Ultraminimal inverted terminal repeat (ITR) sequences and their use
Ultraminiature piggyBac ITR sequences enhance transposition frequency and stability, addressing integration and excision inefficiencies in existing transposon designs, facilitating effective gene delivery for therapeutic applications.
Patent Information
- Application Number
- JP2025558122
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-05
- Filing Date
- 2024-04-04
- Publication Date
- 2026-05-26
AI Technical Summary
Existing transposon ITR designs for transposases like piggyBac (PB) do not optimize integration and excision activities, necessitating improvements for efficient gene delivery and therapeutic applications.
Development of ultraminiature piggyBac inverted terminal repeat (ITR) sequences that enhance transposition frequency and plasmid stability, utilizing minimal ITRs and specific transposases such as SPB, TAL-ssPBx, and ZNF-ssSPB fusion proteins for targeted gene delivery.
The ultraminiature ITR sequences improve the frequency and stability of transposition, enabling effective delivery of therapeutic genes for treating genetic disorders like cancer, liver diseases, urea cycle disorders, and hemophilia.
Smart Images

Figure 2026516596000001 
Figure 2026516596000002 
Figure 2026516596000003
Abstract
Description
Cross - reference to related applications
[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 494,300, filed on April 5, 2023, which is hereby incorporated by reference in its entirety.
[0002] Reference to electronically - submitted sequence listings This application includes a sequence listing submitted in XML format via Patent Center, which is hereby incorporated by reference in its entirety. The XML copy created on March 19, 2024, is named "POTH - 081_001WO_SeqList" and has a size of 101,935 bytes.
Technical Field
[0003] The present disclosure generally relates to hyper - minimal transposon inverted repeat (ITR) polynucleotides, compositions comprising such polynucleotides, and methods of ex vivo and in vivo delivery of nucleic acids to cells, particularly methods of using compositions comprising such polynucleotides for in vivo delivery of therapeutic genes for treating genetic disorders or diseases.
Background Art
[0004] Transposases can be used to introduce non - endogenous DNA sequences into genomic DNA and are advantageous in many respects compared to other methods of gene editing. However, there remains an unmet need for improvements in transposon ITR design to enhance the integration and / or excision activity of transposases ex vivo or in vivo.
[0005] The piggyBac (PB) transposase contains two distinct DNA-binding domains that interact with the inverted terminal repeat (ITR) sequence of the transposon. The DNA-binding and dimerizing domain (DDBD) binds to the proximal sequence of the TTAA site adjacent to the transposon, while the cysteine-rich domain (CRD) at the C-terminus of the protein binds to the distal sequence of the TTAA site. When the transposase dimerizes, the DDBDs bind symmetrically to the ITR, with one monomeric DDBD binding to the left-end (LE) ITR and the second monomeric DDBD binding to the (RE) ITR, while the two CRDs of the dimer bind asymmetrically, both binding to the LE ITR. Based on sequence homology, the RE ITR is predicted to contain two CRD-binding sites, suggesting that the second dimer of the PB transposase may bind distally to the first dimer. The proximal dimer catalyzes the rearrangement reaction, while the distal dimer is hypothesized to stabilize the formation of the hairpin structure that brings LE and RE together, which is a prerequisite for the rearrangement to occur.
[0006] The DDBD and CRD of the PB transposase bind to the ITR in a sequence-specific manner. The LE ITR contains approximately 35 bp of DNA, and the RE ITR is approximately 63 bp long. The DDBD interacts with approximately 10 bp of DNA located 6 bp away from the TTAA sequence adjacent to the transposon. The binding of the DDBD is symmetric, with one transposase monomer binding to the LE ITR and a second monomer binding to the RE ITR. The dimer's CRD domain binds to a 19 bp sequence on the LE ITR located immediately distal to the DDBD binding site. CRD binding is asymmetric, with both CRD domains of the dimer interacting only with the 19 bp sequence on the LE ITR. The RE ITR contains a second DDBD binding sequence followed by a 19 bp CRD binding sequence starting 34 bp from the TTAA, which is a potential second dimer PB transposase binding site.
[0007] In nature, the 5' untranslated region (UTR) and the 3' UTR are seen to be directly adjacent to the LE ITR and RE ITR of the transposon, respectively, with the coding sequence of the PB transposase juxtaposed between the UTRs. The PB 5' UTR and 3' UTR are not required for translocation. However, since the 5' UTR and 3' UTR, or at least a portion thereof, are thought to increase the rate of translocation via an undocumented mechanism, they are often retained in recombinant transposon constructs for DNA delivery. Based on sequence homology, the 5' UTR is hypothesized to contain sequences that share a reasonable degree of similarity with the PB transposase binding site.
[0008] Generally, the LE ITR and 5' UTR together contain 328 bp of DNA, whereas the RE ITR and 3' UTR together contain 359 bp. In some transposon constructs, the distal 5' UTR end of TTAA can be cleaved, resulting in a 309 bp LE ITR + 5' UTR length. Similarly, the distal 3' UTR end of TTAA is cleaved, resulting in a 238 bp RE ITR + 3' UTR length. The combined 309 bp LE ITR / 5' UTR and 238 bp RE ITR / 3' UTR are often referred to as the "complete ITR".
[0009] Transposon ITR sequences with a deleted 5' UTR (generating a 35 bp LE ITR) and ITR sequences with a deleted 3' UTR (generating a 63 bp RE ITR) are referred to as the "minimal LE PB ITR" and "minimal RE ITR", respectively. Such minimal ITRs are provided herein. SUMMARY OF THE INVENTION
[0010] In one embodiment, a polynucleotide encoding a transposon comprising an ultraminiature piggyBac right-end (RE) inverted terminal repeat (ITR) and left-end (LE) minimal ITR sequence is provided herein, wherein the ultraminiature piggyBac RE ITR comprises the nucleic acid sequence shown in any one of SEQ ID NOs: 3-9 and 46-67, and the LE ITR comprises the sequence of SEQ ID NO: 1. In some embodiments, the transposon is a piggyBac transposon or a piggyBac-like transposon.
[0011] In some embodiments, the polynucleotide further comprises at least one exogenous nucleic acid sequence. In some embodiments, at least one exogenous nucleic acid sequence encodes an antigen receptor that does not exist in nature. In some embodiments, at least one exogenous nucleic acid sequence encodes a therapeutic polypeptide. In some embodiments, the therapeutic polypeptide is a factor VIII polypeptide, a factor IX polypeptide, phenylalanine hydroxylase (PAH), an ornithine transcarbamylase (OTC) polypeptide, or a methylmalonyl-CoA mutase (MUT1) polypeptide.
[0012] In some embodiments, the polynucleotide further comprises a promoter sequence. In some embodiments, the RE ITR is reverse-oriented and / or the LE ITR is reverse-oriented.
[0013] In another embodiment, a vector comprising a polynucleotide described herein is provided herein.
[0014] In another embodiment, cells containing polynucleotides provided herein are provided herein.
[0015] In another embodiment, a pharmaceutical composition comprising cells provided herein and a pharmaceutically acceptable carrier is provided herein.
[0016] In another embodiment, a transposon is provided herein that, in the 5'→3' direction, sequentially comprises (i) a left-end (LE) inverted-end repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a naturally occurring antigen receptor, and (iv) a reverse complementary sequence of the ultraminor right-end (RE) inverted-end repeat (ITR) sequence.
[0017] In another embodiment, a transposon is provided herein that, in the 5'→3' direction, sequentially comprises (i) a left-end (LE) inverted-end repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide, and (iv) an inverse complementary sequence of the ultraminor right-end (RE) inverted-end repeat (ITR) sequence.
[0018] In another embodiment, a transposon is provided herein that, in the 5'→3' direction, sequentially comprises (i) a right-end (RE) inverted-end repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a naturally occurring antigen receptor, and (iv) a reverse complementary sequence of an ultraminor left-end (LE) inverted-end repeat (ITR) sequence.
[0019] In another embodiment, a transposon is provided herein that, in the 5'→3' direction, sequentially comprises (i) a right-end (RE) inverted terminal repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide, and (iv) an inverse complementary sequence of an ultraminor left-end (LE) inverted terminal repeat (ITR) sequence.
[0020] In some embodiments, the therapeutic polypeptide is factor VIII polypeptide, factor IX polypeptide, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC) polypeptide, or methylmalonyl-CoA mutase (MUT1) polypeptide.
