide sequence encoding the gB protein of ILTV, preferably having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SV40 polyadenylation signal of SEQ ID NO: 5 or the full-length sequence set forth in SEQ ID NO: 5, wherein and a second nucleotide sequence located under the control of an ie1 promoter, preferably the promoter of SEQ ID NO: 6, or a promoter having at least 80, 85, 90, 95, 96, 97, 98, or 99% identity to the full-length sequence set forth in SEQ ID NO: 6, and linked at its 3' end to a polyadenylation signal-1 inserted in a second intergenic region between HVT052 (UL44) and HVT053 (UL45) (FW311), preferably the polyadenylation signal-1 of SEQ ID NO: 7, or a polyadenylation signal-1 having at least 80, 85, 90, 95, 96, 97, 98, or 99% identity to the full-length sequence set forth in SEQ ID NO: 7.
[0115] Another object of the present invention is a first nucleotide sequence, preferably of SEQ ID NO: 1, encoding the VP2 protein of IBDV, which is under the control of the McMv ie1 promoter, preferably of SEQ ID NO: 6 or a promoter having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence set forth in SEQ ID NO: 6, and which is flanked at its 5' end by an insulator sequence of SEQ ID NO: 4 or an insulator sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence set forth in SEQ ID NO: 4, and at its 3' end by and a first nucleotide sequence flanked by an SV40 polyadenylation signal inserted into a first intergenic region between HVT052 (UL44) and HVT053 (UL45), preferably an SV40 polyadenylation signal of SEQ ID NO: 3, or an SV40 polyadenylation signal having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 3; and a second nucleotide sequence encoding the gB protein of ILTV. a second nucleotide sequence, preferably of SEQ ID NO: 5 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 5, which is under the control of a Pec promoter, preferably of SEQ ID NO: 18 or a promoter having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 18; and a second nucleotide sequence linked to a polyadenylation signal-1 inserted into a second intergenic region between T053 (UL45) and HVT054 (UL46) (FW313), preferably the polyadenylation signal-1 of SEQ ID NO: 7, or a polyadenylation signal-1 having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the full-length sequence set forth in SEQ ID NO: 7.
[0116] Virus construction The recombinant MDV, preferably recombinant HVT, of the present invention can be prepared using techniques known per se in the art, such as recombinant techniques, homologous recombination, site-specific insertion, mutagenesis, and the like.
[0117] Gene cloning and plasmid construction are well known to those skilled in the art and can be essentially carried out by standard molecular biology techniques (Molecular Cloning: A Laboratory Manual. 4 th Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, USA, 2012).
[0118] Typically, recombinant viruses can be prepared by homologous recombination between the viral genome and a construct (e.g., a plasmid) containing the nucleic acid to be inserted and flanked by nucleotides from the insertion site that allow for recombination. Insertion can be performed with or without deletion of endogenous sequences.
[0119] The resulting recombinant viruses can be selected genotypically or phenotypically using known techniques, for example, by hybridization, detection of an enzymatic activity encoded by a gene integrated with the recombinant nucleic acid sequence, or immunological selection by detection of an antigenic peptide expressed by the recombinant virus. The selected recombinant viruses can be grown on a large scale in cell culture, after which recombinant viruses containing the peptide can be harvested.
[0120] cell culture The recombinant viruses of the present invention can be propagated in any competent cell culture. After the required growth of the virus is achieved, the cells can be detached from the well using a scraper or with trypsin, and the infected cells can be separated from the supernatant by centrifugation.
[0121] Examples of competent cells include CEF, embryonated eggs, and chicken kidney cells. Cells or viruses can be cultured for 3 to 6 days at approximately 37°C in a culture medium such as Eagle's MEM or Leibowitz-L-15 / McCoy's 5A (1:1 mixture) culture medium. Infected cells are typically suspended in a culture medium containing 10% dimethyl sulfoxide (DMSO) or CELLBANKER® 1 (ZENOAQ) and stored under liquid nitrogen or frozen in a deep freezer at, for example, -85°C.
[0122] The present invention further relates to a method for producing or replicating an rMDV, preferably an rHVT, comprising infecting a competent host cell with an rMDV or a nucleic acid molecule comprising, consisting essentially of, or consisting of the genome of an rMDV, preferably an rHVT, as described above, and harvesting the rMDV, preferably an rHVT.
[0123] The present invention further relates to a host cell comprising an rMDV, preferably an rHVT, as described above, or a nucleic acid molecule comprising, consisting essentially of, or consisting of the genome of an rMDV, preferably an rHVT.
[0124] Advantageously, the rMDV of the present invention exhibits a high level of stability through passage, which corresponds to the expression of the recombinant nucleotide sequence in cells of avian species even after 10, 15, 20 or more passages. In the context of the present invention, "passage" or "cell passage" refers to the cultivation of cells in conditions suitable for allowing the proliferation of cells and their survival until they reach 90% to 100% confluence. The passaging process consists of transferring a small number of cells of a previously confluent culture into new culture medium. An aliquot of a previously confluent culture containing a small number of cells can be diluted with a large amount of fresh medium. In the case of adherent cultures, the cells can first be detached, for example, by using a mixture of trypsin and EDTA, or any suitable enzyme, and then a small number of detached cells is used to seed new culture medium.
