Treatment methods for chronic kidney disease
Inhibiting ARHGEF6 activity in CKD patients stabilizes podocyte cytoskeleton and adhesion, addressing the underlying mechanisms of kidney dysfunction and offering a non-invasive treatment option.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- ASTRAZENECA AB
- Filing Date
- 2024-05-10
- Publication Date
- 2026-06-15
AI Technical Summary
Current treatments for chronic kidney disease (CKD) are invasive and expensive, and there is a need for early detection and effective strategies to slow, halt, or reverse disease progression, as existing methods do not address the underlying mechanisms contributing to kidney dysfunction.
Administering inhibitors of ARHGEF6 activity to reduce protein levels or degrade ARHGEF6, thereby blocking Rac1 activation and maintaining podocyte adhesion to the glomerular basement membrane by restoring active β1-integrin levels, using agents like antisense oligonucleotides or proteolytic chimeras.
This approach stabilizes the podocyte cytoskeleton and adhesion, protecting the glomerular filtration barrier, reducing kidney damage and potentially reversing CKD progression.
Smart Images

Figure 2026519278000001_ABST
Abstract
Description
[Technical Field]
[0001] This specification relates to a method for treating or preventing chronic kidney disease (CKD), comprising administering an inhibitor of ARHGEF6 activity to a patient in need thereof. ARHGEF6 activity inhibitors may function by depleting or degrading ARHGEF6 at the protein level, or by binding to ARHGEF6 and thereby blocking Rac1 activation and / or reducing ARHGEF6-mediated active β1-integrin levels. This specification also relates to ARHGEF6 activity inhibitors for use in the treatment of chronic kidney disease. A method for identifying patients for treatment or prevention using an ARHGEF6 activity inhibitor is also provided, comprising the step of identifying CKD biomarkers in a sample obtained from such patient, which may be incorporated into the overall method of treatment or prevention.
[0002] Chronic kidney disease (CKD) is a broad term used to describe kidney diseases characterized by the progressive loss of kidney function and ultimately failure. As CKD progresses, the kidneys' ability to filter waste products and excess fluid from the blood declines. CKD is classified on a scale ranging from Stage 1 to Stage 5 based on the level of kidney damage a patient has suffered and the resulting decrease in measured glomerular filtration rate (GFR) (see KDIGO-Kidney International Supplements 2013, 3, 19-62 and Kidney International (2024), 105 (Suppl 4S), S117-S314), with Stage 5 CKD, also known as end-stage renal disease (ESRD) or renal failure, being the most severe. GFR can be estimated using the estimated GFR (eGFR) value, which can be derived from the measurement of filtration markers such as serum creatinine or cystatin C. eGFR is a measure of the kidney's ability to purify blood relative to an expected "normal" value, even though renal function varies with age, sex, and body size and declines with age (for example, a "normal" eGFR for a 40-year-old is approximately 100, and a normal value for a 70-year-old is approximately 75). Various approaches to establishing eGFR are described in the literature and are well known to those skilled in the art (see, for example, LAINKER et al, N Engl J Med 2021;385:1737-1749, DOI:10.1056 / NEJMoa2102953; N Engl J Med 2012;367:20-29, DOI:10.1056 / NEJMoa1114248, and the KDIGO guidelines mentioned above).
[0003] In the early stages of CKD (stages 1 and 2), patients may show few signs or symptoms of the condition, the latter being relatively mild (e.g., hypertension, leg swelling, and urinary tract infections). Patients with stage 1 and 2 CKD have persistent kidney damage, but their renal function is either clearly normal or only mildly impaired (eGFR ≥90% in stage 1 / eGFR 89-60 in stage 2 CKD). However, by stage 3 CKD, patients have mild to moderate (stage 3a, eGFR 45-59) or moderate to severe (stage 3b, eGFR 30-44) loss of renal function and experience an increase in the number and severity of symptoms (e.g., low blood cell count, malnutrition, bone pain, unusual pain, numbness or tingling, decreased mental alertness, or malaise). Patients with stage 3 CKD are also more likely to progress to stage 4 (eGFR = 29-15) or stage 5 CKD (also known as end-stage renal disease (ESRD) or renal failure, where eGFR is less than 15). By stage 4 CKD, patients experience severe loss of kidney function and are prone to anemia, loss of appetite, bone disease, or abnormal blood levels of phosphorus, calcium, or vitamin D. Further symptoms associated with stage 5 CKD / ESRD include uremia, fatigue, shortness of breath, nausea, vomiting, abnormal thyroid levels, swelling of the hands / legs / eyes / lower back, or back pain. Morphology and mortality are high in patients with stage 4 and stage 5 CKD.
[0004] Guidelines for the definition and classification of CKD can be found in Kidney International Supplements (2013) 3, 19-62 (KDIGO), and more recently in the 2024 KDIGO Guidelines, collectively referred to herein as KDIGO / KDIGO Guidelines. See Kidney International (2024), 105 (Suppl 4S), S117-S314. According to the KDIGO Guidelines, GFR is recognized as the best overall indicator of renal function because a) it generally decreases after extensive structural kidney injury, and b) most other renal functions decline in parallel with GFR in CKD. GFR over a period of >3 months is <60 mL / min / 1.73 m³.2 was selected as an indicator of CKD, but this value is less than half of the normal value (125 mL / min / 1.73 m 2 ) in young adult men and women. 60 mL / min / 1.73 m 2 of GFR can be detected by routine laboratory tests. Current estimation formulas for GFR (eGFR) based on serum creatinine (sCr) are sensitive for detecting measured GFR, but not sensitive for sCr alone. A decrease in eGFR established using sCr can be confirmed, if necessary, by GFR estimation using an alternative filtration marker (cystatin C) or GFR measurement.
[0005] Currently, treatment options for patients with severe or end-stage kidney disease include dialysis and kidney transplantation. These treatments are invasive, expensive, and not universally available because a highly developed medical system is required for their delivery. Therefore, there is a substantial medical need to detect CKD as early as possible and provide treatments that can slow, halt, or even reverse disease progression. Thus, there is a need to identify new and effective strategies for therapeutic intervention in the treatment of CKD, similar to biomarker prognostic diagnosis of susceptibility to the onset, initiation, presence, or progression of kidney disease.
[0006] Functionally, the kidney removes waste products and excess fluid from the blood into the urinary tract for excretion through the glomerular filtration barrier. The glomerular filtration barrier is a complex structure that includes podocytes attached to the glomerular basement membrane (GBM), among other elements. In this structure, podocytes are densely clustered and take on a special shape so that slits between adjacent podocytes are formed and maintained. This slit between adjacent podocytes is sometimes called the filtration slit or slit diaphragm and is bridged by various intracellular elements such as nephrin to form a matrix through which controlled diffusion of waste products and excess fluid from the blood into the urinary tract can occur. The shape of podocytes on the GBM is maintained by the internal actin cytoskeleton of podocytes (composed of dynamic actin stress fibers). Therefore, the integrity of the actin cytoskeleton of podocytes is necessary for optimal kidney function. In addition to its shape, podocytes are anchored to the GBM through various factors such as dystroglycan, syndecan, and α3 and β1-integrins. Therefore, the maintenance of podocyte anchoring is also an important factor in the integrity of the glomerular filtration barrier and kidney function. Efficient functioning of the glomerular filtration barrier requires both stable anchoring of podocytes to the glomerular filtration barrier and maintenance of the shape of podocytes.
[0007] Guanine nucleotide exchange factors (GEFs) are proteins or protein domains that activate monomeric GTPases by stimulating the release of guanosine diphosphate (GDP) to enable the binding of guanosine triphosphate (GTP). Rho guanine nucleotide exchange factor 6 (ARHGEF6) is a GEF protein encoded in humans by the ARHGEF6 gene (Note: To avoid ambiguity, ARHGEF6 (in italics) is used herein to refer to the gene, while ARHGEF6 is used to refer to the protein). Among other names (e.g., PIXA; COOL2; MRX46; Cool-2; αPIX; α-PIX), ARHGEF6 is also called Rac / Cdc42 guanine nucleotide exchange factor 6 because it characteristically binds to the GTPases Cdc42 and Rac1. The formation of a stable complex between ARHGEF6 and activated Cdc42 was observed to enhance ARHGEF6's ability to associate with GDP-binding Rac1 (see Baird et al, Current Biology 2001, 15, 1-10). ARHGEF6-binding GTPases Cdc42 and Rac1 are members of the Rho subfamily of Ras-related GTP-binding proteins and are involved in a wide range of cellular responses, including the regulation of actin cytoskeleton structure, cell morphology and motility, intracellular transport, cell cycle progression, and malignant transformation. The catalytic subunit of ARHGEF6 consists of a Dbl-homologous domain (DH) and a plectrin-homologous domain (PH). Studies suggest that the PH domain stabilizes the DH domain in its binding to Rac1, and that the catalytic activity of constructs containing the DH domain but lacking the PH domain is significantly reduced. However, the precise mechanistic understanding of the ARGHEF6-mediated conversion of Rac1-GDP to Rac1-GTP remains unestablished, and ARHGEF6 may act upstream of the final conversion step.
[0008] Knockdown of ARHGEF6 in mice, and the resulting loss of ARHGEF6, impairs the development of immobile ciliates in hair cells and leads to progressive hearing loss (Zhu et al, Mol. Neurosci. 2018, 11:362). To the best of our knowledge, prior to this specification, a relationship between ARHGEF6 activity and the onset and / or progression of chronic kidney disease (CKD) / end-stage renal disease (ESRD) has not been established. Furthermore, prior to this specification, there was no suggestion that inhibition of ARHGEF6 activity could represent a therapeutic strategy for the treatment of CKD / ESRD. Therefore, the object of this specification is to provide a novel method for the treatment or prevention of CKD / ESRD, including, for example, inhibition of ARHGEF6 activity in podocytes.
[0009] In a first aspect of this specification, a method for treating or preventing chronic kidney disease is provided, comprising administering an inhibitor of ARHGEF6 activity to a patient in need thereof. The inventors have confirmed that upregulation of ARHGEF6 mRNA is also detrimental to the morphology of podocytes and their adhesion to the glomerular basement membrane (GBM). The evidence presented herein shows that upregulation of ARHGEF6 (i) affects the actin cytoskeleton of podocytes via Rac1 activation and (ii) causes depletion of active β1-integrin levels, and therefore impairs the adhesion of podocytes to the GBM. Furthermore, a decrease in ARHGEF6 at the protein level restores the normal morphology of podocytes and restores active β1-integrin levels. In addition to its effects on podocytes, ARHGEF6 overexpression in primary human glomerular endothelial cells (HGMECs) has been found to significantly increase apoptosis, suggesting that upregulated ARHGEF6 may contribute in part to endothelial dysfunction in CKD. Therefore, in embodiments, a method for treating or preventing chronic kidney disease includes the use of a drug that can reduce the amount of ARHGEF6 at the protein level. Furthermore, in embodiments, a method for treating or preventing chronic kidney disease includes the use of a drug that reduces ARHGEF6-mediated Rac1 activation and ARHGEF6-mediated depletion of active β1-integrin levels. In embodiments, the patient being treated is a human patient. In embodiments, an inhibitor of ARHGEF6 activity for use in treatment is intended for use in human patients. In certain embodiments, an inhibitor of ARHGEF6 activity for use in the manufacture of a pharmaceutical is an inhibitor of ARHGEF6 activity for use in humans.
[0010] In a second embodiment, an inhibitor of ARHGEF6 activity is provided for use in the treatment or prevention of chronic kidney disease. In this embodiment, the inhibitor of ARHGEF6 activity is a drug that can reduce the amount of ARHGEF6 at the protein level.
[0011] In a third embodiment, an inhibitor of ARHGEF6 activity is provided for use in the manufacture of a pharmaceutical product for the treatment of chronic kidney disease.
[0012] In a further embodiment, an antisense oligonucleotide is provided that selectively binds to ARHGEF6 mRNA, thereby silencing ARHGEF6 protein expression.