[0021] In another embodiment, a method for treating a disease or disorder in a subject requiring treatment of the disease or disorder is provided herein, comprising administering to the subject (i) at least one therapeutically effective dose of a vector or transposon described herein, and (ii) a transposase, or a nucleic acid or nucleic acid sequence encoding a transposase enzyme. In some embodiments, the transposase is an SPB transposase, a TAL-ss-SPB PBx transposase fusion protein, or a ZNF-ssSPB transposase fusion protein.
[0022] In another embodiment, a method for treating a disease or disorder in a subject requiring treatment of the disease or disorder is provided herein, comprising administering at least one therapeutically effective dose of cells described herein to the subject. In some embodiments, the disease or disorder is cancer, liver disease or disorder, urea cycle disorder, metabolic liver disorder or hemophilia.
[0023] All documents cited herein, including patents or applications, that are cross-referenced or related, are incorporated herein by reference in their entirety for all purposes unless expressly excluded or otherwise limited. No citation of any document constitutes prior art relating to any invention disclosed or claimed herein, nor does it teach, suggest, or disclose any such invention, either alone or in combination with any other reference. [Modes for carrying out the invention]
[0024] This specification provides ultraminiature PB transposon inverted terminal repeat (ITR) sequences, particularly ultraminiature PB transposon right-end (RE) ITR polynucleotides, transposons containing ultraminiature PB ITR polynucleotides, and methods of use thereof. Minimal ITRs are considered advantageous because they improve the frequency of transposition. While we do not wish to be constrained by theory, shorter sequences are thought to improve transposition by reducing transposition and plasmid size. Furthermore, since left and right ITRs are sequence-similar, ultraminiature ITRs can reduce plasmid repeatability and improve its stability when it is produced.
[0025] Furthermore, there are provided a method for treating a disease or disorder in a subject requiring treatment of the disease or disorder, comprising administering at least one therapeutically effective dose of a polynucleotide, transposon, vector, cell or composition described herein to the subject. In some embodiments, the disease or disorder is cancer, liver disease or disorder, urea cycle disorder, metabolic liver disorder or hemophilia.
[0026] Dislocation system Transposase The ultraminor transposons described herein can be introduced into cells using any suitable transposase. In some embodiments, the transposase is piggyBac transposase. In some embodiments, the transposase is super piggyBac (SPB) transposase. In some embodiments, a TAL-ssPBx fusion protein is used, which includes a TAL array that targets DNA sequences adjacent to the upstream and downstream of the TTAA integration site fused to a piggyBac transposase, for example, containing an N-terminal deletion of amino acids 1-93, four superactive SPB mutations, and further mutations that cause transposase integration loss but retain normal excision activity (PBx).
[0027] The transposons of this disclosure may be piggyBac(PB) transposons. In certain embodiments, the transposons include ultraminiature transposons ITR. In some embodiments, the transposons are delivered to cells using nanotransposons. Nanotransposons are described, for example, in International Patent Application Publication No. 2020132396, which is incorporated herein by reference in its entirety, with respect to examples of nanotransposons that may be used to deliver the transposons described herein to cells.
[0028] In one embodiment, a polynucleotide encoding a transposon is provided herein, comprising an ultraminiature piggyBac right-terminal (RE) inverted terminal repeat (ITR) sequence and a left-terminal (LE) minimal ITR sequence.
[0029] It will be apparent to those skilled in the art that, as long as the 3' ITR sequence is the reverse complementary sequence of the 5' ITR sequence, the RE ITR may be located on the 5' side of the LE ITR or on the 3' side of the LE ITR. Thus, in another embodiment, a transposon is provided herein comprising, in the 5'→3' direction, in order: (i) a left-end (LE) reversed-end repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide or an antigen receptor not naturally occurring, and (iv) a reverse complementary sequence of an ultraminor right-end (RE) reversed-end repeat (ITR) sequence.
[0030] In another embodiment, a transposon is provided herein that, in the 5'→3' direction, sequentially comprises: (i) a right-end (RE) inverted-end repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide or an antigen receptor not naturally occurring, and (iv) a reverse complementary sequence of an ultraminor left-end (LE) inverted-end repeat (ITR) sequence.
[0031] In certain embodiments, the ultraminiature transposon ITR is the ultraminiature piggyBac right-end (RE) ITR provided herein. In some embodiments, the ultraminiature piggyBac RE ITR comprises the nucleic acid sequence shown in any one of SEQ ID NOs: 3-9 or 46-67.
[0032] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCA (SEQ ID NO: 9). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 9. In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATA (SEQ ID NO: 8). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 8. In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTG (SEQ ID NO: 7). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 7. In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTA (SEQ ID NO: 6). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 6.In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTA (SEQ ID NO: 5). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 5. In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGAT (SEQ ID NO: 4). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 4. In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCA (SEQ ID NO: 3). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 3.
[0033] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATC (SEQ ID NO: 46). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 46.
[0034] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCAT (SEQ ID NO: 47). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 47.
[0035] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATAT (SEQ ID NO: 48). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 48.
[0036] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATT (SEQ ID NO: 49). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 49.
[0037] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTG (SEQ ID NO: 50). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 50.
[0038] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGT (SEQ ID NO: 51). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 51.
[0039] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGA (SEQ ID NO: 52). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 52.
[0040] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGAC (SEQ ID NO: 53). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 53.
[0041] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACG (SEQ ID NO: 54). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 54.
[0042] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGT (SEQ ID NO: 55). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 55.
[0043] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTAC (SEQ ID NO: 56). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 56.
[0044] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACG (SEQ ID NO: 57). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 57.
[0045] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGT (SEQ ID NO: 58). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 58.
[0046] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTT (SEQ ID NO: 59). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 59.
[0047] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAA (SEQ ID NO: 60). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 60.
[0048] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAA (SEQ ID NO: 61). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 61.
[0049] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAG (SEQ ID NO: 62). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 62.
[0050] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGA (SEQ ID NO: 63). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 63.
[0051] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATA (SEQ ID NO: 64). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 64.
[0052] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAA (SEQ ID NO: 65). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 65.
[0053] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAAT (SEQ ID NO: 66). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 66.
[0054] In some embodiments, the ultraminiature RE PB ITR includes the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATC (SEQ ID NO: 67). In some embodiments, the ultraminiature RE PB ITR includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 67.
[0055] In some embodiments, the transposon further comprises a piggyBac left-end (LE) minimal ITR sequence containing the nucleic acid sequence of SEQ ID NO: 1.
[0056] In some embodiments where the transposon is a PB transposon, the transposase is piggyBac®(PB) transposase, piggyBac-like(PBL) transposase, or Super piggyBac®(SPB) transposase. Preferably, the sequence encoding the SPB transposase is an mRNA sequence.
[0057] Non-limiting examples of PB transposons and PB, PBL, and SPB transposases are described herein by reference in U.S. Patent No. 6,218,182; U.S. Patent No. 6,962,810; U.S. Patent No. 8,399,643 and International Publication No. 2010 / 099296, each of which is incorporated herein by reference in its entirety.
[0058] While we do not wish to be constrained by theory, it is thought that PB, PBL, and SPB transposases recognize transposon-specific inverted terminal repeats (ITRs) at the ends of transposons and then insert nucleotide sequences located between the transposon's ITRs at the target site. The target sequences of PB or PBL transposons are 5'-TTAT-3', 5'-TTAA-3', 5'-CTAA-3', 5'-TTAG-3', 5'-ATAA-3', 5'-TCAA-3', 5'AGTT-3', 5'-ATTA-3', 5'-GTTA-3', 5'-TTGA -3', 5'-TTTA-3', 5'-TTAC-3', 5'-ACTA-3', 5'-AGGG-3', 5'-CTAG-3', 5'-TGAA-3', 5'-AGGT-3', 5'-ATCA-3', 5'-CTCC-3', 5'-TAAA-3', 5'-TCTC-3', 5'T These include, or may consist of, GAA-3', 5'-AAAT-3', 5'-AATC-3', 5'-ACAA-3', 5'-ACAT-3', 5'-ACTC-3', 5'-AGTG-3', 5'-ATAG-3', 5'-CAAA-3', 5'-CACA-3', 5'-CATA-3', 5'-CCAG-3', 5'-CCCA-3', 5'-CGTA-3', 5'-GTCC-3', 5'-TAAG-3', 5'-TCTA-3', 5'-TGAG-3', 5'-TGTT-3', 5'-TTCA-3', 5'-TTCT-3', or 5'-TTTT-3'. In some embodiments, there are no size limitations on the target gene that can be included between ITRs in the PB or PBL transposon system.