[0125] According to a preferred embodiment of the present invention, CEF cells transfected with the rMDV of the present invention express the corresponding antigen even after at least 10 passages. In other words, CEF cells obtained from 10 or more passages, more particularly from 15 passages, of CEF cells transfected with the rMDV of the present invention still contain the exogenous nucleotide sequence of the rMDV used for the initial cell transfection and express the corresponding antigen. In the context of the present invention, cells of such passages are considered to still express the antigen if the production level is greater than 80%, preferentially greater than 85%, of the production level of the first passage.
[0126] Compositions, vaccines and uses thereof The present invention further relates to compositions, such as vaccines, comprising an effective immunizing amount of a monovalent or polyvalent recombinant MDV, preferably a recombinant HVT of the present invention, a nucleic acid of the present invention, or a cell of the present invention. An "effective immunizing amount" refers to an amount of the rMDV, preferably a rHVT, of the present invention sufficient to generate an immunological response. An effective amount may vary depending on the antigen. The amount that constitutes an effective amount may vary depending on whether the vaccine is intended as a primary or booster treatment.
[0127] The vaccine of the present invention typically comprises an immunologically effective amount of the above-described recombinant MDV, preferably recombinant HVT, in a pharmaceutically acceptable vehicle.
[0128] Compositions and vaccines of the present invention typically include a suitable solvent or diluent or excipient, such as, for example, an aqueous buffer or a phosphate buffer. The compositions may also include additives, such as proteins or peptides derived from animals (e.g., hormones, cytokines, costimulatory factors), nucleic acids derived from viruses and other sources (e.g., double-stranded RNA, CpG), etc., administered with the vaccine in an amount sufficient to enhance the immune response. In addition, combinations of any number of the foregoing substances may provide an immunostimulatory effect and thus form an immunostimulant of the present invention.
[0129] The vaccines of the present invention may be further formulated with one or more additional additives to maintain isotonicity, physiological pH, and stability, such as a buffer such as saline (0.85%), phosphate-buffered saline (PBS), citrate buffer, Tris hydroxymethyl aminomethane (TRIS), Tris-buffered saline, or an antibiotic such as neomycin or streptomycin.
[0130] The rMDV of the present invention may preferably be used as a live vaccine, although other alternatives such as inactivated or attenuated vaccines are well within the skill of one in the art.
[0131] The route of administration can be any route, including oral (e.g., drinking water, gel), ocular (e.g., eye drops), oculonasal administration using aerosols (e.g., sprays), intranasal, cloacal, intraembryonic, topical, or injection (e.g., intravenous, subcutaneous, intramuscular, intraorbital, intraocular, intradermal, and / or intraperitoneal) vaccination. One skilled in the art will readily adapt the formulation of the vaccine composition for each type of administration route.
[0132] Each vaccine dose may contain a suitable amount sufficient to induce a protective immune response in the avian species. Optimization of such doses is well known in the art. The amount of antigen per dose can be determined by known methods using antigen / antibody reactions, such as ELISA.
[0133] The vaccines of the present invention can be administered as a single dose or multiple doses, depending on the vaccination protocol.
[0134] The vaccines of the present invention are further advantageous in that they confer up to 70%, preferably up to 80%-90% or more protection in avian species against the targeted avian pathogens after four weeks of vaccination.
[0135] The present invention further relates to the use of the above compositions, vaccines or vaccine compositions for immunising or vaccinating avian species, such as poultry, against at least one pathogen.
[0136] The present invention further relates to an rMDV, preferably an rHVT, as described above, for use in immunizing or vaccinating avian species such as poultry, preferably chickens, against at least one avian pathogen.
[0137] The present invention further relates to a method of immunizing or vaccinating avian species by administering an immunologically effective amount of a vaccine according to the invention. The vaccine may advantageously be administered intradermally, subcutaneously, intramuscularly, orally, intraembryonic, mucosally, or oculonasally.
[0138] The present invention further relates to the rMDV described above for use in birds, such as poultry, preferably chickens, to increase the onset of immunity against at least one avian pathogen. By "increasing" the onset of immunity, we mean providing birds with greater immune protection against the pathogen after vaccination with the rMDV, preferably the rHVT, than when a vaccine not containing an insulator element is used, as described herein.
[0139] In a particular embodiment, the rMDV or vaccine composition is for use in vaccinating avians, such as poultry, preferably chickens, against Newcastle Disease Virus (NDV).
[0140] In another embodiment, the rMDV or vaccine composition is for use in vaccinating birds such as poultry, preferably chickens, against both infectious bursal disease virus (IBDV) and infectious laryngotracheitis virus (ILVT).
[0141] In another embodiment, the rMDV or vaccine composition is for use in vaccinating avian species such as poultry, preferably chickens, against infectious bursal disease virus (IBDV).
[0142] The present invention further relates to vaccination kits for immunizing avian species, comprising an effective amount of the monovalent or polyvalent vaccine described above and means for administering the components to the species. For example, such kits may comprise an injection device loaded with the monovalent or polyvalent vaccine of the invention and instructions for intradermal, subcutaneous, intramuscular, or intraembryonic injection. Alternatively, the kit may comprise a spray / aerosol, gel drop, or eye drop device loaded with the polyvalent vaccine of the invention and instructions for oculonasal, oral, or mucosal administration.