[0013] In a further embodiment, proteolytic chimeras (PROTACs) or small molecule degraders are provided, each of which induces the degradation of the ARHGEF6 protein. [Brief explanation of the drawing]
[0014] To better understand this specification, the following figures are referenced. [Figure 1] Lollipop plots showing the locations of rare missense mutations in ARHGEF6, Rac / Cdc42 guanine nucleotide exchange factor 6, obtained from a study comparing the genomes of 500 CKD patients with those of 9,000 controls. Six rare missense mutations in CKD patients (above the line, pink) are shown above the plot, with five of these being found in the DH domain. In contrast, missense mutations in the control population (below the line, blue) are widely distributed across the protein structure. The domains in the figure, from left to right, are (A) the calponin homology (CH) domain, (B) RhoGEF67_u1, (C) SH3_9, (D) the RhoGEF domain, (E) the PH domain, (F) RhoGEF67_u2, and (G) the betaPIX coiled coil. [Figure 2a] Figure 2a) Western blot using ARHGEF6 antibody shows equal expression and cleavage of the 87kDa isoform to the shorter 71kDa isoform across wild-type (wt) and ARHGEF6 variants in HEK293 cells. Figure 2b) Rac1 activation and Figure 2c) Cdc42 activation in mutant cells compared to those observed in ARHGEF6 wild-type cells reveal that the ARHGEF6 mutation identified in CKD patients selectively activates Rac1. [Figure 2b] Figure 2a) Western blot using ARHGEF6 antibody shows equal expression and cleavage of the 87kDa isoform to the shorter 71kDa isoform across wild-type (wt) and ARHGEF6 variants in HEK293 cells. Figure 2b) Rac1 activation and Figure 2c) Cdc42 activation in mutant cells compared to those observed in ARHGEF6 wild-type cells reveal that the ARHGEF6 mutation identified in CKD patients selectively activates Rac1. [Figure 2c] Figure 2a) Western blot using ARHGEF6 antibody shows equal expression and cleavage of the 87kDa isoform to the shorter 71kDa isoform across wild-type (wt) and ARHGEF6 variants in HEK293 cells. Figure 2b) Rac1 activation and Figure 2c) Cdc42 activation in mutant cells compared to those observed in ARHGEF6 wild-type cells reveal that the ARHGEF6 mutation identified in CKD patients selectively activates Rac1. [Figure 3] Structural analysis shows that when ARHGEF6 mutations are superimposed on the Tiam1 crystal structure, they cluster in specific regions of the DH domain, and that they are closer to different interface residues of Rac1 than to Cdc42. Two projections are presented, with the image on the right rotated 90° relative to the image on the left, as shown in the figure. The locations of the ARHGEF6 GI variants projected onto the Tiam1 structure are shown in red. Rac1 interface residues different from the Cdc42 protein sequence are shown in yellow. Rac1 is shown in green (in front of the left image, at the top of the right image), and Tiam1 DH is shown in blue (behind the left image, at the bottom of the right image). [Figure 4a] ARHGEF6 expression is higher in the glomeruli than in the tubulointerstitium, and furthermore, ARHGEF6 is upregulated in CKD glomeruli. [Figure 4b]Upregulation of ARHGEF6 is observed to appear in CKD stage 1 and is maintained up to CKD stage 5, while ARHGEF6 levels in the tubulointerstitium are lower, and upward regulation appears from CKD stage 2 onwards. [Figure 4c] Glomerular ARHGEF6 was observed to be upregulated to statistically significant levels across multiple CKD etiologies. [Figure 5a] ARHGEF6 expression in the cortex and glomeruli of BTBR ob / ob mice at weeks 8, 24, and 20 (normal diet), and at weeks 14 and 20 (high-protein (HP) diet), compared to controls (C-BTBR lean mice), showed progressive upward regulation in the glomeruli of BTBR ob / ob mice over time, but not in the tubules. [Figure 5b] These mice, and [Figure 5c] In situ hybridization of samples from patients with advanced diabetic nephropathy and FSGS (focal segmental glomerulosclerosis) revealed that ARHGEF6 expression is abundant in the glomeruli (dark brown dots represent ARHGEF6 signaling). [Figure 6a] Effect of ARHGEF6 overexpression in podocytes grown in culture: Figure 6a) ARHGEF6 overexpression is observed to cause podocyte detachment. [Figure 6b] The CKD stressor PAN has been shown to promote ARHGEF6 expression in cultured podocytes. [Figure 6c] Depletion of ARHGEF6 in podocytes by lentiviral knockdown has been observed to protect against PAN-induced shedding. [Figure 7] Lentiviral knockdown of ARHGEF6 in podocytes protects against PAN-induced shedding by stabilizing active β-1 integrin. [Figure 8]Partial depletion of ARHGEF6 is sufficient to rescue the PAN-treated podocyte phenotype. Top image: PAN treatment disrupts the organization of actin cytoskeletal stress fibers, but varying degrees of ARHGEF6 depletion rescued stress fibers in both untreated and PAN-treated podocytes. Bottom left image: PAN treatment inactivates β-1 integrin, but varying degrees of ARHGEF6 depletion rescued β-1 integrin activation in both untreated and PAN-treated podocytes. Bottom right image: Activated β-1 integrin promotes adhesion to GBM. [Figure 9] Alignment of the ARHGEF6 gene, transcripts, and ASO sequences. Three ARHGEF6 transcripts, ENST00000250617, ENST00000370622, and ENST00000370620 (available at ensemble.org), are shown in boxes indicating exons, connected by lines with arrows indicating introns. Coding sequences within exons are shown by wider boxes, and non-coding sequences by narrower boxes. The positions where ASOs 1, 2, and 3, listed in Table 1, have complete complementary homology are indicated by bars (ASO columns in the figure). [Figure 10] The role of ARHGEF6 upregulation in chronic kidney disease. Experiments detailed herein reveal that excessive ARHGEF6 activity can be detrimental to both the podocyte cytoskeleton and the levels of active β-1 integrin. Excessive ARHGEF6 is detrimental to normal renal function because it impairs the actin cytoskeleton necessary for maintaining podocyte morphology, and therefore the filtration slits between adjacent, densely clustered podocytes on the glomerular filtration barrier, by inhibiting the activation of β-1 integrin, which is necessary for maintaining podocyte adhesion to the glomerular basement membrane. Experiments herein show that ARHGEF6 interacts with the client protein PAK1 and GIT. [Figure 11a]Overexpression of ARHGEF6 induces apoptosis in human primary glomerular endothelial cells (HGMECs). Figure 11a) HGMECs were transfected with either GFP or the ARHGEF6 plasmid by electroporation. After 24 hours of cell seeding, annexin V fluorescence staining was monitored for another 24 hours using live imaging, and the percentage of annexin V-positive cells was calculated. The percentage of annexin V-positive cells relative to the total number of cells was higher in ARHGEF6-transfected cells than in GFP-transfected cells. [Figure 11b] HGMECs were lysed after annexin V live imaging. Caspase 3 / 7 activity was measured in transfected cultured HGMECs. Unpaired t-test, *P<0.05, ***P<0.001, ****P<0.0001. [Figure 12] Incubation of THP-1 cells with ARHGEF-6 ASO Sequence ID No. 7 (TACAGTTTTCTTGGTC) reveals that i) THP-1 cell viability is maintained after long-term (91-hour) exposure to ASO (CellTiterGlo®), and ii) ARHGEF-6 knockdown occurs (AlphaLISA®). [Figure 13] A schematic summary of the BTBR ob / ob mouse study. Mice were randomized at 7 weeks of age, at which point baseline blood glucose and uACR levels were measured. IP administration of control and ASO9 at two dose levels was initiated at week 9 and continued on a weekly basis until week 20 (total of 12 doses). Urine samples were collected regularly throughout the study to examine the progression of uACR levels. Blood samples were collected at the end of the study for further analysis. [Figure 14]Downregulation of ARHGEF6 gene and protein expression after treatment with ASO9. Left plot: ARHGEF6 gene expression relative to HPrt. Right plot: ARHGEF6 protein expression (fmol / μg). For each case from LHS to RHS, the plots show results obtained in BTBR wild-type mice (healthy controls), BTBR ob / ob mice (disease controls), and BTBR ob / ob mice treated with ASO9 at doses of 1 mg / mg and 8 mg / kg, respectively. Results are shown as mean ± SEM. One-way ANOVA. **** = P-value < 0.0001. [Figure 15] Plot of estimated mean UACR values versus weeks of treatment, measured in urine from BTBR ob / ob disease controls treated with PBS (phosphate-buffered saline, white circles) and either 1 mg / kg (triangle) or 8 mg / kg (black circles) doses of ASO9. For the 8 mg / kg ASO9 cohort, a statistically significant 61% improvement in renal injury was observed after 8 weeks of treatment and maintained until the end of the study. Analysis was performed using a mixed model of repeated measures for each subject over time, with treatment group and time as fixed effects, for the UACR data. Post-hoc contrast with the control group was performed using Dunnett's method. *** = P-value < 0.001, between BTBR ob / ob, control PBS, and BTBR ob / ob, ASO9, 8 mg / kg. [Figure 16] Glomerular scores at the end of a 12-week ASO9 treatment period, based on data analysis using a mixed linear model (MLL) and Student's t-test with the Satterthwaite method. Briefly, a trained AI algorithm was used to assign a numerical score to each glomerulus in the entire histological kidney section, providing an indicator of the degree of glomerular damage. The definitions are: 0: Normal, no change or minimal change, no change or slight change; 1: Mild, mild to moderate mesangial matrix dilation with fewer than 4 mesangial cells / glomerular segments; 2: Moderate, moderate mesangial matrix dilation with 4 to 6 mesangial cells / glomerular segments; 3: Severe, moderate to severe mesangial matrix dilation with more than 6 mesangial cells / glomerular segments. [Figure 17A] Super-resolution microscopy at the end of a 12-week ASO9 treatment period. From left to right, the images show podocyte staining in BTBR wild-type (healthy control), BTBR ob / ob (disease control), and BTBR ob / ob treated with ASO9. The images in the first column (Photo A) and the images in the second column (Photo B) show two different regions in the renal glomerulus, illustrating the foot processes of podocytes. [Figure 17B] The results are presented as mean values in the plots of filtration slit density (FSD, left-hand plot) and estimated glomerular diameter (right-hand plot). Statistics - One-way ANOVA. ** = P-value < 0.01, **** = P-value < 0.0001. [Figure 18] Super-resolution microscopy at the end of a 12-week ASO9 treatment period. From left to right, the images show podocyte staining in BTBR wild-type (healthy control), BTBR ob / ob (disease control), and BTBR ob / ob treated with ASO9. The images in the upper row (labeled A) and lower row (labeled B) represent two different regions in the renal glomerulus, with arrows pointing to green-labeled endothelium (stained with EHD3). [Figure 19] Plasma AST and ALT levels at the end of a 12-week ASO9 treatment period. Levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT), two liver enzymes used in healthcare as biomarkers of liver damage, did not increase in ASO9 treatment over the course of treatment compared to BTBR ob / ob disease control mice. Results are shown as mean ± SEM. Significance was assigned using one-way ANOVA and Dunnett's multiple comparison test. [Figure 20]Body weight and organ weight at the end of a 12-week ASO9 treatment period. Treatment with ASO9 at doses of 1 mg / kg and 8 mg / kg had no effect on body weight or organ weight compared to disease controls. Results are shown as mean ± SEM. One-way ANOVA and Dunnett's multiple comparison test were used. [Figure 21] ASO9 exposure at the end of a 12-week ASO9 treatment period. ASO9 concentrations in the kidneys, liver, skeletal muscle, and heart of animals after 12 weeks of treatment at doses of 1 mg / kg and 8 mg / kg. Results are shown as mean ± SEM. Significant differences between groups calculated by Student's t-test. **** = P-value < 0.0001. [Modes for carrying out the invention]
[0015] As described above, this specification provides a method for treating or preventing chronic kidney disease, comprising administering an inhibitor of ARHGEF6 activity to a patient in need thereof. The inhibitor of ARHGEF6 activity may act by reducing the expression of the ARHGEF6 protein, as in the case of an antisense oligonucleotide (ASO) inhibitor that binds to mRNA produced by ARHGEF6, or as in the case of lentiviral knockdown, or by directly degrading the ARHGEF6 protein, as in the case of a proteolytic chimera (PROTAC), or as in the case of a small molecule degrader (i.e., a small molecule that causes the degradation of ARHGEF6).
[0016] The identification of ARHGEF6 as a novel target for the treatment or prevention of chronic kidney disease, and how precisely therapeutic entities targeting this target function, are built upon a series of studies inspired by initial insights gained from genomic analysis of samples obtained from CKD patients.
[0017] More specifically, recent genomic studies investigating the association of rare variants with renal function and CKD included whole-exome sequencing of 3,150 kidney patient samples and 9,563 control samples encompassing diverse CKD subtypes. The proportion of cases and controls with rare variants per gene were compared using a rare variant decomposition analysis approach to assess the contribution of rare variants to CKD risk in a large multi-ethnic population (Cameron-Christie et al, J Am Soc Nephrol. 2019. 30(6):1109-1122). As described in the Cameron-Christie paper, the association of rare variants can have broader implications. More specifically, the detection of rare, independent variants clustered on a single gene can provide important insights into disease biology and potentially influence clinical treatment in several ways, even if pathogenic variants in a particular gene explain only a small proportion of all cases. Firstly, in populations with both acquired, hereditary, and multifactorial diseases, accurate estimation of the proportion of cases caused by known genes can inform the use of existing treatments and diagnostic trials. Secondly, rare mutations can lead to the discovery of PCSK9 mutations, which in turn can lead to the identification of broadly applicable therapeutic targets, e.g., the development of treatments for common forms of hypercholesterolemia. Thirdly, it is increasingly recognized that validation of such drug targets in genetic studies of human populations improves the probability of success in drug development in clinical trials. ARHGEF6 was one of approximately 300 genes identified in this study that have potential rare variant associations with CKD / ESRD; however, no further relevance or significance of ARHGEF6 in CKD was provided or suggested.
[0018] Considering the results presented in the Cameron-Christie paper, recognizing the role of ARHGEF6 in cytoskeletal rearrangement and motility processes, and further recognizing that another study suggested that hyperactivation of Rac1, a GTPase that binds to and is activated by ARHGEF6, is associated with renal impairment, the inventors decided to explore whether a causal link between ARHGEF6 activity and CKD could be established. Furthermore, if such a causal link could be established, the inventors wondered whether direct or downstream inhibition of ARHGEF6 activity could offer new opportunities for the treatment and / or prevention of CKD. If inhibition of ARHGEF6 activity offers such opportunities for the treatment or prevention of CKD, the inventors sought to understand what characteristics an effective inhibitor of ARHGEF6 activity should have. As detailed below, the results from the studies detailed herein demonstrate that effective treatment of CKD may require regulation of ARHGEF6 protein activity at the protein level, for example, by downregulating ARHGEF protein expression (e.g., using antisense oligonucleotides) or by causing degradation at the ARHGEF6 protein level (e.g., using PROTAC or small molecules), and that simply blocking the interaction between ARHGEF6 and further proteins such as Rac1, directly or indirectly, to block downstream effects may not be optimal.
[0019] The experiments conducted by the inventors in order to establish a relationship between ARGHEF6 and CKD are described in detail in the following section on examples. The results obtained from this study and their significance are summarized in i) to viii) below. i) The locations of ARHGEF6 mutations identified in a study reported by Cameron Christie et al. were projected onto a Lollipop plot to determine whether any specific associations existed at the mutation sites. The resulting plot revealed that five of the six observed rare variant ARHGEF6 mutations identified in the study were located in the DH downstream effector domain, which is thought to be involved in Rac1 binding and GEF catalytic activity (see Figure 1). This clustering of rare variant mutations prompted further research into the functional consequences of these mutations. ii) HEK293-derived cells overexpressing either wild-type ARHGEF6 or ARHGEF6 with point mutations identified in rare variant genome analysis were generated using CRISPR knockdown of ARHGEF6 in HEK293 cells, followed by transfection with both wild-type (wt) and mutant ARHGEF6 (S273F, S278N, L285F, S329T, G360S, and S562L) (Figure 2a). As can be seen from Figures 2b and 2c, increased Rac1 activation was observed in all six cell lines overexpressing mutant ARHGEF6 compared to HEK cells overexpressing wild-type protein, but no significant effect on Cdc42 activation was observed. The ARHGEF6 mutations identified in rare variant genome analysis were therefore identified as gain-of-function mutations that selectively activate Rac1 but do not activate Cdc42. iii) Since the X-ray protein crystal structure of ARHGEF6 itself was not available, the inventors decided to examine the X-ray crystal structure of the nearest homolog (Tiam1) for which a structure was available, in order to see where the mutant residue was located. Previous crystallographic studies had shown that the Tiam1-Rac1 interaction is centered on the DH domain of Tiam1, which has a relatively large surface area (3000 Å). 2It was revealed that it contains (Worthylake et al, Nature 2000, pp. 682-688). In this structure, the PH domain of Tiam1 appears to stabilize the DH domain, and as a result, Tiam1 can efficiently bind to Rac1. When residues of ARGHEF6, which were found to be mutated in rare variant genome analysis of CKD patients, were projected onto the Tiam1 structure (see Figure 3), they were observed to cluster around the α5 and α6 helices of the DH domain, which interact with Rac1 (but not with Cdc42). iv) Human transcriptome analysis of ARHGEF6 revealed that ARHGEF6 expression is significantly higher in the glomeruli compared to the tubulointerstitium, and that ARHGEF6 expression is higher in CKD patients than in controls (1.38-fold change, p<0.05) (Figure 4a). The significant increase in glomerular ARHGEF6 expression was observed to occur in CKD stage 1, i.e., the early stage of CKD, and this expression was demonstrated to be maintained throughout the later stages of the disease (Figure 4b). More progressive, lower-level upregulation of ARHGEF6 in the tubulointerstitium was observed in the same analysis, however, in this case, the upregulation appears to begin in CKD stage 2 / 3. These data support the hypothesis that ARHGEF6 activity may be a causative factor in CKD, due to early and sustained upregulation from the earliest stages of the disease. Glomerular ARHGEF6 was observed to be statistically significant upmodulated across multiple CKD etiologies, including DN (diabetic nephropathy), FSGS (focal segmental glomerulosclerosis), HTN (renal hypertension), IgAN (IgA nephropathy / Berger's disease), RPGN (rapidly progressive glomerulonephritis), and SLE (systemic lupus erythematosus), but not in MCD (thinning of the glomerular basement membrane), MGN (membraneolonephritis), and TMD (thin glomerular basement membrane disease). v) Since ARGHEF6 expression is not localized to podocytes in the kidney alone, we attempted to establish whether there are signs of selective ARGHEF6 upregulation in podocytes in an obese mouse model of CKD diabetic nephropathy (BTBR ob / ob mouse model described in Hudkins et al, J Am Soc Nephrol 2010, 21(9), pp. 1533-42). BTBR ob / ob mice spontaneously develop diabetes at 6 and 8 weeks (male / female, respectively). Compared to control and lean BTBR mice, transcriptome analysis revealed that ARGHEF6 upregulation in obese mice increased over time in the glomeruli but not in the cortex (Figure 5a). In situ hybridization of samples from these mice (Figure 5b), as well as from patients with advanced diabetic nephropathy and FSGS (Figure 5c), revealed that ARHGEF6 expression was abundant in the glomeruli (small dark brown dots in the image are ARHGEF6 signals) but not abundant in the tubules. A correlation was observed between upregulation of ARHGEF6 and the development of CKD diabetic nephropathy and focal segmental glomerulosclerosis, which is consistent with the human transcriptome analysis described in iv) above. vi) Overexpression of ARHGEF6 in cultured podocytes was observed to cause podocyte detachment from the culture (cells transfected with green fluorescent protein (GFP), used as a control, did not detach (see Figure 6a)). In supplementary experiments, exposure of cultured podocytes to the CKD stressor PAN was found to induce ARHGEF6 expression (Figure 6b) and promote podocyte detachment from the culture (Figure 6c). When ARHGEF6 function was inhibited by lentiviral shRNA knockdown of ARHGEF6, PAN-promoted podocyte detachment did not occur (Figure 6c), demonstrating that inhibition of ARHGEF6 activity via suppression of ARHGEF6 at the protein level is protective against podocyte cytoskeletal rearrangement, and that ARHGEF6 activity also promotes detachment from cell culture. vii) Insights into the mechanism by which ARHGEF6 promotes detachment were provided by staining PAN-stressed podocytes treated with lentiviral shRNA against ARHGEF6 and a control against active β-1 integrin (β1-integrin). β1-integrin expression by podocytes has been demonstrated to be essential for maintaining the structural integrity of the glomerular filtration barrier, as β1-integrin activity is essential for podocyte adhesion to the glomerular basement membrane (see Pozzi et al, Developmental Biology 2008, (316), pp. 288-30). As can be seen in Figure 7, inhibition of ARHGEF6 activity by lentiviral shRNA knockdown preserves active β1-integrin, which is crucial for glomerular structural integrity, and consequently protects podocytes from PAN-induced detachment in culture. Therefore, it has been shown that inhibiting the induction of ARHGEF6 protein resulting from exposure to the CKD stressor PAN protects the glomerular filtration barrier by maintaining both the integrity of the cytoskeleton of podocytes on the GBM (maintenance of the actin cytoskeleton of podocytes) and the adhesion of podocytes to the GBM (maintenance of active β-1 integrin levels). viii) To further analyze the mechanism by which ARHGEF6 promotes podocyte shedding, and to supplement the above observations suggesting that inhibiting ARHGEF6-mediated Rac1 activation alone does not completely suppress the harmful effects of ARHGEF6 upregulation in CKD, we conducted experiments to investigate the effects of partial knockdown of ARHGEF6. This experiment was designed to determine whether partial knockdown of ARHGEF6 protects against the harmful effects on podocytes that we have established as results from ARHGEF6 upregulation. Accordingly, PAN-stressed podocytes were treated with altered amounts of lentiviral shRNA against ARHGEF6, and titration experiments were performed to reduce PAN-stimulated ARHGEF6 protein levels. The results of this experiment showed that partial depletion of ARHGEF6 protein was sufficient to restore the level of active β1-integrin to the level observed in normal, PAN-free podocytes (Figure 8). Therefore, regulation of ARHGEF6 protein levels is established as having a positive, restorative benefit from the maintenance of the podocyte actin cytoskeleton on the glomerular filtration barrier by downregulating ARHGEF6-mediated Rac1 activation to “normal” levels, thereby protecting the podocyte actin cytoskeleton, and further promoting podocyte adhesion by restoring “normal” active β1-integrin levels. ix) In addition to podocyte injury, endothelial dysfunction is another characteristic of CKD. Multiple factors, including oxidative stress, inflammatory responses, advanced glycation end products, and uremic toxins, contribute to renal endothelial damage (see, for example, J. Malyszko, Clin Chim Acta. 2010 Oct 9;411(19-20):1412-20.doi:10.1016 / j.cca.2010.06.019). Experiments using single-cell RNA sequencing (see, e.g., T. Andrews, M. Hemberg, Molecular Aspects of Medicine 59(2018), 114-122) and RNAscope (see, e.g., https: / / acdbio.com / science / how-it-works, F. Wang et al, J Mol Diagnostics, 2012, 5(2):210-219) revealed that ARHGEF6 is expressed in glomerular endothelial cells of both human and mouse kidneys. To study the functional effects of ARHGEF6 upregulation in endothelial cells, ARHGEF6 was overexpressed in primary human glomerular endothelial cells (HGMECs) by electroporation of the ARHGEF6 plasmid. Overexpression of ARHGEF6 was found to significantly increase apoptosis of HGMECs, as evidenced by a significant increase over time in Annex V-positive HGMECs and increased caspase 3 / 7 activity in ARHGEF6-overexpressed HGMECs compared to control plasmid-transfected HGMECs (Figures 11a and 11b, respectively). These results suggest that upregulated ARHGEF6 may partially contribute to endothelial dysfunction in CKD. Therefore, considering together with the effects of ARHGEF6 overexpression on the cytoskeleton of podocytes and their adhesion to the GBM, it is demonstrated that overexpression of ARHGEF6 is detrimental to multiple components of the glomerular filtration barrier. x) ASOs against human and mouse ARHGEF6 were generated, and profiling demonstrated that very potent, non-toxic ASOs can be generated. Furthermore, long-term exposure of associated cells to such ASOs, and high-level ARHGEF6 knockdown in the same cells, were well tolerated and therefore support progression to clinical evaluation of this modality.
