Acceptor splice site modules optimized for biological and biotechnological applications

Abstract

The present invention relates to novel acceptor splice regions and their uses and applications.

Description

Technical Field

[0001] The present invention relates to a novel acceptor splice region, as well as its use and applications.

Background Art

[0002] Most eukaryotic genes contain non-coding introns. These need to be removed from precursor messenger RNA (pre-mRNA) to generate translatable mature messenger RNA (mRNA) in a process called "splicing". Splicing is mediated through a large ribonucleoprotein complex, the spliceosome, which consists of five conserved small nuclear ribonucleoproteins (snRNPs), namely U1, U2, U4, U5, and U6 snRNPs, as well as over 300 proteins. The spliceosome is a very dynamic process that constructs and degrades each intron. For this purpose, the exon-intron boundaries are demarcated by different sequence motifs that function as binding sites for ribonucleoproteins involved in the regulation of mRNA splicing.

[0003] The most relevant splice motifs are the standard donor splice site and acceptor splice site that demarcate the exon-intron boundary. The 5' donor splice site (DSS) is at the 3' end of the exon and the 5' end of the downstream intron, and the 3' acceptor splice site (ASS) is at the 3' end of the intron and the 5' end of the downstream exon. A functional acceptor splice site (ASS) requires three different sequences (elements), the branch point (BP), the polypyrimidine tract (PPT), and the standard ASS sequence, which are usually located in a range of about 50 bp.

[0004] So-called GT-AG splicing is the most common type of mammalian mRNA splicing, clarifying the first two nucleotides and the last two nucleotides of an intron at the DNA level. Thus, a portion of a standard DSS sequence represents the first two bases of the 5' intron sequence, guanine and followed by thymine (GT) in the DNA sequence (corresponding to GU in the RNA sequence), as well as the last two bases, adenine and followed by guanine (AG) (representing the most conserved portion of the consensus ASS). GT-AG nucleotides are essential for an effective splicing reaction, and their corruption or substitution leads to the loss of a functional splice site.

[0005] Each splicing cycle consists of two transesterification reactions. In the first reaction, known as the branching reaction, the branching nucleoside (usually adenosine) attacks the phosphate bond at the 5' exon-intron junction. This forms an intron lariat-3' exon intermediate (containing the exon and intron downstream of the splice site) and a free 5' exon end (containing the exon upstream of the splice site). In the second reaction, called exon ligation, the free end of the 5' exon attacks the phosphate at the intron-3' exon junction, causing ligation of the two exons and release of the intron lariat structure. The splicing reaction is controlled by an auxiliary cis-acting splicing regulatory element in premRNA, which consists of up to 10 nucleotides. These elements can be classified according to their function and location into intra-exon splicing-promoting elements (ESEs), intra-exon splicing-promoting elements (ESSs), intra-intron splicing-promoting elements (ISEs), and intra-intron splicing-repressing elements (ISSs). These elements are proposed to play a crucial role in alternative splicing because they can recruit trans-acting proteins to promote or prevent exon inclusion.

[0006] The splicing efficiency of a particular exon is expected to depend on the strength of the donor and acceptor splice sites. The strength of this DSS or ASS depends on the upstream or downstream intron or exon sequence elements of the GT or AG. The strength of a functional DSS can be reliably predicted using standard in silico prediction software (e.g., NNSplice: http: / / www.fruitfly.org / seq_tools / splice.html or Human Splice Finder: http: / / www.umd.be / HSF3 / ). In contrast, due to its complexity, in silico prediction of ASS strength leads to unreliable results (e.g., Koller et al., (2011) “A novel screening system improves genetic correction by internal exon replacement.” Nucleic acids research. 39:e108; Lorain et al., (2013) “Dystrophin rescue by trans-splicing: a strategy for DMD genotypes not eligible for exon skipping approaches.” Nucleic acids research. 41:8391-8402). Therefore, actual ASS strength needs to be validated experimentally. Many biological, bioengineering, and therapeutic applications rely on the efficiency of classical GT-AG mRNA splicing and, therefore, on the use of strong splice sites.

[0007] Apart from the usual cis-splicing event, which generates translatable mature mRNA from pre-mRNA by removing non-coding introns, splicing also occurs in trans, combining two separate pre-mRNA molecules to create non-colinear chimeric RNA (Lei et al., (2016) “Evolutionary insights into RNA trans-splicing in vertebrates”, Genome Biol. Evol. 8(3):562-577). This process was first discovered in trypanosomes. Since then, trans-splicing events have been observed in many species, including mice (Hirano M and Noda T., (2004) “Genomic organization of the mouse Msh4 gene producing bicistronic chimeric and antisense mRNA”, Gene 342: 165-177) and human cells (Chuang et al., (2018) “Integrative transcriptome sequencing reveals extensive alternative trans-splicing and cis-back splicing in human cells”. Nucleic Acids Research, 46(7): 3671-3691), but trans-splicing appears to occur less frequently only in higher vertebrates.