[0143] Further aspects and advantages of the present application will now be disclosed in the following examples which illustrate the invention. [Example]
[0144] We constructed a series of recombinant HVTs with different expression cassettes inserted into the non-coding regions located between HVT053 (UL45) and HVT054 (UL46), or between HVT052 (UL44) and HVT053 (UL45), or between HVT087 (SORF3) and HVT088 (US2). Schematic diagrams of these are shown in Figure 2(a) and Figure 5(a).
[0145] In the experiment, several monovalent and polyvalent recombinant HVTs were used in each efficacy test. These viruses are named as follows (virus / insertion site inserted expression cassette): FW169:rHVT / HVT053-054_Bac-VP2 (vaccine control) FW181:rHVT / HVT053-054_Pec-gBdel FW285:rHVT / HVT053-054_m3'HS1-72-Bac-VP2 FW348:rHVT / HVT053-054_m3'HS1-72-Bac-F FW260:rHVT / HVT053-054_Bac-VP2 / HVT052-053_Mcmvie1-gBdel FW311:rHVT / HVT053-054_m3'HS1-72-Bac-VP2 / HVT052-053_Mcmvie1-gBdel FW313:rHVT / HVT052-053_m3'HS1-72-Mcmvie1-VP2 / HVT053-054_Pec-gBdel
[0146] Example 1: Construction of a homology vector Plasmid construction is essentially carried out by standard molecular biology techniques (Molecular Cloning: A Laboratory Manual. 4 th Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, USA, 2012).
[0147] Construction of p45 / 46_m3'HS1-72 Bac-VP2 A fragment in which the insulator sequence m3'HS1-72 (SEQ ID NO: 4) was directly linked to the 5' end of the Bac promoter was generated by overlap PCR using p45 / 46BacVP2 (wo03064595) and specific primers (SEQ ID NOs: 9, 10, 11, and 12). The amplicon was cloned into XbaI- and EcoRI-digested p45 / 46BacVP2 to obtain p45 / 46_m3'HS1-72-Bac-VP2.
[0148] Construction of p44 / 45d46_Mcmvie1-gBdel The nucleotide sequence of the ILTV-gBdel gene (SEQ ID NO: 5) was first obtained by cloning from ILTV strain 632 (EP1731612A1). The ILTV gBdel gene was cloned into the pUC18 plasmid so that the ILTV gBdel gene had additional XbaI and Sall sites at the 5' and 3' ends, respectively. The ILTV gBdel portion was then separated into two fragments by digestion with XbaI and Sall. These two ILTV gBdel gene pieces were cloned into p44 / 45d46_Mcmvie1-VP2 (WO13144355) digested with XbaI and Sall to obtain p44 / 45d46_Mcmvie1-gBdel.
[0149] Construction of p45 / 46_Bac-F The NDV-F gene was synthesized and replaced with the IBDV-VP2 gene of p45 / 46_BacVP2 (US7153511) by digestion with XbaI and SalI to obtain p45 / 46_Bac-F.
[0150] Construction of p45 / 46_m3'HS1-72 Bac-F A fragment containing the insulator sequence, m3'HS1-72 (SEQ ID NO: 4), was digested from p45 / 46_m3'HS1-72_Bac-VP2 with XhoI and cloned into XhoI-digested p45 / 46_Bac-F to obtain p45 / 46_m3'HS1-72_Bac-F.
[0151] Construction of p44 / 45d46_m3'HS1-72 Mcmvie1-VP2 A fragment of the Mcmvie1 promoter linked to an insulator sequence (SEQ ID NO: 4) at the 5' end was amplified by overlap PCR using p44 / 45d46_Mcmvie1-VP2 (wo13144355) and specific primers (SEQ ID NOs: 19, 20, 21, 22, 23, and 24). The fragment was inserted into p44 / 45d46_Mcmvie1-VP2 digested with SacII and NaeI by In-Fusion cloning to obtain p44 / 45d46_m3'HS1-72-Mcmvie1-VP2.
[0152] Example 2: Construction of recombinant HVT Recombinant HVT was constructed by homologous recombination in cultured cells. For homologous recombination in cultured cells, viral DNAs of wild-type HVT strains FC-126 (PASS+14), FW285 (PASS+25), and FW181 (PASS+22) were prepared as described by Morgan et al. (Avian Diseases, 34:345-351, 1990). Approximately 2 pg of parental viral DNA and 1 pg of one of the homologous vectors were electroporated using Nucleofector II (Lonza, Basel, Switzerland) to prepare approximately 10 7The transfected cells were then transfected into 100 CEF cells. The transfected cells were added to Leibovitz's L-15 (Life Technologies Corp., catalog no. 41300-39), McCoy's 5A medium (Life Technologies Corp., catalog no. 21500-061) (1:1), and 4% fetal bovine serum (LM(+) medium) in a 96-well tissue culture plate and incubated at 37°C in 4-5% CO2 for 5-7 days until recombinant HVT plaques became visible. The cells were then detached from the plate by trypsinization and equally transferred to two 96-well plates containing CEF and incubated for 4-6 days until plaques were observed. Screening was performed by a black plaque assay, which stains only plaques expressing IBDV VP2 protein or IBDV gB protein. Briefly, one of the two plates was fixed with a methanol:acetone mixture (1:2) and incubated with anti-IBDV VP2 mouse monoclonal antibody R63 (ATCC#:HB-9490) or anti-ILTV gB mouse monoclonal antibody #1_B4_7 (unpublished). Next, the plates were incubated with a biotinylated anti-mouse IgG antibody (Vector Laboratories, Cat#BA-9200) and then with a VECTASTAIN ABC-AP kit (Vector Laboratories, Cat#AK-5000). Plaques expressing VP2 or gB proteins were stained by adding NBT / BCIP solution (Roche Applied Science, Cat#1681451). Wells containing stained recombinant plaques were identified, and cells from the corresponding wells on the other 96-well plate were trypsinized. The cells were then diluted with fresh secondary CEF cells and transferred to a 96-well plate to complete the first purification step. The purification procedure was repeated until all plaques stained positive in the black plaque assay.