[0059] Exemplary amino acid sequences of one or more PB, PBL, and SPB transposases are disclosed in U.S. Patent No. 6,218,185; U.S. Patent No. 6,962,810; and U.S. Patent No. 8,399,643, each of which is incorporated herein by reference in its entirety as an example of a transposase that may be used with the transposons described herein.
[0060] PB or PBL transposases include, or may consist of, an amino acid sequence having two or more, three or more, or each of the amino acid substitutions at positions 30, 165, 226, 282, or 538 (numbering begins at the 12th amino acid of SEQ ID NO: 45) of the sequence of SEQ ID NO: 45. In some embodiments, the amino acid substitutions are hyperactive amino acid substitutions. The transposase may be an SPB transposase, which includes, or consists of, an amino acid sequence of the sequence of SEQ ID NO: 45 having one, two, three, or all of the hyperactive amino acid substitutions I30V, G165S, M226F, M282V, and N538K (numbering begins at the 12th amino acid of SEQ ID NO: 45). In some embodiments, the SPB transposase contains an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence shown in SEQ ID NO: 45. In some embodiments, the SPB transposase contains an amino acid sequence shown in SEQ ID NO: 45 having one, two, three, four, or five conservative amino acid substitutions. In some embodiments, the SPB transposase contains an amino acid sequence shown in SEQ ID NO: 45.
[0061] Formulation, dosage, and method of administration This disclosure provides formulations, dosages, and methods of administration of compositions and cells as described herein. In one embodiment, a pharmaceutical composition comprising a tandem dimer transposase as described herein and a pharmaceutically acceptable carrier is provided herein. In another embodiment, a pharmaceutical composition comprising modified cells as described herein and a pharmaceutically acceptable carrier is provided herein.
[0062] The disclosed compositions and pharmaceutical compositions may contain, but are not limited to, at least one suitable adjuvant, such as diluents, binders, stabilizers, buffers, salts, lipophilic solvents, preservatives, and adjuvants. A pharmaceutically acceptable adjuvant is preferred. Non-limited examples of such sterile solutions and methods for their preparation are well known in the art, for example, but are not limited to Gennaro, Ed., Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co. (Easton, Pa.) 1990 and "Physician's Desk Reference", 52nd ed., Medical Economics (Montvale, NJ) 1998. A pharmaceutically acceptable carrier suitable for the dosage, solubility, and / or stability of the protein backbone, fragment, or variant composition can be routinely selected, as is well known in the art or as described herein.
[0063] Non-limiting examples of pharmaceutical excipients and additives suitable for use include proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars including monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides, derivatized sugars such as alditol, aldonic acid, and esterified sugars, as well as polysaccharides or sugar polymers), which can exist alone or in combination, and which together constitute 1 to 99.99% by weight or volume. Non-limiting examples of protein excipients include serum albumins such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, and casein. Representative amino acid / protein components that can also function in buffering capacity include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, and aspartame. One preferred amino acid is glycine.
[0064] Non-limiting examples of carbohydrate excipients suitable for use include monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, and sorbose; disaccharides such as lactose, sucrose, trehalose, and cellobiose; polysaccharides such as raffinose, meletitose, maltodextrin, dextran, and starch; and algitols such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol), and myo-inositol. Preferably, the carbohydrate excipient is mannitol, trehalose, and / or raffinose.
[0065] This composition may also contain a buffer or pH adjuster, typically a buffer being a salt prepared from an organic acid or base. Typical buffers include organic acid salts such as citric acid, ascorbic acid, gluconic acid, carbonate, tartaric acid, succinic acid, acetic acid, and phthalic acid salts, Tris, tromethamine hydrochloride, or phosphate buffer. Preferred buffers are organic acid salts such as citrate.
[0066] Furthermore, the disclosed compositions may include polymer excipients / additives, such as polyvinylpyrrolidone, Ficol (polymer sugar), dextrose (e.g., cyclodextrin, e.g., 2-hydroxypropyl-β-cyclodextrin), polyethylene glycol, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, surfactants (e.g., polysorbates, e.g., "TWEEN20" and "TWEEN80"), lipids (e.g., phospholipids, fatty acids), steroids (e.g., cholesterol), and chelating agents (e.g., EDTA).
[0067] Many known and developed methods can be used to administer a therapeutically effective amount of the composition or pharmaceutical composition disclosed herein. Non-limiting examples of administration methods include bolus, buccal, injection, intra-articular, intra-bronchial, intraperitoneal, intrasacral, intracartilaginous, intracerebral, intracolic, intracervical, intragastric, intrahepatic, intrafocal, intramuscular, intramyocardial, transnasal, intraocular, intraosseous, intraosteal, intrapelvic, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal cord, synovial, intrathoracic, intrauterine, intratumoral, intravenous, intrabladder, oral, parenteral, rectal, sublingual, subcutaneous, percutaneous, or vaginal means. In preferred embodiments, the composition comprising the modified cells described herein is administered intravenously, for example, by intravenous infusion.
[0068] The compositions of this disclosure can be prepared, in particular, in the form of liquid solutions or suspensions, for use in parenteral administration (subcutaneous, intramuscular, or intravenous) or any other administration. For parenteral administration, the compositions disclosed herein may be formulated together with a parenteral vehicle that is pharmaceutically acceptable as a solution, suspension, emulsion, particles, powder, or lyophilized powder, or may be provided separately from the parenteral vehicle.
[0069] Parenteral formulations may contain common excipients such as sterile water or saline solution, polyalkylene glycols such as polyethylene glycol, plant-derived oils, and hydrogenated naphthalene. Aqueous or oily suspensions for injection can be prepared according to known methods using appropriate emulsifiers or humectants and suspending agents. Injectable or injectable formulations may be non-toxic, non-oral diluents such as aqueous solutions, sterile injection solutions, or suspensions in solvents.
[0070] Suitable vehicles or solvents include water, Ringer's solution, isotonic saline, etc., and sterile non-volatile oils can be used as ordinary solvents or suspension solvents. For these purposes, all kinds of non-volatile oils and fatty acids can be used, including natural, synthetic, or semi-synthetic fatty oils or fatty acids, and natural, synthetic, or semi-synthetic mono-, di-, or tri-glycerides. Parenteral administration is known in the art and is not limited to conventional injection methods, including gas-pressurized needleless injection devices as described in U.S. Patent No. 5,851,198, and laser puncture devices as described in U.S. Patent No. 5,839,446.
[0071] It may be desirable to deliver the disclosed compound to a subject in a single dose over a long period, for example, from one week to one year. Various sustained-release, depot, or implantable dosage forms can be used. For example, the dosage form may include a pharmaceutically acceptable non-toxic salt of the compound with low solubility in body fluids, e.g., (a) an acid addition salt with a polybasic acid, e.g., phosphoric acid, sulfuric acid, citrate, tartaric acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalene mono or disulfonic acid, polygalacturonic acid, etc.; (b) a salt with a polyvalent metal cation, e.g., zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, etc., or a salt with an organic cation formed from, for example, N,N'-dibenzyl ethylenediamine or ethylenediamine; or (c) a combination of (a) and (b), e.g., zinc tannate. Furthermore, the disclosed compounds, or preferably relatively insoluble salts, such as those just described, can be formulated into gels suitable for injection, such as aluminum monostearate gel containing sesame oil. Particularly preferred salts include zinc salts, zinc tannate salts, and pamoate salts.
[0072] Another type of sustained-release depot formulation for injection contains a compound or salt dispersed for encapsulation in a slowly degradable, non-toxic, non-antigenic polymer, such as polylactic acid / polyglycolic acid polymer, as described, for example, in U.S. Patent No. 3,773,919. This compound, or preferably a relatively insoluble salt, for example, the above, can also be formulated into cholesterol matrix silastic pellets, particularly for use in animals. Further sustained-release formulations, depot formulations, or implant formulations, such as gaseous or liquid liposomes, are known in the literature (U.S. Patent No. 5,770,222 and "Sustained and Controlled Release Drug Delivery Systems," JR Robinson ed., Marcel Dekker, Inc., NY, 1978).
[0073] Treatment methods This disclosure provides the use of the disclosed composition or pharmaceutical composition for treating a disease or disorder in a cell, tissue, organ, animal, or subject, as known in the art or as described herein, for example, by administering or contacting a therapeutically effective amount of the composition or pharmaceutical composition to a cell, tissue, organ, animal, or subject. In some embodiments, the subject is a mammal. Preferably, the subject is a human. The terms “subject” and “patient” are used interchangeably herein.