[0020] In summary, the results of the above experiments establish that administration of agents capable of depleting or degrading ARHGEF6 protein levels to deliver levels associated with a normally functioning kidney can restore the cytoskeleton of podocytes and their attachment to the GBM. Thus, a novel therapeutic approach for CKD has been established, involving the administration of ARHGEF6 activity inhibitors to patients in need. ARHGEF6 activity inhibitors are preferably agents that function to reduce ARHGEF6-mediated Rac1 activation and protect against activated β1-integrin. As demonstrated herein, ARHGEF6 activity inhibitors may act to deplete protein expression or directly degrade ARHGEF6 at the protein level, thereby aiming at the attachment of podocytes to the GBM through the maintenance or restoration of a “normal” actin cytoskeleton and the restoration of “normal” levels of activated β1-integrin in podocytes on the GBM. For example, inhibitors of ARHGEF6 activity may act by downregulating ARHGEF6 at the protein level, similar to the case of ASOs (as directly demonstrated, e.g., in the lentiviral knockdown experiments above and with ASOs below). Alternatively, inhibitors of ARHGEF6 activity may act by degrading ARHGEF6, as in the case of proteolytic chimeras (PROTACs) or small molecule degraders.
[0021] To further demonstrate the concepts outlined above and foreshadowed in (x) above, we designed and synthesized a set of antisense oligonucleotides (ASOs) against ARHGEF6 and evaluated their ability to reduce ARHGEF6 expression in human THP-1 cells. ASOs with a length of 16 nucleotides were designed for the ARHGEF6 (ENSG00000129675) gene sequence and its unspliced transcript. Regions accessible for ASO targeting were identified using the Vienna RNA RNAplfold algorithm (see Bernhart, SH, Muckstein, U. & Hofacker, ILRNA Accessibility in cubic time. Algorithms Mol Biol 6, 3 (2011)). Preliminary designs of ASOs were performed according to the general guidelines described in Oligonucleotide-Based Therapies: Methods and Protocols (Humana Press, 2019). doi:10.1007 / 978-1-4939-9670-4. Next, candidate ASOs (complementary base pair sequences) targeting accessible regions were further filtered before synthesis based on meeting the following criteria a) to f). a) Accessibility score > 0.001 (using the Vienna RNA RNAplfold algorithm) b) Complete complementarity for ARHGEF6 sequence only, c) Complementarity with 50 or less other genes with 1 mismatch, d) ASO does not target regions with minor allele frequencies > 0.05. e) No CG motifs, and f) %GC > 10.
[0022] The ASO design was further prioritized based on the predicted lack of a tendency to form double helix with itself (i.e., another identical ASO) and the low probability of self-folding, thereby ensuring that the ASO exists in a conformation suitable for binding to the target ARHGEF6 mRNA (algorithms for determining these factors are provided in numerous sources, e.g., Lorenz, R., Hofacker, IL & Stadler, PFRNA folding with hard and soft constraints. Algorithms for Molecular Biology 11,8 (2016)).
[0023] To evenly cover the ARHGEF6 transcript, a first set of 50 ASOs was randomly selected for synthesis from the obtained, filtered set of ASO designs that met criteria a) to f). The ASOs were synthesized by standard automated RNA synthesis as 3-10-3 gapmers having an LNA-DNA-LNA structure. The gapmers are chimeric antisense oligonucleotides containing a central block of deoxynucleotide monomers (i.e., DNA units) long enough to induce RNase H cleavage. In the oligonucleotide as a whole, the component ribonucleic acid monomer units are linked by a phosphate bond between the 3'-O ribose group and the 5'-O ribose group of the adjacent ribonucleic acid monomer (delivering a phosphodiester bond). The LNA-DNA-LNA gapmer is a gapmer characterized by LNA monomers at the 3' and 5' ends of the central DNA unit. LNA refers to locked nucleic acid monomer modified A, C (or 5-Me-C), G, or T ribonucleic acid monomers, in which the ribose moiety is modified with methylene bridges connecting the 2',- and 4'-carbons of the ribose ring. Therefore, the 3-10-3 LNA-DNA-LNA gapmer is an oligonucleotide containing 10 central units of A, C (or 5-Me-C), G, or T deoxynucleotide monomers (nucleotides characterized by a 2-deoxyribose moiety), with each of the 3' and 5' ends of the entire ASO sequence flanked by units containing three LNA monomers. Substitution of the C deoxynucleotide monomer with 5-methyldeoxycytosine (5-Me-dC) may be advantageous in ASOs for preventing or reducing undesirable immune responses. The ASOs described herein are characterized by 5-Me-C LNA and DNA units (as indicated by mC in Table 1).
[0024] The advantages of using LNA-DNA-LNA gapmer designs are well known in the field. Briefly, methylene crosslinks in LNA fix, or "lock," the ribose motif to the 3'-end conformation, resulting in reduced conformational flexibility of ribose and increased local organization of the phosphate backbone. This entropic constraint, among other advantages, leads to improved binding to complementary RNA and DNA sequences (see, e.g., Elayadi et al, Biochemistry 2002, 41(31), 9973-9981). Numerous synthetic ribonucleic acid derivatives featuring crosslinks connecting the 2'- and 4'-carbons of the ribose ring are available and collectively known as crosslinked nucleic acids (BNAs). The binding of ASO gapmers to their complementary target mRNA triggers RNase recruitment, followed by mRNA cleavage by RNase, leading to downregulation of gene expression. mRNA cleavage releases the ASO gapmer, allowing it to function catalytically.
[0025] The synthesized ASO library was evaluated for its ability to reduce ARHGEF6 expression in THP1 cells. Results from three exemplary ASOs, SEQ ID NOs: 1, 2, and 3, along with ARHGEF6 knockdown in THP1 cells, are shown in Table 1. The distribution of ASOs across ARHGEF6 transcripts is shown in Figure 9 (ASOs 1, 2, and 3 are ordered from left to right in the figure).
[0026] [Table 1]
[0027] As can be seen in Table 1, prototype ASOs designed to target ARHGEF6 across the entire gene were demonstrated to reduce ARHGEF6 expression in cells. Thus, the ability of ARHGEF6-targeting ASOs to modulate ARHGEF6 expression is demonstrated, and when considered together with the established associations among the ARHGEF6 upregulations described herein, ARHGEF6 targeting is shown to be a viable modality for the treatment of chronic kidney disease.
[0028] To extend these preliminary results, the inventors attempted to obtain more active mouse and human ASOs. A set of prototype mouse ASOs was designed and synthesized according to the algorithm described above for SEQ ID NOs: 1-3, yielding a set of molecules that were proven to be able to knock down ARHGEF6 protein expression in mouse cells. Generating mouse ASOs was desirable because it provides an opportunity to explore efficacy, selectivity, and toxicity in non-human model systems.
[0029] An RNA walk process was performed to optimize the degree of knockdown delivered by the prototype ASO (both mouse and human). The RNA walk process involves systematically shifting the target RNA sequence by one or more bases from the one targeted by the initial prototype ASO. In practice, this involves deleting one or more nucleosides from one end of the existing ASO and adding the same number of nucleosides to the opposite end of the ASO, with the newly added nucleosides being complementary to the corresponding mRNA sequence. The activity of four additional human ASOs (SEQ ID NOs. 4-7) is shown in Table 1, demonstrating that this can produce highly potent and effective ASOs against human ARHGEF6.
[0030] To establish whether exposure to ASO or knockdown of ARHGEF-6 in cells impairs cell viability, we conducted experiments to evaluate the effects of long-term exposure of THP-1 cells to ASO Sequence ID No. 7. The results of this experiment are shown in Figure 12. In this experiment, THP-1 cells were incubated with ASO Sequence ID No. 7 for 91 hours. To evaluate cell viability, we repeated incubations using CellTiterGlo® (see Promega.co.uk for details on this luminescent cell viability assay, e.g., based on the quantification of ATP presence; ATP is used as an indicator of metabolically active cells), and ARHGEF-6 AlphaLISA® (see perkinelemer.com; ARHGEF-6 specific AlphaLISA® was developed in-house and is based on PerkinElmer anti-rabbit IgG AlphaLISA acceptor beads (AL104C), anti-mouse IgG alpha donor beads (AS104), ARHGEF-6 purified MaxPab mouse polyclonal antibody (B01P) (Abnova, H00009459-B01P), and Cool2 / αPix(C23D2) mAb monoclonal (rabbit) antibody (CST, 4573S)) to measure ARHGEF-6 protein expression. The CellTiterGlo® assay and the AlphaLISA® assay were normalized against an H2O control. The AlphaLISA® assay was normalized against a neutral control (H2O) and an inhibitory control ASO that showed >90% ARHGEF-6 knockdown. As can be seen in Figure 12, THP-1 cells can be grown over a sustained period in plates with a volume of 10 μL / well. No effect of ASO treatment on cell viability was observed throughout the experiment (91 hours of incubation time), and ARHGEF-6 knockdown reached 100% over the same time course.
[0031] Table 2 shows the sets of mouse ASOs generated after RNA walking, along with their knockdown, cytotoxicity (caspase MEC), and potency. As can be seen from Table 2, a set of highly active mouse ASOs was generated. Caspase MEC (minimum effective concentration of μM, minimum threshold set at 30%) is a measure of ASO cytotoxicity, and a mean EC30 value > 0.1 μM is considered to indicate an ASO with a safe hepatotoxic and cytotoxic profile.
[0032] [Table 2]
[0033] The conversion of this ASO activity in an in vitro system to an in vivo setting is progressing, as is the optimization of ASO for therapeutic use in humans. Below, we report the results of the first proof-of-concept study demonstrating that renal filtration barrier function in CKD can be restored using ARHGEF6 gene and protein-level knockdown.
[0034] To obtain in vivo proof of the concept that renal filtration barrier function can be restored in CKD using ARHGEF6 gene and protein-level knockdown, we conducted studies to evaluate the effects of ARHGEF6 ASO administration to diabetic BTBR ob / ob mice. Functional readouts used to understand the effect on the filtration barrier included longitudinal analysis of urinary albumin to creatinine combined with glomerular histological and structural super-resolution analysis. A schematic diagram outlining the study is shown as Figure 13.
[0035] Leptin-deficient BTBR ob / ob mouse (spontaneous mutation, Lep obThose with homozygosity exhibit extreme obesity due to overeating. They develop severe and progressive hyperglycemia, hypertriglyceridemia, elevated plasma insulin, impaired wound healing, as well as decreased metabolism and hypothermia (see, e.g., KL Hudkins et al, J Am Soc Nephrol 2010, Sep, 21(9), 1533-42). Thus, the diabetic BTBR ob / ob mouse model mimics the features of early diabetic neuropathy (DN) in humans (CKD / DN stage 2 in humans), with chronic injury limited to the glomeruli. These mice also develop severe progressive albumin and proteinuria, as well as some of the morphological features typical of human DN, such as mesangial proliferation, basement membrane thickening, and some degree of mesangial lysis. BTBR ob / ob mice are hyperfiltration, thereby mimicking the early stages of human DN.
[0036] As described in detail herein, the effects of intraperitoneal ARHGEF6 ASO treatment versus control showed beneficial effects on the restoration of the filtration barrier, resulting in less albumin leakage into the urine (proteinuria, UACR) as a result of the improved structural improvement of the filtration barrier achieved by ASO.
[0037] Figure 14 shows the first confirmation that intraperitoneal (ip) administration of mouse ARHGEF6 ASO and ASO9 can deliver a knockdown effect on ARHGEF6 gene and protein expression in mouse kidneys. The degree of knockdown was observed to increase in a dose-dependent manner.
[0038] Furthermore, as can be seen in Figure 15, once-weekly ip administration of ASO9 at doses of 1 mg / kg and 8 mg / kg resulted in a promising reduction in UACR levels, with a 61% reduction in UACR levels compared to the control group in the 8 mg / kg ASO9 dose cohort. Moreover, UACR levels in the 8 mg / week ASO9 cohort were observed to decrease throughout the study compared to the UACR level at the start of the study. In summary, the data obtained in this study suggest that ARHGEF6 ASO treatment may not only prevent the progression of kidney injury in the BTBR ob / ob mouse model, but that regulating ARHGEF6 protein levels may also potentially reverse already sustained kidney injury.
[0039] In addition to its promising effect on UACR, the cohort administered 8 mg / kg of ASO9 per week showed significantly improved glomerular scores, as shown in Figure 16. In histological sections obtained in this study, the amount of severely damaged glomeruli in ASO-treated sections was significantly reduced, while the number of normal glomeruli increased (in placebo-treated BTBR ob / ob control mice, there were hardly any normal glomeruli).
[0040] Improvements in glomerular health were also confirmed using super-resolution microscopy. ASO9 treatment resulted in the repair of podocyte foot processes (as indicated by filtration slit density (FSD)) and restoration of glomerular size (as indicated by a decrease in glomerular diameter), as can be seen in Figure 17. Furthermore, improved glomerular endothelial morphology was observed after ASO9 treatment with a decrease in endothelial processes in BTBR ob / obASO-treated samples, similar to that seen in the healthy endothelial phenotype in BTBR wild-type (wt) mice (see Figure 18).
[0041] No differences in AST and ALT levels were observed between ASO9-treated mice and disease controls (Figure 19), nor were any changes in body weight or organ weight (see Figure 20). Taken together, these results indicate that ASO9 does not adversely affect liver enzymes or health status. These results highlight the safety of ARHGEF6-targeted ASO and support the suitability of ARHGEF6 targeting in treatment.