[0153] A list of the constructed recombinant HVTs, their parent viruses, and the homology vectors used is provided below in Table I. A diagram showing the genomic structures of the recombinant HVT / IBD and recombinant HVT / IBD-LT is shown in Figure 1(a).
[0154] [Table 1] The construction of FW169 and FW181 was carried out as disclosed in WO03064595.
[0155] Example 3: Verification of the genomic structure of recombinant HVT / IBD Using FW285 as a model case, the characterization method of recombinant HVT / IBD is described below. Briefly, the genomic structure of recombinant HVT / IBD was verified by PCR reaction to amplify the flanking regions of the inserted gene. Figure 1(b) shows the location of the amplified region in FW285. The primer pair used for the PCR reaction is SEQ ID NO: 13 and SEQ ID NO: 14. Figure 1(c) demonstrates that all clones of FW285 have the correct genomic structure and are free of the parent virus.
[0156] Example 4: Comparison of VP2 protein expression from recombinant HVT / IBD Expression of the VP2 antigen by the recombinant HVT / IBD (FW285) of the present invention was confirmed by Western blot assay. Western blot analysis was performed using CEF cells infected with the recombinant virus and the anti-IBDV VP2 mouse monoclonal antibody R63. Briefly, CEF cells in 12-well plates were infected with the recombinant virus or one of the other recombinant virus strains at a multiplicity of infection of approximately 0.1. Three days after inoculation, the cells were harvested with trypsin and centrifuged at 913 × g for 5 minutes. The pellet was washed with PBS and resuspended in 100 μl of PBS. After adding the same volume of 2 × SDS sample buffer (130 mM Tris-Cl (pH 6.8), 6% SDS, 20% glycerol, 10% 2-mercaptoethanol, and 0.01% bromophenol blue), the cell suspension was boiled for 5 minutes. Samples were separated by SDS-PAGE using a 10% polyacrylamide gel and transferred to a PVDF membrane (Immobilon-P, Millipore). The membrane was completely dried and then incubated with anti-IBDV VP2 mouse monoclonal antibody R63. After rinsing, biotinylated anti-mouse IgG antibody (Vector Laboratories, catalog no. BA-9200) was used, followed by a VECTASTAIN ABC-AP kit (Vector Laboratories, catalog no. AK-5000). Proteins bound to anti-IBDV VP2 mouse monoclonal antibody R63 were visualized by adding NBT / BCIP solution (Roche Applied Science, catalog no. 1681451).
[0157] As shown in Figure 2(a), a protein band of 40 kilodaltons (kDa), the expected size of VP2 protein, was observed in the lanes containing rHVT / IBD-infected cells (FW285 and FW169). The in vitro results clearly demonstrate that the inclusion of a single upstream insulator does not alter promoter transcriptional activity.
[0158] To compare the amount of VP2 protein expressed between recombinant HVT / IBD, the results of the Western blot assay were quantified using ImageJ and shown as a bar graph in Figure 2(b). The relative density of the bands was measured against the vaccine control, FW169. It was demonstrated that the insulator sequence can enhance VP2 protein expression in vitro compared to insulator-free rHVT.
[0159] Example 5: Efficacy of recombinant HVT / IBD in SPF chickens The efficacy of FW285 was further investigated in SPF chickens. One-day-old chickens were divided into four groups, and chickens in groups 3 and 4 were subcutaneously vaccinated with approximately 3,000 plaque-forming units (pfu) / 0.2 mL of one of the recombinant HVT / IBDs (FW169: group 3, FW285: group 4). Chickens in group 2 (non-immunized, challenge positive control - NIC) were left unvaccinated. Chickens in group 1 (non-immunized, non-challenge control - NINC) were left unvaccinated and unchallenged. Chickens were bled weekly between 1 and 4 weeks of age and tested for the presence of anti-IBDV antibodies using a commercially available IBDV ELISA kit (ID Screen® IBD VP2: Idvet). Challenge was performed at 4 weeks of age. For challenge, 1 x 10 of the virulent IBDV STC strain was used. 3 EID 50 was administered orally. Chickens were observed daily for clinical signs associated with IBD, such as depression and death. Seven days after challenge, chickens were necropsied and observed for macroscopic bursal lesions, such as edema, discoloration, atrophy, bleeding, and yellow or gelatinous exudate. Body and bursal weights were also measured at necropsy for calculation of the B / B index, which is the ratio between bursal weight and body weight of challenged birds divided by the same ratio of unchallenged birds.
[0160] The IBDV ELISA results are shown in Figure 3 and the efficacy results are summarized in Table II below.