[0074] In some embodiments, the treatment of a disease or disorder includes adoptive cell therapy. For example, in some embodiments, the disclosure provides modified cells expressing a chimeric antigen receptor (CAR). Transposons described herein may be used to produce such modified cells. The modified cells may be allogeneic or autologous to the patient. In some preferred embodiments, the modified cells are allogeneic cells. In some embodiments, the modified cells are autologous T cells or modified autologous CAR T cells. In some preferred embodiments, the modified cells are allogeneic T cells or modified allogeneic CAR T cells.
[0075] In some embodiments, the disease or disorder treated according to the methods described herein is cancer. Non-limiting examples of cancer include leukemia, acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphoblastic leukemia, B cell, T cell, or FAB. Examples include ALL, acute myeloid leukemia (AML), acute myeloid leukemia, chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), lymphoma, Hodgkin's disease, malignant lymphoma, non-Hodgkin lymphoma, Burkitt lymphoma, multiple myeloma, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, nasopharyngeal cancer, malignant histiocytosis, paraneoplastic syndromes / hypercalcemia of malignant tumors, solid tumors, bladder cancer, breast cancer, colorectal cancer, endometrial cancer, head cancer, cervical cancer, hereditary nonpolyposis cancer, Hodgkin lymphoma, liver cancer, lung cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell carcinoma, testicular cancer, adenocarcinoma, sarcoma, malignant melanoma, hemangioma, metastatic disease, cancer-related bone resorption, and cancer-related bone pain.
[0076] In another non-limiting example, the present disclosure provides a method for treating a metabolic liver disorder in a subject, comprising administering to the subject: a) at least one therapeutically effective amount of at least one composition comprising at least one transposon of the present disclosure comprising a sequence encoding a therapeutic polypeptide; and b) at least one therapeutically effective amount of a composition comprising at least one nucleic acid sequence encoding at least one transposase. In some embodiments, the metabolic liver disorder may be ornithine transcarbamylase (OTC) deficiency, and the at least one therapeutic protein may comprise an ornithine transcarbamylase (OTC) polypeptide. In some embodiments, the metabolic liver disorder may be methylmalonic acidemia (MMA), and the at least one therapeutic protein may comprise a methylmalonyl-CoA mutase (MUT1) polypeptide.
[0077] In a non-limiting example, the present disclosure provides a method for treating a hemophilic disorder in a subject, comprising administering to the subject: a) at least one therapeutically effective amount of at least one composition comprising at least one transposon of the present disclosure comprising a sequence encoding a therapeutic polypeptide; and b) at least one therapeutically effective amount of a composition comprising at least one nucleic acid sequence encoding at least one transposase. In some embodiments, the hemophilic disorder may be hemophilia A, and the at least one therapeutic protein may comprise factor VIII. In some embodiments, the hemophilic disorder may be hemophilia B, and the at least one therapeutic protein may comprise factor IX.
[0078] In a non-limiting example, the present disclosure provides a method for treating phenylketonuria (PKU) in a subject, comprising administering to the subject: a) at least one therapeutically effective amount of at least one composition comprising at least one transposon of the present disclosure comprising a sequence encoding a phenylalanine hydroxylase gene; and b) at least one therapeutically effective amount of a composition comprising at least one nucleic acid sequence encoding at least one transposase.
[0079] In non-limiting examples, the disclosure provides a method for treating a disease or disorder in a subject by administering a therapeutically effective amount of an LNP composition comprising a DNA transposon encoding a therapeutic protein containing an ultraminor ITR and mRNA encoding a piggyBac transposase to the subject in need of treatment for the disease or disorder. In some embodiments, the disease or disorder is cancer, liver disease or disorder, urea cycle disorder, metabolic liver disorder, or hemophilia.
[0080] In a non-limiting example, the present disclosure provides a method of treating a disease or disorder in a subject by administering to the subject a first LNP composition comprising a DNA transposon encoding a therapeutic protein comprising a super-minimal ITR at a therapeutically effective amount and a second LNP composition comprising mRNA encoding a piggyBac transposase. In some embodiments, the disease or disorder is cancer, a liver disease or disorder, a urea cycle disorder, a metabolic liver disorder or a hemophilia disease. In some embodiments, the disease or disorder is an autoimmune disease. In one embodiment, the autoimmune disease is autoimmune neutropenia, Guillain-Barré syndrome, epilepsy, autoimmune encephalitis, Isaac's syndrome, nevus syndrome, pemphigus vulgaris, pemphigus foliaceus, bullous pemphigoid, epidermolysis bullosa acquisita, pemphigoid gestationis, mucous membrane pemphigoid, antiphospholipid antibody syndrome, autoimmune anemia, myasthenia gravis, autoimmune Graves' disease, thyroid eye disease (TED), Goodpasture's syndrome, multiple sclerosis, rheumatoid arthritis, lupus, idiopathic thrombocytopenic purpura (ITP), warm autoimmune hemolytic anemia (WAIHA), chronic inflammatory demyelinating polyneuropathy (CIDP), lupus nephritis, or membranous nephropathy.
[0081] The dosage of the pharmaceutical composition administered to the subject can vary depending on known factors such as the pharmacodynamic properties of the particular agent, its mode and route of administration, the age, health status, and weight of the recipient, the nature and extent of the symptoms, the type of concurrent treatment, the frequency of treatment, and the desired effect.
[0082] In an aspect where the composition administered to the subject that requires administration of the composition is the modified cell disclosed herein, about 1x10 3 ~ about 1x10 4 cells, about 1x10 4 ~ about 1x10 5 cells, about 1x10 5 ~ about 1x10 6 cells, about 1x10 6 ~ about 1x10 7 cells, about 1x10 7 ~ about 1x10 8 cells, about 1x10 8 ~ about 1x109 Each cell, approximately 1 x 10⁶ 9 ~approximately 1x10 10 Each cell, approximately 1 x 10⁶ 10 ~approximately 1x10 11 Each cell, approximately 1 x 10⁶ 11 ~approximately 1x10 12 Each cell, approximately 1 x 10⁶ 12 ~approximately 1x10 13 Each cell, approximately 1 x 10⁶ 13 ~approximately 1x10 14 Each cell, approximately 1 x 10⁶ 14 ~approximately 1x10 15 Each cell, approximately 1 x 10⁶ 15 ~approximately 1x10 16 Each cell, approximately 1 x 10⁶ 16 ~approximately 1x10 17 Each cell, approximately 1 x 10⁶ 17 ~approximately 1x10 18 Each cell, approximately 1 x 10⁶ 18 ~approximately 1x10 19 A single cell, or about 1 x 10⁶ 19 ~approximately 1x10 20 A number of cells may be administered. In some embodiments, the cells are approximately 5 x 10 6 ~about 25x10 6 It is administered in doses of individual cells.
[0083] In other embodiments, the cell dosage may depend on the person's body weight, for example, about 1 x 10¹⁶ cells per kg of the subject's body weight. 3 ~approximately 1x10 4 Each cell, approximately 1 x 10⁶ 4 ~approximately 1x10 5 Each cell, approximately 1 x 10⁶ 5 ~approximately 1x10 6 Each cell, approximately 1 x 10⁶ 6 ~approximately 1x10 7 Each cell, approximately 1 x 10⁶ 7 ~approximately 1x10 8 Each cell, approximately 1 x 10⁶ 8 ~approximately 1x10 9 Each cell, approximately 1 x 10⁶ 9 ~approximately 1x10 10 Each cell, approximately 1 x 10⁶ 10 ~approximately 1x10 11 Each cell, approximately 1 x 10⁶ 11 ~approximately 1x1012 Each cell, approximately 1 x 10⁶ 12 ~approximately 1x10 13 Each cell, approximately 1 x 10⁶ 13 ~approximately 1x10 14 Each cell, approximately 1 x 10⁶ 14 ~approximately 1x10 15 Each cell, approximately 1 x 10⁶ 15 ~approximately 1x10 16 Each cell, approximately 1 x 10⁶ 16 ~approximately 1x10 17 Each cell, approximately 1 x 10⁶ 17 ~approximately 1x10 18 Each cell, approximately 1 x 10⁶ 18 ~approximately 1x10 19 A single cell, or about 1 x 10⁶ 19 ~approximately 1x10 20 Individual cells may be administered.
[0084] A more detailed description of the disclosed compositions and pharmaceutically acceptable excipients, formulations, dosages, and methods of administration of the pharmaceutical compositions is disclosed in International Publication No. 2019 / 049816, which is incorporated herein by reference in its entirety.
[0085] kit In another embodiment, a kit is provided herein comprising a cell line engineered to include a modified target site of an SPB or PBx provided herein within its genome, preferably within a highly expressed genomic region. The kit may further comprise a composition comprising one or more ultraminiature PB transposon inverted terminal repeat (ITR) sequences described herein. In some embodiments, the cell line is a T cell line.