[0042] As can be seen in Figure 21, the quantification levels of ASO9 in different organs confirm that ASO exposure is much higher in the kidney—more than 14 times—compared to exposure levels in the liver, muscle, or heart. Therefore, ASO accumulation after IP administration is observed in the target tissue (kidney).
[0043] In summary, the results in the BTBR ob / ob model provide proof of concept that reducing the ARHGEF6 protein, as achieved in this study by administering ARHGEF6 ASO9 to BTBR ob / ob mice, can improve renal function by restoring the glomerular filtration barrier in the kidney. This is demonstrated by reduced protein loss (UACR) through the renal filtration barrier, resulting from improved health of the cells, podocytes, and endothelial cells that constitute the filtration barrier. This is also demonstrated by the recovery of glomerular lesions (glomerular score). In summary, the positive results obtained in this disease-related model support the proposal that ASOs that selectively target ARHGEF6 have the potential to restore renal function in CKD with glomerular filtration barrier dysfunction. These results also support the therapeutic potential of other modalities that result in a reduction of ARHGEF6 at the protein level, such as PROTACS or small molecules that cause degradation of the ARHGEF6 protein.
[0044] ASO structures other than the above-described 3-10-3 LNA-DNA-LNA gapmer can be equally applicable to the generation of ASOs against ARHGEF6. For example, the LNA units can be replaced with alternative cross-bridged nucleic acids such as (S)-cEt or ENA (see Morita et al, Bio Med Chem Lett 2002, 12(1), p73-76), and / or the lengths of the three component units of the gapmer can be adjusted. Gapmers characterized by alternative substitutions at the 2'-position of some or all of the ribose units, such as 2'-OH (RNA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-O-MOE), and 2'-fluoro (2'-F RNA), can also be used to adjust ASO properties (for reviews on the design of ASOs, see Deleavey and Damha, Chem Biol, 2012, 19(8), p937-54, and Shen and Corey, Nucleic Acids Research, 2018, 46(4), p1584-1600). It is also possible to replace the ribose units in the component ribonucleic acid monomers with morpholino (PMO) units. Finally, part or all of the phosphate linker between the 3'-O group and the 5'-O group of adjacent ribonucleic acid monomer units (which provide the overall phosphodiester units in the oligomer) in the oligonucleotide can be replaced with phosphorothioate (PS), thiophosphoramidate (NP), or boranophosphate linkages.
[0045] In embodiments, an ARHGEF6-selective antisense oligonucleotide having the following gapmer structure is provided: (A) 0-6 -(DNA) 8-14 -(C) 0-6 Wherein, (A) 0-6 , and (C) 0-6 each independently represents a unit containing 0 to 6 modified ribonucleic acid monomers (indicated by subscripts), and (DNA) 8-14This represents a unit containing 8 to 14 2-deoxyribonucleic acid monomer nucleotides. As those skilled in the art will understand, the ribonucleic acid monomer units that constitute motifs A and C are covalently linked via phosphodiester bonds between the 3' and 5' carbon atoms of adjacent monomer ribose units. DNA units are similarly linked, even though the phosphodiester bonds are between the 3' and 5' carbon atoms of adjacent monomer 2-deoxyribose units.
[0046] In these gapmer ASO structures, the modified ribonucleic acid monomers containing A and C are independently selected from LNA, (S)-cEt, RNA, 2'-OMe, 2'-O-MOE, or 2'-F nucleotide motifs, or nucleosides in which ribose is replaced by a morpholino (PMO) group. In these gapmers, some or all of the phosphodiester bonds may be replaced by phosphorothioate (PS), thiophosphoamide group, thiophosphoamide (NP), or boranophosphate bond.
[0047] Examples of chemical modifications to internucleotide bonds that may be used in ARHGEF6 ASO are shown below (quoted from Chem Biol, 2012, 19(8), pp. 937-54).
[0048] [ka]
[0049] Examples of chemical modifications of oligonucleotide sugars that may be used in ARHGEF6 ASO are shown below (quoted from Chem Biol, 2012, 19(8), pp. 937-54).
[0050] [ka]
[0051] In parallel with the development of inhibitors of ARHGEF6 activity, the inventors attempted to further understand the interaction between ARHGEF6 and its protein partners.
[0052] ARHGEF6 is a scaffolding protein that drives its biological functions through interactions with important protein partners. To investigate the role of ARHGEF6 in Rac1 activation, we investigated the interactions between ARHGEF6 and PAK1 and GIT1. PAK1 is a member of the p21-activated kinase family involved in regulating cell motility and morphology. GIT1, a G protein-coupled receptor (GPCR)-kinase interacting protein 1, is a ubiquitous multi-domain GTPase-activating protein and has been proposed to act as a scaffolding protein to facilitate multi-protein interactions in diverse cellular processes.
[0053] A peptide derived from PAK1 (amino acid sequence: DDDATPPPVIAPRPEHTKSVYTR (SEQ ID NO: 17)) was found to bind to full-length ARHGEF6 (residues 1-776) with a potency of 13.6 μM in surface plasmon resonance (SPR) experiments. Further exploration of the interaction was carried out using a shortened ARHGEF6 construct (SH3-DH-PH construct = amino acid residues 155-551). The PAK1 peptide showed specific binding to this construct with potencies of 7.3 μM and 9.6 μM, respectively, when applying a steady-state model and a 1:1 dynamic interaction model. The binding of the peptide to this construct was further confirmed using isothermal titration calorimetry (ITC), yielding a binding affinity of 4.3 μM.
[0054] The interaction between PAK1 and GIT1 was tested for hARHGEF6 isoform 2 (M155-P776). In SPR experiments, it was observed that PAK1 transiently interacted with ARHGEF6. The association rate constant (k on ), and the dissociation rate constant (k off ) are, each, 7.6 × 10 5 M -1 s-1 , and 1.6 × 10 -2 s -1 It is estimated that the apparent dissociation constant (K) is 21.1 nM. D ) was obtained.
[0055] On the other hand, GIT1 showed slow association with ARHGEF6, but demonstrated very stable complex formation with ARHGEF6. Due to the slow kinetics, particularly the dissociation step, the value of the rate constant could not be uniquely determined from the SPR curve. However, the binding analysis showed that k on , and k off The values are approximately 1.7 × 10⁻⁶ each. 4 , and <10 -5 This suggested that...
[0056] R max Based on value estimations, PAK1 monomers were bonded to 13.7 monomers of ARHGEF6 immobilized on the SPR chip. ARHGEF6 exists in a heterogeneous state (potentially different stereochemical states or post-translational modifications), and it is likely that only a subset of ARHGEF6 protomers can bind to PAK1. Similar analysis using GIT1 suggests a binding ratio of 1:2.4 (GIT1:ARHGEF6).
[0057] As described above, this specification provides methods for the treatment or prevention of chronic diseases, inhibitors of ARHGEF6 activity for use in the treatment of chronic kidney disease, and inhibitors of ARHGEF6 activity for use in the manufacture of pharmaceuticals.
[0058] Accordingly, this specification provides a method for the treatment or prevention of chronic kidney disease, comprising administering an inhibitor of ARHGEF6 activity to a patient in need thereof. In some cases, an inhibitor of ARHGEF6 activity for use in a method for treating CKD reduces ARHGEF6 expression at the protein level. Examples of ARHGEF6 activity inhibitors include antisense oligonucleotides against ARHGEF6 mRNA that cause downregulation of ARHGEF6 or ARHGEF6 proteolysis-inducible chimeras (PROTACs), or small molecules that cause degradation of ARHGEF6 protein. In some cases, an inhibitor of ARHGEF6 activity acts in a catalytic manner.
[0059] In embodiments, the therapeutic methods and uses described herein are for CKD, such as diabetic nephropathy (DN), focal segmental glomerulosclerosis (FSGS), renal hypertension (HTN), IgA nephropathy / Berger's disease (IgAN), rapidly progressive glomerulonephritis (RPGN), and systemic lupus erythematosus (SLE).
[0060] In embodiments, the therapeutic methods and uses described herein are for chronic kidney disease (CKD) accompanied by glomerular filtration barrier dysfunction.
[0061] Inhibitors of ARHGEF6 activity may act by reducing the expression of the ARHGEF6 protein, as in the case of antisense oligonucleotide (ASO) inhibitors that bind to mRNA produced by ARHGEF6, or they may directly induce the degradation of ARHGEF6 at the protein level, as in the case of proteolytic chimeras (PROTACs, see, e.g., Sun et al, Signal Transduction and Targeted Therapy volume 4, Article number: 64 (2019)) or small molecule degraders.
[0062] Embodiments of this specification provide a method for treating chronic kidney disease, comprising administering an antisense oligonucleotide against ARHGEF6 mRNA to a patient in need thereof, thereby causing ARHGEF6 protein depletion. In certain embodiments, the ASO is an RNase H competent ASO, i.e., an ASO that binds to a homologous mRNA transcript to form an RNA-DNA heteroduplex recognized by the endogenous RNase H enzyme RNASEH1, resulting in the enzymatic catalytic degradation of the RNA, thereby releasing the ASO to bind to further mRNA, thereby silencing ARHGEF6 expression and reducing ARHGEF6 protein levels.
[0063] In one embodiment, patients requiring treatment with an ARHGEF6 activity inhibitor are identified as having stage 2 or stage 3 CKD. In another embodiment, patients requiring treatment with an ARHGEF6 activity inhibitor are identified as having stage 4 or stage 5 CKD. In yet another embodiment, patients requiring treatment are identified based on the stage of CKD, established by eGFR measured before the start of treatment. In yet another embodiment, patients requiring treatment are identified based on eGFR measured before the start of treatment, for example, <90 mL / min / 1.73 m 2 , or <70 mL / min / 1.73 m 2 , or <60 mL / min / 1.73 m 2 They are identified based on the stage of CKD, as established by the measured eGFR. In the embodiment, patients requiring treatment are those with a blood glucose level of <60 mL / min / 1.73 m 2Patients are identified based on having a GFR. In embodiments, patients requiring treatment are identified based on the stage of CKD, established by the urinary albumin-to-creatinine ratio (UACR) measured before the initiation of treatment, for example, patients having a UACR of >30 mg / g, e.g., 200-5000 mg / g. Methods for diagnosing chronic kidney disease and CKD stages are well known in the art. A comprehensive overview of the techniques used to assess CKD is provided in the 2024 KDIGO Guidelines at Chapter 1 (pages S169-S195).
[0064] In embodiments of this specification in which GFR or eGFR values are identified, they may be established, for example, based on an analysis of serum creatinine levels (see, e.g., Cockcroft, Nephron 1976:16:31-41). Alternatively, eGFR values may be calculated based on a composite of serum creatinine and cystatin C levels, for example, according to the four-variable MDRD study formula, in combination with data on the patient's age, race, and sex (see, e.g., Inker et al, N Eng J Med 2012 Jul 5;367(1):20-9; www.mdrd.com). Other methods for measuring GFR or EGFR are apparent to those skilled in the art.
[0065] Embodiments of this specification provide a method for treating chronic kidney disease, comprising administering a proteolytic chimera (PROTAC) that induces the degradation of ARHGEF6 to a patient in need thereof (see Paiva and Crews, Curr Opin Chem Biol 2019, 50, 111-119 for an overview of PROTACs). A proteolytic event mediated by E3 ubiquitin ligase releases the PROTAC, allowing it to function in a catalytic manner.
[0066] Embodiments of this specification provide a method for treating chronic kidney disease, comprising administering a degrader of ARHGEF6, for example, a small molecule or a PROTAC, to a patient in need thereof.
[0067] Embodiments of this specification provide a method for treating chronic kidney disease, comprising administering an ARHGEF6 activity inhibitor to a patient in need thereof. In the embodiment, the inhibitor may prevent, reverse, or reduce ARHGEF6-mediated Rac1 activation and / or prevent, reverse, or reduce depletion of βARHGEF6-mediated active 1-integrin levels compared to those observed before treatment with the ARHGEF6 inhibitor. In the embodiment, the ARHGEF6 activity inhibitor can prevent or reduce the degree of ARHGEF6-mediated Rac1 activation and prevent or reduce the degree of depletion of ARHGEF6-mediated active β1-integrin levels compared to those observed before treatment with the ARHGEF6 inhibitor.
[0068] In the embodiments described herein, the ARHGEF6 activity inhibitor is a drug that binds to ARHGEF6 mRNA, for example, ARHGEF6 ASO, thereby inducing the degradation of ARHGEF6 mRNA and consequently inducing a decrease in the intracellular concentration of ARHGEF6 protein. In the embodiments, the ARHGEF6 activity inhibitor is a drug that binds to ARHGEF6 protein and induces the degradation of ARHGEF6, thereby inducing a decrease in the intracellular concentration of ARHGEF6 protein.
[0069] In this embodiment, an inhibitor of ARHGEF6 activity directly binds to ARHGEF6, thereby inhibiting ARHGEF6-mediated Rac1 activation and / or inhibiting the depletion of ARHGEF6-mediated active β1-integrin levels. In this embodiment, an inhibitor of ARHGEF6 activity directly binds to ARHGEF6, thereby inhibiting ARHGEF6-mediated Rac1 activation. In this embodiment, an inhibitor of ARHGEF6 activity directly binds to ARHGEF6, thereby inhibiting the depletion of ARHGEF6-mediated active β1-integrin levels. In this embodiment, an inhibitor of ARHGEF6 activity may bind to ARHGEF6 in a reversible or irreversible manner.
[0070] In embodiments, inhibitors of ARHGEF6 activity may reduce, halt, or reverse the rate of progression of chronic kidney disease, for example, by a decrease in GFR or eGFR, or an increase in UACR. The rate of progression of chronic kidney disease can be assessed by comparing the rate of change in measured GFR, eGFR, or UACR in patients with chronic kidney disease treated with an ARHGEF6 activity inhibitor with that in patients with chronic kidney disease who have equivalent measured GFR, eGFR, or UACR, treated with placebo or an alternative treatment for chronic kidney disease.
[0071] In this embodiment, the ARHGEF6 inhibitor is used in patients with stage 3 CKD or those with stage 3 CKD, i.e., <70 mL / min / 1.73 m 2 Patients with a GFR of 30-59 mL / min / 1.73 m 2 It is intended for use in the treatment of patients with GFR. In some embodiments, ARHGEF6 inhibitors are used in patients with stage 4 or stage 5 CKD, i.e., <30 mL / min / 1.73 m 2 This is intended for use in the treatment of patients with GFR.
[0072] In embodiments, a method for treating CKD further includes identifying patients for treatment based on patients having GFR, eGFR, or UAR, indicating that the patient has stage 2, stage 3, or stage 4 CKD.
[0073] In embodiments, the treatment method further comprises selecting patients in need for treatment with an inhibitor of ARHGEF6 activity, the inhibitor of ARHGEF6 activity being a drug capable of inhibiting ARHGEF6-mediated Rac1 activation, or a drug capable of inhibiting the decrease in ARHGEF6-mediated activated β-integrin levels, or a drug capable of reducing ARHGEF6 expression, or a drug capable of degrading ARHGEF6 at the protein level, thereby reducing the intracellular ARHGEF6 concentration.
[0074] In one aspect of this specification, inhibitors of ARHGEF6 activity are provided for use in the treatment or prevention of chronic kidney disease. In the embodiments of this specification, inhibitors of ARHGEF6 activity for use can reduce the amount of ARHGEF6 at the protein level, thereby reducing net ARHGEF6 activity. In the embodiments of this specification, inhibitors of ARHGEF6 activity can reduce ARHGEF6-mediated Rac1 activation and / or depletion of ARHGEF6-mediated active β1-integrin levels.
[0075] The ARHGEF6 activity inhibitors used may act by reducing the expression of the ARHGEF6 protein, as in the case of antisense oligonucleotide (ASO) inhibitors that bind to mRNA produced by ARHGEF6, or they may directly induce the degradation of ARHGEF6 at the protein level, as in the case of proteolytic chimeras (PROTACs) or small molecule ARHGEF6 degraders.
[0076] Further aspects of this specification provide antisense oligonucleotides (ASOs) against ARHGEF6 mRNA for use in the treatment of CKD. Further aspects of this specification provide antisense oligonucleotides (ASOs) against human ARHGEF6 mRNA for use in the treatment of CKD in human patients requiring treatment for CKD.
[0077] In one embodiment, the ARHGEF6 activity inhibitor for use is for use in patients identified as having stage 2 or stage 3 CKD. In another embodiment, the ARHGEF6 activity inhibitor for use is for use in patients identified as having stage 4 or stage 5 CKD. In yet another embodiment, the ARHGEF6 activity inhibitor for use is for use in patients identified based on the stage of CKD, established by eGFR measured before the start of treatment. In yet another embodiment, the ARHGEF6 activity inhibitor for use is for use with eGFR measured before the start of treatment, e.g., <90 mL / min / 1.73 m 2 , or <70 mL / min / 1.73 m 2 It is for use in patients identified based on the stage of CKD, established by measured eGFR. In embodiments, the ARHGEF6 activity inhibitor for use is for use in patients identified based on the stage of CKD, established by the urinary albumin-to-creatinine ratio (UACR) measured before the initiation of treatment, e.g., patients having a UACR of >30 mg / g, e.g., 200-5000 mg / g.