[0161] Construct FW285 appeared to induce the production of anti-VP2 antibodies earlier in vaccinated chickens than chickens vaccinated with the control FW169 vaccine (2 week OOI for FW285 and 3 week OOI for FW169), confirming the early onset of immunity with the construct of the invention. Furthermore, compared to the anti-IBDV VP2 titers obtained with the FW169 vaccine, the FW285 construct yielded higher anti-IBDV VP2 titers as early as 3 weeks and up to 4 weeks post-vaccination, confirming stronger immunity with the construct of the invention.
[0162] [Table 2] ( * ) B / B index means cystic index ( ** ) % protection = 100 - 100 × (number of deaths + number of lesions) / nB / B index is calculated as follows: BB index = BB ratio of infected (or vaccinated) birds / BB ratio of controls BB ratio = [bursa weight (g) / body weight (g)] × 1000
[0163] As shown in the publication "Bursal body index as a visual indicator for the assessment of bursa of Fabricius" (Journal of Veterinary Medicine and Animal Health vol.9(2), pp32-38, February 2017; DOI:10.5897 / JVMAH2016.0456), an index of less than 0.7 is usually considered to indicate bursal atrophy, while a B / B index of more than 0.7 indicates the absence of bursal atrophy.
[0164] Table II confirms that FW285 is stable in vivo. Table II further demonstrates that FW285, like FW169, can effectively protect chickens from IBDV challenge. Furthermore, FW285 induces better anti-IBDV VP2 antibody titers than FW169 (Figure 3).
[0165] These data indicate that insulator sequences can enhance both transgene expression and antibody titers of rHVT in vivo. Vaccination of avians with the rHVT of the present invention further results in an earlier onset of immunity in the animals.
[0166] Example 6: Verification of the genomic structure of recombinant HVT / ND Using FW348 as a model case, the characterization method of the recombinant HVT / ND is described below. Briefly, the genomic structure of the recombinant HVT / ND was verified by PCR reaction to amplify the flanking regions of the inserted gene. The primer pair used in the PCR reaction is SEQ ID NO: 25 and SEQ ID NO: 26.
[0167] Example 7: Comparison of F protein expression from recombinant HVT / ND Expression of the F antigen by the recombinant HVT / ND of the present invention (FW348) was confirmed by black plaque assay and Western blot assay. Black plaque and Western blot were performed using CEF cells infected with the recombinant virus and anti-NDV F mouse monoclonal antibody #77-2.
[0168] For black plaques, CEF cells in 12-well plates were infected with one of the recombinant viruses at a multiplicity of infection of approximately 0.1. Three days after inoculation, the cells were fixed with a methanol:acetone mixture (1:2). After washing three times with PBS, the samples were incubated with anti-NDV F mouse monoclonal antibody #77-2. After rinsing the anti-NDV F mouse monoclonal antibody #77-2, the samples were incubated with a biotinylated anti-mouse IgG antibody (Vector Laboratories, catalog number BA-9200) and then with a VECTASTAIN ABC-AP kit (Vector Laboratories, catalog number AK-5000). Finally, NDV-F protein expression was visualized using NBT / BCIP solution (Roche Applied Science, catalog number 1681451). The results were observed under a microscope.
[0169] For Western blot analysis, CEF cells in 12-well plates were infected with the recombinant virus or one of the other recombinant virus strains at a multiplicity of infection of approximately 0.1. Three days after inoculation, the cells were harvested with trypsin and centrifuged at 913 × g for 5 min. The pellet was washed with PBS and resuspended in 100 μl of PBS. After adding the same volume of 2 × SDS sample buffer (130 mM Tris-Cl (pH 6.8), 6% SDS, 20% glycerol, 10% 2-mercaptoethanol, and 0.01% bromophenol blue), the cell suspension was boiled for 5 min. Samples were separated by SDS-PAGE using a 10% polyacrylamide gel and transferred to a PVDF membrane (Immobilon-P, Millipore). The membrane was completely dried and then incubated with anti-NDV F mouse monoclonal antibody #77-2. After washing away the anti-NDV F mouse monoclonal antibody #77-2, biotinylated anti-mouse IgG antibody (Vector Laboratories, catalog number BA-9200) and then VECTASTAIN ABC-AP kit (Vector Laboratories, catalog number AK-5000) were used. Proteins bound to anti-NDV F mouse monoclonal antibody #77-2 were visualized by adding NBT / BCIP solution (Roche Applied Science, catalog number 1681451).
[0170] As shown in Figure 10, NDV F protein expression was observed in CEF cells infected with rHVT / ND.
[0171] As shown in Figure 11, a protein band of 60 kilodaltons (kDa), the expected size of the F protein, was observed in the lanes with rHVT / ND-infected cells (FW348 and FW026). The in vitro results clearly demonstrate that the inclusion of a single upstream insulator does not alter promoter transcriptional activity.
[0172] Example 8: Verification of the genomic structure of recombinant HVT / IBD-LT Using FW311 as a model case, the characterization method of the recombinant HVT / IBD-LT is described below. Briefly, the genomic structure of the recombinant HVT / IBD-LT was verified by PCR reaction to amplify the flanking regions of the inserted gene. Figure 4(a) shows the amplified region in FW311. The primer pairs used in the PCR reaction are SEQ ID NO: 13 and SEQ ID NO: 14 for PCR primer set 1 and SEQ ID NO: 15 and SEQ ID NO: 16 for PCR primer set 2. Figure 4(b) shows that FW311 has the correct genomic structure and is free of the parent virus.