[0086] definition As used throughout this disclosure, the singular forms "a," "an," and "the" include multiple referents unless the context explicitly indicates otherwise. Thus, for example, a reference to "a method" includes multiple such methods, and a reference to "a dose" includes one or more doses and equivalents known to those skilled in the art.
[0087] The terms "about" or "approximately" mean that a particular value is within an acceptable margin of error, as determined by those skilled in the art, and this depends to some extent on the method by which the value is measured or determined, for example, on the limitations of the measurement system. For example, "about" may mean within one or more standard deviations. Alternatively, "about" may mean a range of up to 20%, or up to 10%, or up to 5%, or up to 1% of a given value.
[0088] Alternatively, particularly with respect to biological systems or processes, this term may mean within one order of magnitude of the value, preferably within five times, and more preferably within two times. Where a specific value is stated in this application and claims, unless otherwise specified, the term “about” should be assumed to mean within an acceptable margin of error of the specific value.
[0089] This disclosure provides isolated or substantially purified polynucleotide or protein compositions. “Isolated” or “purified” polynucleotides or proteins, or their biologically active portions, substantially or essentially contain no components that would normally accompany or interact with polynucleotides or proteins found in their naturally occurring environments. Therefore, isolated or purified polynucleotides or proteins, if produced by recombinant technology, substantially contain no other cell material or culture medium, and if chemically synthesized, substantially contain no chemical precursors or other chemicals. Optimally, an “isolated” polynucleotide does not contain sequences naturally adjacent to it in the genomic DNA of the organism from which it originates (i.e., sequences located at the 5' and 3' ends of the polynucleotide (optimally, protein-coding sequences)). For example, in various embodiments, an isolated polynucleotide may contain approximately 5kb, 4kb, 3kb, 2kb, 1kb, 0.5kb, or less than 0.1kb of nucleotide sequences naturally adjacent to it in the genomic DNA of the cell from which it originates. Substantially cellular protein-free proteins include protein preparations containing approximately 30%, 20%, 10%, 5%, or less than 1% (dry weight) of contaminating protein. When the proteins of this disclosure or their biologically active portions are recombinantly produced, the culture medium optimally contains approximately 30%, 20%, 10%, 5%, or less than 1% (dry weight) of chemical precursors or chemicals other than the protein of interest.
[0090] This disclosure provides disclosed DNA sequence fragments and variants, as well as proteins encoded by these DNA sequences. As used throughout this disclosure, the term “fragment” refers to a portion of a DNA sequence, or a portion of an amino acid sequence, and by extension, the protein encoded thereby. A DNA sequence fragment containing a coding sequence may encode a protein fragment that retains the biological activity of the native protein and therefore retains DNA recognition or binding activity to a target DNA sequence, as described herein. Alternatively, a DNA sequence fragment useful as a hybridization probe generally does not encode a biologically active protein and does not retain promoter activity. Therefore, DNA sequence fragments may range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides to the full-length polynucleotides of this disclosure.
[0091] The nucleic acids or proteins of the present disclosure may be constructed by a modular approach, which involves pre-assembling monomeric units and / or repeating units in a target vector that can then be assembled into a final target vector. The polypeptides of the present disclosure may consist of repeating monomers of the present disclosure and may be constructed by a modular approach, which involves pre-assembling repeating units in a target vector that can then be assembled into a final target vector. The present disclosure provides polypeptides produced by this method and nucleic acid sequences encoding these polypeptides. The present disclosure provides host organisms and cells containing nucleic acid sequences encoding polypeptides produced by this modular approach.
[0092] The term “comprising” is intended to mean that a composition and method includes the elements described but does not exclude others. “Consisting essentially of” when used to define a composition and method shall mean excluding other elements that are essentially important to the combination when used for the intended purpose. Therefore, compositions consisting essentially of the elements defined herein do not exclude trace amounts of contaminants or inert carriers.
[0093] "Consisting of" means excluding other components and elements that are present in amounts greater than trace amounts of the substantial method steps. The embodiments defined by each of these transitional terms are within the scope of this disclosure.
[0094] As used herein, “expression” refers to the process by which a polynucleotide is transcribed into mRNA, and / or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include the splicing of mRNA in eukaryotic cells.
[0095] "Gene expression" refers to the process of converting the information contained in a gene into a gene product. A gene product can be the direct transcript of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, shRNA, microRNA, structural RNA, or other types of RNA) or a protein produced by the translation of mRNA. Gene products also include RNA modified by processes such as capping, polyadenylation, methylation, and editing, as well as proteins modified by processes such as methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.
[0096] Components linked by non-covalent bonds, as well as methods for producing and using non-covalently linked components, are disclosed. Various components can take on a variety of different forms, as described herein. For example, non-covalently linked (i.e., operably linked) proteins may be used to enable transient interactions that circumvent one or more problems in the art. The ability of non-covalently linked components, such as proteins, to associate and dissociate allows for functional association only under circumstances where such association is required for the desired activity, or primarily under such circumstances. The linkage only needs to last for a duration sufficient to enable the desired effect.
[0097] A method for inducing a protein to a specific gene locus in the genome of an organism is disclosed. This method may include the steps of preparing a DNA localization component and preparing an effector molecule, the DNA localization component and the effector molecule being operablely linked via non-covalent bonding.
[0098] A "target site" or "target sequence" is a nucleic acid sequence that defines the portion of the nucleic acid to which a binding molecule will bind, provided that sufficient conditions for binding are present.
[0099] The terms “nucleic acid,” “oligonucleotide,” or “polynucleotide” refer to at least two nucleotides linked by a covalent bond. A single-stranded description also defines the sequence of a complementary strand. Thus, a nucleic acid may encompass a complementary strand of a described single-stranded strand. The nucleic acids of this disclosure also encompass substantially identical nucleic acids and their complementary sequences that retain the same structure or encode the same protein.
[0100] The nucleic acids of this disclosure may be single-stranded or double-stranded. The nucleic acids of this disclosure may contain double-stranded sequences even if the majority of the molecule is single-stranded. The nucleic acids of this disclosure may contain single-stranded sequences even if the majority of the molecule is double-stranded. The nucleic acids of this disclosure may include genomic DNA, cDNA, RNA, or hybrids thereof. The nucleic acids of this disclosure may include combinations of deoxyribonucleotides and ribonucleotides. The nucleic acids of this disclosure may include combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. The nucleic acids of this disclosure may be synthesized to include non-natural amino acid modifications. The nucleic acids of this disclosure may be obtained by chemical synthesis or recombinant methods.
[0101] The nucleic acids disclosed herein may not exist in nature in whole or in part. The nucleic acids disclosed may contain one or more mutations, substitutions, deletions, or insertions that do not exist in nature, and the entire nucleic acid sequence may not exist in nature. The nucleic acids disclosed may contain one or more duplicate, reverse, or repeat sequences, and as a result, such sequences do not exist in nature, and the entire nucleic acid sequence may not exist in nature. The nucleic acids disclosed may contain modified nucleotides, artificial nucleotides, or synthetic nucleotides that do not exist in nature, and the entire nucleic acid sequence may not exist in nature.
[0102] When the genetic code contains redundancy, multiple nucleotide sequences can encode a particular protein. All such nucleotide sequences are assumed herein.
[0103] As used throughout this disclosure, the term “operably linked” refers to the expression of a gene under the control of a spatially linked promoter. The promoter may be located 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the promoter and the gene may be approximately the same as the distance between the promoter and the gene it controls in the gene from which the promoter originates. Changes in the distance between the promoter and the gene can be adapted without impairing the function of the promoter.
[0104] As used throughout this disclosure, the term “promoter” refers to a synthetic or naturally occurring molecule that can confer, activate, or enhance the expression of a nucleic acid within a cell. A promoter may include one or more specific transcriptional regulatory sequences to further enhance expression and / or alter its spatial and / or transient expression. A promoter may also include a distal enhancer or repressor element, which may be located thousands of base pairs away from the transcription start site. Promoters may originate from sources including viruses, bacteria, fungi, plants, insects, and animals. A promoter can constitutively or differentially control the expression of a gene component with respect to the cell, tissue, or organ in which the expression occurs, to the developmental stage in which the expression occurs, or in response to external stimuli such as physiological stress, pathogens, metal ions, or inducers. Representative examples of promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, EF-1 alpha promoter, CAG promoter, SV40 early promoter or SV40 late promoter, and CMV IE promoter.
