Re-editable templates, cells, compositions, and methods for producing them

The use of re-editable templates with no sequence similarity to the genome addresses off-target issues in genome editing, enabling precise and efficient editing for therapeutic cell applications.

JP2026520854APending Publication Date: 2026-06-25TAKEDA PHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
TAKEDA PHARMA CO LTD
Filing Date
2024-05-09
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Existing genome editing technologies face challenges such as unwanted cleavage at previously edited sites or off-target sites, cytotoxicity, and residual sequences from integration events, limiting their therapeutic efficacy and applicability.

Method used

A flexible genome editing technology using re-editable templates with no substantial sequence similarity to the genome, recognizable by genome editing systems, allows precise and specific targeting with minimal off-target editing, enabling rapid development of multiple mutations and phenotypes.

Benefits of technology

Enables precise and efficient genome editing with reduced off-target effects, facilitating the rapid generation of platform cells for therapeutic applications, such as iPSCs, with reduced manufacturing time and cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026520854000001_ABST
    Figure 2026520854000001_ABST
Patent Text Reader

Abstract

The present invention provides, in particular, a method for recombining a re-editable target locus within a cell, comprising inserting an exogenous re-editable template sequence into the target locus; a method for recombining a re-editable cell, comprising a re-editable template sequence having two adjacent homology arms, wherein the re-editable template sequence is inserted into the target locus by homologous recombination; and methods for using the same. In some embodiments, a re-editable template sequence is provided, which has virtually no sequence similarity to any region in the genome, and which is recognizable by a genome editing system.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - reference to Related Applications This application claims priority and benefit of U.S. Provisional Patent Application No. 63 / 465,352, filed May 10, 2023, the content of which is hereby incorporated by reference in its entirety.

[0002] Incorporation by Reference of Sequence Listing This application includes a sequence listing submitted electronically in XML format, the content of which is hereby incorporated by reference in its entirety. The sequence listing file titled MIL - 024WO1.XML was created on April 24, 2024, and has a size of 18,368,504 bytes.

Background Art

[0003] Genome editing technologies based on programmable nucleases, such as meganucleases, zinc - finger nucleases (ZFNs), transcription activator - like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) - associated RNA - guided nucleases (e.g., Cas9, Cas12a, etc.), are powerful tools for achieving therapeutic genome editing at precise loci in diseased cells and tissues, resulting in the removal or correction of harmful mutations or the insertion of protective mutations.

[0004] ZFNs, TALENs, and meganucleases achieve specific DNA binding through protein - DNA interactions, while Cas and related nucleases are targeted to specific sites by RNA - guide molecules that directly base - pair with the target locus. However, despite the advantages of accurate genome targeting, these genome editing technologies have limitations such as unwanted cleavage at previously edited sites or off - target sites, leaving concerns.

[0005] Sequence-specific recombinases and integrases, such as serine recombinases specific to specific binding sites (attP and attB), are other useful tools for extending genome recombination strategies to repair gene mutations or perform site-specific integration of functional genes by recognizing and targeting specific genomic sequences. However, inserting DNA sequences into the genome is not without consequences, as residual sequences from the integration event remain.

[0006] On the other hand, programmable epigenome editing eliminates the cytotoxicity associated with gene editing because it does not require DNA cutting, and it is also configurable and reversible. However, programmable epigenome editing requires the constitutive expression of dCas fusion proteins, which makes it difficult for therapeutic cell and in vivo editing. [Overview of the project] [Means for solving the problem]

[0007] The present invention provides a flexible genome editing technology that is precise and specific to target loci, yet capable of recombining and further manipulating edited loci for therapeutic applications, enabling the rapid achievement of different phenotypes or the recombination of cells with specific phenotypes. As will be further detailed below and in the examples, the present invention provides a “re-editing technology” comprising a method for recombining re-editable target loci and cells using re-editable templates. A method for designing re-editable templates that are unique and recognizable by a specific genome editing system is provided herein.

[0008] The present invention provides, in particular, a method for recombining a re-editable target locus within a cell, comprising inserting an exogenous re-editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any region in the genome, and the template sequence is recognizable by a genome editing system. The present invention also provides, in particular, a method for recombining a re-editable cell, comprising a unique re-editable template sequence with two adjacent homology arms, wherein the re-editable template sequence is inserted into the target locus by homologous recombination, and a method for using the same.

[0009] In some embodiments, re-editable template sequences are provided herein, which have virtually no sequence similarity to any region in the genome, and which are recognizable by genome editing systems. The re-editable templates of the present invention are subsequently subject to targeted modification by genome editing nucleases different from those used to insert the re-editable templates. The re-editable templates and methods of the present invention facilitate the rapid development of multiple different types of mutations in platform cells in a plug-and-play approach for treating multiple different indications.

[0010] The re-editable templates of the present invention are designed to have virtually no sequence similarity to any region in the genome (for example, containing at least three mismatches to other coding regions in the genome that are recognizable by a guide RNA or another nuclease system), thus minimizing or eliminating off-target editing. Therefore, the methods provided herein modify a locus to be uniquely editable using one or more genome editing tools, such as CRISPR-Cas, activator-like effector nucleases (TALENs), or zinc finger nucleases (ZFNs). In some embodiments, the target locus is precisely modified using gRNAs with established on- and off-target profiles in a CRISPR-Cas system. In some embodiments, the re-editable locus is editable by a different gRNA, not the same gRNA used to insert the re-editable template. In some embodiments, the wild-type gene is knocked out by insertion of the re-editable template.

[0011] As described in the Examples section, in some embodiments, HLA class I and II genes are knocked out, and exemplary modified target loci, e.g., B2M and CIITA, are integrated with a specific re-editable template used to induce double-strand breaks by nucleases, thereby enabling subsequent manipulation. In some embodiments, during subsequent manipulation, protein-coding genes are integrated within the template sequence to express one or more proteins that can, for example, protect cells from recognition by NK cells (cloaking genes), terminate cells in the presence of inducing molecules (safety switches), or increase the efficacy of the product (e.g., CAR cassettes). In some embodiments, a platform iPSC strain is generated, which is readily modifiable by integration with a re-editable template, offering the advantage of reduced manufacturing time in a GMP suite for providing universal off-the-shelf therapeutic iPSCs or iPSC-derived cells for treating multiple disorders, thereby reducing costs. In short, the present invention can be summarized as follows:

[0012] In some embodiments, the present invention provides a method for recombining a re-editable target locus within a cell, comprising inserting an exogenous re-editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any region in the genome, and the template sequence is recognizable by a genome editing system.

[0013] In some embodiments, the present invention provides a method for recombining re-editable cells, comprising introducing an exogenous re-editable template sequence having two adjacent homology arms such that the re-editable template sequence is inserted into a target locus by homologous recombination, wherein the template sequence has no substantial sequence similarity to any region in the genome, and the template sequence is recognizable by a genome editing system.

[0014] In some embodiments, the genome editing system is a CRISPR-Cas-related nuclease system, a transcription activator-like effector nuclease (TALEN) system, or a zinc finger nuclease (ZFN) system.

[0015] In some embodiments, the Cas protein is Cas9, Cas12a, or Cas12b.

[0016] In some embodiments, the Cas protein is an enzyme-inactive Cas protein or nickase. In some embodiments, the Cas protein is an enzyme-inactive Cas protein. In some embodiments, the Cas protein is nickase. In some embodiments, the Cas protein is Cas9 D10A or Cas9 H840A.

[0017] In some embodiments, Cas nuclease, TALEN, or ZFN fuses to a FokI nuclease or related nuclease domain. In some embodiments, Cas nuclease fuses to a FokI nuclease. In some embodiments, enzyme-inactive Cas nuclease or nickas fusing to a FokI nuclease. In some embodiments, Cas9 D10A or Cas H840A fusing to a FokI nuclease. In some embodiments, TALEN fuses to a FokI nuclease. In some embodiments, ZFN fusing to a FokI nuclease. In some embodiments, Cas9 D10A or Cas H840A fusing to Moloney's mouse leukemia virus (M-MLV) reverse transcriptase.

[0018] In some embodiments, the homology arm is approximately 50–500 nt. In some embodiments, the homology arm is approximately 50 nt. In some embodiments, the homology arm is approximately 100 nt. In some embodiments, the homology arm is approximately 150 nt. In some embodiments, the homology arm is approximately 200 nt. In some embodiments, the homology arm is approximately 250 nt. In some embodiments, the homology arm is approximately 300 nt. In some embodiments, the homology arm is approximately 350 nt. In some embodiments, the homology arm is approximately 400 nt. In some embodiments, the homology arm is approximately 450 nt. In some embodiments, the homology arm is approximately 500 nt. In some embodiments, the homology arm is greater than 500 nt.

[0019] In some embodiments, the re-editable mold is approximately 10 to 500 nt. In some embodiments, the re-editable mold is approximately 10 nt. In some embodiments, the re-editable mold is approximately 20 nt. In some embodiments, the re-editable mold is approximately 30 nt. In some embodiments, the re-editable mold is approximately 40 nt. In some embodiments, the re-editable mold is approximately 50 nt. In some embodiments, the re-editable mold is approximately 60 nt. In some embodiments, the re-editable mold is approximately 70 nt. In some embodiments, the re-editable mold is approximately 80 nt. In some embodiments, the re-editable mold is approximately 90 nt. In some embodiments, the re-editable mold is approximately 100 nt.

[0020] In some embodiments, the re-editable mold is approximately 150 nt. In some embodiments, the re-editable mold is approximately 200 nt. In some embodiments, the re-editable mold is approximately 250 nt. In some embodiments, the re-editable mold is approximately 300 nt. In some embodiments, the re-editable mold is approximately 350 nt. In some embodiments, the re-editable mold is approximately 400 nt. In some embodiments, the re-editable mold is approximately 450 nt. In some embodiments, the re-editable mold is approximately 500 nt.

[0021] In some embodiments, the re-editable template includes a protospacer adjacent motif (PAM). In some embodiments, the re-editable template includes a 5'-NGG-3'PAM, where the nuclease is Cas9. In some embodiments, the re-editable template includes a specific PAM for a particular Cas nuclease.

[0022] In some embodiments, the coding region in the genome recognizable by the guide RNA contains at least three mismatches with respect to the sequence in the re-editable template recognizable by the guide RNA. In some embodiments, the coding region in the genome recognizable by the guide RNA contains at least four mismatches with respect to the sequence in the re-editable template recognizable by the guide RNA. In some embodiments, there is no off-target editing.

[0023] In some embodiments, the cells are mammalian cells. In some embodiments, the cells are human cells. In some embodiments, the cells are cultured cells. In some embodiments, the cells are primary cells. In some embodiments, the cells are non-dividing cells. In some embodiments, the cells are immune cells. In some embodiments, the cells are B cells, T cells, or NK cells. In some embodiments, the cells are stem cells or progenitor cells. In some embodiments, the cells are induced pluripotent stem cells (iPSCs).

[0024] In some embodiments, the target locus is at least one locus selected from the group consisting of ubiquitously expressed genes, cell division-related genes, and genes whose expression is restricted to a specific cell type. In some embodiments, the target locus is a class I or class II HLA gene. In some embodiments, the target locus is a class I HLA gene. In some embodiments, the target locus is a class II HLA gene. In some embodiments, the target locus is B2M.

[0025] In some embodiments, the gRNA that directs double-strand cleavage and inserts a re-editable template into the B2M exon 1 locus comprises 70%, 80%, 90%, 95%, 99%, or 100% identity to GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3). In some embodiments, the gRNA that directs double-strand cleavage and inserts a re-editable template into the B2M exon 1 locus comprises 70% identity to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs double-strand cleavage and inserts a re-editable template into the B2M exon 1 locus comprises 75% identity to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs double-strand cleavage and inserts a re-editable template into the B2M exon 1 locus comprises 80% identity to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs double-strand cleavage and inserts a re-editable template into the B2M exon 1 locus comprises 85% identity to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs double-strand cleavage and inserts a re-editable template into the B2M exon 1 locus comprises 90% identity to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs double-strand cleavage and inserts a re-editable template into the B2M exon 1 locus comprises 95% identity to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs double-strand cleavage and inserts a re-editable template into the B2M exon 1 locus comprises 99% identity to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs double-strand cleavage and inserts a re-editable template into the B2M exon 1 locus comprises 100% identity to any one of SEQ ID NOs: 1-3.