[0173] Example 9: Comparison of VP2 protein expression from recombinant HVT / IBD-LT The expression of VP2 antigen by the recombinant HVT / IBD-LT (FW311, 313) of the present invention was confirmed by Western blot assay. Western blot was performed using CEF cells infected with the recombinant virus and the anti-IBDV VP2 mouse monoclonal antibody R63, as described in Example 4.
[0174] A protein band of 40 kilodaltons (kDa), the expected size of VP2 protein, was observed in the lane containing rHVT / IBD-LT-infected cells. FW260 is a multivalent rHVT lacking an insulator and was used as the counterpart of FW311 (Figure 4(c)). Similarly, FW261 is a multivalent rHVT lacking an insulator and was used as the counterpart of FW313 (Figure 8(a)).
[0175] To compare the amount of VP2 protein expressed between recombinant HVT / IBD-LT, the results of the Western blot assay were quantified using ImageJ and shown as bar graphs in Figure 5 (FW311) and Figure 8b (FW313). The relative density of the bands was measured against the vaccine control, FW169 (Figure 5). It was demonstrated that the insulator sequence can enhance VP2 protein expression compared to insulator-free rHVT in vitro.
[0176] Example 10: Efficacy of recombinant HVT / IBD-LT against virulent IBDV in SPF chickens (FW311) The efficacy of recombinant HVT / IBD-LT FW 311 was investigated in SPF chickens. One-day-old chickens were divided into four groups, and chickens in group 4 were subcutaneously vaccinated with approximately 3,000 plaque-forming units (pfu) / 0.2 mL of recombinant HVT / IBD-LT (FW311: group 4). Similarly, chickens in group 3 were subcutaneously vaccinated with a vaccine control (FW169). Chickens in group 2 (non-immunized, challenge-positive control) were left unvaccinated. Chickens in group 1 (non-immunized, non-challenge control) were left unvaccinated and unchallenged. Chickens were bled weekly between 1 and 4 weeks of age. Challenge was performed at 4 weeks of age. For challenge, 1 x 10 of virulent IBDV STC strain was used. 3 EID 50 was administered orally. Chickens were observed daily for clinical signs associated with IBD, such as depression and death. Seven days after challenge, chickens were necropsied and observed for macroscopic bursal lesions, such as edema, discoloration, atrophy, bleeding, and yellow or gelatinous exudate. Body and bursal weights were also measured at necropsy for calculation of the B / B index, which is the ratio between bursal weight and body weight of challenged birds divided by the same ratio of unchallenged birds.
[0177] The results of the IBDV ELISA are shown in Figure 6 and the results of the efficacy testing are summarized in Table III below.
[0178] Construct FW311 induced the synthesis of anti-VP2 antibodies.
[0179] [Table 3] * B / B index means cystic index ( ** ) Protection % = 100 - 100 × (number of deaths + number of lesions) / n.
[0180] The results confirm that FW311 is stable in vivo. The results further demonstrate that FW311 induces protective immunity against IBDV challenge infection in vivo.
[0181] Example 11: Efficacy of recombinant HVT / IBD-LT against virulent ILTV in SPF chickens (FW311) The efficacy of recombinant HVT / IBD-LT FW311 was investigated in SPF chickens. One-day-old chickens were divided into three groups, and chickens in group 3 were subcutaneously vaccinated with approximately 3,000 plaque-forming units (pfu) / 0.2 mL of recombinant HVT / IBD-LT FW311. Similarly, chickens in group 2 were subcutaneously vaccinated with a vaccine control (FW181). Chickens in group 1 (non-immunized, challenge-positive control) were left unvaccinated. Chickens were bled weekly between 1 and 4 weeks of age. Challenge was performed at 4 weeks of age. For challenge, 1 x 10 of the virulent ILTV US strain was used. 3 EID 50 was administered via the intratracheal route. The chickens were observed daily for clinical signs associated with ILTV, including rales, panting, neck extension, bloody sputum, nasal exudate, foamy eyes, watery eyes, mucous conjunctivitis, hemorrhagic nostrils, head swelling / eyes / face, head banging, ruffled feathers, depression and death. Ten days after challenge, the chickens were necropsied.
[0182] The efficacy results are summarized in Tables IV and V below.
[0183] [Table 4]
[0184] The results show that FW311 induces excellent protective immunity against ILTV challenge infection in vivo.
[0185] [Table 5] Clinical signs score = total points / surviving birds
[0186] The flock of chickens vaccinated with FW311 had very good clinical scores from day 3 post vaccination with an average clinical sign score of 0.02.
[0187] Taken together, these results indicate that the presence of an insulator in a multivalent rHVT increases the expression of the antigen under its influence without altering the synthesis and expression of the second antigen. Furthermore, the introduction of an insulator into the genome of rHVT does not affect the stability or efficacy of the virus.