[0105] As used throughout this disclosure, the term “vector” refers to a nucleic acid sequence containing an origin of replication. A vector may be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. A vector may be either a DNA vector or an RNA vector. A vector may be a self-replicating extrachromosomal vector, preferably a DNA plasmid. A vector may contain amino acids and a DNA sequence, an RNA sequence, or a combination of both DNA and RNA sequences.
[0106] Conservative substitutions of amino acids, i.e., substitution of an amino acid with a different amino acid having similar properties (e.g., hydrophilicity, degree and distribution of charged region), are typically recognized in the art as involving only minor changes. These small changes can be partially identified by considering the hydrophobicity index of amino acids, as understood in the art. Kyte et al., J.Mol.Biol.157:105-132 (1982). The hydrophobicity index of an amino acid is based on consideration of its hydrophobicity and charge. Substitution of amino acids with similar hydrophobicity indices can maintain the function of the protein. In some embodiments, amino acids with a hydrophobicity index of ±2 are substituted. The hydrophilicity of amino acids can also be used to identify substitutions that maintain the biological function of a protein. By considering the hydrophilicity of amino acids in the context of peptides, it is possible to calculate the maximum local mean hydrophilicity of that peptide, which is a useful indicator that has been reported to correlate well with antigenicity and immunogenicity. U.S. Patent No. 4,554,101 is fully incorporated herein by reference.
[0107] By substituting amino acids with similar hydrophilicity values, peptides with preserved biological activity, such as immunogenicity, can be obtained. Substitutions can be performed with amino acids whose hydrophilicity values are within ±2 of each other. Both the hydrophobicity index and hydrophilicity of an amino acid are influenced by its specific side chain. Consistent with this observation, it is understood that amino acid substitutions suitable for biological function depend on the relative similarity of the amino acids, particularly their side chains, as revealed by their hydrophobicity, hydrophilicity, charge, size, and other properties.
[0108] As used herein, “conservative” amino acid substitutions may be defined as shown in Tables 1, 2, and 3 below. In some embodiments, conservative substitutions are introduced by modifications of the polynucleotides encoding the polypeptides of this disclosure. Amino acids can be classified by their physical properties and their contributions to the secondary and tertiary structures of proteins. A conservative substitution is the substitution of one amino acid with another amino acid having similar properties. Exemplary conservative substitutions are shown in Table 1. [Table 1]
[0109] Alternatively, conserved amino acids can be classified as shown in Table 2, as described by Lehninger (Biochemistry, Second Edition; Worth Publishers, Inc. NY, NY (1975), pp. 71-77). [Table 2]
[0110] Alternatively, exemplary conservative substitutions are shown in Table 3. [Table 3]
[0111] The polypeptides and proteins of this disclosure may not exist in nature in whole or in any part thereof. The polypeptides and proteins of this disclosure may contain one or more mutations, substitutions, deletions, or insertions that do not exist in nature, and the entire amino acid sequence may not exist in nature. The polypeptides and proteins of this disclosure may contain one or more duplicate, reverse, or repeat sequences, and as a result, the sequence may not exist in nature, and the entire amino acid sequence may not exist in nature. The polypeptides and proteins of this disclosure may contain modified amino acids, artificial amino acids, or synthetic amino acids that do not exist in nature, and the entire amino acid sequence may not exist in nature.
[0112] When used throughout this disclosure, the identity between two sequences may be determined using a standalone executable BLAST engine program (bl2seq) for blasting the two sequences, which can be obtained from the National Center for Biotechnology Information (NCBI) ftp site using default parameters (Tatusova and Madden, FEMS Microbiol Lett., 1999, 174, 247-250, which is incorporated herein by reference in its entirety).
[0113] The term "identical" or "synchronization," when used in the context of two or more nucleic acid or polypeptide sequences, refers to a specific percentage of identical residues across a particular region of each sequence. In some embodiments, sequence identity is determined over the entire length of the sequence. The percentage can be calculated by optimally aligning the two sequences, comparing them over a specified region, determining the number of positions where identical residues appear in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the specified region, and multiplying the result by 100 to obtain the percentage of sequence identity. If the two sequences are of different lengths, or if alignment produces sequences with one or more ends shifted, and the specified comparison region contains only a single sequence, the residues of the single sequence are included in the denominator of the calculation but not in the numerator. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be performed manually or using computer sequencing algorithms such as BLAST or BLAST 2.0.
[0114] In certain embodiments, if a sequence has a specific sequence identity with a particular sequence number (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%), then the sequence and the sequence of that sequence number have the same length. In certain embodiments, if a sequence has a specific sequence identity with a particular sequence number (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%), then the sequence and the sequence of that sequence number differ only by a conservative amino acid substitution.
[0115] As used throughout this disclosure, the term “endogenous” refers to a nucleic acid or protein sequence that is naturally associated with the target gene or the host cell into which it is introduced.
[0116] As used throughout this disclosure, the term “exogenous” means a nucleic acid or protein sequence that is not naturally associated with the target gene or the host cell into which it is introduced, and includes multiple copies of a naturally occurring nucleic acid that are not naturally occurring, such as a DNA sequence, or a naturally occurring nucleic acid sequence located at a genomic location that is not naturally occurring.
[0117] This disclosure provides a method for introducing a polynucleotide construct containing a DNA sequence into a host cell. “Introducing” means presenting the polynucleotide construct to the cell in a manner that allows it to access the interior of the host cell. The method of this disclosure does not depend on a specific method for introducing the polynucleotide construct into a host cell, but only on the polynucleotide construct accessing the interior of a single host cell. Methods for introducing polynucleotide constructs into bacteria, plants, fungi, and animals, including but not limited to stable transformation methods, transient transformation methods, and virus-mediated methods, are known in the art. [Examples]
[0118] The examples in this section are provided for illustrative purposes only and are not intended to limit the invention.
[0119] Example 1: Construction of ultra-minimal PiggyBac inverted terminal repeat polynucleotides Ultraminor piggyBac RE ITR variants were constructed by constructing an ultraminor PB RE ITR polynucleotide set, which is a cleaved set of the piggyBac 63bp least right-end (RE) ITR (SEQ ID NO: 2), by sequential deletion of the 3' end of the minimal RE ITR sequence. The ultraminor RE ITR variants contain the first 17bp, 19bp, 24bp, 29bp, 34bp, 39bp, or 44bp of the 63bp minimal RE ITR sequence shown in SEQ ID NO: 2, resulting in nucleic acid sequences SEQ ID NOs: 3-9, respectively.
[0120] In short, we synthesized, purified, and used nucleic acids encoding ultraminiature RE ITR variants to create transposons containing these ultraminiature RE ITR variants.
[0121] Example 2: Effect of ultra-minimum PB RE ITR polynucleotide length on Super PiggyBac (SPB) transposase cleavage activity The ultraminiature PB ITR polynucleotides prepared in Example 1 were first tested using a luciferase transposon excision reporter. Briefly, the excision reporter contains a PGK promoter (SEQ ID NO: 10), followed by a disrupted nanoLuc luciferase coding sequence, and then a late SV40 polyadenylation signal sequence (SEQ ID NO: 11). The nanoLuc sequence is disrupted with TTAA so that the 5' end of nanoLuc (SEQ ID NO: 12) is separated from the 3' end of nanoLuc (SEQ ID NO: 13) by the PB transposon. The transposon contains, from 5' to 3', a TTAA sequence, a 35 bp LE ITR (SEQ ID NO: 1), a 189 bp "cargo" (SEQ ID NO: 14), a 63 bp reverse complementary RE sequence (SEQ ID NO: 2) or a cleaved RE ITR containing one of SEQ ID NOs. 3-9, and the TTAA sequence. The reporter construct was cotransfected into cells with a plasmid expressing Super piggyBac (SPB) transposase. If the ultraminor ITR is functional, the excision of the transposon containing the ultraminor PB RE ITR and the seamless repair of the reporter coding sequence result in nanoLuc expression, which can be detected by luciferase assays.
[0122] In short, on day 0, 30,000 HEK293T cells were reverse transfected with 20 ng of reporter construct, 10 ng of SPB expression vector, and 20 ng of carrier DNA using 0.15 μL of Transit2020 transfection reagent according to the manufacturer's instructions, and the cells were seeded in 100 μL of DMEM medium + 10% FBS in a 96-well plate. The cells were incubated at 37°C, and luciferase activity was measured on day 1. The results are shown in Table 1. [Table 1]
[0123] As shown in Table 1, for all ultraminor PB RE ITR variants, luciferase activity was detected in translocated cells, with the highest signal observed using the ultraminor 19 bp PB RE ITR.