[0026] In some embodiments, the re-editable template is

Chemical formula

[0027] In some embodiments, the re - editable template is

Chemical Formula

[0028] In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 70% identity with any one of SEQ ID NOs. 7. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 75% identity with any one of SEQ ID NOs. 7. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 80% identity with any one of SEQ ID NOs: 7-9. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 85% identity with any one of SEQ ID NOs: 7-9. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 90% identity with any one of SEQ ID NOs: 7-9. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 95% identity with any one of SEQ ID NOs: 7-9. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 99% identity with any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 100% identity with any one of sequence numbers 7-9.

[0029] In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 80% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 90% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 95% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 99% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 99% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

[0030] In some embodiments, the gRNA that recognizes the re-editable template inserted at the B2M exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11). In some embodiments, the gRNA that recognizes the re-editable template inserted at the B2M exon 2 locus contains 70% identity with either SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted at the B2M exon 2 locus contains 75% identity with either SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted at the B2M exon 2 locus contains 80% identity with either SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted at the B2M exon 2 locus contains 85% identity with either SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted at the B2M exon 2 locus contains 90% identity with either SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted at the B2M exon 2 locus contains 95% identity with either SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted at the B2M exon 2 locus contains 99% identity with either SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted at the B2M exon 2 locus contains 100% identity with either SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 80% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 90% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 95% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 99% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

[0031] In some embodiments, the re-editable mold is [ka] In some embodiments, the re-editable template is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity. In some embodiments, the re-editable template is defined by an array containing 70% identity with sequence number 12. In some embodiments, the re-editable template is defined by an array containing 75% identity with sequence number 12. In some embodiments, the re-editable template is defined by an array containing 80% identity with sequence number 12. In some embodiments, the re-editable template is defined by an array containing 85% identity with sequence number 12. In some embodiments, the re-editable template is defined by an array containing 90% identity with sequence number 12. In some embodiments, the re-editable template is defined by an array containing 95% identity with sequence number 12. In some embodiments, the re-editable template is defined by an array containing 99% identity with sequence number 12. In some embodiments, the re-editable template is defined by an array containing 100% identity with sequence number 12.

[0032] In some embodiments, the target seating position is CIITA.

[0033] In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contains 70% identity with any one of SEQ ID NOs. 13-15. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contains 75% identity with any one of SEQ ID NOs. 13-15. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus has 80% identity with any one of sequence numbers 13-15. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus has 85% identity with any one of sequence numbers 13-15. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus has 90% identity with any one of sequence numbers 13-15. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus has 95% identity with any one of sequence numbers 13-15. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus has 99% identity with one of sequence numbers 13-15. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus has 100% identity with one of sequence numbers 13-15.

[0034] In some embodiments, the re-editable mold is [ka] In some embodiments, the re-editable template is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity. In some embodiments, the re-editable template is defined by an array containing 70% identity with sequence number 18. In some embodiments, the re-editable template is defined by an array containing 75% identity with sequence number 18. In some embodiments, the re-editable template is defined by an array containing 80% identity with sequence number 18. In some embodiments, the re-editable template is defined by an array containing 85% identity with sequence number 18. In some embodiments, the re-editable template is defined by an array containing 90% identity with sequence number 18. In some embodiments, the re-editable template is defined by an array containing 90% identity with sequence number 18. In some embodiments, the re-editable template is defined by an array containing 95% identity with sequence number 18. In some embodiments, the re-editable template is defined by an array containing 99% identity with sequence number 18. In some embodiments, the re-editable template is defined by an array that has 100% identity with sequence number 18.

[0035] In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 70% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 80% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus has 90% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus has 95% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus has 99% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 100% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17).

[0036] In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 70% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 75% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 80% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 85% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 90% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 95% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 99% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 100% identity with SEQ ID NO: 19.

[0037] In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus contains 70% identity with SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus contains 75% identity with SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus contains 80% identity with SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus contains 85% identity with SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus has 90% identity with SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus has 95% identity with SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus has 99% identity with SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus has 100% identity with SEQ ID NO: 20.

[0038] In some embodiments, the re-editable mold is [ka] In some embodiments, the re-editable template is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity. In some embodiments, the re-editable template is defined by an array containing 70% identity with sequence number 21. In some embodiments, the re-editable template is defined by an array containing 75% identity with sequence number 21. In some embodiments, the re-editable template is defined by an array containing 80% identity with sequence number 21. In some embodiments, the re-editable template is defined by an array containing 85% identity with sequence number 21. In some embodiments, the re-editable template is defined by an array containing 90% identity with sequence number 21. In some embodiments, the re-editable template is defined by an array containing 95% identity with sequence number 21. In some embodiments, the re-editable template is defined by an array containing 99% identity with sequence number 21. In some embodiments, the re-editable template is defined by an array containing 100% identity with sequence number 21.

[0039] In some embodiments, the re-editable template includes an exogenous protein-coding gene. In some embodiments, the exogenous gene is an immunoregulatory gene or a cloaking gene. In some embodiments, the exogenous gene is an immunoregulatory gene. In some embodiments, the exogenous gene is a cloaking gene. In some embodiments, the exogenous gene expresses a cell death-inducing protein, and the gene is selected from the group consisting of HSV-TK, iCaspase8, and iCaspase9. In some embodiments, the exogenous gene expresses a protein that induces cell death in infiltrating cells in the presence of a specific compound, and the gene is HSV-TK. In some embodiments, the exogenous gene expresses a protein that induces cell death after activation, and the gene is iCaspase8. In some embodiments, the exogenous gene expresses a protein that induces cell death after activation, and the gene is iCaspase9.

[0040] In some embodiments, the re-editable template includes a chimeric antigen receptor (CAR) gene.

[0041] In some embodiments, isolated cells recombinant by the methods provided herein are provided.

[0042] In some embodiments, recombinant cells comprising re-editable target loci are provided herein, the re-editable target loci comprising an exogenous re-editable template sequence that has substantial sequence similarity to any region in the rest of the genome, and the re-editable template sequence is recognizable by a genome editing system.

[0043] In some embodiments, the genome editing system is a CRISPR-Cas-related nuclease system, a transcription activator-like effector nuclease (TALEN) system, or a zinc finger nuclease (ZFN) system.

[0044] In some embodiments, the cell contains a Cas protein, which is Cas9, Cas12a, or Cas12b. In some embodiments, the Cas protein is Cas9. In some embodiments, the Cas protein is Cas12a. In some embodiments, the Cas protein is Cas12b.

[0045] In some embodiments, the Cas protein in recombinant cells is an enzyme-inactive Cas protein or nickase. In some embodiments, the Cas protein is an enzyme-inactive Cas protein. In some embodiments, the Cas protein is nickase. In some embodiments, the Cas protein is Cas9 D10A or Cas9 H840A.

[0046] In some embodiments, the Cas protein, TALEN, or ZFN fuses to the FokI nuclease or a related nuclease domain. In some embodiments, the Cas protein fuses to the FokI nuclease. In some embodiments, the enzyme-inactive Cas protein or nickase fuses to the FokI nuclease. In some embodiments, Cas9 D10A or Cas9 H840A fuses to the FokI nuclease or M-MLV reverse transcriptase. In some embodiments, the TALEN fuses to the FokI nuclease. In some embodiments, the ZFN fuses to the FokI nuclease.

[0047] In some embodiments, the homology arm is approximately 50–500 nt. In some embodiments, the homology arm is approximately 50 nt. In some embodiments, the homology arm is approximately 100 nt. In some embodiments, the homology arm is approximately 150 nt. In some embodiments, the homology arm is approximately 200 nt. In some embodiments, the homology arm is approximately 250 nt. In some embodiments, the homology arm is approximately 300 nt. In some embodiments, the homology arm is approximately 350 nt. In some embodiments, the homology arm is approximately 400 nt. In some embodiments, the homology arm is approximately 450 nt. In some embodiments, the homology arm is approximately 500 nt. In some embodiments, the homology arm is greater than approximately 500 nt.

[0048] In some embodiments, the re-editable mold is approximately 10 to 500 nt. In some embodiments, the re-editable mold is approximately 10 nt. In some embodiments, the re-editable mold is approximately 20 nt. In some embodiments, the re-editable mold is approximately 30 nt. In some embodiments, the re-editable mold is approximately 40 nt. In some embodiments, the re-editable mold is approximately 50 nt. In some embodiments, the re-editable mold is approximately 60 nt. In some embodiments, the re-editable mold is approximately 70 nt. In some embodiments, the re-editable mold is approximately 80 nt. In some embodiments, the re-editable mold is approximately 90 nt. In some embodiments, the re-editable mold is approximately 100 nt.

[0049] In some embodiments, the re-editable mold is approximately 150 nt. In some embodiments, the re-editable mold is approximately 200 nt. In some embodiments, the re-editable mold is approximately 250 nt. In some embodiments, the re-editable mold is approximately 300 nt. In some embodiments, the re-editable mold is approximately 350 nt. In some embodiments, the re-editable mold is approximately 400 nt. In some embodiments, the re-editable mold is approximately 450 nt. In some embodiments, the re-editable mold is approximately 500 nt.

[0050] In some embodiments, the re-editable template of the cell includes a protospacer adjacent motif (PAM). In some embodiments, the re-editable template includes a 5'-NGG-3'PAM, and the nuclease is Cas9. In some embodiments, the re-editable template includes a specific PAM for a particular Cas nuclease.

[0051] In some embodiments, the coding region in the genome recognizable by the guide RNA contains at least 3 mismatches. In some embodiments, the coding region in the genome recognizable by the guide RNA contains 3 mismatches. In some embodiments, the coding region in the genome recognizable by the guide RNA contains 4 or more mismatches. In some embodiments, the coding region in the genome recognizable by the guide RNA contains 4 mismatches. In some embodiments, the coding region in the genome recognizable by the guide RNA contains 5 mismatches. In some embodiments, the coding region in the genome recognizable by the guide RNA contains 6 mismatches. In some embodiments, the coding region in the genome recognizable by the guide RNA contains 7 mismatches. In some embodiments, the coding region in the genome recognizable by the guide RNA contains 8 mismatches. In some embodiments, the coding region in the genome recognizable by the guide RNA contains 9 mismatches. In some embodiments, the coding region in the genome recognizable by the guide RNA contains 10 mismatches. In some embodiments, there is no off-target editing.

[0052] In some embodiments, the cells are mammalian cells. In some embodiments, the cells are human cells. In some embodiments, the cells are cultured cells. In some embodiments, the cells are primary cells. In some embodiments, the cells are non-dividing cells. In some embodiments, the cells are immune cells. In some embodiments, the cells are B cells, T cells, or NK cells. In some embodiments, the cells are B cells. In some embodiments, the cells are T cells. In some embodiments, the cells are NK cells. In some embodiments, the cells are stem cells or progenitor cells. In some embodiments, the cells are stem cells. In some embodiments, the cells are progenitor cells. In some embodiments, the cells are induced pluripotent stem cells (iPSCs).

[0053] In some embodiments, the target locus is an immunogene. In some embodiments, the target locus is a class I or class II HLA gene. In some embodiments, the target locus is a class I HLA gene. In some embodiments, the target locus is a class II HLA gene. In some embodiments, the target locus is B2M.

[0054] In some embodiments, intracellular gRNAs that instruct a double-strand break to insert a re-editable template into the B2M exon 1 locus contain 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3). In some embodiments, intracellular gRNAs that instruct a double-strand break to insert a re-editable template into the B2M exon 1 locus contain 70% identity with any one of SEQ ID NOs: 1-3. In some embodiments, the intracellular re-editable template is defined by a sequence containing 75% identity with any one of SEQ ID NOs: 1-3. In some embodiments, intracellular gRNAs that instruct a double-strand break to insert a re-editable template into the B2M exon 1 locus contain 80% identity with any one of SEQ ID NOs: 1-3. In some embodiments, the intracellular re-editable template is defined by a sequence having 85% identity with one of sequence numbers 1-3. In some embodiments, the intracellular gRNA, which is instructed to perform a double-strand break to insert the re-editable template into the B2M exon 1 locus, has 90% identity with one of sequence numbers 1-3. In some embodiments, the intracellular gRNA, which is instructed to perform a double-strand break to insert the re-editable template into the B2M exon 1 locus, has 95% identity with one of sequence numbers 1-3. In some embodiments, the intracellular gRNA, which is instructed to perform a double-strand break to insert the re-editable template into the B2M exon 1 locus, has 99% identity with one of sequence numbers 1-3. In some embodiments, the intracellular gRNA, which is instructed to perform a double-strand break to insert the re-editable template into the B2M exon 1 locus, has 100% identity with one of sequence numbers 1-3.