[0008] Attempts have been made to utilize trans-splicing for gene therapy. Viral vectors are attractive media for gene therapy, but their limited loading capacity often restricts the genes that can be exchanged. For example, adeno-associated virus vectors have a packaging capacity of up to approximately 5.0 kb, which allows for transgenes of approximately 4 kb or less. Trans-splicing, that is, joining two physically separated pre-mRNAs to form a mature mRNA, can be one way to overcome these limitations. For example, spliceosome-mediated RNA trans-splicing (SMaRT), which involves an exogenous pre-mRNA trans-splicing molecule introduced into target cells to replace only a portion of a mutated endogenous pre-mRNA, can be used as a tool for gene therapy. This may allow for the delivery of shorter coding sequences in viral vectors.

[0009] Another way to address the size limitations of viral vectors, particularly adeno-associated virus (AAV)-based vectors, is to use recombinant AAV (rAAV) dual-vector technology. AAV is a single-stranded DNA virus. In rAAV dual-vector technology, the coding sequence of the transgene (the gene of interest) is split into at least two parts and packaged into two or more separate rAAV vectors. After simultaneous transduction of target cells by the split genome vectors, the full-length coding sequence is reconstructed. Many cells, such as retinal photoreceptor cells, exhibit high simultaneous transduction efficiencies exceeding 90%, suggesting that efficient delivery of both rAAVs to the same target cells is not limiting. However, efficient reconstruction of half of the two transgenes remains challenging. For several years after the development of rAAV dual vector systems, rearrangement was addressed only at the DNA level, and several strategies have been explored to improve this approach (McClements and MacLaren, (2017) “Adeno-associated virus (AAV) dual vector strategies for gene therapy encoding large transgenes, Yale Journal of Biology and Medicine 90: 611-623).

[0010] These rAAV dual-vector systems are often misleadingly referred to as "trans-splicing dual vectors," but mRNA splicing in these approaches does not actually occur in trans. Rather, the reconfiguration in the aforementioned rAAV dual-vector systems relies on concatemerization of the ITR structure and / or homologous recombination of overlapping sequences, generating a single pre-mRNA that is cis-spliced ​​to remove the concatemerized ITR element and / or the artificially recombinant element. Such rAAV dual-vector systems have been disclosed, for example, by Trapani et al. ("Effective delivery of large genes to the retina by dual AAV vectors", (2014) EMBO Molecular Medicine, 6(2): 194-211). Reconfiguration of rAAV dual-vector systems at the DNA level can be recognized by the presence of a promoter driving the expression of the 5' portion of the coding sequence of the first AAV vector, and the absence of a promoter driving the expression of the 3' portion of the coding sequence of the second AAV vector. The reported in vivo efficiencies of such rAAV dual-vector systems are relatively low, less than 10% (Carvalho et al., “Evaluating efficiencies of dual AAV approaches for retinal targeting”, (2017) Frontiers in Neuroscience, 11(503): 1-8). In contrast, for premRNA splicing to occur in trans configuration, both vectors in the rAAV dual-vector system require promoters to generate two separate premRNA molecules.

[0011] There is an unmet need for the identification of potent ASS regions that are optimized and experimentally validated for optimal performance in mRNA splicing, particularly mRNA transsplicing. In particular, there is a need for potent ASS regions, which can be used in the development of next-generation rAAV dual vector systems or further AAV vectors such as AAVs that deliver highly specific and efficient pre-mRNA transsplicing molecules, and can be used in gene therapy. [Overview of the project]

[0012] The present invention is suited to this need as described herein, in the examples, figures and claims.

[0013] Provided herein is a premRNA transsplicing molecule comprising: (i) an acceptor splice region comprising: (ia) a pyrimidine region comprising: (iaa) 5-25 nucleotides; (iab) where at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (ib) an acceptor splice region (i) In one embodiment, the premRNA trans-splicing molecule of claim 1 comprises: (ii) a nucleotide sequence or portion thereof of interest, wherein the receptive splice region is localized to the 3' or 5' side of the nucleotide sequence or portion thereof of interest; (iii) a donor splice site, wherein the donor splice site is localized to the 3' side of the nucleotide sequence or portion thereof of interest; (iv) a first binding domain targeting premRNA located at the 5' side of the nucleotide sequence or portion thereof of interest; (v) a second binding domain targeting premRNA located at the 3' side of the nucleotide sequence or portion thereof of interest; (vi) optionally a first spacer sequence, wherein the first spacer is localized between the first binding domain and the receptive splice region; (vii) optionally a second spacer sequence, wherein the second spacer is localized between the second binding domain and the donor splice site.