[0078] In a further aspect of this specification, ARHGEF6 PROTAC is provided for use in the treatment of CKD.
[0079] In one embodiment, the use of ARHGEF6 activity inhibitors for the treatment of chronic kidney disease involves the administration of a proteolytic chimera (PROTAC) that causes degradation of ARHGEF6.
[0080] In embodiments, the use of ARHGEF6 activity inhibitors for the treatment of chronic kidney disease includes the administration of ARHGEF6 degraders, such as small molecules or PROTACs.
[0081] In the embodiment, the ARHGEF6 activity inhibitor for use in the treatment of chronic kidney disease is administered orally. In the embodiment, the ARHGEF6 activity inhibitor for use in the treatment of chronic kidney disease is administered intravenously (IV). In the embodiment, the ARHGEF6 activity inhibitor can prevent ARHGEF6-mediated Rac1 activation and / or ARHGEF6-mediated depletion of active β1-integrin levels. In the embodiment, the ARHGEF6 activity inhibitor can prevent ARHGEF6-mediated Rac1 activation and ARHGEF6-mediated depletion of active β1-integrin levels.
[0082] In embodiments of this specification, an ARHGEF6 activity inhibitor for use in the treatment of chronic kidney disease is a drug that binds to ARHGEF6 mRNA, thereby inducing the degradation of ARHGEF6 mRNA and consequently inducing a decrease in the intracellular concentration of ARHGEF6 protein. In embodiments, an ARHGEF6 activity inhibitor for use in the treatment of chronic kidney disease is a drug that binds to ARHGEF6, thereby inducing the degradation of ARHGEF6 and consequently inducing a decrease in the intracellular concentration of ARHGEF6 protein.
[0083] In the embodiment, an inhibitor of ARHGEF6 activity directly binds to ARHGEF6, thereby inhibiting ARHGEF6-mediated Rac1 activation and / or ARHGEF6-mediated depletion of active β1-integrin levels. In the embodiment, an inhibitor of ARHGEF6 activity directly binds to ARHGEF6, thereby inhibiting ARHGEF6-mediated Rac1 activation. In the embodiment, an inhibitor of ARHGEF6 activity may directly bind to ARHGEF6, thereby inhibiting ARHGEF6-mediated depletion of active β1-integrin levels.
[0084] In one embodiment, an ARHGEF6 activity inhibitor directly binds to a protein that associates with ARHGEF6, activating Rac1 and thereby inhibiting ARHGEF6-mediated Rac1 activation. In another embodiment, an ARHGEF6 activity inhibitor binds to a complex of ARHGEF6 with at least one other protein and thereby inhibits ARHGEF6-mediated Rac1 activation. In yet another embodiment, an ARHGEF6 activity inhibitor binds to a complex of ARHGEF6 with at least one other protein and thereby inhibits the depletion of ARHGEF6-mediated active β1-integrin levels.
[0085] In embodiments, ARHGEF6 activity inhibitors for use reduce, halt, or reverse the rate of progression of chronic kidney disease, as assessed, for example, by a decrease in GFR or eGFR, or an increase in UACR. The rate of progression of chronic kidney disease can be assessed by comparing the measured rate of change in GFR, eGFR, or UACR in patients with chronic kidney disease treated with an ARHGEF6 activity inhibitor with that in patients with chronic kidney disease treated with placebo or an alternative treatment for chronic kidney disease.
[0086] In this embodiment, the ARHGEF6 inhibitor is used in the treatment of stage 3 CKD, i.e., 30-59 mL / min / 1.73 m 2 Between <70 mL / min / 1.73 m 2 This is intended for use in patients with GFR. In this embodiment, the ARHGEF6 inhibitor is used in the treatment of stage 4 or stage 5 CKD, i.e., 30 mL / min / 1.73 m 2 This is intended for use in patients with a GFR of less than 1 / 2.
[0087] In the embodiment, the ARHGEF6 inhibitor is intended for use in the treatment of CKD in patients identified for treatment based on having GFR, eGFR, or UAR, exhibiting stage 2, stage 3, or stage 4 CKD.
[0088] In this embodiment, ARHGEF6 inhibitors for use in the treatment of CKD are agents that can inhibit ARHGEF6-mediated Rac1 activation, or agents that can inhibit the decrease in ARHGEF6-mediated activated β-integrin levels, or agents that can reduce ARHGEF6 expression, or agents that can degrade ARHGEF6 at the protein level, thereby reducing the intracellular ARHGEF6 concentration.
[0089] In one embodiment, an ARHGEF6 ASO is provided. In one embodiment, the ARHGEF6 ASO is selective for ARHGEF6 mRNA, i.e., it has complete complementarity only with ARHGEF6 mRNA, for example, human ARHGEF6.
[0090] In this embodiment, the ARHGEF6 ASO a) targets a region of ARHGEF6 having an accessibility score > 0.001 (using the Vienna RNA RNAplfold algorithm), b) has complete complementarity only to the ARHGEF6 sequence, c) has one mismatch complementarity to 50 or fewer other genes, d) does not target regions with a minor allele frequency > 0.05, e) does not have a CG motif, and f) has a %GC content > 10.
[0091] In this embodiment, an ARHGEF6 ASO having the following gapmer structure is provided. (A) 0-6 -(DNA) 8-14 -(C) 0-6 During the ceremony, (A) 0-6 , and (C) 0-6 These independently represent units containing 0 to 6 modified ribonucleic acid monomers. (DNA) 8-14 This represents a unit containing 8 to 14 2-deoxyribonucleic acid monomers. The subscript indicates the number of monomers that make up A, B, and C.
[0092] In this embodiment, ARHGEF6 ASO is a 3-10-3 LNA-DNA-LNA gapmer.
[0093] In one embodiment, an ARHGEF6 ASO is provided, which is produced by a process comprising the following steps: a) selecting an ASO that targets an accessible region of ARHGEF6, optionally a region of ARHGEF6 having an accessibility score >0.001, as determined using the Vienna RNA RNAplfold algorithm; b) determining that the candidate ASO has complete complementarity only to the ARHGEF6 sequence; c) determining that the candidate ASO has complementarity with one mismatch to 50 or fewer other genes; d) filtering to ensure that the candidate ASO does not target a region having a minor allele frequency >0.05; e) ensuring that the candidate ASO does not have a CG motif and has a %GC content >10; and optionally, f) synthesizing the obtained candidate oligonucleotide.
[0094] In this embodiment, the ARHGEF6 ASO product obtained through this process has the following gapmer structure. (A) 0-6 -(DNA) 8-14 -(C) 0-6 During the ceremony, A and C independently represent units containing 0 to 6 modified ribonucleic acid monomers. DNA represents a unit containing a 2-deoxyribonucleic acid monomer. Each subscript indicates the number of monomers that make up A, B, and C.
[0095] In this embodiment, the ARHGEF6 ASO product obtained in this process is a 3-10-3 LNA-DNA-LNA gapmer.
[0096] In one embodiment, ARHGEF6 ASO is provided for use in the treatment of chronic kidney disease. In this embodiment, ARHGEF6 ASO for use in the treatment of chronic kidney disease has the following gapmer structure. (A) 0-6 -(DNA) 8-14 -(C) 0-6 During the ceremony, A and C independently represent units containing 0 to 6 modified ribonucleic acid monomers. DNA represents a unit containing a 2-deoxyribonucleic acid monomer. The subscripts indicate the number of monomers in the embodiments in which A, B, and C are configured, and ARHGEF6 ASO for use in the treatment of chronic kidney is a 3-10-3 LNA-DNA-LNA gapmer.
[0097] In one embodiment, a method for treating chronic kidney disease is provided, comprising administering ARHGEF6 ASO to a patient in need thereof. In this embodiment, ARHGEF6 ASO for use in the therapeutic method has the following gapmer structure. (A) 0-6 -(DNA) 8-14 -(C) 0-6 During the ceremony, A and C independently represent units containing 0 to 6 modified ribonucleic acid monomers. DNA represents a unit containing a 2-deoxyribonucleic acid monomer. In the formula, the subscripts indicate the number of monomers that make up A, B, and C. A and C independently represent units containing 0-6 modified ribonucleic acid monomers (indicated by subscript numbers), and DNA is a unit consisting of 8 to 14 2-deoxyribonucleic acid monomers.
[0098] In this embodiment, ARHGEF6 ASO, for use in a method of treating chronic kidney disease, is a 3-10-3 LNA-DNA-LNA gapmer.
[0099] In one embodiment, the ARHGEF6 PROTAC is provided.
[0100] In one embodiment, an inhibitor of ARHGEF6 activity is provided for use in the manufacture of pharmaceuticals, for example, pharmaceuticals intended for the treatment of chronic kidney disease.
[0101] In this embodiment, the inhibitor of ARHGEF6 activity for use in the manufacture of pharmaceuticals is an ARHGEF6 ASO having the following gapmer structure. (A) 0-6 -(DNA) 8-14 -(C) 0-6 During the ceremony, A and C independently represent units containing 0 to 6 modified ribonucleic acid monomers. DNA represents a unit containing a 2-deoxyribonucleic acid monomer. Each subscript indicates the number of monomers that make up A, B, and C. In the embodiment, ARHGEF6 ASO for use in the manufacture of pharmaceuticals has a 3-10-3 LNA-DNA-LNA gapmer structure.
[0102] In the embodiment, the pharmaceutical formulation containing ARHGEF6 ASO is intended for use in the treatment of chronic kidney disease. In the embodiment, the pharmaceutical formulation containing ARHGEF6 ASO is intended for use in the treatment of chronic kidney disease accompanied by glomerular filtration barrier dysfunction.
[0103] In the embodiment, the pharmaceutical for the treatment of CKD is intended for use in patients identified for treatment based on having GFR, eGFR, or UACR, indicating stage 2, stage 3, or stage 4 CKD. In the embodiment, the pharmaceutical is used in the treatment of stage 3 CKD, i.e., <70 mL / min / 1.73 m 2 30-59 mL / min / 1.73 m 2 This is intended for use in patients with a GFR of [value missing]. In the embodiment, the ARHGEF6 inhibitor is used in the treatment of stage 4 or stage 5 CKD, i.e., 30 mL / min / 1.73 m 2This is intended for use in patients with a GFR of less than a certain level.
[0104] In one embodiment, a pharmaceutical composition comprising an inhibitor of ARHGEF6 activity is provided. In the embodiment, the pharmaceutical composition is for oral administration. In the embodiment, the pharmaceutical composition is for intravenous administration. In the embodiment, the pharmaceutical composition is for intramuscular administration.
[0105] In one embodiment, a kit is provided comprising a pharmaceutical composition containing an inhibitor of ARHGEF6 activity and instructions for its use in the treatment of CKD.
[0106] Further aspects of this specification provide a method for identifying a patient for treatment with an inhibitor of ARHGEF6 activity, comprising analyzing a sample collected from the patient for the presence of a biomarker of chronic kidney disease, e.g., ARHGEF6, Rac1 activation, or β1-integrin inactivation, or a marker of CKD, e.g., measured GFR, eGFR, or UACR.
[0107] In one embodiment, this specification provides a method for treating or preventing CKD, comprising administering an ARHGEF6 inhibitor to a patient in need thereof. The patient may be identified as having renal impairment based on their eGFR value. The eGFR value may be established, for example, based on an analysis of serum creatinine levels (see, e.g., Cockcroft, Nephron 1976:16:31-41). Alternatively, the eGFR value may be calculated based on a complex of serum creatinine and cystatin C levels, combined with data on the patient's age, race, and sex, for example, according to the four-variable MDRD study formula (see, e.g., Inker et al, N Eng J Med 2012 Jul 5;367(1):20-9; www.mdrd.com).
[0108] In this embodiment, patients requiring treatment with an ARHGEF6 inhibitor may be identified as having CKD based on their measured glomerular filtration rate (GFR). For example, if the measured GFR is <60 mL / min / 1.73 m 2 This can be used to identify patients who are in stage 3 or more advanced CKD (see KDIGO) and are suitable for treatment with ARHGEF6 inhibitors. Patients for treatment can also be identified as having early CKD using ARHGEF6 inhibitor interventions used to halt, delay, or substantially reduce disease progression.
[0109] Identifying patients requiring treatment with ARHGEF6 inhibitors can also be established by a combination of existing studies or other existing studies known to detect renal impairment. For example, measuring the amount of albumin in a patient's urine (albumin versus creatinine (ACR) test) may indicate renal disease if the ACR is greater than 30 mg / g. eGFR can be equally used to identify and classify the degree of renal impairment and the need for therapeutic intervention with ARHGEF6 inhibitors.
[0110] Patients requiring treatment with ARHGEF6 inhibitors can also be identified by obtaining a renal biopsy sample from the patient and analyzing whether the sample shows elevated levels of ARHGEF6. Advantageously, since ARHGEF6 overexpression is known to begin in CKD stage 1, the use of ARHGEF6 inhibitors can be indicated and initiated at an earlier stage of CKD than is possible by other means. Intervention with ARHGEF6 inhibitors may reverse, halt, or delay the decline in a patient's renal function.
[0111] In one embodiment, this specification provides a method for treating or preventing a patient diagnosed with or at risk of developing chronic kidney disease (CKD), comprising administering to the patient a therapeutically effective dose of an ARHGEF6 inhibitor. The patient may be diagnosed with, for example, 1, 2, or 3 CKD based on, for example, their urinary albumin-to-creatinine ratio, or their urinary protein-to-creatinine ratio, their measured GFR, or their eGFR. The patient may be diagnosed with 1, 2, or 3 CKD based, for example, on any of the techniques recommended in the 2024 KDIGO guidelines.
[0112] In one embodiment, the Specified Public Service provides a method for reducing the risk of CKD in patients suspected of having a tendency to develop CKD or a tendency to progress to a later stage of CKD, for example, patients identified as overexpressing ARHGEF6 or ARHGEF6 based on the results of a renal biopsy or based on the urinary albumin to creatinine ratio, urinary protein to creatinine ratio, measured GFR, or eGFR, comprising administering a therapeutically effective dose of an ARHGEF6 inhibitor to the patient.
[0113] In one embodiment, this specification provides a method for reducing the risk of CKD in a patient suspected of having a tendency to develop CKD, the method comprising administering a therapeutically effective dose of an ARHGEF6 inhibitor to the patient.
[0114] In one embodiment, this specification provides a method for treating or preventing CKD in a subject, comprising administering an ARHGEF6 inhibitor to the subject to thereby treat or prevent CKD in the subject. In such embodiments, preventing CKD may refer to stopping, reversing, or reducing the rate of decline of eGFR, or measured GFR, so that stage 3 CKD does not progress to stage 4 CKD, or so that a patient identified as having a particular stage of CKD at the start of treatment sees an improvement in measured or estimated GFR after a certain period of treatment with the ARHGEF6 inhibitor.
[0115] In one embodiment, this specification provides a method for treating a subject having CKD, comprising administering an ARHGEF6 inhibitor to a patient in need thereof, for reversing, stopping, or slowing the rate of decline in the patient's eGFR.
[0116] In one embodiment, this specification provides a method for monitoring the response of a patient with CKD to an ARHGEF6 inhibitor, the method being: (a) Evaluate the patient's eGFR or GFR after treatment with an ARHGEF6 inhibitor, (b) Comparing this eGFR or GFR to the eGFR or GFR level measured before the initiation of treatment with an ARHGEF6 inhibitor.
[0117] In such embodiments, the determination of the patient's eGFR, or GFR, after administration of an ARHGEF6 inhibitor may occur after treatment with the ARHGEF6 inhibitor for a period of one week, two weeks, one month, or longer, for example, six months or one year.
[0118] In the embodiments described herein, the ARHGEF6 inhibitor is administered orally. In the embodiments described herein, the ARHGEF6 inhibitor is administered by injection, for example, into the bloodstream or directly to the kidney. [Examples]
[0119] To facilitate understanding of this specification, the following examples are provided.