[0055] In some embodiments, the re-editable template within the cell is [ka] In contrast, it is defined by a sequence containing 70%, 80%, 90%, 95%, 99%, or 100% identity. In some embodiments, the intracellular re-editable template is defined by a sequence containing 70% identity with SEQ ID NO: 5. In some embodiments, the intracellular re-editable template is defined by a sequence containing 75% identity with SEQ ID NO: 5. In some embodiments, the intracellular re-editable template is defined by a sequence containing 80% identity with SEQ ID NO: 5. In some embodiments, the intracellular re-editable template is defined by a sequence containing 85% identity with SEQ ID NO: 5. In some embodiments, the intracellular re-editable template is defined by a sequence containing 90% identity with SEQ ID NO: 5. In some embodiments, the intracellular re-editable template is defined by a sequence containing 95% identity with SEQ ID NO: 5. In some embodiments, the intracellular re-editable template is defined by a sequence containing 99% identity with SEQ ID NO: 5. In some embodiments, the intracellular re-editable template is defined by a sequence containing 100% identity with SEQ ID NO: 5.

[0056] In some embodiments, the re-editable template within the cell is codon-optimized. In some embodiments, the re-editable template within the cell is [ka] In some embodiments, the intracellular re-editable template is defined by a sequence containing 70%, 80%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 6. In some embodiments, the intracellular re-editable template is defined by a sequence containing 70% identity with SEQ ID NO: 6. In some embodiments, the intracellular re-editable template is defined by a sequence containing 75% identity with SEQ ID NO: 6. In some embodiments, the intracellular re-editable template is defined by a sequence containing 80% identity with SEQ ID NO: 6. In some embodiments, the intracellular re-editable template is defined by a sequence containing 85% identity with SEQ ID NO: 6. In some embodiments, the intracellular re-editable template is defined by a sequence containing 90% identity with SEQ ID NO: 6. In some embodiments, the intracellular re-editable template is defined by a sequence containing 95% identity with SEQ ID NO: 6. In some embodiments, the intracellular re-editable template is defined by a sequence containing 99% identity with SEQ ID NO: 6. In some embodiments, the intracellular re-editable template is defined by a sequence containing 100% identity with SEQ ID NO: 6.

[0057] In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 80% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 90% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 95% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

[0058] In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template into the B2M exon 2 locus contain 70%, 80%, 90%, 95%, 99%, or 100% identity with AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9). In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template into the B2M exon 2 locus contain 70% identity with any one of SEQ ID NOs. 7. In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template into the B2M exon 2 locus contain 75% identity with any one of SEQ ID NOs. 7. In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template at the B2M exon 2 locus contain 80% identity with any one of sequence numbers 7-9. In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template at the B2M exon 2 locus contain 85% identity with any one of sequence numbers 7-9. In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template at the B2M exon 2 locus contain 90% identity with any one of sequence numbers 7-9. In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template at the B2M exon 2 locus contain 95% identity with any one of sequence numbers 7-9. In some embodiments, intracellular gRNAs that are instructed to perform double-strand breaks to insert a re-editable template into the B2M exon 2 locus contain 99% identity with any one of sequence numbers 7-9. In some embodiments, intracellular gRNAs that are instructed to perform double-strand breaks to insert a re-editable template into the B2M exon 2 locus contain 100% identity with any one of sequence numbers 7-9.

[0059] In some embodiments, intracellular gRNAs that recognize a re-editable template inserted at the B2M exon 2 locus contain 70%, 80%, 90%, 95%, 99%, or 100% identity with CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11). In some embodiments, intracellular gRNAs that recognize a re-editable template inserted at the B2M exon 2 locus contain 70% identity with SEQ ID NO: 10 or 11. In some embodiments, intracellular gRNAs that recognize a re-editable template inserted at the B2M exon 2 locus contain 75% identity with SEQ ID NO: 10 or 11. In some embodiments, intracellular gRNAs that recognize a re-editable template inserted at the B2M exon 2 locus contain 80% identity with SEQ ID NO: 10 or 11. In some embodiments, intracellular gRNA that recognizes a re-editable template inserted at the B2M exon 2 locus contains 85% identity with SEQ ID NO: 10 or 11. In some embodiments, intracellular gRNA that recognizes a re-editable template inserted at the B2M exon 2 locus contains 90% identity with SEQ ID NO: 10 or 11. In some embodiments, intracellular gRNA that recognizes a re-editable template inserted at the B2M exon 2 locus contains 95% identity with SEQ ID NO: 10 or 11. In some embodiments, intracellular gRNA that recognizes a re-editable template inserted at the B2M exon 2 locus contains 99% identity with SEQ ID NO: 10 or 11. In some embodiments, intracellular gRNA that recognizes a re-editable template inserted at the B2M exon 2 locus contains 100% identity with SEQ ID NO: 10 or 11.

[0060] In some embodiments, the re-editable template within the cell is [ka] In some embodiments, the intracellular re-editable template is defined by a sequence containing 70%, 80%, 90%, 95%, 99%, or 100% identity with sequence number 12. In some embodiments, the intracellular re-editable template is defined by a sequence containing 70% identity with sequence number 12. In some embodiments, the intracellular re-editable template is defined by a sequence containing 75% identity with sequence number 12. In some embodiments, the intracellular re-editable template is defined by a sequence containing 80% identity with sequence number 12. In some embodiments, the intracellular re-editable template is defined by a sequence containing 85% identity with sequence number 12. In some embodiments, the intracellular re-editable template is defined by a sequence containing 90% identity with sequence number 12. In some embodiments, the intracellular re-editable template is defined by a sequence containing 95% identity with sequence number 12. In some embodiments, the intracellular re-editable template is defined by a sequence containing 99% identity with sequence number 12. In some embodiments, the intracellular re-editable template is defined by a sequence containing 100% identity with sequence number 12.

[0061] In some embodiments, the target seating position is CIITA.

[0062] In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contain 70%, 80%, 90%, 95%, 99%, or 100% identity with ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contain 70% identity with any one of SEQ ID NOs. 13-15. In some embodiments, intracellular gRNAs that are instructed to perform a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contain 75% identity with any one of SEQ ID NOs. 13-15. In some embodiments, intracellular gRNAs that are instructed to perform double-strand breaks to insert a re-editable template into exon 2 at the CIITA locus contain 80% identity with any one of sequence numbers 13-15. In some embodiments, intracellular gRNAs that are instructed to perform double-strand breaks to insert a re-editable template into exon 2 at the CIITA locus contain 85% identity with any one of sequence numbers 13-15. In some embodiments, intracellular gRNAs that are instructed to perform double-strand breaks to insert a re-editable template into exon 2 at the CIITA locus contain 90% identity with any one of sequence numbers 13-15. In some embodiments, intracellular gRNAs that are instructed to perform double-strand breaks to insert a re-editable template into exon 2 at the CIITA locus contain 95% identity with any one of sequence numbers 13-15. In some embodiments, intracellular gRNAs that instruct a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contain 100% identity with any one of sequence numbers 13-15.

[0063] In some embodiments, the re-editable template within the cell is [ka] In some embodiments, the intracellular re-editable template is defined by a sequence containing 70%, 80%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 18. In some embodiments, the intracellular re-editable template is defined by a sequence containing 70% identity with SEQ ID NO: 18. In some embodiments, the intracellular re-editable template is defined by a sequence containing 75% identity with SEQ ID NO: 18. In some embodiments, the intracellular re-editable template is defined by a sequence containing 80% identity with SEQ ID NO: 18. In some embodiments, the intracellular re-editable template is defined by a sequence containing 85% identity with SEQ ID NO: 18. In some embodiments, the intracellular re-editable template is defined by a sequence containing 90% identity with SEQ ID NO: 18. In some embodiments, the intracellular re-editable template is defined by a sequence containing 95% identity with SEQ ID NO: 18. In some embodiments, the intracellular re-editable template is defined by a sequence containing 99% identity with SEQ ID NO: 18. In some embodiments, the intracellular re-editable template is defined by a sequence containing 100% identity with SEQ ID NO: 18.

[0064] In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 70% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 80% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus has 90% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus has 95% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus has 100% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17).

[0065] In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 70% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 75% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 80% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 85% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 90% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 95% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 99% identity with SEQ ID NO: 19. In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 100% identity with SEQ ID NO: 19.

[0066] In some embodiments, intracellular gRNAs that recognize a re-editable template inserted into exon 3 of the CIITA locus have 70%, 80%, 90%, 95%, 99%, or 100% identity with TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, intracellular gRNAs that recognize a re-editable template inserted into exon 3 of the CIITA locus have 70% identity with SEQ ID NO: 20. In some embodiments, intracellular gRNAs that recognize a re-editable template inserted into exon 3 of the CIITA locus have 75% identity with SEQ ID NO: 20. In some embodiments, intracellular gRNAs that recognize a re-editable template inserted into exon 3 of the CIITA locus have 80% identity with SEQ ID NO: 20. In some embodiments, intracellular gRNAs that recognize a re-editable template inserted into exon 3 of the CIITA locus have 85% identity with SEQ ID NO: 20. In some embodiments, intracellular gRNA that recognizes a re-editable template inserted into exon 3 of the CIITA locus contains 90% identity with SEQ ID NO: 20. In some embodiments, intracellular gRNA that recognizes a re-editable template inserted into exon 3 of the CIITA locus contains 95% identity with SEQ ID NO: 20. In some embodiments, intracellular gRNA that recognizes a re-editable template inserted into exon 3 of the CIITA locus contains 99% identity with SEQ ID NO: 18. In some embodiments, intracellular gRNA that recognizes a re-editable template inserted into exon 3 of the CIITA locus contains 100% identity with SEQ ID NO: 20.

[0067] In some embodiments, the re-editable template within the cell is [ka] In contrast, it is defined by a sequence containing 70%, 80%, 90%, 95%, 99%, or 100% identity. In some embodiments, the intracellular re-editable template is defined by a sequence containing 70% identity with SEQ ID NO: 21. In some embodiments, the intracellular re-editable template is defined by a sequence containing 75% identity with SEQ ID NO: 21. In some embodiments, the intracellular re-editable template is defined by a sequence containing 80% identity with SEQ ID NO: 21. In some embodiments, the intracellular re-editable template is defined by a sequence containing 85% identity with SEQ ID NO: 21. In some embodiments, the intracellular re-editable template is defined by a sequence containing 90% identity with SEQ ID NO: 21. In some embodiments, the intracellular re-editable template is defined by a sequence containing 95% identity with SEQ ID NO: 21. In some embodiments, the intracellular re-editable template is defined by a sequence containing 99% identity with SEQ ID NO: 21. In some embodiments, the intracellular re-editable template is defined by a sequence containing 100% identity with SEQ ID NO: 21.

[0068] In some embodiments, the re-editable template within the cell includes an exogenous protein-coding gene.

[0069] In some embodiments, the exogenous protein-coding gene is an immunoregulatory gene or a cloaking gene.

[0070] In some embodiments, exogenous genes within cells express proteins that induce cell death.

[0071] In some embodiments, the re-editable template for cells includes a chimeric antigen receptor (CAR) gene.

[0072] In some embodiments, the present invention provides a method for modifying a gene locus in recombinant cells, comprising contacting the recombinant cells provided herein with a genome editing system comprising a nucleic acid encoding a recombinant nuclease protein or Cas protein and a guide RNA that specifically recognizes a PAM sequence contained in a re-editable template, wherein the recombinant nuclease protein or Cas protein is capable of binding to the guide RNA and editing the locus.

[0073] In some embodiments, the nucleic acid encoding the Cas protein is fused to an adenine or cytosine deaminase, and the Cas protein fusion is conjugable to a guide RNA and a base that edits a re-editable template.

[0074] In some embodiments, re-editable template sequences are provided herein, which have virtually no sequence similarity to any region in the genome, and which are recognizable by a genome editing system.

[0075] As used herein, the terms “about” and “approximately” are to be used synonymously. Numerical values ​​used in this application, whether “about” or “approximately,” are to be understood as encompassing the normal variations recognized by those skilled in the art.

[0076] Other features, purposes, and advantages of the present invention will become apparent in the detailed description below. However, it should be understood that the detailed description, while illustrating embodiments of the present invention, is for illustrative purposes only and not limiting. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art from the detailed description.

[0077] The following diagrams constitute the drawings and are for illustrative purposes only; they do not limit the present invention. [Brief explanation of the drawing]

[0078] [Figure 1]This is a schematic diagram showing a re-editable template that is incorporated into a WT locus by genome editing and homologous recombination, forming a re-editable target locus. The re-editable target locus includes an integrated re-editable template and homology arms on both sides of the re-editable template. [Modes for carrying out the invention]

[0079] definition To facilitate understanding of the present invention, certain terms are first defined below. Further definitions of these terms and other terms are provided throughout this specification.