[0014] Preferably, the receptive splice region is localized to the 5' side of the target nucleotide sequence or portion thereof, and the binding domain is localized to the 5' side of the receptive splice region. The premRNA transsplicing molecule may further include a stop sequence, preferably a poly(A) sequence. Preferably, the premRNA transsplicing molecule according to the present invention includes a pyrimidine region, where 5 to 25 nucleotides of the pyrimidine region include a sequence encoded by the sequence TTTTTT or TCTTTT. Additionally or alternatively, the sequence between the last pyrimidine of the pyrimidine region and the receptive splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases. Additionally or alternatively, the receptive splice site has the sequence CAGG.

[0015] The acceptor splice region may include: (a) seven nucleotides at the 5' end of a pyrimidine region having at least four nucleotides of sequence CAACGAG, where the first 5' nucleotide is C; (b) seven nucleotides at the 5' end of a pyrimidine region having at least five nucleotides of sequence CAACGAG, where the first 5' nucleotide is C; (c) seven nucleotides at the 5' end of a pyrimidine region having at least four nucleotides of sequence CAACGAG, where the first 5' nucleotide is CAA; or (d) seven nucleotides at the 5' end of a pyrimidine region having at least five nucleotides of sequence CAACGAG, where the first 5' nucleotide is CAAC. In one embodiment, the acceptor splice region is encoded by a nucleotide sequence having sequence SEQ ID NO: 3 or 4 or a nucleotide sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to sequence SEQ ID NO: 3 or 4. A DNA molecule containing a promoter and a sequence encoding a premRNA trans-splicing molecule according to the present invention is also provided, where the DNA molecule is preferably a vector or plasmid.

[0016] Another aspect of the present invention relates to a method for producing a nucleic acid sequence, the method comprising: (A) providing a first nucleic acid sequence comprising one or more donor splice site sequences; (B) providing a second nucleic acid sequence comprising: (i) a receptive splice region comprising: (ia) a pyrimidine region comprising (iaa) 5 to 25 nucleotides; (iab) where at least 60% of the nucleotides within these 5 to 25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (ib) a receptive splice site, (iba) where the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) where the receptive splice site comprises a NAGG sequence from 5' to 3', where N is A, C, T / U, or G; (c) a step of cleaving a first nucleic acid sequence at one or more donor splice site sequences and cleaving a second nucleic acid sequence at a receptive splice site; (d) a step of ligating the first cleaved nucleic acid sequence to the second cleaved nucleic acid sequence to obtain a nucleic acid sequence. The first nucleic acid sequence further comprises the target nucleotide sequence or a portion thereof, wherein at least a portion of the target nucleotide sequence is located on the 5' side of the donor splice site, and the second nucleic acid sequence further comprises the target nucleotide sequence or a portion thereof, wherein at least a portion of the target nucleotide sequence is located on the 3' side of the acceptor splice region. Preferably, the first and second nucleic acid sequences are introduced into a host cell, and preferably the first and second nucleic acid sequences are recombinant nucleic acid sequences.

[0017] In another aspect of one embodiment of the method of the present invention, the method comprises the following steps: Step (A) Introducing a first nucleic acid sequence containing a premRNA trans-splicing molecular sequence or a nucleic acid sequence encoding the premRNA trans-splicing molecule into a host cell, wherein the first premRNA trans-splicing molecule comprises the following from 5' to 3': (a) the 5' portion of the nucleotide acid sequence of interest; (b) a donor splice site; (c) optionally a spacer sequence; (d) a first binding domain; and (e) optionally a stop sequence, preferably a poly-A sequence; Step (B) Introducing a second nucleic acid sequence containing a premRNA trans-splicing molecular sequence or a nucleic acid sequence encoding the premRNA trans-splicing molecule into a host cell, wherein the second premRNA trans-splicing molecule comprises the following from 5' to 3': (i) a second binding domain complementary to the first target domain of the first nucleic acid sequence; (ii) a receptive splice region sequence comprising the following; and (iia) a pyrimidine comprising the following (i) a region; (i) 5 to 25 nucleotides; (ii) where at least 60% of the nucleotides in these 5 to 25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (ii) a receptive splice site, (ii) where the receptive splice site is located on the 3' side of the pyrimidine region; and (iibb) where the receptive splice site comprises a NAGG sequence from 5' to 3', where N is A, C, T / U, or G; (iii) a 3' portion of the target nucleotide sequence; and (iv) a stop sequence, preferably a poly-A sequence; step (c) cleaving a first nucleic acid sequence at the donor splice site sequence and cleaving a second nucleic acid sequence at the receptive splice site; and step (D) ligating the first cleaved nucleic acid sequence containing the 5' portion of the target nucleotide sequence to the second cleaved nucleic acid sequence containing the 3' portion of the target nucleotide sequence, thereby obtaining the target nucleic acid sequence.