[0188] Example 12: Efficacy of recombinant HVT / LBD-LT against virulent IBDV in SPF chickens (FW313) In relation to FW311 (Example 8), the efficacy of recombinant HVT / IBD-LT FW313 was investigated in SPF chickens. One-day-old chickens were divided into three groups, and chickens in Group 3 were subcutaneously vaccinated with approximately 3,000 plaque-forming units (pfu) / 0.2 mL of the recombinant HVT / IBD-LT of the present invention (FW313: Group 3). Chickens in Group 2 (non-immunized, challenge-positive control) were left unvaccinated. Chickens in Group 1 (non-immunized, non-challenge control) were left unvaccinated and unchallenged. Chickens were bled weekly between 1 and 4 weeks of age. Challenge was performed at 4 weeks of age. For the challenge, 1 x 10 of the virulent IBDV STC strain was used. 3 EID 50 was administered orally. Chickens were observed daily for clinical signs associated with IBD, such as depression and death. Seven days after challenge, chickens were necropsied and observed for macroscopic bursal lesions, such as edema, discoloration, atrophy, bleeding, and yellow or gelatinous exudate. Body and bursal weights were also measured at necropsy for calculation of the B / B index, which is the ratio between bursal weight and body weight of challenged birds divided by the same ratio of unchallenged birds.
[0189] The results of the efficacy studies are summarized in Table IV below.
[0190] Construct FW313 induced the synthesis of anti-VP2 antibodies.
[0191] [Table 6] ( * ) B / B index means cystic index ( ** ) Protection % = 100 - 100 × (number of deaths + number of lesions) / n.
[0192] The results confirm that FW313 is stable in vivo. The results further demonstrate that FW313 induces protective immunity against IBDV challenge infection in vivo.
Claims
1. A recombinant Marek's disease virus (rMDV) comprising a recombinant nucleotide sequence encoding an antigen inserted into an insertion site and operably linked to a promoter and an insulator, wherein the insulator is located upstream of the promoter.
2. 2. The rMDV of claim 1, wherein the insulator comprises one or more CCCTC binding factor (CTCF) motifs.
3. 3. The rMDV of claim 1 or claim 2, wherein the insulator comprises or consists of a functional fragment of the mouse 3' hypersensitive site 1 (m3'HS1) insulator.
4. The rMDV of claim 3, wherein the functional fragment of m3'HS1 comprises, consists essentially of, or consists of a nucleotide sequence set forth in SEQ ID NO: 4 or a nucleotide sequence that has at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 4 and retains insulator activity.
5. 5. The rMDV of any one of claims 1 to 4, comprising a first recombinant nucleotide sequence encoding a first antigen inserted into a first insertion site and a second recombinant nucleotide sequence encoding a second antigen inserted into a second insertion site different from the first insertion site, wherein the first recombinant nucleotide sequence encoding the antigen is operably linked to a promoter and an insulator located upstream of the promoter, and the second recombinant nucleotide sequence is operably linked to the promoter.
6. The rMDV of claim 5 , wherein the nucleotide sequences encode different antigens.
7. 7. The rMDV according to any one of claims 1 to 6, wherein the insertion site is located in a non-coding region of the viral genome, preferably selected from the non-coding regions between UL43 and UL47, between UL55 and SORF4, and between US1 and US3, more preferably selected from the non-coding regions located between UL44 and UL45, between UL45 and UL46, between UL55 and SORF4, between US10 and SORF3, and between SORF3 and US2, even more preferably selected from the non-coding regions located between UL44 and UL45, between UL45 and UL46, and between SORF3 and US2.
8. The rMDV according to any one of claims 1 to 7, wherein the recombinant nucleotide sequence encodes an antigen from an avian pathogen, preferably selected from a surface protein, a secreted protein and a structural protein of said avian pathogen, or an antigenic fragment thereof.
9. 9. The rMDV according to claim 8, which is selected from among an antibody to avian paramyxovirus type 1, preferably an F protein or an antigenic fragment thereof of Newcastle disease virus (NDV), an antibody to Gumboro disease virus, preferably a VP2 protein or an antigenic fragment thereof of infectious bursal disease (IBDV), an antibody to infectious laryngotracheitis virus (ILTV), preferably a gB protein or an antigenic fragment thereof, an antibody to Mycoplasma gallisepticum, preferably a 40K protein or an antigenic fragment thereof, and an antibody to avian influenza virus, preferably a surface protein hemagglutinin (HA) or an antigenic fragment thereof.
10. 10. The rMDV of any one of claims 1 to 9, wherein the promoter controlling the expression of the recombinant nucleotide sequence is selected from among a chicken beta-actin (Bac) promoter, a Pec promoter, a murine cytomegalovirus (Mcmv) immediate early (ie) 1 promoter, a human cytomegalovirus promoter (Hcmv), a simian virus 40 (SV40) promoter, and a Rous sarcoma virus (RSV) promoter, or any fragment thereof that retains promoter activity.
11. The rMDV of any one of claims 1 to 10, which is a recombinant herpesvirus of turkeys (rHVT).
12. 12. The rMDV of any one of claims 1 to 11, comprising a first recombinant nucleotide sequence inserted into the non-coding region located between UL44 and UL45 and a second recombinant nucleotide sequence inserted into the non-coding region located between UL45 and UL46, wherein the first recombinant nucleotide sequence encoding an antigen is operably linked to a promoter and an insulator located upstream of the promoter, and the second recombinant nucleotide sequence is operably linked to a promoter.
13. 12. The rMDV of any one of claims 1 to 11, comprising a first recombinant nucleotide sequence inserted into the non-coding region located between UL44 and UL45 and a second recombinant nucleotide sequence inserted into the non-coding region located between UL45 and UL46, wherein the first recombinant nucleotide sequence encoding an antigen is operably linked to a promoter, and the second recombinant nucleotide sequence is operably linked to a promoter and an insulator located upstream of the promoter.