[0120] cell culture The inducible CAS9 cell line HEK-ODIN was generated at AstraZeneca R&D Gothenburg (see US2018305714(A1) for details). HEK-ODIN cells were cultured at 37°C in a 5% CO2 incubator in Dulbecco's Modified Eagle Medium (DMEM, Gibco®, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS, Gibco®, Thermo Fisher Scientific) and 1% penicillin-streptomycin (Pen / Strep, Thermo Fisher Scientific). CAS9 expression was induced by overnight treatment with 1 μg / mL doxycycline. Bristol human podocyte cell lines (obtained from Prof. Saleem, Bristol University) were maintained and grown in RPMI-1640 medium (Merck) supplemented with insulin-transferrin-selenium, 10% FBS, and 1% Pen / Strep in an incubator at 33°C and 5% CO2. Before the experiment, the Bristol human podocyte cell line was cultured at 25,000 cells / cm³. 2 The cells were seeded and transferred to a culture medium at 37°C for 14 days. The podocytes were stimulated with puromycin aminonucleoside (PAN, Sigma-Aldrich) 100 or 1000 ng / μl for 72 hours. Palmitic acid (Sigma-Aldrich) 100 or 300 μM was conjugated to human serum albumin (HSA, Sigma-Aldrich) for 24 hours, and protamine sulfate (Sigma-Aldrich) 600 μg / mL for 30 or 60 minutes.
[0121] Construction and transfection of ARHGEF6 sgRNA expression plasmid To efficiently construct ARHGEF6 knockouts, a pair of sgRNAs (CRISPR1:AATCAAGGTGCATCGAGCCC; CRISPR2:CAGCAAACCATTCATGCGAC) were selected from a previously designed library based on the RefSeq sequence NM_004840.3, and proximal cleavage was induced to precisely delete the 47 bp region of the ARHGEF6 CDS. The selected sgRNAs were ordered as oligo-double strands (Sigma-Aldrich) and cloned into the AarI restriction enzyme recognition site of the pMlu backbone (an in-house constructed sgRNA expression backbone containing a human U6 promoter). This construct contains a human U6 promoter and a SpCas9-sgRNA scaffold. Cloning the oligo-double strands into this construct (between U6 and the scaffold) yields the final expressed sgRNA plasmid. The sequence of the recombinant plasmid (expressing the sgRNA) was Sanger sequence validated. The sgRNA plasmid was transfected into CAS9-induced HEK-ODIN cells using lipofectamine LTX (Thermo Fisher Scientific) according to the manufacturer's instructions. Genomic DNA was isolated from the transfected cells using the Qiagen PureGene kit (catalog number 158745, Qiagen), and the knockout efficacy of ARHGEF6 was validated using genotyping primers (forward: CATGAGTGTCTGGCTCACCA; reverse: GGACCATACTTGGCACACGA) (Sigma-Aldrich).
[0122] Construction and transfection of ARHGEF6 overexpression plasmids Eight gBlocks were designed and ordered from GeneArt (Invitrogen) to construct plasmids for overexpression of the ARHGEF6 plasmid. These gblocks include two containing CDSs of wild-type ARHGEF6 splice variants (RefSeq NM_004840.3 and NM_001306177.1), and six containing mutations corresponding to six human SNPs identified based on RefSeq NM_004840.3 (X-135762909-GA, X-135772876-CT, X-135789128-AT, X-135790902-TG, X-135790924-CT, and X-135795444-GA). Each gBlock consisted of a forward primer binding site (MM4), EcoRI, Kossack motif, FLAG-tag, CDS, GS-linker, XhoI, stop codon, XbaI, and reverse primer binding site. The received gBlocks were cloned into a pMA backbone (Thermo Fisher Scientific). The construct was digested using EcoRI and XhoI restriction enzymes (New England Biolabs), the inserts were gel-purified, and cloned into the EcoRI and XhoI sites of the pCMV-Cas9-2A-GFP plasmid (GenScript). Finally, the recombinant plasmid was purified using the Qiagen Miniprep kit and the Sanger sequence was confirmed. The final construct expresses the ARHGEF6 CDS variant under the control of the CMV promoter. The self-cleaving peptide T2A is expressed between ARHGEF6 CDS and GFP. ARHGEF6 overexpression plasmids were transfected into CAS 9-induced HEK-ODIN cells or podocytes using lipofectamine LTX (Thermo Fisher Scientific) according to the manufacturer's instructions.
[0123] Lentiviral infection of podocytes Lentiviral particles expressing ARHGEF6-GFP were purchased from Origene (www.origene.com), and lentiviral particles overexpressing ARHGEF6 shRNA based on RefSeq NM_004840.3 and Rac1 shRNA based on RefSeq NM_006908.5 were purchased from Sigma. After culturing at 37°C for 7-9 days, podocytes were infected with lentivirus using MOI (Multiplicity of Infection). MOI = plaque-forming units (Pfu) / number of cells) was 1 or 10, and the cells were cultured for 7-5 days. Podocytes were harvested 14 days after culturing at 37°C.
[0124] Protein extraction and Western blotting Cells were lysed in RIPA buffer (Santa Cruz Biotechnology) supplemented with 1× PhosStop and Complete mini (Roche). The total protein lysate was subjected to electrophoresis on Novex 4-20% Tris-glycine minigels and blotted onto PVDF membranes. The membranes were incubated overnight at 4°C with rabbit monoclonal anti-ARHGEF 6 antibody 1:1000 (Cell Signaling Technology), followed by incubation at room temperature for 1 hour with HRP anti-rabbit secondary antibody. For protein loading control, the membranes were incubated at room temperature for 1 hour with HRP conjugate mouse monoclonal anti-GAPDH antibody (Abcam). Chemiluminescence signals were detected using SuperSignal West Pico Plus reagent (Thermo Fisher Scientific). Images were captured using the Bio-Rad ChemiDoc Imaging System and analyzed with Image Lab 5.2 software.
[0125] Active Rho GTPase pull-down assay Active Rho GTPases Rac1, Cdc42, and RhoA were determined using the Active Rac1 / Cdc42 or Rho Pull-Down and Detection Kit (catalog numbers 16118 and 16116, Thermo Fisher Scientific, respectively) according to the manufacturer's instructions. Briefly, protein lysates of HEK-ODIN cells containing 0.5 mg of protein were applied in a spin cup onto a glutathione resin containing GST-Rhotekin-RBD (for active RhoA) or GST-Human Pak1-PBD (for active Rac1 / Cdc42). The active GTP-bound GTPases in the lysate were bound to the resin and retained in the spin cup. After three washes, unbound proteins were discarded, and the active Rho GTPases bound to the resin were eluted using 50 μL of reducing sample buffer. 25 μL of eluted active GTPase was subjected to Western blotting quantification of protein levels using the anti-Rac 1 antibody, anti-Cdc 42 antibody, or anti-RhoA antibody included in the kit. Equal volumes of protein lysis without pull-down assay were also applied to Western blotting to determine the total protein levels of Rac 1, Cdc 42, or RhoA. The ratio of active Rho GTPase to total Rho GTPase was used as an indicator of Rho GTPase activity.
[0126] Fluorescent staining of podocytes Porphyrocysts cultured in 96-well black-walled plates were washed with phosphate-buffered saline (PBS, Gibco®, Thermo Fisher Scientific) and fixed for 5 minutes with 2% paraformaldehyde (PFA, VWR Chemicals) and 4% sucrose (Sigma-Aldrich) in PBS. The porphyrocysts were permeabilized with 0.3% triton-X (Sigma-Aldrich) in PBS at 4°C for 10 minutes. The porphyrocysts were blocked at room temperature for 30 minutes with a blocking buffer containing 2% FBS, 2% bovine serum albumin (BSA, Sigma-Aldrich), and 0.2% fish gelatin (Sigma-Aldrich). After blocking, podocytes were incubated with mouse anti-active β1 integrin (12G10) antibody (1:300, Abcam) at room temperature for 1 hour, then with anti-mouse secondary antibody for 1 hour, followed by incubation with phalloidin (5 units / mL, Thermo Fisher Scientific) for 30 minutes. Fluorescence imaging was performed using a high-throughput CV7000 Yokogawa confocal microscope equipped with a 20x objective lens. The number of podocytes with positive stress fibers was manually counted, and the intensity of phalloidin and active β1 integrin staining was measured using a Columbus Image Analysis System.
[0127] Immunofluorescence staining of kidney sections Deparaffinization and antigen recovery of mouse kidney paraffin sections were performed in a steam cooker (2100 Retriever) for 45 minutes using a rodent decloaker plus hot rinse (Biocare Medical). The sections were blocked in PBS with 1% BSA, 2.5% horse serum, and 0.5% Triton X-100 for 30 minutes at room temperature. The sections were incubated overnight at 4°C with rabbit polyclonal anti-ARHGEF 6 antibody 1:100 (Thermo Fisher Scientific). After washing three times with PBS, the sections were treated with the secondary antibody Alexa Fluor 594 donkey anti-rabbit IgG (H+L) (Invitrogen, Thermo Fisher Scientific) 1:500 for 1 hour at room temperature. To reduce autofluorescence, the sections were incubated in 0.3% Sudan Black B (Sigma-Aldrich) in 70% ethanol solution for 25 minutes in the dark. After staining, sections were mounted using Vectashield, which contains DAPI mounting medium (Vector). Fluorescence images were acquired using a Zeiss Axio Scan.Z1 scanner equipped with a 20x objective lens.
[0128] Isolation of mouse glomeruli C57BL / 6N mice were anesthetized with isoflurane, their chests were opened, and they were perfused through the left ventricle with 30 mL of Hanks equilibrium salt solution (HBSS, Gibco®, Thermo Fisher Scientific), followed by perfusion with 30 mL of magnetic beads (catalog no. 140.04, Dynal, Thermo Fisher Scientific). After perfusion, the kidneys were collected, and the cortex was finely chopped on ice. The chopped cortex was mixed with 1 mL of collagenase A (catalog no. 103 586, Roche, 1 mg / mL in HBSS) and incubated at 37°C for 30 minutes. The chopped cortex was passed twice through a 100 μm cell strainer, and the glomerular suspension was collected. The suspension in a 50 mL Falcon tube was centrifuged at 4°C at maximum speed for 15 minutes. The pellet was resuspended in HBSS, and the glomeruli were purified on a magnetic holder. The final glomerular pellet was collected and resuspended in 1 mL of HBSS. The glomeruli were examined and counted under a dissecting microscope. Approximately 250 glomeruli were seeded into each well of a 24-well plate and cultured in DMEM containing 10% FBS at 37°C in a 5% CO2 incubator.
[0129] RNA extraction, cDNA synthesis, and quantitative RT-PCR from mouse glomeruli. Total RNA was extracted from cells using the RNeasy Mini kit (Qiagen), and from mouse glomeruli, total RNA was extracted using the RNeasy 96 kit according to the manufacturer's instructions (Qiagen). cDNA was synthesized using the High-capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer's instructions.
[0130] Real-time qPCR RT-qPCR was performed using a QuantStudio® 6 Flex Real-Time PCR instrument (Applied Biosystems) with Taqman Gene Expression Master Mix. Human Arhgef6 and 36B4, as well as mouse ARHGEF6 and Hprt Taqman probes, were purchased from Applied Biosystems.
[0131] ASO synthesis All starting materials, reagents, and solvents were used as received. Unless otherwise specified, solvents and reagents were obtained from Sigma Aldrich.
[0132] Oligonucleotide synthesis: Oligonucleotides were synthesized on a 1 μmol scale on a K&A DNA-RNA Synthesizer H-8 SE (K&A Laboratories GbR, 64850 Schaafheim, Germany) using a controlled porous glass support with a universal CUTAG linker (27 μmol / g, purchased from HTI Automation GmbH, 85560 Ebersburg, Germany). All phosphoramidites (Sigma Aldrich) were dissolved in DNA-grade acetonitrile to a final concentration of 0.1 M (22 equivalents) before use. Detritylation was performed using 3% dichloroacetic acid in dichloromethane. Activator 42® (5-[3,5-bis(trifluoromethyl)phenyl]-1H-tetrazole solution, 0.25 M in acetonitrile) was used as an activator for coupling. The coupling time for the phosphoramidites was 1 minute for the DNA building block and 7 minutes for the LNA building block. Sulfidating agent II (3-((dimethylamino-methylidene)amino)-3H-1,2,4-dithiazol-3-thione, or DDTT, obtained from Glen Research, 22825 Davis Drive, Sterling, VA 20164) was dissolved in 3:2 (v / v) pyridine / acetonitrile (0.05 M), and the thiolation time was 5 minutes in all cycles. Cap A (acetic anhydride / tetrahydrofuran, 9.1:90.9 v / v) and Cap B (tetrahydrofuran / N-methylimidazole / pyridine, 8:1:1 v / v / v) were mixed in situ in a 1:1 v / v ratio for capping. Removal of the cyanoethyl skeleton was performed with diethylamine / acetonitrile (10% v / v) after the final 5'-detritylation. Oligonucleotides were cleaved from the solid support by four treatments (5-10-10-10 mins) in AMA (26% ammonium hydroxide: 40% methylamine, 1:1) at 20°C, and further deprotected by treatment in the same solution at 65°C for 1 hour.The oligonucleotides were dried under reduced pressure at 45°C for 2 hours, and then diluted with sodium acetate buffer (0.3 M, 330 μL, pH 5.5). Next, ice-cold ethanol (4-5 volumes) was added, and the oligonucleotides were precipitated at -20°C for 2 hours. The suspension was centrifuged for 10 minutes (18000 rcf), and the supernatant was discarded. The oligonucleotide pellets were dried under reduced pressure at 45°C for 30 minutes and used directly without further purification.
[0133] The ASOs described herein are all 3-10-3 gapmers having an LNA-DNA-LNA structure, where the LNA terminus is constructed from LNA-A, LNA-5Me-C, LNA-G, and LNA-T construction blocks, and the central DNA unit is constructed from deoxy-A, deoxy-5Me-C, deoxy-G, and deoxy-T (see definitions below). Amidites used in ASO synthesis: Deoxy-A:(2R,3S,5R)-5-(6-benzamido-9H-purine-9-yl)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)tetrahydrofuran-3-yl(2-cyanoethyl)diisopropylphosphorumidite, Deoxy-5Me-C:(2R,3S,5R)-5-(4-benzamido-5-methyl-2-oxopyrimidine-1(2H)-yl)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)tetrahydrofuran-3-yl(2-cyanoethyl)diisopropylphosphorumidite, Deoxy-G:(2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(2-isobutylamide-6-oxo-1,6-dihydro-9H-purine-9-yl)tetrahydrofuran-3-yl(2-cyanoethyl)diisopropylphosphorumidite, Deoxy-T:(2R,3S,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidine-1(2H)-yl)tetrahydrofuran-3-yl(2-cyanoethyl)diisopropylphosphorumidite, LNA-A:(1R,3R,4R,7S)-3-(6-benzamido-9H-purine-9-yl)-1-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl(2-cyanoethyl)diisopropylphosphorumidite, LNA-5Me-C:(1R,3R,4R,7S)-3-(4-benzamido-5-methyl-2-oxopyrimidine-1(2H)-yl)-1-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl(2-cyanoethyl)diisopropylphosphorumidite, LNA-G:(1R,3R,4R,7S)-1-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(2-isobutylamide-6-oxo-1,6-dihydro-9H-purine-9-yl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl(2-cyanoethyl)diisopropylphosphorumidite, LNA-T:(1R,3R,4R,7S)-1-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(5-methyl-2,4-dioxo-3,4-dihydropyrimidine-1(2H)-yl)-2,5-dioxabicyclo[2.2.1]heptan-7-yl(2-cyanoethyl)diisopropylphosphorumidite.
[0134] Human ARHGEF6 ASO spot test The knockdown effect of ARHGEF6 ASO was determined using THP-1 cells that endogenously express human ARHGEF6. The ASO was biologically duplicated at a single concentration, and relative ARHGEF6 expression levels were analyzed technically in a triple-duplicate manner.
[0135] ASO was pre-dispensed into 96-well cell culture plates using an Echo 655 Acoustic Liquid Handler (Labcyte) to a final concentration of 3.5 μM. Cryopreserved THP-1 cells (ATCC® TIB-202®) were thawed according to standard procedures, washed in culture medium (RPMI 1640 containing GlutaMax, 2 g / L glucose, HEPES, MEM non-essential amino acids, 1 mM sodium pyruvate, 10% FBS, and 50 μM β-mercaptoethanol), and dispensed in 100 μL of culture medium at a rate of 3.5 × 10⁶ per well. 4 The cells were plated onto ASO at a density of living cells. The cells were incubated at 37°C and 5% CO2 for 24 hours.
[0136] After incubation, the cells were transferred to a 96-well V-bottom polypropylene microplate and pelleted at 500g for 3 minutes. After removing the medium, the cells were lysed in 20 μL of lysis buffer (Qiagen RNeasy RLN lysis buffer containing 4% RNAsecure® RNase Inactivation Reagent) at room temperature for 5 minutes. 2 μL of the lysate was used as a template in a 20 μL reverse transcription (RT) reaction (50% RT buffer and 5% enzyme mix from Invitrogen's Cells-to-CT Bulk RT Reagents), and RT was carried out at 37°C for 60 minutes, followed by 95°C for 5 minutes.