[0124] In the second experiment, reporter constructs containing a 17 bp ultraminor PB RE ITR or a 19 bp ultraminor PB RE ITR, as well as a complete PB ITR containing an intact PB 5'UTR sequence (SEQ ID NO: 15) and an intact 3'UTR sequence (SEQ ID NO: 16), and a minimal PB ITR containing a 35 bp LE ITR (SEQ ID NO: 1) and a 63 bp RE (SEQ ID NO: 2) were tested in a luciferase excision assay. The results are shown in Table 2. [Table 2]
[0125] As shown in Table 2, the 19 bp PB RE ultraminor ITR reporter outperformed the complete PB ITR reporter, which further included the minimum 63 bp RE ITR, as well as the PB LE ITR and the ultraminor PB RE ITR with PB 5'UTR and 3'UTR added, respectively.
[0126] Example 3: Effect of transposon DNA cargo size on the SPB transposase integration and excision activity of transposons containing ultraminiature PB RE ITR The effects of full ITR, minimal ITR, and ultraminimal ITR on SPB transposase activity for incorporating or excising larger transposons compared to the transposon in Example 2 were tested using a double excision / incorporation luciferase reporter system. The reporter system contains a firefly luciferase open reading frame disrupted by an SPB transposon. Initially, firefly luciferase is not expressed, but SPB-mediated excision and seamless repair of the transposon leads to expression. The transposon itself expresses destabilized nanoluc luciferase mRNA. NanoLuc expression from an episomal vector is unstable because the mRNA lacks a poly-A tail and contains a 3' destabilization element. Incorporation of the transposon into genomic DNA allows the mRNA to utilize the genomic poly-A sequence and splice the destabilization element using a splice donor sequence on the transposon, resulting in luciferase expression (SEQ ID NO: 17).
[0127] The transposon ITR of this reporter plasmid was modified to prepare transposons containing full ITR, minimal ITR, or 19 bp RE ultraminor ITR. Briefly, on day 0, approximately 200,000 K562 cells were nucleofectioned with 50 ng of one of the reporters and 500 ng of SPB expression vector (or carrier DNA as a negative control) and seeded in 600 μL of IMDM medium + 10% FBS in a 24-well plate. Cells were incubated at 37°C and luciferase activity was measured on day 2. The results are shown in Table 3. [Table 3] Rep.: Reproduction
[0128] As shown in Table 3, the detected firefly luciferase excision signal and nanoLuc integration signal were highest in the complete PB ITR, lower in the minimal PB ITR, and lowest in the 19 bp PB RE ultraminor ITR, respectively. Transposons containing larger DNA cargoes resulted in the placement of LE ITRs and RE ITRs at even greater distances, suggesting that the absence of a second transposase dimer binding site in the ultraminor RE ITR may reduce the transposition efficiency of larger DNA cargoes.
[0129] Example 4: SPB transposase integration and excision activity of spacer length between PB LE ITR and PB RE ITR in transposons containing ultra-miniature PB RE ITR. Transposons are typically delivered to cells on circular DNA vectors, either ex vivo or in vivo. The strategy for bringing ITRs close to the circular vector is to reduce the number of base pairs (i.e., plasmid backbone) that separate the ITRs outside the transposon, even for large transposons.
[0130] The dual luciferase reporter prepared in Example 3 was modified to bring the ITRs closer together, essentially converting the entire vector into a transposon to create transposons containing a 221 bp sequence between a full PB ITR (SEQ ID NO: 18), a minimal PB ITR (SEQ ID NO: 19), or an ultra-minimal PB ITR (SEQ ID NO: 20) and the TTAA outside the transposon. The firefly excision reporter underwent partial deletion during the process, while the nanoLuc integration reporter remained intact. These new integration-only luciferase reporters were tested for transposon integration in K562 cells, along with a positive control luciferase reporter containing a full-length plasmid backbone, as described in Example 3. The results are shown in Table 4. [Table 4]
[0131] As shown in Table 4, full ITR and minimal ITR resulted in high transposition, but using an ultraminimal ITR of 19 bp resulted in lower levels of transposition, suggesting that ultraminimal ITR works best for SPB-mediated transposition of very small transposons.
[0132] Example 5: Site-specific, excision-only effect of ultra-minimum PB RE ITR polynucleotide length on transposase excision activity of TAL-Super PiggyBac fusion protein (TAL-ss-SPB PBx). Using the nanoLuc excision-only reporter system described in Example 2, the excision activity of reporter plasmids containing transposons with full ITR, minimal ITR, or RE ultraminor ITR variants of 44 bp, 34 bp, 19 bp, and 17 bp was compared. Briefly, 30,000 HEK293T cells were reverse transfected with each reporter as described in Example 2, using GFP left-targeted TAL-ssSPB PBx expression vector (SEQ ID NO: 21) and GFP right-targeted TAL-ssSPB PBx expression vector (SEQ ID NO: 22). The GFP-targeted TAL-ssSPB PBx expression vector contains a TAL array targeting DNA sequences adjacent to the upstream and downstream TTAA integration site fused to a piggyBac transposase, which contains an N-terminal deletion of amino acids 1-93, four hyperactive SPB mutations, and further mutations that lack transposase integration but retain normal excision activity (PBx). TAL array-SPB transposase fusion proteins GFP1 right TAL-ssSPB PBx and GFP1 left TAL-ssSPB PBx, targeted to specific 10 bp right and 10 bp left sequences within the coding region of the GFP gene, were prepared as described in Examples 14 and 18 of the jointly owned international patent application publication PCT / 2022 / 22549, whose entire contents are incorporated by reference.
[0133] Luciferase signaling was measured in cells transfected with transposons containing various ITR sequences. The results are shown in Table 5. [Table 5]
[0134] As shown in Table 5, transfected cells containing any of the reporter constructs resulted in the generation of luciferase signaling and demonstrated transposon excision from the reporter and recovery of the full-length luciferase coding sequence. Transposons containing full ITR, minimal ITR, or 44 bp ultraminimal ITR (retaining part of the distal transposase binding site) all functioned similarly. Transposons containing 34 bp, 19 bp, and 17 bp ultraminimal ITRs, all completely lacking the distal transposase dimer binding site, each showed a higher excision signal than transposons containing full ITR or larger ITR variants.
[0135] Example 6: Site-specific, excision-only effect of ultra-minimum PB RE ITR polynucleotide length on transposase excision activity of TAL-Super PiggyBac fusion protein (TAL-ss-SPB PBx). In Example 3, by transfecting HEK293T as described above, polynucleotides including full ITR, minimal ITR, or ultraminimal ITR of 19 bp were investigated to adapt the transposition of large transposons using a double excision / integration luciferase reporter and SPB transposase and TAL-ssSPB PBx fusion protein. Considering that TAL-ssSPB consists only of excision of the PBx transposase delta 1-93 sequence and that the targeted integration site of GFP TAL-ssSPB is not present in the genome, only the excision signal of the double excision / integration luciferase reporter was monitored. The results of the excision assay are shown in Table 6. [Table 6]
[0136] As shown in Table 6, the highest cleavage activity was observed with SPB transposases using reporter constructs containing a full ITR, while cleavage activity was low with minimal ITRs and lowest with ultra-minimal ITRs. However, this trend was partially reversed with the use of TAL-ssSPB PBx fusion proteins, where reporter constructs containing ultra-minimal ITRs showed the highest cleavage activity compared to reporter constructs containing similar but less effective full or minimal ITRs. As a negative control for the assay, catalytic dead SPBs showed background-level luciferase activity.
[0137] Example 7: Construction of a TAL-binding ITR for site-directed transposition and its use in a TAL-ssSPB PBx fusion protein A series of ultraminor RE ITR variants were constructed by extending the reporter plasmid target site of a second distal GFP1 R TAL-ssSPB, which includes an ultraminor RE ITR sequence followed by a TAL binding site (SEQ ID NO: 23), a spacer, and then binding sites for the PBx DBD and CRD domains, using spacers of various lengths. Several TAL RE ITR variants ("TAL-bound RE ITR") with different spacer lengths between the RE ITR and the TAL array were constructed: no spacer (SEQ ID NO: 24); a+5bp spacer (SEQ ID NO: 25); a+10bp spacer (SEQ ID NO: 26); a+15bp spacer (SEQ ID NO: 27); a+20bp spacer (SEQ ID NO: 28); and a+25bp spacer (SEQ ID NO: 29). As the spacer length increases, the binding sites of the first proximal left TAL-ssSPB PBx dimer and the second distal right TAL-ssSPB PBx dimer are further separated.