14. 14. The rMDV of claim 12 or claim 13, wherein the recombinant nucleotide sequence encodes the VP2 protein of IBDV or an antigenic fragment thereof, and the second recombinant nucleotide sequence encodes the gB protein of ILTV or an antigenic fragment thereof.
15. 15. The rMDV according to any one of claims 11 to 14, wherein a first recombinant nucleotide sequence encoding an IBDV VP2 protein or an antigenic fragment thereof, operably linked to a promoter, preferably a Bac promoter, and to an m3'HS1 insulator or a functional fragment thereof located upstream of the Bac promoter, is inserted into a first insertion site located in the non-coding region between UL45 and UL46, and a second recombinant nucleotide sequence encoding an ILTV gB protein or an antigenic fragment thereof, operably linked to a promoter, preferably an Mcmv ie1 promoter, is inserted into a second insertion site located in the non-coding region between UL44 and UL45, wherein the functional fragment of the m3'HS1 insulator comprises or consists of a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO:4 and retaining insulator activity.
16. 15. The rMDV of any one of claims 11 to 14, wherein a first recombinant nucleotide sequence encoding an IBDV VP2 protein or an antigenic fragment thereof, operably linked to a promoter, preferably the Mcmv ie1 promoter, and to an m3'HS1 insulator or a functional fragment thereof located upstream of the Mcmv ie1 promoter, is inserted into a first insertion site located in the non-coding region between UL44 and UL45; and a second recombinant nucleotide sequence encoding an ILTV gB protein or an antigenic fragment thereof, operably linked to a promoter, preferably the Pec promoter, is inserted into the second insertion site located in the non-coding region between UL45 and UL46, wherein the functional fragment of the m3'HS1 insulator comprises or consists of a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO:4 and retaining insulator activity.
17. 12. The rMDV of any one of claims 1 to 4, or any one of claims 7 to 11 when dependent on any one of claims 1 to 4, comprising a single recombinant nucleotide sequence encoding an antigen, said single recombinant nucleotide sequence being operably linked to a promoter and an insulator located upstream of said promoter.
18. 18. The rMDV of claim 17, wherein the single recombinant nucleotide sequence is inserted into an insertion site located in the non-coding region between UL45 and UL46.
19. 19. The rMDV of claim 17 or 18, wherein a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a Bac promoter and a functional fragment of the m3'HS1 insulator located upstream of the Bac promoter, is inserted into an insertion site located in the non-coding region between UL45 and UL46, and wherein the functional fragment of the m3'HS1 insulator comprises or consists of a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 4, and retaining insulator activity.
20. 19. The rMDV of claim 17 or 18, wherein a recombinant nucleotide sequence encoding the F protein or an antigenic fragment thereof, operably linked to a Bac promoter and a functional fragment of the m3'HS1 insulator located upstream of the Bac promoter, is inserted into an insertion site located in the non-coding region between UL45 and UL46, and wherein the functional fragment of the m3'HS1 insulator comprises or consists of a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence set forth in SEQ ID NO: 4, and retaining insulator activity.
21. 21. A host cell comprising an rMDV according to any one of claims 1 to 20, or a nucleic acid molecule comprising, consisting essentially of, or consisting of the genome of an rMDV according to any one of claims 1 to 20.
22. A vaccine composition comprising the rMDV of any one of claims 1 to 20 and a pharmaceutically acceptable vehicle.
23. 23. A vaccination kit for immunizing avian species comprising the vaccine composition of claim 22, a means for administering the vaccine composition to the species, and optionally instructions for administering the vaccine composition.
24. 23. An rMDV according to any one of claims 1 to 20 or a vaccine composition according to claim 22 for use in vaccinating avian species such as poultry, preferably chickens, against at least one avian pathogen.
25. 23. The rMDV of any one of claims 1 to 20 or the vaccine composition of claim 22 for use in inducing early onset of immunity against at least one avian pathogen in avian species such as poultry, preferably chickens.
26. 17. The rMDV or vaccine composition comprising said rMDV according to claim 15 or claim 16, for use in vaccinating birds such as poultry, preferably chickens, against infectious bursal disease virus (IBDV) and infectious laryngotracheitis virus (ILVT).
27. 20. The rMDV of claim 19, or a vaccine composition comprising said rMDV, for use in vaccinating avian species such as poultry, preferably chickens, against infectious bursal disease virus (IBDV).
28. 21. The rMDV of claim 20, or a vaccine composition comprising said rMDV, for use in vaccinating avian species such as poultry, preferably chickens, against Newcastle Disease Virus (NDV).
29. 23. A method of immunizing or vaccinating avian species such as poultry, preferably chicken, against an avian pathogen by administering to said avian species an immunologically effective amount of an rMDV according to any one of claims 1 to 20, or a vaccine according to claim 22.
30. A method for increasing the onset of immunity against an avian pathogen in an avian species such as poultry, preferably chicken, by administering to said avian species an immunologically effective amount of an rMDV according to any one of claims 1 to 20, or a vaccine according to claim 22.
31. 31. The method of claim 29 or claim 30, wherein the rMDV is administered orally, ophthalmically, by oculonasal administration using an aerosol, intranasally, by cloacal administration, by mucosal administration, intraembryonic administration, or by injection.