[0080] Approximately or about: When used herein, the terms “approximately” or “about” applied to one or more values ​​of interest refer to values ​​similar to the given reference value. In certain embodiments, unless otherwise stated or evident from the context, the terms “approximately” or “about” refer to a range of values ​​that fall within the range of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction (greater than or less than) the given reference value (unless such numerical value exceeds 100% of the possible value).

[0081] Base editing: As used herein, “base editing” refers to CRISPR-Cas9-based genome editing techniques that enable the introduction of point mutations into DNA without generating double-stranded bones (DSBs). Two main classes of base editors are cytidine (or cytosine) base editors or CBEs, which enable the conversion of C to T, and adenine (or adenosine) base editors or ABEs, which enable the conversion of A to G.

[0082] Biologically active: As used herein, the term “biologically active” refers to the characteristic of any drug that is active in a biological system, in particular in a living organism. For example, a drug that has a biological effect on an organism when administered to that organism is considered biologically active. In certain embodiments, if a protein or polypeptide is biologically active, the portion of that protein or polypeptide that shares at least one biological activity is usually referred to as the “biologically active” portion.

[0083] Homology Arms: As used herein, “homology arms” refer to adjacent arrangements on either side of a re-editable mold. The re-editable mold is introduced into the wild-type target locus by homologous recombination of the wild-type locus and the donor mold, thereby integrating the intervening re-editable mold with two adjacent homology arms. In some embodiments, each homology arm is 50 to 500 nt. The sizes of the two homology arms may be the same or different.

[0084] Homologous Recombination Repair (HDR): Homologous recombination repair (HDR) is one of the mechanisms by which DNA double-strand breaks generated by CRISPR endonuclease-based genome editing are repaired. HDR requires an HDR donor template containing sequences defined as "homology arms" that are homologous to specific sequences adjacent to the break site. HDR allows for the introduction of exogenous DNA templates and DNA editing within the genome. Briefly, HDR repair is carried out in the following steps: (a) the 5' end of the DNA strand is cut, i.e., nucleotides are digested from the 5' end of the break site to create a 3' overhang; (b) the 3' overhang functions as a substrate for repair proteins such as the Rad51 protein, which stimulates strand entry by the donor repair template for base insertion or gene substitution; (c) the entry strand replaces one strand of the homologous DNA double-strand and pairs with the other strand to form a hybrid DNA structure called a substitution loop (D-loop); (d) the recombination intermediate is then degraded to repair the DNA. Conservative HDR methods are precise and accurate, and are performed using classical double-strand break repair, synthesis-dependent strand annealing, or break-induced repair pathways.

[0085] Non-homologous end joining (NHEJ): Non-homologous end joining (NHEJ) is a mechanism for repairing DNA double-strand breaks generated by CRISPR-endonuclease-based genome editing. In NHEJ, the end generated at the break site is directly ligated without the need for a homologous template. NHEJ occurs in non-dividing, proliferating cells and is usually guided by a short homologous DNA extension or microhomology corresponding to an overhang. NHEJ is generally more error-prone than HDR. The general mechanism by which NHEJ occurs is as follows: (a) DNA end recognition, and assembly and stabilization of the NHEJ complex containing the Ku70 / Ku80 heterodimer upon DNA double-strand breaks, recruiting other factors such as DNA-PKcs, XRCC4, DNA ligase IV, XRCC4-like factor (XLF), aprataxin, and PNK-like factor (APLF) to the cleavage site; (b) bridging the DNA ends to promote end stability; (c) DNA end processing by enzymes such as Artemis, PNKP, APLF, polymerase μ and λ, Werner (WRN), aprataxin, and K; and (d) ligation of the cleaved ends and lysis of the NHEJ complex by DNA ligase IV.

[0086] On-target editing, or on-target editing efficiency: On-target editing refers to specific and efficient gene editing at a desired target locus, minimizing or preventing unintended or nonspecific modifications to the genome at sites other than the target locus. "On-target editing" or "on-target editing efficiency" refers to the percentage of cells edited at the on-target locus relative to the total number of cells. The percentage of on-target editing is a measure of gene editing efficiency. For example, 50% on-target editing means that 50% of the cells are edited at the on-target locus. In the case of CRISPR-Cas editing systems, on-target editing is measured by designing gRNAs that exhibit high on-target activity with minimal off-target effects.

[0087] Off-target editing: Off-target editing refers to nonspecific and unintended genetic recombination resulting from genome editing techniques. Due to homology or mismatch tolerance, when the repair complex after dsDNA cleavage binds to a sequence other than the target sequence, the off-target sequence is cleaved, leading to nonspecific genetic recombination, including point mutations, deletions, insertions, inversions, and / or translocations. Off-target binding arises from partial but sufficient matching to the target sequence due to base mismatch tolerance in linear sequences or bulge mismatches, i.e., off-target sites (RNA bulges) that lack a few bases or have slight deletions, and off-target sites (DNA bulges) that have extra bases or slight insertions, recognized by gRNA. In some embodiments, specified criteria for suppressing off-target editing require that coding genes in the genome have at least three mismatches to a template sequence recognizable by a specific guide RNA.

[0088] Prime Editing: As used herein, the term "prime editing" refers to a multifunctional and precise genome editing method programmed with prime editing guide RNA (pegRNA) that directly inserts new genetic information into specific DNA sites using a catalytically inactive Cas endonuclease fused to recombinant reverse transcriptase, identifying target sites and encoding the desired edit. Prime editing is used to insert sequences approximately 30–40 nt in length. Prime editing edits sequences without producing double-strand breaks. Prime editing offers advantages in efficiency and product purity compared to HDR, complementary strengths compared to base editing, and lower off-target editing than Cas nucleases at known Cas off-target sites.

[0089] RNA guide or guide RNA (gRNA): Refers to an RNA molecule that facilitates the targeting of Cas proteins to their target loci. gRNA is a guide RNA containing a guide sequence (crRNA) and a Cas9 nuclease recruitment sequence (tracrRNA). As used herein, "sgRNA" and "gRNA" are used interchangeably.

[0090] Re-editable template: As used herein, the term “re-editable template” refers to a sequence that does not have substantial sequence homology to any coding region of the genome and is recognizable by a genome editing system.

[0091] Re-editable loci, re-editable target, re-editable gene, or re-editable site: As used herein, the terms “re-editable loci,” “re-editable target,” “re-editable gene,” and “re-editable site” are interchangeable and refer to loci, targets, genes, or sites within a genome where two adjacent homology arms of a re-editable template are combined by homologous recombination and subsequently recognizable by a genome editing system.

[0092] Substantial Sequence Similarity: As used herein, the term “substantial sequence similarity” is interchangeable with “sequence homology” and “sequence identity” and refers to at least 70%, 75%, 80%, 85%, 90%, 95%, or more identity to a region within the genome. In some embodiments, substantial sequence similarity refers to 100% sequence identity.

[0093] Detailed explanation The present invention provides a “re-editing technique” which is a flexible genome editing technique that prepares edited loci precisely and specifically to a target locus, and for therapeutic purposes, allows for further manipulation by another precise genome editing system to achieve various phenotypes in a short time or to recombinate cells with a specific phenotype. The “re-editing technique” of the present invention includes methods for recombining re-editable target loci and cells with re-editable templates. The present invention provides, in particular, a method for recombining a re-editable target locus in a cell, comprising inserting an exogenous re-editable template sequence into the target locus; and a method for recombining a re-editable cell, comprising a re-editable template sequence with two adjacent homology arms, wherein the re-editable template sequence is inserted into the target locus by homologous recombination, as well as methods for using these. In some embodiments, re-editable template sequences are provided herein, wherein the template sequences have virtually no sequence similarity to any region in the genome, and the template sequences are recognizable by a genome editing system. Various aspects of the present invention are described in further detail below.

[0094] Re-editing technology allows for the rearrangement of re-editable target positions. The present invention provides, in particular, a method for recombining a re-editable target locus within a cell, comprising inserting an exogenous re-editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any coding region in the genome, and the template sequence is recognizable by a genome editing system. In some embodiments, the template sequence is recognizable by an integrase (e.g., a phage-derived integrase, e.g., phiC31, Bxb1). As used herein, “exogenous” refers to a sequence that is not normally expressed at a given locus.

[0095] Re-editable mold The re-editable template sequences of the present invention are designed to have virtually no sequence similarity to any coding region in the genome. In some embodiments, the re-editable template has approximately 70%, 75%, 80%, 85%, 90%, 95%, or less than 100% identity to any coding region in the genome. In some embodiments, the re-editable template has approximately 70–75% identity to any coding region in the genome. In some embodiments, the re-editable template has approximately 75–80% identity to any coding region in the genome. In some embodiments, the re-editable template has approximately 80–85% identity to any coding region in the genome. In some embodiments, the re-editable template has approximately 85–90% identity to any coding region in the genome. In some embodiments, the re-editable template has approximately 90–95% identity to any coding region in the genome. In some embodiments, the re-editable template has approximately 95-100% identity with respect to any coding region in the genome. In some embodiments, the re-editable template has less than 70% identity with respect to any coding region in the genome. In some embodiments, the re-editable template has less than 75% identity with respect to any coding region in the genome. In some embodiments, the re-editable template has less than 80% identity with respect to any coding region in the genome. In some embodiments, the re-editable template has less than 85% identity with respect to any coding region in the genome. In some embodiments, the re-editable template has less than 90% identity with respect to any coding region in the genome. In some embodiments, the re-editable template has less than 95% identity with respect to any coding region in the genome. In some embodiments, the re-editable template has less than 100% identity with respect to any coding region in the genome.

[0096] Therefore, off-target editing is minimized or eliminated by the re-editable template of the present invention. Off-target editing is a major limitation in genome editing technologies that needs to be suppressed to ensure the safe and widespread use of gene therapy in various therapeutic applications. Briefly, off-target editing causes breaks in double-stranded DNA at sequences other than the intended target site, resulting in unwanted mutations and gene disruption, which can lead to toxicity or lethality. However, off-target editing can also occur at the target site. For example, a single-base pair substitution in a protospacer sequence at a target site may result in a re-break by the Cas enzyme at the same target site, potentially removing the desired genome modification by the template repair pathway. Often, further target site disruption mutations are introduced into the repair template to prevent re-breaks, but these may affect regulatory motifs or result in non-synonymous mutations.

[0097] In the CRISPR-Cas system, off-target cleavage arises from the recognition of complementary genomic sites by gRNA, and several approaches to minimize this include Cas9 variants with low off-target specificity, such as HF-Cas9, eCas9, and HypaCas9. In some embodiments of the present invention, Cas9 is a variant Cas9, or a Cas9 homolog.

[0098] The present invention provides a re-editable template that prevents undesirable re-cutting by the same genome editing tool used to insert the re-editable template, and instead prepares a template for subsequent specific modification by a different genome editing tool. In some embodiments, the genome editing tool is a nucleic acid, e.g., RNA, or protein-guided TALEN, zinc finger nuclease, meganuclease, CRISPR-Cas, or related nuclease. In some embodiments, the genome editing tool is a sequence-specific recombinase or integrase, e.g., phiC31 having its cognitive attP or attB recognition sequence. In some embodiments, the target is a pseudo-attP or attB site in the genome that is recognizable by the recombinase or integrase. The re-editable template of the present invention allows for subsequent targeted modification by a genome editing nuclease different from the one used to insert the re-editable template, thereby facilitating the rapid development of multiple different types of mutations in platform cells for treating multiple different indications.

[0099] The designed re-editable template sequence determines the suitability of the genome editing system for subsequent editing. For example, in some embodiments, where the sequence is inserted at 5' of an existing PAM site, a new cleavage site is created near the previously existing PAM site, and the PAM site is identified within the homology arm, making the template sequence re-editable. In some embodiments, if the re-editable template does not have 5'-NGG-3'PAM, it is not possible to subsequently modify the re-editable locus by Cas9 nuclease, but the locus can be recognized and edited by TALEN, for example, or another Cas protein. Therefore, in various embodiments, the re-editable template is designed to prevent re-cleavage and off-target effects while enabling precise subsequent genome modification.