[0137] cDNA samples were diluted 1:4, and real-time PCR reactions were performed in a total volume of 10 μL using 3 μL of cDNA, TaqMan® Fast Advanced Master Mix, and ARHGEF6 or hypoxanthine phosphoribosyltransferase 1 (HPRT1) TaqMan® gene expression assays (Hs00374477_m1 and Hs02800695_m1, all from Applied Biosystems). Amplification was performed on a QuantStudio® 7 Flex Real-Time PCR System (Applied Biosystems) for 40 cycles of 2 minutes at 50°C, 10 minutes at 95°C, followed by 15 seconds at 95°C and 1 minute at 60°C. Quantitative cycle (Cq) values were determined by software using the Auto Baseline and Auto Threshold options and then used to calculate relative ARHGEF6 expression (2^-dCq) normalized to the reference gene HPRT1.
[0138] ARHGEF6 ASO concentration-response curves in podocytes The efficacy of ARHGEF6 ASO was evaluated in human iPS cell-derived podocytes that endogenously express human ARHGEF6. iPS cells were induced from the human fibroblast cell line BJ (ATCC CRL-2522) using a stemgent mRNA reprogramming kit, followed by targeted integration of the Tet-On regulated Cas9 transgene (for details, see Lundin, A., Porritt, MJ, Jaiswal, H. et al. Development of an ObLiGaRe Doxycycline Inducible Cas9 system for pre-clinical cancer drug discovery. Nat.Commun. 11, 4903 (2020)). Next, differentiation was performed based on the published protocol (see Musah, S., Dimitrakakis, N., Camacho, DMet al. Directed differentiation of human induced pluripotent stem cells into mature kidney podocytes and establishment of a Glomerulus Chip. Nat. Protoc. 13, 1662-1685 (2018)). ASO was tested using biological dilutions, and relative ARHGEF6 expression levels were analyzed using technical triplicates.
[0139] 1 cm before podocyte maturation 2 3.5 x 10 4Human iPS cell-derived podocytes, seeded at a density of 100 viable cells, were maintained in completely serum-free RocketFuel® maintenance medium (Cell Systems, Kirkland, WA 98034, USA, SF-4Z0-50). Cells were treated with serial 3-fold dilutions of ASO at 37°C and 5% CO2 for 24 hours, then lysed in 20 μL of lysis buffer and processed according to the same protocol as described above for THP-1 cells. Relative ARHGEF6 expression (2^-dCq) was normalized relative to the reference gene HPRT1, data were analyzed, and concentration-response curves were plotted using GraphPad Prism version 8.0.1 for Windows (GraphPad Software Inc., La Jolla, CA, USA; www.graphpad.com). 50 This was calculated using a 4-parameter logistic fitting with the following formula: Y=Bottom+(Top-Bottom) / (1+10^((LogIC 50 -X) * (ChoiceSlope)) In the formula, Y is the response, X is the base-10 logarithm of the ASO concentration, Bottom corresponds to the maximum decrease achieved, and Top is the lowest level achieved.
[0140] Protein production (expression and protein purification) Expression of the N-terminal HN-tagged ARHGEF6 SH3-DH-PH domain construct (N-6xHN-GGG-TEV-hARHGEF6(M155-A551)) and the PAK1 construct (6HN-GGG-TEV-PAK1(M1-K269)) was performed using the bacterial E. coli strain BL21λDE3Gold via a self-induction method.
[0141] The full-length ARHGEF6 construct (N-6xHN-GGG-TEV-hARHGEF6(M1-P776)) and the construct ARHGEF6(M155-P776)-TEV-GSG-HALO-6His were expressed in insect cells (Sf21 cells) with a 48-hour time of intake (TOI).
[0142] For all constructs, cells were recovered by centrifugation and stored at -80°C. The same purification method was used for all constructs, with only the cell lysis method differing.
[0143] The cells were resuspended in a buffer solution (50 mM Tris / HCl, pH 8, 300 mM NaCl, 10% glycerol, 1 mM TCEP, and 1× complete protease inhibitor) and then lysed. The ARHGEF6 SH3-DH-PH domain construct and the PAK1 construct (6HN-GGG-TEV-PAK1(M1-K269)) were lysed by high-pressure homogenization (Emulsiflex), and the full-length ARHGEF6 construct and the ARHGEF6(M155-P776)-TEV-GSG-HALO-6His construct were lysed using Ultra-Turrax. After clarification by centrifugation and addition of imidazole to a final concentration of 20 mM, the lysate was loaded onto a 5 mL Ni HisTrap column (Cytiva) equilibrated in a buffer consisting of 50 mM Tris / HCl, pH 8, 500 mM NaCl, 10% glycerol, 1 mM TCEP, and 20 mM imidazole. Elution was performed with a buffer consisting of 50 mM Tris / HCl, pH 8, 500 mM NaCl, 10% glycerol, 1 mM TCEP, and 500 mM imidazole. The fraction containing the target protein peak was pooled.
[0144] A size exclusion column (Superdex200, Cytvia) was used as the second purification step in 50 mM Tris / HCl buffer, pH 8, 150 mM NaCl, 10% glycerol, and 1 mM TCEP. Protein peaks were collected, concentrated, and stored at -80°C.
[0145] The GIT1 construct, GIT1-TEV-6xHis, was expressed in bacteria (E. coli), recovered by centrifugation, and stored at -80°C.
[0146] Cells were lysed by sonication in a buffer of 20 mM Tris-HCl, pH 7.4, 250 mM NaCl, 5 mM imidazole, and a protease inhibitor. After clarification by centrifugation, the lysate was mixed with cobalt resin equilibrated in a buffer of 20 mM Tris-HCl, pH 7.4, 250 mM NaCl, and 5 mM imidazole. After incubation in batch mode, the resin was placed in an empty column and eluted with a buffer of 20 mM Tris-HCl, pH 7.4, 250 mM NaCl, and 500 mM imidazole. The fraction containing the target protein peak was pooled.
[0147] A size exclusion column (Superdex200, Cytvia) was used as the second purification step in a buffer solution of 50 mM Tris-HCl, pH 8, 300 mM NaCl, 1 mM TCEP, and 1% glycerol. Protein peaks were collected, concentrated, and stored at -80°C.
[0148] Preparation of biotinylated hARHGEF 6 isoform 2 Biotinylation of full-length hARHGEF6 isoform 2 (hARHGEF6(M155-P776)-TEV-GSG-HALO-AAA-6xHis), which has a C-terminal HALO tag, was carried out by mixing 42 μM protein with 50 μM HaloTag® PEG-biotin ligand (Promega G859A) in a buffer containing 50 mM Tris / HCl, pH 8, 150 mM NaCl, 10% glycerol, and 1 mM TCEP. The reaction mixture was incubated at room temperature for 2 hours, and the protein was then purified by gel filtration on a Superose-6 increase 3.2 / 300 column in a buffer containing 50 mM Tris / HCl, pH 7.5, 250 mM NaCl, 10% glycerol, and 1 mM DTT.
[0149] Surface plasmon resonance (SPR) coupling SPR binding experiments were performed on an HN-tagged ARHGEF6 SH3-DH-PH domain construct (N-6xHN-GGG-TEV-hARHGEF6(M155-A551)) and an HN-tagged full-length ARHGEF6 construct using a Biacore T200 optical biosensor unit (GE Healthcare) at 20°C. Sensor chips Series S NTA (research grade, GE Healthcare) were equilibrated at room temperature before use. The electrophoresis buffer for protein tethering and subsequent ligand binding experiments was 10 mM HEPES, 150 mM NaCl, 1 mM TCEP, 0.05% P2O, pH 7.40. Protein tethering was performed at 10 μl / min. -1 The procedure was carried out at the specified flow rate. The NTA surface was prepared by injecting 350 mM EDTA solution (pH 8.3) for 1 minute, followed by injecting electrophoresis buffer supplemented with 0.5 mM NiCl2 for 1 minute. After the initial capture step, the prepared surface was activated for 7 minutes with 50 mM NHS and 200 mM EDC to enable covalent tethering. Immediately thereafter, 50–100 μg / mL was injected with a contact time of 2–3 minutes. -1 Proteins were injected into the electrophoresis buffer at the specified concentrations, yielding final coupling densities of 5500–6000 RU for the ARHGEF6 SH3-DH-PH domain construct and 7000–7500 RU for the full-length ARHGEF6 construct. Inactivation of residual esters was achieved by injecting 300 mM ethanolamine into the electrophoresis buffer for 7 minutes. The reference surface was prepared accordingly, omitting the injection of proteins into the activated reference surface.
[0150] SPR binding experiments on biotinylated ARHGEF6 isoform 2 were performed at 20°C on a Biacore S200 optical biosensor unit (GE Healthcare). Sensor chip series S HLC30M (research grade, GE Healthcare) was equilibrated at room temperature before use. The electrophoresis buffer for protein tethering and subsequent ligand binding experiments was 20 mM HEPES, 250 mM NaCl, 1 mM TCEP, 0.05% P2O, pH 7.5. The surface was prepared with 50 mM NaOH and 1 M NaCl, and 10 μl was electrophoresed using 50 mM NHS and 200 mM EDC. -1 The mixture was activated at the specified flow rate for 10 minutes. Immediately thereafter, 10 μg / mL neutraavidin in 10 mM sodium acetate pH 5.5 was injected for 240 seconds to obtain a coupling density of approximately 1000 RU. Inactivation of the residual ester was achieved by injecting 1 M ethanolamine pH 8.5 for 5 minutes. Then, 2 μl of biotinylated ARHGEF6 isoform 2 (65 nM) was added. -1 Inject at a lower flow rate for several minutes to obtain the desired coupling density, then add 10 μl of 1 mM biotin in electrophoresis buffer to the remaining neutraavidin binding site. -1 Quenching was performed by injecting at a flow rate of 1 minute. Ligand coupling densities ranging from 300 to 1200 RU were tested.
[0151] Binding experiment using PAK1 peptide, 30 μL -1The analysis was performed using a multicycle dynamics method at a flow rate. A contact time of 45 seconds was selected, followed by a 2-minute dissociation step. PAK1 peptide (molecular weight: 2562.8 Da) was dissolved in DMSO to 50 mM, and a compound concentration series was established using eight concentrations in a 2-fold dilution pattern with a digital dispenser HP D300 (Tecan). The concentrations tested were 400, 800, 1600, 3200, 6400, 12800, 25600, and 51200 nM. Before the analysis of compound binding, the instrument was equilibrated by injecting three electrophoresis buffer blanks. The acquisition rate was set to 10 Hz, and all experiments were repeated three times to allow for error estimation. Solvent correction was not necessary due to the low DMSO mismatch (maximum approximately 0.1%) introduced by the addition of the compound.
[0152] Binding experiments using PAK1 were also conducted using 30 μL. -1 The procedure was carried out using a multicycle dynamics method at the specified flow rate. PAK1 concentrations (1.95–125 nM) were prepared in electrophoresis buffer, and each concentration was injected with a contact time of 1 minute and a dissociation time of 10 minutes.
[0153] The experiment using GIT1 involved 30 μl -1 The procedure was performed using a single-cycle kinetics method at the specified flow rate. GIT1 concentrations (2-500 nM) were prepared in electrophoresis buffer, and each concentration was injected sequentially with a contact time of 10 minutes, followed by a final dissociation time of 30-60 minutes.
[0154] For all experiments, the reference-subtracted data was further analyzed by subtracting similar experiments containing only buffer injection to correct for injection artifacts, systematic noise, and instrument drift. This dual-reference data was then fitted using either a 1:1 kinetic interaction model or a steady-state fit to describe transient coupling processes, extracting both kinetic and affinity data.
[0155] Isothermal titration calorimetry (ITC) coupling. SPR binding experiments were performed on an HN-tagged ARHGEF6 SH3-DH-PH domain construct (N-6xHN-GGG-TEV-hARHGEF6(M155-A551)) using a MicroCal Auto-iTC200 unit (Malvern) at 25°C. The titration buffer used for ligand binding experiments consisted of 10 mM HEPES, 150 mM NaCl, 1 mM TCEP, 0.05% P2O, 1% DMSO, and pH 7.40.
[0156] The protein was passed through a PD10 column (GE Healthcare) pre-equilibriumized with titration buffer according to the manufacturer's instructions, and adjusted to a final concentration of 25-30 mM. PAK1 peptide (molecular weight 2562.8 Da) was dissolved in DMSO to 30 mM and then diluted 1:100 in DMSO-free titration buffer to achieve a nominal concentration of 300 mM in the buffer, precisely matching the composition of the titration buffer. The titration experiment was initiated by injecting 1 × 0.4 mL of PAK1 peptide solution into the protein solution, followed by a 60-second waiting period, and then 19 × 2 mL. The interval between individual injections was set to 90 seconds, while a 5-second filtration period and a high-feedback mode were applied to allow for rapid equilibration after each injection.
[0157] Data fitting for ITC coupling experiments Prior to fitting the data, the data was processed by subtracting similar experiments involving only buffer injection to correct for injection artifacts, systematic noise, and instrument drift. The data were fitted using a 1:1 interaction model and 4.26 μM K D The stoichiometric value was 0.87. Under experimental conditions, the bond appears to be strongly enthalpy driven with a DH value of -21.9 kcal / mol.
[0158] BTBR ob / ob mouse model Model Description Leptin-deficient BTBR ob / ob mouse (spontaneous Lep mutation) obHomozygous individuals with this condition exhibit extreme obesity due to overeating. They develop severe and progressive hyperglycemia, hypertriglyceridemia, elevated plasma insulin, impaired wound healing, decreased metabolism, and hypothermia (see, for example, KL Hudkins et al, J Am Soc Nephrol 2010, Sep, 21(9), 1533-42).
[0159] Conversion to human kidney injury mechanisms The diabetic BTBR ob / ob mouse model mimics key features of early diabetic nephropathy (DN) in humans (CKD / DN stage 2 in humans), with chronic injury limited to the glomeruli. They also develop severe progressive albumin and proteinuria, as well as some of the morphological features typical of human DN, such as mesangial proliferation, basement membrane thickening, and some degree of mesangial lysis. BTBR ob / ob mice are hyperfiltration, thereby mimicking the early stages of human DN.
[0160] research design The study design for each mouse is outlined in Figure 13. BTBR ob / ob and BTBR wild-type (wt) females were used in the study (provided by The Jackson Laboratory and bred at AstraZeneca R&D Breeding Facility, Gothenburg, Sweden, BTBR V(B6)-Lep). ob (Embryos from WISCJ stock number 004824). Standard solid feed was used from 0 to 6 weeks of age (R36, Lantmaennen, Stockholm, Sweden). The energy percentage was 18.5% protein, 4% fat, and 55.7% nitrogen-free extracts, with a total energy content of 3011 kcal / kg.
[0161] Rearing management, rearing environment, photoperiod, feed Mice were maintained in a controlled room environment with a temperature of 21±0.5°C, a 12:12 light-dark cycle (lights turned on at 06:00 AM), and a relative humidity of 50±5%. The mice were housed in transparent Makrolon cages with wooden bedding and nesting materials. The cages were placed on a partially heated pad to maintain body temperature. Mice were placed in groups of 2-3 in the cages and given free access to water and standard solid feed (R3, Lantmaennen, Stockholm, Sweden). The energy percentage was 21% protein, 5% fat, and 51.5% nitrogen-free extracts, with a total energy content of 3011 kcal / kg. Mice were fed the R3 diet from 6 to 20 weeks of age.
[0162] Ethical Approval The experimental procedures were approved by the Regional Laboratory Animal Ethics Committee in Gothenburg, Sweden (Idnr:002668, Dnr:5.8.18-04150 / 2020). The animal housing facility is fully accredited by the Association for Evaluation and Accreditation of Laboratory Animal Care (AAALAC).
[0163] Randomization Mice were randomized at 7 weeks of age based on data from urinary albumin-to-creatinine ratio (UACR), body weight, and 3-hour fasting glucose. Glucose was measured using a standard glucometer (Accu-Chek mobile®) in tail vein blood samples.
[0164] Administration regimen and route All BTBR ob / ob mice were administered intraperitoneally (ip) at a dose of 3 mL / kg once a week, according to Table 3. For comparison, a group of uninjected, healthy BTBR wild-type mice was included as a healthy control.
[0165] [Table 3]
[0166] Experimental Procedure Urine collection: Mice were given water and placed in empty cages for up to one hour, and spontaneous urination was collected. Urine samples were collected at 7, 10, 12, 14, 16, 18, and 19 weeks of age, through testing for analysis.