[0138] Similarly, a series of ultraminor LE ITR variants were constructed for a second distal TAL-ssSPB dimer. Several TAL LE ITR variants ("TAL-bound LE ITR") with different spacer lengths between the LE ITR and the TAL array were constructed: no spacer (SEQ ID NO: 30); a+5bp spacer (SEQ ID NO: 31); a+10bp spacer (SEQ ID NO: 32); a+15bp spacer (SEQ ID NO: 33); a+20bp spacer (SEQ ID NO: 34); and a+25bp spacer (SEQ ID NO: 35). To avoid potential recombination between these extended ultraminor LE ITRs and RE ITRs, the spacer sequences of the LE ITR and RE ITR pairs were modified to reduce sequence repeatability and homology.
[0139] TAL-binding LE and RE ITRs were first tested in HEK293T using a luciferase transposon excision reporter, as described above in Example 2. Each reporter plasmid was co-transfected with either GFP1 R TAL-ssSPB PBx (SEQ ID NO: 22), which binds to ITRs, or PAH2 L TAL-ssSPB PBx (SEQ ID NO: 36), which does not bind to ITRs. PAH2 L TAL-ssSPB PBx was prepared as described in the jointly owned international patent application publication PCT / 2022 / 22549. GFP1 R TAL-ssSPB PBx yielded a higher excision signal than PAH2 L TAL ssSPB PBx with all TAL-binding ITR reporters. As a control, reporter constructs containing minimal and ultraminor ITRs were transfected, in which case both TAL-ssSPB PBx fusion proteins yielded similar excision signals. The results are shown in Table 7. [Table 7]
[0140] As shown in Table 7, the highest signal using TAL-bound ITR was observed in the version containing the longest 25 bp spacer sequence.
[0141] Example 8: Construction of a TAL-binding ITR targeting the LINE1 element for site-directed transposition and its use in a LINE1-targeted TAL-ssSPB PBx fusion protein A. Small transposons In the first experiment, various TAL-binding ITR designs were compared for site-directed transposition of small transposons to the human genome at target sites found in the LINE1 repeat (SEQ ID NO: 37) catalyzed by LINE1 TAL-ssSPB, including LINE L1 ss-SPB PBx (SEQ ID NO: 38) and LINE R1 ss-SPB PBx (SEQ ID NO: 39). LINE1 L1 TAL-ssSPB PBx and LINE R1 ss-SPB PBx were prepared as described in the jointly owned international patent application publication PCT / 2022 / 22549. A 610 bp transposon with a complete ITR (SEQ ID NO: 40), a 392 bp transposon with a TAL-binding ITR with a 25 bp spacer (SEQ ID NO: 41), a 365 bp transposon with a minimal ITR (SEQ ID NO: 42), and a 321 bp transposon with an ultraminimal ITR of 19 bp (SEQ ID NO: 43) were cloned into a 4.5 kb donor vector. Following the manufacturer's instructions, 450 ng of each transposon donor was co-transfected into 120,000 HEK293 T cells (seeded 1 day prior) using 1 μL of JetPrime transfection reagent, along with a total of 50 ng of LINE1 TAL-ssSPB pairs. After 2 days, genomic DNA was collected, and site-specific transposon integration into target sites in both forward and reverse orientations was quantified by ddPCR. The results are shown in Table 8. [Table 8]
[0142] As shown in Table 8, the ultraminiature ITR transposons resulted in the highest level of site-specific integration among the four ITR designs tested. However, TAL-bound ITRs showed good activity in the LINE1 element. B. Large Transposons In the second experiment, various ITR designs were then compared for site-specific transposition of large transposons into the human genome at target sites found in LINE1 repeats (SEQ ID NO: 37) catalyzed by LINE1 TAL-ssSPB, including LINE L1 ss-SPB PBx (SEQ ID NO: 38) and LINE R1 ss-SPB PBx (SEQ ID NO: 39). The transposon donor nanoplasmid contained a "cargo" consisting of a 309 bp fragment containing TTAA, parts of the PiggyBac 5'ITR and UTR, an EF1a promoter, a puromycin resistance gene, a 2A peptide, and a GFP reporter, followed by a 238 bp fragment containing parts of the PiggyBac 3'ITR and UTR, as well as a PiggyBac transposon containing TTAA (SEQ ID NO: 44). The donor DNA transposon was modified to replace the complete ITR with a TAL-bound ITR having a 25 bp spacer, a minimal ITR, or a 19 bp ultraminimum ITR. Each transposon donor was co-transfected into HEK293T cells with a LINE1 TAL-ssSPB expression vector. Genomic DNA was collected after 1 or 3 days, and site-specific transposon integration into target sites in forward orientation was quantified by ddPCR. The results are shown in Table 9. [Table 9]
[0143] As shown in Table 9, similar to the first experiment using small transposons, ultra-small ITR transposons resulted in the highest level of site-specific incorporation of large transposons into the LINE1 element repeat.
Claims
1. A polynucleotide encoding a transposon, comprising an ultraminiature piggyBac right-end (RE) inverted terminal repeat (ITR) sequence and a left-end (LE) minimum ITR sequence, wherein the ultraminiature piggyBac RE ITR comprises the nucleic acid sequence shown in SEQ ID NO: 8, and the LE ITR comprises the sequence shown in SEQ ID NO:
1.
2. The polynucleotide according to claim 1, wherein the transposon is a piggyBac transposon or a piggyBac-like transposon.
3. The polynucleotide according to claim 1 or 2, further comprising at least one exogenous nucleic acid sequence.
4. The polynucleotide according to claim 3, wherein at least one exogenous nucleic acid sequence encodes an antigen receptor that does not exist in nature.
5. The polynucleotide according to claim 3, wherein the at least one exogenous nucleic acid sequence encodes a therapeutic polypeptide.
6. The polynucleotide according to claim 5, wherein the therapeutic polypeptide is factor VIII polypeptide, factor IX polypeptide, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC) polypeptide, or methylmalonyl-CoA mutase (MUT1) polypeptide.
7. The polynucleotide according to any one of claims 3 to 6, further comprising a promoter sequence.
8. The polynucleotide according to any one of claims 1 to 7, wherein the RE ITR is reverse-oriented and / or the LE ITR is reverse-oriented.
9. A vector comprising a polynucleotide according to any one of claims 1 to 8.
10. A cell comprising a polynucleotide according to any one of claims 1 to 8 or a vector according to claim 9.
11. A pharmaceutical composition comprising the cells described in claim 10 and a pharmaceutically acceptable carrier.
12. A transposon comprising, in order from 5' to 3', (i) a left-end (LE) inverted-end repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a naturally occurring antigen receptor, and (iv) a reverse complementary sequence of the ultraminor right-end (RE) inverted-end repeat (ITR) sequence.
13. A transposon comprising, in order from 5' to 3', (i) a left-end (LE) inverted terminal repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide, and (iv) a reverse complementary sequence of the ultraminor right-end (RE) inverted terminal repeat (ITR) sequence.
14. A transposon comprising, in order from 5' to 3', (i) a right-end (RE) inverted terminal repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a naturally occurring antigen receptor, and (iv) a reverse complementary sequence of the ultraminor left-end (LE) inverted terminal repeat (ITR) sequence.
15. A transposon comprising, in order from 5' to 3', (i) a right-end (RE) inverted terminal repeat (ITR) sequence, (ii) a promoter, (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide, and (iv) a reverse complementary sequence of the ultraminor left-end (LE) inverted terminal repeat (ITR) sequence.
16. The transposon according to claim 13 or 15, wherein the therapeutic polypeptide is factor VIII polypeptide, factor IX polypeptide, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC) polypeptide, or methylmalonyl-CoA mutase (MUT1) polypeptide.
17. A method for treating a disease or disorder in a subject requiring treatment of a disease or disorder, comprising administering to the subject (i) at least one therapeutically effective dose of the vector according to claim 9 or the transposon according to any one of claims 13 to 15, and (ii) a transposase, or a nucleic acid or nucleic acid sequence encoding a transposase enzyme.
18. The method according to claim 17, wherein the transposase is SPB transposase, TAL-ss-SPB PBx transposase fusion protein, or ZNF-ssSPB transposase fusion protein.
19. A method for treating a disease or disorder in a subject requiring treatment of a disease or disorder, comprising administering to the subject at least one therapeutically effective dose of the cells described in claim 10.
20. The method according to any one of claims 17 to 19, wherein the disease or disorder is cancer, liver disease or disorder, urea cycle disorder, metabolic liver disorder, or hemophilia.