[0100] In some embodiments, any coding region in the genome contains at least 3 mismatches compared to a template sequence recognizable by guide RNA. In some embodiments, any coding region in the genome contains at least 1 mismatch compared to a template sequence recognizable by guide RNA. In some embodiments, any coding region in the genome contains at least 2 mismatches compared to a template sequence recognizable by guide RNA. In some embodiments, any coding region in the genome contains at least 4 mismatches compared to a template sequence recognizable by guide RNA. In some embodiments, any coding region in the genome contains at least 5 mismatches compared to a template sequence recognizable by guide RNA. In some embodiments, any coding region in the genome contains at least 6 mismatches compared to a template sequence recognizable by guide RNA. In some embodiments, any coding region in the genome contains at least 7 mismatches compared to a template sequence recognizable by guide RNA. In some embodiments, any coding region in the genome contains at least 8 mismatches compared to a template sequence recognizable by guide RNA. In some embodiments, any coding region in the genome contains at least 9 mismatches compared to a template sequence recognizable by guide RNA. In some embodiments, any coding region within the genome contains fewer than 10 mismatches compared to a template sequence recognizable by guide RNA. It is then revealed that the template sequence is recognizable by guide RNA when a mismatch-tolerant nuclease is recruited and cleavage occurs.

[0101] The re-editable mold of the present invention has a thickness of less than approximately 500 nt. In some embodiments, the re-editable mold is approximately 10 to 500 nt. In some embodiments, the re-editable mold is approximately 10 to 100 nt, and in some embodiments, the re-editable mold is approximately 10 to 20 nt. In some embodiments, the re-editable mold is approximately 20 to 30 nt. In some embodiments, the re-editable mold is approximately 30 to 40 nt. In some embodiments, the re-editable mold is approximately 40 to 50 nt. In some embodiments, the re-editable mold is approximately 50 to 60 nt. In some embodiments, the re-editable mold is approximately 60 to 70 nt. In some embodiments, the re-editable mold is approximately 70 to 80 nt. In some embodiments, the re-editable mold is approximately 80 to 90 nt. In some embodiments, the re-editable mold is approximately 90 to 100 nt. In some embodiments, the re-editable mold is approximately 100 to 200 nt. In some embodiments, the re-editable mold is approximately 200-300 nt. In some embodiments, the re-editable mold is approximately 300-400 nt. In some embodiments, the re-editable mold is approximately 400-500 nt.

[0102] In some embodiments, an entire exon is replaced with a re-editable template. In some embodiments, one or more exons are replaced with a re-editable template, such as various PAMs. In some embodiments, the re-editable template is inserted within a non-coded area.

[0103] In some embodiments where the genome editing system is a CRISPR-Cas system, the Cas protein is a type II Cas enzyme. In some embodiments, the Cas protein is Cas9, Cas12a, or Cas12b. Examples of type II nucleases include Cas9, a double-stranded RNA guide nuclease that requires both CRISPR RNA (crRNA) and tracrRNA and contains both HNH and RuvC nuclease domains; Cas12a, a single-stranded RNA guide nuclease that requires only crRNA and contains a single RuvC domain; and Cas12b, a double-stranded RNA guide nuclease that contains a single RuvC domain and requires both crRNA and tracrRNA.

[0104] In some embodiments, the Cas protein is an enzyme-inactive Cas protein or nickase. In some embodiments, the Cas protein is Cas9 D10A or Cas9 H840A. In some embodiments, the Cas nuclease, TALEN, or ZFN is fused to a FokI nuclease or related nuclease domain. Inactive Cas9 is fused to a FokI nuclease (fCas9) to improve DNA cleavage specificity. DNA cleavage by fCas9 requires the association of two fCas9 monomers that simultaneously bind to target sites 15 or 25 base pairs apart. In human cells, fCas9 modified target DNA sites with more than 140 times higher efficiency than wild-type Cas9. (Guilinger, Thompson and Liu, 2014, Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification, Nature Biotechnology, 32, p.577-582). In some embodiments, inactive Cas9 fuses to M-MLV reverse transcriptase. In some embodiments, Cas9 H840A fuses to M-MLV reverse transcriptase for prime editing.

[0105] In various embodiments of the present invention, where the genome editing system is a CRISPR-Cas system, the re-editable template includes a protospacer-adjacent motif (PAM). A PAM is typically a 2-6 nt long DNA sequence adjacent to a CRISPR locus, which is targeted for cleavage by a Cas-associated nuclease within the CRISPR-Cas genome editing system. The Cas enzyme binds to the DNA sequence adjacent to the PAM sequence, thereby instructing it to perform DNA cleavage at a precise location. In some embodiments, the re-editable template includes a 5'-NGG-3'PAM sequence, where N is any nucleotide followed by two guanine nucleotides, and is recognized by the Cas9 enzyme from Streptococcus pyogenes (SpCas9). In some embodiments, the re-editable template includes a 5'-NGG-3'PAM and the nuclease is Cas9. Furthermore, S. pyogenes Cas9 mutants with altered specificity or those recognizing novel PAM sequences have been identified. SaCas9 (derived from Staphylococcus aureus) specifically recognizes the short PAM sequence 5'-NGRR(N)-3'. Other Cas nucleases, including Cas9 from other species, recognize longer PAMs or have higher specificity, minimizing off-target cleavage. Therefore, the appropriate Cas nuclease and corresponding PAM are selected for the design of a re-editable template. The re-editable template of the present invention includes various PAMs that associate with Cas9 from various species in various embodiments.For example, Neisseria meningitides (NmeCas9) specifically recognizes NNNNGATT, Campylobacter jejuni (CjCas9) specifically recognizes NNNNRYAC, Streptococcus thermophilus (StCas9) recognizes NNAGAAW, Lachnospiraceae bacterium (LbCpf1, Cas12a) recognizes TTTV, Acidaminococcus sp. (AsCpf1, Cas12a) recognizes TTTV, Alicyclobacillus acidiphilus (AacCas12b) recognizes TTN, Bacillus hisashii (BhCas12bv4) recognizes ATTN, TTTN, and GTTN, and uncultured archaea (Cas14) recognize T-rich PAM sequences, such as TTTA.

[0106] Some PAM sequences are recombined to expand the repertoire of Cas9 targets. For example, Francisella novicida Cas9 recognizes the canonical 5'-NGG-3' PAM, but has been recombined to recognize 5'-YG-3', where Y is any pyrimidine. In addition to CRISPR-Cas9, Francisella novicida CRISPR-Cpf1 recognizes PAM 5'-TTTN-3' or 5'-YTN-3'. CRISPR-Cas13a(C2c2) is an RNA-guided CRISPR system that, instead of being PAM-recognition sequence-independent, requires a protospacer facies site (PFS), which is usually a nucleotide other than guanine, and is known to have reduced effectiveness.

[0107] In some embodiments, the re-editable template of the present invention therefore includes an exotic sequence of interest that does not have substantial sequence similarity to any coding region of the genome, is not the same as the one used to insert into the target locus, is specific to recognition by a desired genome editing system, varies in length (e.g., 10–500 nt), and does not normally express at the locus. In some embodiments, the exotic sequence is a non-coding sequence.

[0108] In some embodiments, the re-editable mold is [ka] or [ka] This is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

[0109] In some embodiments, the re-editable mold is [ka] This is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

[0110] In some embodiments, the re-editable mold is [ka] This is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

[0111] In some embodiments, the re-editable mold is [ka] This is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

[0112] Generation of re-editable target loci by introducing a re-editable template. The present invention provides a method for recombining a re-editable target locus within a cell, comprising inserting an exogenous re-editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any region in the genome, and the template sequence is recognizable by a genome editing system.

[0113] An exogenous re-editable template refers to a sequence other than the endogenous sequence for the locus in question, i.e., a sequence that is not normally present in the genome at the target locus. In some embodiments, an exogenous re-editable template includes a wild-type sequence expressed at a different locus, or in the genome of a different species, or in a different cell of the same or different species. In some embodiments, an exogenous re-editable template also includes a modified or manipulated recombinant sequence. In some embodiments, an exogenous re-editable template includes a protein-coding gene.

[0114] In some embodiments, the re-editable template array has two adjacent homology arms so that the re-editable template array is inserted into the target seat by homologous recombination.

[0115] Homologous recombination is a type of genetic modification in which nucleotide sequences are exchanged between two similar or identical molecules of DNA, i.e., adjacent homology arms. In short, homologous recombination is initiated by a double-strand break, which is repaired by the cell. Genome editing induces DNA breaks at one or more sites, for example, double-strand breaks (DSBs) at a target locus (or target genomic region) in the genome. The DNA breaks are then repaired by cellular enzymes using either the error-prone non-homologous end joining pathway (NHEJ) or the error-free homologous recombination repair (HDR) pathway.

[0116] In NHEJ, DNA damage is repaired by fusing the two ends of a DNA break in a series of enzymatic processes involving Ku70 / 80 heterodimers and DNA-dependent protein kinase (DNA-PKc) enzymes. The repair mechanism involves tethering and alignment of the two DNA ends, breakage, elongation, and ligation, resulting in the formation of small insertion or deletion mutations (indels) at the break site. Indels introduced into the gene's coding sequence can induce either immature stop codon or frameshift mutations, leading to the production of non-functional cleavage proteins. Using NHEJ, it is possible to create two unique alleles within a gene by generating indels that knock out gene expression.

[0117] Homologous recombination repair (HDR) is another mechanism by which cells repair double-strand DNA breaks. HDR requires an HDR donor template containing sequences defined as "homology arms" that are homologous to specific sequences adjacent to the break site. The HDR pathway involves repair proteins, such as Rad51, which stimulate strand entry by the donor repair template for base insertion or gene substitution. HDR allows for the introduction of exogenous DNA templates and DNA editing within the genome.

[0118] The optimal length for homology arms has been reported to be a minimum of 30 nt on both sides of the DSB, and asymmetric donor oligos have been shown to improve HDR. HDR efficiency is highest when the desired edit is located near the DSB and decreases significantly at loci far from the event. Furthermore, the report indicates that the use of donor oligos with sequences that are either complementary or non-complementary to the gRNA may be preferred.

[0119] CRISPR-Cas-mediated re-cleavage of dsDNA reduces HDR efficiency, leading to the incorporation of blocking mutations. Therefore, HDR using homozygous frameshift mutations (e.g., indels resulting in immature stop codons) along with silent blocking mutations (multiple possible) generates two identical alleles. HDR occurs very infrequently during the S and G2 phases of DNA replication. The most common form of HDR is homologous recombination. The HDR mechanism is available to cells only when homologous DNA fragments are present in the nucleus, primarily during the G2 and S phases of the cell cycle. Other examples of homologous repair include single-strand annealing and cleavage-induced replication.

[0120] The intervening re-editable templates described herein are integrated into the genome by homologous recombination to generate a re-editable target locus, which includes the re-editable template and adjacent homology arms. The sizes of the two homology arms may be the same or different.

[0121] In some embodiments, the homology arm is about 50 to 500 nt. In some embodiments, the homology arm is 30 nt. In some embodiments, the homology arm is between about 50 nt. In some embodiments, the homology arm is about 100 nt in length. In some embodiments, the homology arm is about 150 nt in length. In some embodiments, the homology arm is about 200 nt in length. In some embodiments, the homology arm is about 250 nt in length. In some embodiments, the homology arm is about 300 nt in length. In some embodiments, the homology arm is about 350 nt in length. In some embodiments, the homology arm is about 400 nt in length. In some embodiments, the homology arm is about 450 nt in length. In some embodiments, the homology arm is about 500 nt in length.

[0122] In some embodiments, later modifications use a gRNA-guided Cas nuclease to generate a double-strand break and integrate an exogenous protein-coding gene into the target locus.

[0123] target locus The target locus of the present invention is any genomic locus into which a re-editable template is inserted, enabling subsequent genome modification at the desired locus. For example, the target gene locus or target locus is a locus in which gene function is knocked out and subsequent genome editing is performed to integrate an exogenous gene. In some embodiments, the target locus is a locus in which gene function is not disrupted or knocked out.

[0124] In some embodiments, the target locus is at least one locus selected from the group consisting of ubiquitously expressed genes, cell division-related genes, and genes whose expression is restricted to specific cell types. In some embodiments, the target locus is a ubiquitously expressed gene, such as an HLA class I gene, such as the B2M gene. HLA class I molecules are expressed on the surface of almost all nucleated cells. In some embodiments, the target locus is a cell division-related gene, such as a cell cycle checkpoint gene. In some embodiments, the target locus is a gene whose expression is restricted to specific cell types, such as an HLA class II gene. HLA class II molecules are expressed only in B lymphocytes, antigen-presenting cells (monocytes, macrophages, and dendritic cells), and activated T lymphocytes.