[0167] Weight measurement: Weight was recorded once a week before medication was administered.
[0168] Food and water intake measurement: Food and water intake over a 24-hour period was recorded once a week for each cage throughout the entire study.
[0169] Termination and organ sampling: Mice were fasted for 3-5 hours prior to termination (20 weeks old). All mice were anesthetized with isoflurane [Datex Ohmeda Isotec 5 Isoflurane Anesthesia Vaporizer (5% isoflurane, 2 L / min air)], and after loss of consciousness and muscle tone, they were decapitated for final blood collection.
[0170] Plasma collection: Blood samples were collected in EDTA-coated tubes and centrifuged at 12600xg for 2 minutes. The collected plasma was stored at -80°C until analysis.
[0171] Tissue weights: At the endpoint, the kidneys, quadriceps, subcutaneous adipose tissue, heart, spleen, and liver were collected for subsequent analysis.
[0172] UACR measurement albumin: Urinary albumin was measured using competitive antibody capture ELISA, and the anti-albumin antibody was conjugated to horseradish peroxidase using a commercially available kit (catalog number 1011, Ethos Bioscience, NJ, USA) according to the manufacturer's instructions. Briefly, the sample and anti-mouse albumin AB-HRP were added to wells coated with mouse albumin. The plate was washed to remove unbound Ab-HRP-albumin from the liquid phase of the wells. The bound antibody-conjugate (bound to albumin in the stationary phase) was detected by tetramethylbenzidine (TMB) in a color reaction. The reaction was stopped with acid, and the absorbance was measured at 450 nm. Background absorbance was measured at 570 nm.
[0173] Creatinine: Urinary creatinine was measured using a commercially available kit (ab65340; Abcam®, Cambridge, MA, USA), where creatinine was converted to creatine by creatininase. Next, creatine was converted to sarcosine, which was specifically oxidized to produce a product, which was then reacted with the probe to generate a red color. In this assay, the inventors performed both colorimetric and fluorescence measurements to encompass a wider range of concentrations. Samples and standards were added with a background mix containing creatinase, probe, and "enzyme mix," and incubated in a half-area plate (Corning, catalog no. 3695) at 37°C for 1 hour. The background was then read for both absorbance (OD=570nm) and fluorescence (Ex / Em=535 / 595nm). Next, the reaction mixture containing creatininase was added, and the plate was incubated at 37°C for 1 hour. The final measurements were performed using both optical density (OD=570nm) and fluorescence (Ex / Em=535 / 595nm).
[0174] RNA extraction, cDNA synthesis, and quantitative RT-PCR RNA extraction and cDNA synthesis from mouse kidneys Total RNA was extracted from cells using the RNeasy Mini kit (QIAGEN), and from mouse glomeruli, total RNA was extracted using the RNeasy 96 kit according to the manufacturer's instructions (Qiagen). cDNA was synthesized using the High-capacity cDNA reverse transcription kit (Applied Biosystem) according to the manufacturer's instructions.
[0175] Real-time qPCR RT-qPCR was performed on a QuantStudio® 7 Flex Real-Time PCR System (Applied Biosystems) using TaqMan® Fast Advanced Master Mix. Mouse ARHGEF6, Nphs1, Nphs2, Wt1, Synpo, MafB, and Hprt TaqMan® gene expression assays (Mm00461751_m1, Mm01176615_g1, Mm01292252_m1, Mm01337048_m1, Mm03413333_m1, Mm00627481_s1, and Mm03024075_m1) were purchased from Applied Biosystems.
[0176] Nephrology The kidneys obtained at the end of the above study were cut transversely, fixed in 4% formaldehyde solution for 48 hours, dehydrated, embedded in paraffin, and cut into 2 μm thin sections. The sections were deparaffinized, rehydrated, and stained with standard periodate Schiff (PAS) in a Leica ST5020-CV5030 automated staining system. The entire kidney section was scanned at 20x magnification using a Panoramic scan II (3DHIstec Ltd, Hungary) scanner.
[0177] Protein extraction and LC / MS Mouse kidney tissue was homogenized in lysis buffer (RIPA buffer, nuclease, protease inhibitor) using metal beads and a tissue lysis device (Qiagen). The protein lysates were subjected to reduction and alkylation, followed by protease treatment with trypsin / LysC. The peptide samples were supplemented with the corresponding heavily labeled AQUA peptide to enable absolute quantification. LC-MS / MS analysis was performed using an Evosep LC system and a Fusion Lumos (Thermo Fisher Scientific) coupled with a nano-electrospray ion source (Easy Spray Source, Thermo Fisher Scientific). MS was operated in parallel reaction monitoring (PRM) mode, targeting endogenous ARHGEF6 and the heavily labeled peptide. Data analysis was performed using Skyline.
[0178] 3D Structured Illumination Microscopy (3D-SIM) Analysis using NIPOKA Formalin-fixed, paraffin-embedded (FFPE) kidney sections from 3BTBR wt, 6BTBR ob / ob, and 6BTBR ob / ob + ASO9 (8 mg / kg) were sent to NIPOKA GmbH (Greifswald, Germany) for analysis. Sections were double-stained for integrin α3 (podocyte foot processes) and nephrin (slit diaphragm) and visualized by structured illumination microscopy (SIM) using an N-SIM super-resolution microscope (Nikon, Tokyo, Japan) equipped with a 100x silicone objective lens (ref: PMID 35884965). 3D SIM reconstruction was performed for 20 glomeruli per mouse using NIS-Elements AR 5.30 software. The filtration slit density (FSD) of selected capillary regions (A) was determined by dividing the filtration slit length (lSD) within the selected region by the region size (lSD / A). The same non-quantifiable analysis was performed on stained samples for Ehd3 and synaptopodium, and the glomerular endothelial ultrastructure was qualitatively evaluated in a blinded manner using NIPOKA.
[0179] exposure Homogenization of the sample: Mouse tissue samples and blank samples were weighed and transferred to 2 mL Precellys tubes (Bertin Corp) containing zirconium oxide beads (2.8 mm, NETZSCH), and cooled with ice. Cold Milli-Q water (Merck, Q-POD) was added to each tube, and then homogenized using a homogenizer (Precellys Evolution, Bertin) at 5500 rpm for two 25-second cycles (with a 2-minute interval on ice between cycles). This process was repeated until the samples reached the desired homogenization.
[0180] Sample extraction: A liquid-liquid extraction protocol was performed using an Agilent Bravo automated liquid handling system for the extraction of antisense oligonucleotides (ASOs) from samples. Calibration curves were prepared by spiking a stock solution of ASOs into a blank tissue homogenate, followed by serial dilutions. 100 μL of standard and study sample were pipettered into a 1 mL Nunc® 96 DeepWell polypropylene plate, Natural RNase / DNase-Free (REF 260252, Thermo Scientific). The pH was adjusted by adding Milli-Q water and ammonium hydroxide (28%-30%, Sigma-Aldrich). A phenol-chloroform-isoamyl alcohol mixture (Sigma-Aldrich) was added to the sample and subsequently pipetted for 50 cycles until phase separation was achieved. The plate was then centrifuged at 4°C at 4000 rpm for 10 minutes using an Eppendorf Centrifuge 5810R. Next, the aqueous phase in each well was transferred to a new Nunc plate, and 1,2-dichloroethane (Thermo Scientific) was added. The mixture was pipetted for 25 cycles and then centrifuged again at 4000 rpm for 10 minutes at 4°C. The aqueous phase was transferred to a new Nunc plate and loaded overnight into an evaporator (MiniVap, Porvair Sciences) under a gentle flow of nitrogen gas to ensure complete drying. After evaporation was complete, 100 μL of Milli-Q water was added to reconstitute the sample, followed by vortexing at 1500 rpm for 5 minutes to ensure homogeneity. Subsequently, the sample was further diluted in a new Nunc plate using a 5 nM internal standard solution to a range of 10 to 40 times. The resulting plates were then prepared for LC-MS / MS implantation.
[0181] LC-MS / MS quantification For accurate quantification of antisense oligonucleotides, a Waters Xevo TQ-XS triple quadrupole mass spectrometer was used. An ion-pair reversed-phase mobile phase was prepared in Milli-Q water, consisting of mobile phase A containing 200 mM 1,1,1,3,3,3-hexafluoroisopropanol (TCI) and 7.5 mM triethylamine (Sigma-Aldrich), while mobile phase B consisted of methanol (Merck Supelco hypergrade for LC-MS). A 13-minute HPLC method was devised to elute the antisense oligonucleotides, where mobile phase B was increased from 15% to 30% over 6 minutes. The flow rate was set to 0.3 mL / min, and the column temperature was maintained at 60°C using an Acquity Premier Oligonucleotide BEH C18 column. The multiple reaction monitoring (MRM) transition monitored for AZ14294632 was 757.04 → 94.83, and for AZ14283945 it was 764.47 → 94.83, with the internal standard being 764.48 → 97.1. During chromatography, the LC stream was directed to waste for the first 4.5 minutes, switched to mass spectrometry from 4.5 to 9 minutes, and then redirected back to waste to prevent contamination of the instrument.
[0182] Results and Data Interpretation Downward adjustment of ARHGEF6 Figure 14 shows the ASO9 knockdown effect on ARHGEF6 gene and protein expression in mouse kidneys. A dose-dependent downregulation of ARHGEF6 was observed, with a 58% knockdown achieved with 8 mg / kg of ASO9 treatment.
[0183] Improved UACR As can be seen in Figure 15, UACR is significantly reduced in mice treated with 8 mg / kg ASO9. Compared to controls, a significant improvement in renal injury was observed 8 weeks after treatment, and this 61% improvement window was maintained until the end of the experiment. Data for the 1 mg / kg dose of ASO9 also suggest a positive trend, although no statistically significant difference in outcomes between this dose cohort and disease controls was found in this experiment.
[0184] Histological improvement To further confirm that ASO9 treatment improves glomerular health, renal glomerular scores were quantified using a trained AI algorithm. This tool assigns a numerical score to each glomerulus in the entire histological kidney section, providing an indicator of glomerular damage. The definitions are as follows: 0: Normal, no change or minimal change, no change or slight change; 1: Mild, mild to moderate mesangial matrix dilation with fewer than 4 mesangial cells / glomerular segments; 2: Moderate, moderate mesangial matrix dilation with 4 to 6 mesangial cells / glomerular segments; 3: Severe, moderate to severe mesangial matrix dilation with more than 6 mesangial cells / glomerular segments.
[0185] Treatment with 8 mg / kg of ASO9 significantly improved glomerular scores in the fraction shown in Figure 16, and we observed that the amount of severely damaged glomeruli decreased while the number of normal glomeruli increased (in BTBR ob / ob control mice treated with placebo, there were almost no normal glomeruli).
[0186] Improvements in glomerular health were confirmed using super-resolution microscopy. Restoration of podocyte foot processes was indicated in 4 of the 6 animals treated with ASO9 by an increase in filtration slit density (FSD) to levels observed in healthy mice (see Figures 17A and 17B). ASO9 treatment also improved glomerular diameter (see Figure 17B), consistent with the improvement in glomerular score shown in Figure 16. Qualitative data also showed improvement in glomerular endothelium by ASO9-induced reduction of endothelial processes in BTBR ob / ob mice, similar to the healthy endothelial phenotype seen in BTBR wt mice (Figure 18; arrows indicate green-stained endothelium with a structure in ASO9-treated mice that is very similar to that of BTBR wt mice).
[0187] Plasma AST and ALT Levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT), two liver enzymes used in healthcare as biomarkers of liver damage, did not increase in ASO9 treatment compared to BTBR ob / ob disease control mice (Figure 19).
[0188] Body weight and organ weight Treatment with ASO9 had no effect on body weight or organ weight (see Figure 20).
[0189] tissue exposure Figure 21 shows the levels of ASO9 in different organs at the end of a 12-week treatment. The amount of ASO9 found in the kidneys was approximately 35 times higher than in other organs (liver, skeletal muscle, and heart), indicating that the ASO levels found at the intended site of action were far higher than those in other tissues.
Claims
1. An inhibitor of ARHGEF6 activity.
2. The inhibitor according to claim 1, which reduces the expression of the ARHGEF6 protein or directly causes the degradation of the ARHGEF6 protein.
3. The inhibitor according to claim 1 or 2, wherein the ARHGEF6-specific antisense oligonucleotide is optionally a human ARHGEF6-specific ASO.
4. ARHGEF6-specific antisense oligonucleotide ARHGEF6 ASO having the following gapmer structure, (A) 0-6 -(DNA) 8-14 -(C) 0-6 During the ceremony, A and C independently represent units containing 0 to 6 modified ribonucleic acid monomers. DNA represents a unit containing 8 to 14 2-deoxyribonucleic acid monomers. The inhibitor according to any one of claims 1 to 3, wherein the subscript indicates the number of monomers that make up A, B, and C, and the ARHGEF6 ASO.
5. 3-10-3 An ARHGEF6 inhibitor according to any one of claims 1 to 4, which is an ARHGEF6 ASO having an LNA-DNA-LNA gapmer structure.
6. An inhibitor according to any one of claims 1 to 5, manufactured by a process comprising: a) selecting an ASO that targets an accessible region of ARHGEF6, optionally having an accessibility score of >0.001, as determined using the Vienna RNA RNAplfold algorithm; b) determining that the candidate ASO has complete complementarity only with respect to the ARHGEF6 sequence; c) determining that the candidate ASO has complementarity with one mismatch to 50 or fewer other genes; d) filtering to remove ASOs that target regions with a minor allele frequency >0.05; and e) further filtering to remove ASOs that have a CG motif and have a GC content % < 10.
7. The inhibitor according to claim 1 or 2, which is an ARHGEF6-specific PROTAC.
8. An inhibitor according to any one of claims 1 to 7, for use in the treatment or prevention of chronic kidney disease, optionally for patients diagnosed with DN (diabetic nephropathy), FSGS (focal segmental glomerulosclerosis), HTN (renal hypertension), IgAN (IgA nephropathy / Berger's disease), RPGN (rapidly progressive glomerulonephritis), and SLE (systemic lupus erythematosus), but without MCD (minimal change disease), MGN (membranephritis), and TMD (thinning of the glomerular basement membrane).
9. A method for the treatment or prevention of a condition, comprising administering an effective amount of an ARHGEF6 inhibitor according to any one of claims 1 to 7 to a patient in need thereof, wherein the patient in need thereof has a chronic kidney disease.
10. The treatment or prevention method according to claim 9, wherein the patient requiring the treatment has been diagnosed with DN (diabetic nephropathy), FSGS (focal segmental glomerulosclerosis), HTN (renal hypertension), IgAN (IgA nephropathy / Berger's disease), RPGN (rapidly progressive glomerulonephritis), and SLE (systemic lupus erythematosus), but is not diagnosed with MCD (minimal change disease), MGN (membranephritis), and TMD (thinning of the glomerular basement membrane).
11. An inhibitor of ARHGEF6 according to any one of claims 1 to 7, for use in the manufacture of pharmaceuticals.
12. The inhibitor for use according to claim 11, wherein, if the pharmaceutical product is for the treatment of chronic kidney disease, it is optionally used in patients diagnosed with DN (diabetic nephropathy), FSGS (focal segmental glomerulosclerosis), HTN (renal hypertension), IgAN (IgA nephropathy / Berger's disease), RPGN (rapidly progressive glomerulonephritis), and SLE (systemic lupus erythematosus), but without MCD (minimal change disease), MGN (membranephritis), and TMD (thinning of the glomerular basement membrane).
13. An inhibitor for use or a treatment method according to any one of claims 8 to 12, wherein the use or treatment method is indicated based on measured GFR, eGFR, or UACR obtained from a patient-derived sample indicating that the patient has chronic kidney disease.
14. The aforementioned usage is when the measured eGFR, or GFR, is <70 mL / min / 1.73 m 2 An inhibitor for use or method of treatment according to claim 13, intended for patients in whom the measured UACR is >30 mg / g.
15. A process for manufacturing ARHGEF6 ASO, a) Select an ASO that targets an accessible region of ARHGEF6, optionally, a region of ARHGEF6 having an accessibility score >0.001, as determined using the Vienna RNA RNAplfold algorithm, b) Determining that the candidate ASO has complete complementarity only with respect to the ARHGEF6 sequence, c) Determining that the candidate ASO has complementarity with 50 or fewer other genes, d) Filtering to ensure that the candidate ASO does not target regions with a minor allele frequency > 0.05, e) ensuring that the candidate ASO does not have a CG motif and has a GC content of >10%, and optionally f) synthesizing the obtained candidate oligonucleotide.
16. ARGHEF6-specific ASO produced by the process described in claim 15.