[0125] In transplantation, the gene loci involved in the rejection of foreign cells are known as the major histocompatibility complex (MHC). MHC encodes highly polymorphic cell surface molecules. Human MHC is also known as the HLA (human leukocyte antigen) system because these antigens were first identified and characterized using alloantibodies against leukocytes. Molecular HLA allele typing is typically performed during allogeneic stem cell transplantation to match HLA class I and class II alleles in order to avoid transplant rejection. HLA molecules play a role in immune regulation and the detection of self and non-self antigens. In some embodiments, the target locus is a class I or class II HLA gene. In some embodiments, the target locus is B2M. In some embodiments, the target locus is CIITA.

[0126] In some embodiments, the target locus is a safe harbor locus, which is a location in the genome that allows the expression of an exogenous gene without the risk of affecting adjacent endogenous genes (e.g., ROSA26, AAVS1, CLYBL, H11, COL1A1, CCR5, collagen, HTRP, GAPDH, ACTB, ACTG1, TCR, RUNX1, POLR2a). In some embodiments, the target locus is a locus desirable for gene blockade, e.g., TAP1, TAP2, or tapasin, β-2 microglobulin (B2M), NLRC5, PD1, LAG3, TIM3, RFXANK, CIITA, RFX5, RFXAP.

[0127] In some embodiments, the target locus is a binding site within the genome for a recombinase or integrase, e.g., an attP or attB within the genome. In some embodiments, the integrase is a phage-derived integrase. In some embodiments, the target locus is a pseudo-attP or attB site within the genome. In some embodiments, the target is the smallest attP or attB sequence.

[0128] In some embodiments, the integrase is BxB1. In some embodiments, the BxB1 attP site is [ka] In some embodiments, the BxB1 attB portion is [ka] That is the case. In some embodiments, the integrase is phiC31. In some embodiments, the phiC31 attP site is [ka] In some embodiments, the phiC31 attB region is [ka] The bold and lowercase letters indicate core nucleotides crucial for synapse formation during the recombination (by cognitive integrase) of the attP and attB sequences, while adjacent sequences facilitate recognition / binding by integrase.

[0129] Exogenous genes An exogenous gene is a gene that is not normally present at a locus or is not expressed from that locus. In some embodiments, the exogenous gene is a protein-coding gene. In some embodiments, the exogenous gene is non-coding. An exogenous gene includes any gene that expresses a protein that may otherwise be expressed at other loci or in other cells, and includes a wild-type sequence. Examples of exogenous genes include, among others, PD-L1, FASL, CD47, CD24, B2M, HLA-E, HLA-G, CD200, CCL21, MFGE8, H2-M3, and SPI6.

[0130] In some embodiments, the exogenous gene encodes a safety switch and expresses a protein that induces cell death, and the gene is selected from the group consisting of, among others, herpes simplex virus-derived thymidine kinase (HSV-tk), iCaspase 8, iCaspase 9, iCaspase 3, iCaspase 7, cytosine deaminase, modified EGFR, B-cells, and CD20. In some embodiments, the safety switch is associated with endogenous gene expression (e.g., via a cleavable 2A linker or IRES). In some embodiments, the safety switch is associated with endogenous gene expression via a cleavable 2A linker. In some embodiments, the safety switch is associated with endogenous gene expression via an internal ribosome entry site (IRES) element. In some embodiments, the safety switch is driven by a synthetic promoter (e.g., EF1A, CAG). In some embodiments, the safety switch is driven by an EF1A promoter. In some embodiments, the safety switch is driven by a CAG promoter.

[0131] Stimulating suicide genes is important for killing cancer cells, unwanted cells, or other proliferating cells in tissues and organs, as well as for making cells more sensitive to chemotherapy. Most suicide genes mediate this by encoding viral or bacterial enzymes that convert inactive drugs into toxic antimetabolites that inhibit nucleic acid synthesis. In some embodiments, exogenous genes express suicide genes that are activated by inducer molecules, triggering cell death in hypoimmune iPSCs or cells derived therefrom. For example, herpes simplex virus (HSV)-tk is triggered by ganciclovir. The E. coli cytosine deaminase gene (EC-CD) is triggered by 5-fluorocytosine (5-FC). Suicide genes do not have off-target effects because they need to be introduced in highly specific cells and at targeted loci. In some embodiments of the present invention, a means is provided to control the expression of suicide genes at a desired time and at a precise locus within the cell by introducing them into a re-editable template.

[0132] In some embodiments, the protein-coding gene is a cloaking gene that protects cells from recognition by NK cells and generates low-immunity cells (e.g., iPSCs (e.g., undifferentiated iPSCs, and in some embodiments, progenitor cells and / or differentiated cells), stem cells, progenitor cells, immune cells including T cells and NK cells, or any other differentiated cells). In some embodiments, the protein-coding gene induces cell termination in the presence of an inducing molecule. In some embodiments, the protein-coding gene expresses one or more proteins that increase the efficacy of a chimeric antigen receptor (CAR) product.

[0133] Exogenous genes may include genes encoding transcription factors, receptors, signaling molecules, pharmaceutically active peptides, or proteins that promote various cellular functions of iPSCs or iPSC-derived cells used in tissue engineering, including but not limited to trafficking, homing, engraftment, self-renewal, persistence, viability, and / or survival.

[0134] In some embodiments, the exogenous gene encodes an RNA product including, but not limited to, siRNA, shRNA, microRNA, antisense nucleic acid, circRNAs, and lncRNAs. In some embodiments, the re-editable template includes one or more constitutive promoters, inducible promoters, time-specific promoters, and / or tissue or cell-type specific promoters for driving the expression of the exogenous gene.

[0135] genome editing system Double-strand breaks significantly increase the efficiency of homology-dependent repair in mammalian cells, and targeted nucleases guided by RNA or proteins are used in genome editing systems to produce modifications at precise target sites. Genome editing systems include protein-guided systems such as zinc finger nucleases or TALENs, and RNA-guided systems such as [examples of RNA-guided systems].

[0136] Zinc finger nuclease (ZFN) In some embodiments of the present invention, a re-editable template is designed to be recognizable by a zinc finger nuclease (ZFN) system. The ZFN comprises a site-specific DNA-binding domain and a sequence-nonspecific cleavage domain. The zinc finger domain includes a modular array of Cys2His2 zinc fingers, each consisting of approximately 30 amino acids and recognizing three DNA base pairs. Target recognition is determined by the amino acid sequence of each zinc finger, the number of zinc fingers in the array, and their interaction with the FokI endonuclease domain. Two ZFN molecules bind to the target site in the appropriate orientation, which requires recognition of six sites for DNA cleavage by a zinc finger nuclease containing a fusion of FokI and the zinc fingers, thereby generating a double-strand break at a specific locus, followed by an endogenous NHEJ or HDR repair system. The zinc finger nuclease is optimized by recombining its DNA-binding and catalytic domains. In some embodiments, ZFNs containing 3 to 6 fingers can interact with 9 to 18 nt of DNA, so precise target recognition is specified by 18 to 36 nt of DNA at each cleavage site. Furthermore, linkers spanning finger-to-finger and finger-FokI cleavage domain junctions significantly increase the number of ZFN configurations for targeting precise genome editing.

[0137] Transcription activator-like effector nucleases (TALENs) In some embodiments of the present invention, a re-editable template is designed to be recognizable by the TALEN system. TALEN is a fusion protein of bacterial TALE proteins derived from Xanthomonas and FokI endonuclease. Each TALE motif contains 33-35 amino acid repeat domains that recognize a single nucleotide in DNA. TALE arrays can bind to DNA extensions, e.g., 30-40 nt, having specificity in that the TALE binding site starts with a T base. The TALE protein has two hypervariable amino acids, known as repeating variable double residues, which give it specificity. FokI endonuclease requires dimerization and binding of TALEN on the opposite strand of the target DNA for cleavage.

[0138] Clustered, regularly arranged short palindromic sequence repetitions (CRISPR)-Cas endonuclease In some embodiments of the present invention, the re-editable template is designed to be recognizable by the CRISPR-Cas system. The CRISPR genome editing system is an RNA-guided editing system comprising a Cas nuclease, a transactivating crRNA (tracrRNA), and a CRISPR RNA (crRNA) that recognizes a target sequence. The target sequence must be followed by a protospacer adjacent motif (PAM). Typically, the CRISPR-Cas system recognizes 20-25 nt, e.g., 22 nt, and PAM sequences. Each Cas9 protein has a specific PAM sequence; for example, Cas9 recognizes 5'-NGG-3' and produces a double-strand break. A variant Cas9 called nickase produces a single-strand break. Since target recognition in the CRISPR-Cas system is RNA-guided, such gRNAs can be designed for any genomic target, with criteria for minimizing off-target editing. Furthermore, if necessary, multiple sites can also be modified simultaneously in a multi-layered manner.

[0139] Cas9 variants and homologs, such as CRISPR-Cas12(Cpf1) and CRISPR-Cas13a(C2s2), recognize different PAMs. In some embodiments, the Cas protein is Cas9, Cas12a, or Cas12b. In some embodiments, the Cas protein is an enzyme-inactive Cas protein or nickase. In some embodiments, the nickase is Cas9 D10A. Furthermore, in some embodiments, the Cas9 protein is fused to a FokI endonuclease.

[0140] Guide RNA design RNA guides and guide RNAs are used interchangeably in this specification. Appropriate guide RNA sequences are carefully designed based on the location and sequence of the target locus. The guide RNA needs to be highly active and efficient while minimizing off-target editing. In some embodiments, the guide RNA includes approximately 20 nt followed by a specific PAM sequence, e.g., 20 nt followed by 5'-NGG-3' in SpCas9. For homology-dependent repair, the gRNA sequence recognizes a DNA sequence within approximately 30 nt of the desired editing site.

[0141] In some embodiments, a suitable guide RNA is selected to include a 20nt PAM sequence followed by a PAM sequence containing more than two mismatches. In some embodiments, the guide RNA is selected to include a 20nt PAM sequence followed by a PAM sequence containing three mismatches. For example, in some embodiments, the guide RNA is selected using techniques well known in the art for guide RNA selection, using the criterion that the on-target efficiency exceeds 50% and that there are no protein-coding genes with fewer than three mismatches in the expected off-target list. Target sites in the human genome with more than 70% homology are not included; that is, the gRNA targets a site with less than 70% homology to another region in the genome, thereby reducing off-target cleavage. Target sites in the human genome with 70%, 75%, 80%, 85%, 90%, 95% or more homology are not included. A variety of gRNA design tools are well known in the art, including but not limited to E-CRISP, CHOP-CHOP, CRISPR-ERA, Broad gRNA, Addgene, IDT sequence checker, Benchling, and Desktop Genomics, and in various embodiments, these are used for guide RNA design. In some embodiments, guide RNA design targets within 50 to 500 nt of the transcription start site for CRISPR activation technology, near the transcription start site for CRISPR interference, specific exons and intron sequences for gene knock-in, and protein-coding exons for sequence knock-out.

[0142] In some embodiments, the gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3).

[0143] In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 80% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 90% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 95% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 99% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

[0144] In some embodiments, the gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9).

[0145] In some embodiments, the gRNA that recognizes a re-editable template inserted into the B2M exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity to CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11).

[0146] In some embodiments, gRNAs that instruct a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contain 70%, 80%, 90%, 95%, 99%, or 100% identity with ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, gRNAs that instruct a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contain 70% identity with ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, gRNAs that instruct a double-strand break to insert a re-editable template into exon 2 of the CIITA locus have 80% identity with ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, gRNAs that instruct a double-strand break to insert a re-editable template into exon 2 of the CIITA locus have 90% identity with ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, gRNAs that instruct a double-strand break to insert a re-editable template into exon 2 of the CIITA locus have 95% identity to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, gRNAs that instruct a double-strand break to insert a re-editable template into exon 2 of the CIITA locus have 99% identity to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15).In some embodiments, the gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contains 100% identity to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15).

[0147] In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 70% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 80% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus has 90% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus has 95% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus has 99% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the re-editable template inserted into the CIITA exon 2 locus contains 100% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with respect to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 70% identity with respect to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 80% identity with respect to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 90% identity to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 95% identity to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 99% identity to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, a gRNA that instructs a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contains 100% identity to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus contains 70% identity with TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus contains 80% identity with TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus contains 90% identity with TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus has 95% identity to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus has 100% identity to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20).

[0148] Cells and Uses In some embodiments, recombinant cells comprising re-editable target loci are provided herein, the re-editable target loci comprising an exogenous re-editable template sequence that has substantial sequence similarity to any region in the rest of the genome, and the re-editable template sequence is recognizable by a genome editing system.

[0149] In some embodiments, the cells are mammalian cells. In some embodiments, the cells are human cells. In some embodiments, the cells are cultured cells. In some embodiments, the cells are primary cells. In some embodiments, the cells are non-dividing cells. In some embodiments, the cells are immune cells. In some embodiments, the cells are B cells, T cells, mononuclear cells, macrophages, or NK cells. In some embodiments, the cells are B cells. In some embodiments, the cells are T cells. In some embodiments, the cells are mononuclear cells. In some embodiments, the cells are macrophages. In some embodiments, the cells are NK cells. In some embodiments, the cells are stem cells or progenitor cells. In some embodiments, the cells are stem cells. In some embodiments, the cells are progenitor cells. In some embodiments, the cells are induced pluripotent stem cells (iPSCs).

[0150] In some embodiments, cells are provided herein, and the genome editing system is a CRISPR-Cas-related nuclease system, a transcription activator-like effector nuclease (TALEN) system, or a zinc finger nuclease (ZFN) system. In some embodiments, the Cas protein is Cas9, Cas12a, or Cas12b. In some embodiments, the Cas protein is an enzyme-inactive Cas protein or nickase. In some embodiments, the Cas protein is Cas9 D10A.

[0151] The cells provided herein include a re-editable template introduced into a re-editable locus adjacent to a homology arm, as described in other chapters of this application. In some embodiments, the re-editable template is less than about 500 nt. In some embodiments, the homology arm is about 50 to 500 nt.

[0152] In some embodiments, the present invention provides a method for modifying a gene locus in recombinant cells, comprising contacting the recombinant cells with a genome editing system comprising a nucleic acid encoding a recombinant nuclease protein or Cas protein and a guide RNA that specifically recognizes a PAM sequence contained in a re-editable template, wherein the recombinant nuclease protein or Cas protein is capable of binding to the guide RNA and editing the locus.

[0153] In some embodiments, the nucleic acid encoding the Cas protein is fused to an adenine or cytosine deaminase, and the Cas protein fusion is conjugable to a guide RNA and a base that edits a re-editable template.

[0154] Generation of re-editable low-immunity iPSC cell lines Hypoimmune induced pluripotent stem cells are cells that lack one or more immune antigens capable of inducing an immune response, such as HLA class I and II antigens, and have been modified to avoid phagocytosis or cytotoxicity, for example, by the release of granzymes and / or perforins by immune cells, resulting in improved in vivo persistence. Furthermore, hypoimmune cells eliminate the need for HLA matching in adoptive cell therapy, thus providing a universal off-the-shelf source for generating various therapeutic cell types, reducing costs and effort. Such cell platforms are useful for generating specific cell products for creating specific tissues and organs for regenerative therapy.

[0155] Human leukocyte antigen (HLA) class I and class II genes. In some embodiments, the iPSCs are knocked out for one or more genes selected from HLA class I and HLA class II genes. In some embodiments, the iPSCs are knocked out for one or more genes selected from the group consisting of B2M, A2AR, LAG3, TIM3, TAP1, TAP2, Tapasin, NLRC5, PD1, RFKANK, CIITA, RFX5, and RFXAP.

[0156] β-2 microglobulin (B2M) is ubiquitously expressed in somatic cells and is often considered a "housekeeping" gene. B2M has transcriptional activity at varying expression levels in all cells. In some embodiments, the hypoimmunogenic iPSC cells of the present invention are deleted or knocked out for the B2M gene and lack B2M protein expression. In some embodiments, the hypoimmunogenic iPSC cells of the present invention are defective for the B2M gene and have reduced B2M protein expression. In some embodiments, the target locus is B2M.

[0157] Class II major histocompatibility complex transactivator (CTIIA): CTIIA is a human gene that functions as an HLA class II gene by activating the transcription factor RFX5. The CTIIA protein contains an acidic transcription activation domain, four leucine-rich repeats (LRRs), and a GTP-binding domain. CTIIA binds to GTP and translocates to the nucleus, where it promotes class II HLA gene transcription. CTIIA expression is induced by IFN-γ. In some embodiments, the target locus is CTIIA.

[0158] The present invention introduces a re-editable template that knocks out B2M or CIITA expression, for example, by using a unique gRNA and incorporating a unique sequence that can be used to further modify the locus. By introducing a re-editable template to the B2M or CIITA locus, wild-type gene expression is disrupted, resulting in a cleavage of the coding region.

[0159] To genetically modify low-immunity cells, it is necessary to prevent cell surface expression of class I and class II HLA genes. For example, preventing the localization of B2M to the cell surface is important to reduce the presentation of alloantigens to HLA class I molecules. In some embodiments, class I and class II genes are knocked out and replaced with re-editable templates. For example, induced pluripotent stem cells (iPSCs) are recombined to knock out exemplary HLA class I and class II genes to generate re-editable B2M and CIITA loci that can be modified later. For example, a “housekeeping gene” locus (e.g., B2M) can be used later to express the target protein-coding gene from that locus in all somatic cells in the future. In some embodiments, the CIITA locus is used to express the target gene in cell types that express HLA class II antigens. In some embodiments, the locus is modified with a re-editable template that does not contain protein-coding exogenous genes.

[0160] In some embodiments, the re-editable template includes a chimeric antigen receptor (CAR) gene for CAR-T therapy. Chimeric antigen receptor T cells are genetically modified cells that express a new receptor, allowing them to bind to and kill cancer cells. In some embodiments, the invention provides hypoimmune pluripotent stem cells containing nucleic acids encoding CARs. In some embodiments, the CAR-expressing hypoimmune cells are homozygous null for the B2M gene and / or the CIITA gene. Each type of CAR T cell therapy is performed to combat specific types of cancer antigens expressed on various cells. One application of the invention is to provide a simple method for rapidly producing cells for CAR T therapy targeting various antigens, for example.

[0161] Tables 1-4 below provide guide RNA sequences that instruct double-strand breaks at exemplary loci, guide RNA sequences that recognize re-editable templates for subsequent editing, re-editable loci, and corresponding wild-type loci. [Table 1] [Table 2] [Table 3] [Table 4] [Examples]

[0162] Example 1. Exemplary design of a re-editable mold and its integration into a target seat. This embodiment demonstrates the formation of a re-editable target seat by incorporating an exemplary re-editable template into the target seat.

[0163] In short, in this embodiment, the gRNA is designed to instruct double-strand breaks to insert re-editable templates into exemplary target gene loci: B2M exon 1, B2M exon 2, CIITA exon 2, and CIITA exon 3.

[0164] A unique, re-editable template is designed that has virtually no sequence similarity to any region within the genome, and the template sequence is recognizable by a genome editing system, such as CRISPR-Cas, a transcription activator-like effector nuclease (TALEN), or a zinc finger nuclease (ZFN) system. In some embodiments, the re-editable template is a sequence less than approximately 100 nt. In some embodiments where the genome editing tool is CRISPR-Cas, the re-editable template includes a protospacer-adjacent motif (PAM) recognizable by a specific Cas nuclease. In some embodiments, the re-editable template includes a 5'-NGG-3'PAM, and the nuclease is SpCas9.

[0165] In this example, the gRNA spacer was designed to consist of approximately 20 nt followed by a 5'-NGG-3'PAM sequence with more than two mismatches to SpCas9. A gRNA checker tool was used with the following criteria: the presented target sequence (20 nt) must have a score of over 50% for expected on-target efficiency, and the expected off-target list must not contain any protein-coding genes with fewer than three mismatches. No target sites with 100% homology (e.g., no mismatches) were identified in the human reference genome.

[0166] In some embodiments, off-target editing does not exist.

[0167] Gene editing technology, such as CRISPR-Cas, is used to incorporate a re-editable template adjacent to a site-specific homology arm into the target gene locus via homologous recombination. In some embodiments, the homology arm is approximately 50–500 nt. In some embodiments, the homology arm is approximately 100 nt. The homology arm is designed for each target gene locus, taking into account GC content, structural repeats, etc. Exemplary guide RNAs and re-editable target loci are shown below.

[0168] Re-editable B2M Exxon 1 seat In this embodiment, in some embodiments, the gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3). In some embodiments, the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). Re-editable seating positions are, [ka] or [ka] This is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

[0169] The bolded sequences indicate re-editable templates. The flanking sequences, on the other hand, are homology arms.

[0170] Re-editable B2M Exxon2 seat In some embodiments, the gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9).

[0171] gRNAs that recognize a re-editable template inserted into the B2M exon 2 locus include 70%, 80%, 90%, 95%, 99%, or 100% identity with CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11).

[0172] Re-editable seating positions are, [ka] These are defined by sequences containing 70%, 80%, 90%, 95%, 99%, or 100% identity. Sequences in bold indicate re-editable templates. Flanking sequences, on the other hand, are homology arms.

[0173] Re-editable CIITA Exon 2 seat In the embodiment, the gRNA that instructs a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15).

[0174] In some embodiments, the gRNA that recognizes a re-editable template inserted into the CTIIA exon 2 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17).

[0175] Re-editable seating positions are, [ka] This is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

[0176] The sequences in bold indicate re-editable templates. Flanking sequences, on the other hand, are homology arms. Introducing a re-editable template into the CIITA exon 2 locus removes the alternative splice site, disrupting wild-type gene expression.

[0177] Re-editable CIITA Exxon 3 seat gRNAs that instruct a double-strand break to insert a re-editable template into exon 3 of the CIITA locus contain 70%, 80%, 90%, 95%, 99%, or 100% identity to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19).

[0178] gRNAs that recognize a re-editable template inserted into exon 3 of the CIITA locus have 70%, 80%, 90%, 95%, 99%, or 100% identity with TGACTGATGTAAGACTAGTA (SEQ ID NO: 20).

[0179] Re-editable seating positions are, [ka] This is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

[0180] The bolded sequences indicate re-editable templates. The flanking sequences, on the other hand, are homology arms.

[0181] In summary, the unique re-editable templates designed in this embodiment are incorporated into specific target gene loci using gRNAs designed for each target, forming re-editable target loci that are recognizable by genome editing tools. The re-editable loci are editable by a guide RNA different from the one used to insert the template. Guide RNAs that specifically recognize re-editable loci for subsequent genome modification are provided herein. Based on the methods provided herein, those skilled in the art can design unique re-editable templates that have substantially no sequence similarity to any other region of the genome, and gRNAs specific to any given locus, for generating any re-editable target locus that is specifically recognizable by one or more genome editing systems for subsequent modification.

[0182] Example 2: Exemplary generation of re-editable cells This embodiment demonstrates the generation of exemplary re-editable cells, including an exogenous re-editable template in which two homology arms incorporated into the target locus are adjacent, by homologous recombination as described in Example 1.

[0183] In short, the re-editable template designed in Example 1 is introduced into cells by methods well known in the art, such as transfection, transduction, transformation, and conjugation, which include, in particular, electroporation, bioristic methods, and microinjection of nucleic acids, such as vectors, plasmids, minicircles, circular single-stranded DNA, linear double-stranded DNA, or linear single-stranded DNA.

[0184] For each specific locus, the homology arm designed in Example 1 is adjacent to the re-editable template, introducing an exogenous re-editable template sequence into the target locus via homologous recombination, thereby generating a cell containing the re-editable template locus, which is recognizable by one or more genome editing systems for subsequent modification.

[0185] The exemplary cells in this embodiment are human iPSC cells containing re-editable class I and / or class II HLA gene loci. For example, an iPSC cell line containing loci re-editable by B2M is prepared by the method of this embodiment. In another embodiment, iPSC cells containing loci re-editable by CIITA are prepared by the method of this embodiment. In yet another embodiment, iPSC cells containing both B2M-re-editable loci and CIITA-re-editable loci are prepared by the method of this embodiment.

[0186] Based on the method described in this embodiment, those skilled in the art can create any cell containing a unique re-editable template that has substantially no sequence similarity to any other region of the genome for generating any re-editable target locus that can be specifically recognized by one or more genome editing systems for subsequent modification. For example, the cell may be a mammalian cell, a human cell, a cultured cell, a primary cell, a non-dividing cell, or an immune cell. Exemplary immune cells may be B cells, T cells, mononuclear cells, macrophages, or NK cells. In some embodiments, the cell may be a stem cell. In some embodiments, the cell may be a cell line used to generate a rapidly modifiable platform for various applications.

[0187] Example 3: Generation of a low-immunity iPSC cell line In short, this embodiment generates a low-immunity iPSC cell line using the methods described in Examples 1 and 2.

[0188] By recombining induced pluripotent stem cells (iPSCs) to knock out exemplary HLA class I and class II genes, we generate B2M and CIITA loci that can be modified and re-edited later.

[0189] In exemplary embodiments, later modifications utilize a gRNA-guided Cas nuclease to generate double-strand breaks and incorporate a protein-coding gene. In some embodiments, the protein-coding gene is a cloaking gene that protects the cell from recognition by NK cells and generates a low-immunity iPSC. In some embodiments, the protein-coding gene induces cell termination in the presence of an inducing molecule. In some embodiments, the protein-coding gene expresses one or more proteins that increase the efficacy of the CAR product.

[0190] While several embodiments of the present invention are described and illustrated herein, those skilled in the art will readily conceive of various other means and / or structures to perform the functions described herein and / or to obtain the results and / or one or more advantages, and each of such variations and / or modifications will be considered to fall within the scope of the embodiments of the present invention described herein. Those skilled in the art will recognize many equivalents of the particular embodiments of the present invention described herein, or can verify them using only conventional experimental methods. Therefore, it should be understood that the embodiments described herein are presented only as examples, and embodiments of the present invention can be carried out in ways other than those specifically described and claimed, within the scope of the appended claims and their equivalents.

Claims

1. A method for recombining a re-editable target locus within a cell, comprising inserting an exogenous re-editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any region in the genome, and the template sequence is recognizable by a genome editing system.

2. A method for recombining re-editable cells, The method comprises introducing an exogenous, re-editable template sequence having two adjacent homology arms such that the re-editable template sequence is inserted into the target locus by homologous recombination, wherein the template sequence has no substantial sequence similarity to any region within the genome, and the template sequence is recognizable by a genome editing system.

3. The method according to any one of the prior claims, wherein the genome editing system is a CRISPR-Cas-related nuclease system, a transcription activator-like effector nuclease (TALEN) system, or a zinc finger nuclease (ZFN) system.

4. The method according to claim 3, wherein the Cas protein is Cas9, Cas12a, or Cas12b.

5. The method according to claim 4, wherein the Cas protein is an enzyme-inactive Cas protein or niccas.

6. The method according to claim 5, wherein the Cas protein is Cas9 D10A or Cas9 H480A.

7. The method according to claim 3, wherein the Cas protein, TALEN, or ZFN is fused to a FokI nuclease or related nuclease domain.

8. The method according to any one of the prior claims, wherein each homology arm adjacent to the re-editable mold is approximately 50 to 500 nt.

9. The method according to claim 8, wherein the homology arm is approximately 100 nt.

10. The method according to any one of the prior claims, wherein the re-editable mold is less than approximately 500 nt.

11. The method according to any one of the prior claims, wherein the re-editable mold is approximately 10 to 500 nt.

12. The method according to claim 11, wherein the re-editable mold is approximately 100 nt.

13. The method according to claim 11, wherein the re-editable mold is approximately 500 nt.

14. The method according to any one of the prior claims, wherein the re-editable mold includes a protospacer adjacent motif (PAM).

15. The method according to claim 10, wherein the re-editable mold comprises 5'-NGG-3'PAM and the nuclease is Cas9.

16. The method according to any one of the prior claims, wherein any coding region within the genome contains at least three mismatches with respect to the sequence in the re-editable template that is recognizable by the guide RNA.

17. The method according to claim 16, wherein off-target editing is absent.

18. The method according to any one of the prior claims, wherein the cells are mammalian cells.

19. The method according to claim 18, wherein the cells are human cells.

20. The method according to claim 18, wherein the cells are cultured cells.

21. The method according to claim 18, wherein the cells are primary cells.

22. The method according to claim 18, wherein the cells are non-dividing cells.

23. The method according to claim 18, wherein the cells are immune cells.

24. The method according to claim 23, wherein the cells are B cells, T cells, mononuclear cells, macrophages, or NK cells.

25. The method according to claim 18, wherein the cells are stem cells or progenitor cells.

26. The method according to claim 25, wherein the cells are induced pluripotent stem cells (iPSCs).

27. The method according to any one of the prior claims, wherein the target locus is at least one locus selected from the group consisting of ubiquitously expressed genes, cell division-related genes, and genes whose expression is limited to a specific cell type.

28. The method according to claim 27, wherein the target locus is a class I or class II HLA gene.

29. The method according to claim 28, wherein the target seating position is B2M.

30. The method according to claim 29, wherein the gRNA that commands a double-strand break to insert a re-editable template into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGTAGGCGAGCCAGCTA (SEQ ID NO: 1), AGGGTAGAGAGACTCAACGC (SEQ ID NO: 2), or GGCCGAGAATGTTCTCGCTCCG (SEQ ID NO: 3).

31. The aforementioned re-editable seating position is, 【Chemistry 1】 or 【Chemistry 2】 The method according to claim 30, wherein the identity is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

32. The method according to claim 29, wherein the gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus includes 70%, 80%, 90%, 95%, 99%, or 100% identity with AAGTCAACTTCCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCAACAGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCCAAGGAC (SEQ ID NO: 9).

33. The method according to claim 29, wherein the gRNA that recognizes the re-editable template inserted into the B2M exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCAACCCTAC (SEQ ID NO: 11), or the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

34. The aforementioned re-editable seating position is, 【Transformation 3】 The method according to claim 33, wherein the identity is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

35. The method according to claim 28, wherein the target seat is CIITA.

36. The method according to claim 35, wherein the gRNA that commands a double-strand break to insert a re-editable template into exon 2 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTCTATGAACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTCCC (SEQ ID NO: 15).

37. The method according to claim 35, wherein the gRNA that recognizes the re-editable template inserted into exon 2 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCCAGTGTGCTAACCA (SEQ ID NO: 17).

38. The aforementioned re-editable seating position is, 【Chemistry 4】 The method according to claim 36, wherein the identity is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

39. The method according to claim 38, wherein the gRNA that commands a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with AGGCTGTGTGTGACATGGA (SEQ ID NO: 19).

40. The method according to claim 35, wherein the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with respect to TGACTGATGTAAGAACTAGTA (SEQ ID NO: 20).

41. The aforementioned re-editable seating position is, 【Transformation 5】 The method according to claim 40, wherein the identity is defined by an array containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

42. The method according to any one of the prior claims, wherein the re-editable template includes an exogenous protein-coding gene.

43. The method according to claim 42, wherein the exogenous gene is an immunoregulatory gene or a cloaking gene.

44. The method according to claim 42, wherein the exogenous gene expresses a protein that induces cell death, and the gene is selected from the group consisting of HSV-TK, iCaspace8, and iCaspace9.

45. The method according to any one of the prior claims, wherein the re-editable template comprises a chimeric antigen receptor (CAR) gene.

46. Isolated cells, recombinant by the method described in any one of the prior claims.

47. Recombinant cells comprising a re-editable target locus, wherein the re-editable target locus comprises an exogenous re-editable template sequence that has no substantial sequence similarity to any region of the rest of the genome, and the re-editable template sequence is recognizable by a genome editing system.

48. The cell according to claim 47, wherein the genome editing system is a CRISPR-Cas-related nuclease system, a transcription activator-like effector nuclease (TALEN) system, or a zinc finger nuclease (ZFN) system.

49. The cell according to claim 48, wherein the Cas protein of the CRISPR-Cas-related nuclease system is Cas9, Cas12a, or Cas12b.

50. The cell according to claims 47 to 49, wherein the Cas protein is an enzyme-inactive Cas protein or niccas.

51. The cell according to claim 50, wherein the Cas protein is Cas9 D10A or Cas9 H840A.

52. The cell according to any one of the prior claims, wherein homology arms are adjacent to the re-editable template, and the homology arms are approximately 50 to 500 nt.

53. The cell according to claim 52, wherein the homology arm is approximately 100 nt.

54. The cell according to any one of the prior claims, wherein the re-editable template is less than approximately 500 nt.

55. The cell according to any one of the prior claims, wherein the re-editable template is less than approximately 100 nt.

56. The re-editable template is a cell according to any one of the prior claims, comprising a protospacer adjacent motif (PAM).

57. The cell according to claim 56, wherein the re-editable template comprises 5'-NGG-3'PAM and the nuclease is Cas9.

58. The cell according to any one of the prior claims, wherein the coding region within the genome that is recognizable by the guide RNA contains at least three mismatches.

59. The cell according to claim 58, wherein no off-target editing occurs.

60. The cell according to any one of the prior claims, wherein the cell is a mammalian cell.

61. The cell according to claim 60, wherein the cell is a human cell.

62. The cell according to claim 60, wherein the cell is a cultured cell.

63. The cell according to claim 60, wherein the cell is a primary cell.

64. The cell according to claim 60, wherein the cell is a non-dividing cell.

65. The cell according to claim 60, wherein the cell is an immune cell.

66. The cell according to claim 65, wherein the cell is a B cell, a T cell, a mononuclear cell, a macrophage, or an NK cell.

67. The cell according to claim 60, wherein the cell is a stem cell.

68. The cell according to claim 67, wherein the cell is an induced pluripotent stem cell (iPSC).

69. The cell according to any one of the prior claims, wherein the target locus encodes an immunogene.

70. The cell according to claim 69, wherein the target locus is a class I or class II HLA gene.

71. The cell according to claim 70, wherein the target locus is B2M.

72. The cell according to claim 71, wherein the gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 1 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with GAGTAGGCGAGCCAGCTA (SEQ ID NO: 1), AGGGTAGAGAGACTCAACGC (SEQ ID NO: 2), or GGCCGAGAATGTTCTCGCTCCG (SEQ ID NO: 3).

73. The aforementioned re-editable seating position is, 【Transformation 6】 or 【Transformation 7】 The cell according to claim 72, defined by a sequence containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

74. The cell according to claim 73, wherein the gRNA that recognizes the re-editable template inserted into the B2M exon 1 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with respect to GAGCGTGTGAACTAGCTGTAC (SEQ ID NO: 4).

75. The cell according to claim 73, wherein the gRNA that instructs a double-strand break to insert a re-editable template into the B2M exon 2 locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with AAGTCAACTTCCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCAACAGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCCAAGGAAC (SEQ ID NO: 9).

76. The cell according to claim 73, wherein the gRNA that recognizes the re-editable template inserted into the B2M exon 2 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTTCACCCTAC (SEQ ID NO: 11).

77. The aforementioned re-editable seating position is, 【Transformation 8】 The cell according to claim 76, defined by a sequence containing 70%, 80%, 90%, 95%, 99%, or 100% identity.

78. The cell according to claim 70, wherein the target locus is CIITA.

79. The cell according to claim 78, wherein the gRNA that commands a double-strand break to insert a re-editable template into exon 2 of the CIITA locus contains 70%, 80%, 90%, 95%, 99%, or 100% identity with ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTCTATGAACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTCCC (SEQ ID NO: 15).

80. The cell according to claim 78, wherein the gRNA that recognizes the re-editable template inserted into exon 2 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCCAGTGTGCTAACCA (SEQ ID NO: 17).

81. The aforementioned re-editable seating position is, 【Chemistry 9】 The cell according to claim 78, defined by a sequence containing 70%, 80%, 90%, 95%, 99%, or 100% identity with respect to the given cell.

82. The cell according to claim 78, wherein the gRNA that commands a double-strand break to insert a re-editable template into exon 3 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with AGGCTGTGTGTGACATGGA (SEQ ID NO: 19).

83. The cell according to claim 78, wherein the gRNA that recognizes the re-editable template inserted into exon 3 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity with respect to TGACTGATGTAAGAACTAGTA (SEQ ID NO: 20).

84. The aforementioned re-editable seating position is, 【Chemistry 10】 The cell according to claim 82, defined by a sequence containing 70%, 80%, 90%, 95%, 99%, or 100% identity with respect to the given.

85. The re-editable template is a cell according to any one of the prior claims, comprising an exogenous protein-coding gene.

86. The cell according to claim 85, wherein the exogenous protein-coding gene is an immunoregulatory gene or a cloaking gene.

87. The cell according to claim 85, wherein the exogenous protein-coding gene expresses a protein that induces cell death.

88. The re-editable template is a cell according to any one of the prior claims, comprising a chimeric antigen receptor (CAR) gene.

89. A method for modifying gene loci within recombinant cells, The recombinant cells according to claim 46 or 47 nucleic acids encoding recombinant nuclease proteins or Cas proteins, and Guide RNA that specifically recognizes the PAM sequence contained in the aforementioned re-editable template This includes contacting a genome editing system that includes The method wherein the recombinant nuclease protein or Cas protein is capable of binding to the guide RNA and editing the locus.

90. The method according to claim 89, wherein the nucleic acid encoding the Cas protein is fused to an adenine or cytosine deaminase, and the Cas protein fusion is capable of binding to the guide RNA and to bases that edit the re-editable template.

91. A re-editable template sequence, wherein the template sequence has no substantial sequence similarity to any region within the genome, and the template sequence is recognizable by a genome editing system.