[0018] In yet another embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising at least two reverse terminal repeats, wherein the nucleic acid sequence comprises a nucleic acid sequence between the two reverse terminal repeats, wherein the nucleic acid sequence comprises the following from 5' to 3': (i) promoter; (ii) binding domain; (iii) optionally spacer sequence; (iv) receptor splice region sequence comprising (a) pyrimidine region comprising (aa) 5-25 nucleotides; (ab) where at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (b) a receptive splice site, where the receptive splice site is located on the 3' side of the pyrimidine region; and where the receptive splice site contains a NAGG sequence from 5' to 3', where N is A, C, T / U, or G; (v) a nucleotide sequence of choice or a portion thereof; and (vi) a poly-A sequence, optionally.An AAV vector may also be part of an AAV vector system comprising: (I) a first AAV vector comprising at least two reverse-terminal repeats comprising a nucleic acid sequence between the two reverse-terminal repeats, wherein the nucleic acid sequence between the two reverse-terminal repeats comprises (a) a promoter, (b) a nucleotide sequence encoding the N-terminal portion of the polypeptide of interest, (c) a donor splice site, (d) optionally a spacer sequence, (e) a first binding domain, and (f) optionally a stop sequence, preferably a polyA sequence; (II) a second AAV vector comprising a nucleic acid sequence comprising at least two reverse-terminal repeats comprising a nucleic acid sequence between the two reverse-terminal repeats, wherein the nucleic acid sequence between the two reverse-terminal repeats comprises (i) a promoter, (ii) a second binding domain complementary to the first binding domain of the first AAV vector, (ii) optionally a spacer sequence, and (iii) a receptive splice region sequence. (a) a pyrimidine region comprising (aa) 5 to 25 nucleotides; (ab) where at least 60% of the nucleotides within these 5 to 25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (b) a receptive splice site, where the receptive splice site is located on the 3' side of the pyrimidine region; and where the receptive splice site comprises a NAGG sequence from 5' to 3', where N is A, C, T / U, or G; (iv) a nucleotide sequence encoding the C-terminal portion of the polypeptide of interest; (iva) where the C-terminal portion and the N-terminal portion of the polypeptide of interest reconstitute the polypeptide of interest; and (v) a stop sequence, preferably a poly-A sequence. In one embodiment, the polypeptide is a full-length polypeptide, and the first AAV vector comprises the N-terminal portion of the full-length polypeptide of interest, and the second AAV vector comprises the C-terminal portion of the polypeptide of interest.

[0019] Also provided is a nucleic acid sequence comprising: (ia) a receptor splice region sequence comprising: (aa) a pyrimidine region comprising: (aa) 5 to 25 nucleotides; (ab) where at least 60% of the nucleotides within these 5 to 25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (ib) a receptor splice site, ba) where the receptor splice site is located on the 3' side of the pyrimidine region; and bb) where the receptor splice site comprises a NAGG sequence from 5' to 3', where N is A, C, T / U, or G; and (ii) a nucleotide sequence of interest, where the nucleotide sequence of interest (iia) is located on the 3' or 5' side of the receptor splice region.

[0020] In certain embodiments of the present invention, the receptive splice region described herein includes a pyrimidine region in which 5 to 25 nucleotides of the pyrimidine region include a sequence encoded by the sequence TTTTTT or TCTTTT. The sequence between the last pyrimidine of the pyrimidine region and the receptive splice site is less than 10 bases, preferably less than 5 bases, and more preferably less than 3 bases. Furthermore, the receptive splice site preferably has the sequence CAGG. The receptive splice region further includes 7 nucleotides on the 5' side of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C. In preferred embodiments, the splice receptive region is encoded by a nucleic acid sequence including or consisting of the sequence of SEQ ID NO: 3 or 4, or including or consisting of the sequence of SEQ ID NO: 3 or 4. [Brief explanation of the drawing]

[0021] [Figure 1]mRNA splicing of the RHO minigene in HEK293 cells and transduction photoreceptors. A, Schematic diagram of the RHO gene to scale. Boxes represent exons, and the thick lines between them represent introns, showing their respective start and stop codons. The asterisk represents the c.620T>G mutation in exon 3. B and C, the rhodopsin minigene, including the coding portion of the exon and adjacent introns, was driven by either the CMV promoter (B) for expression in HEK293 cells or the human rhodopsin (hRHO) promoter (C) for expression in photoreceptors. The RHO minigene was shortened to show intron 1 to allow packaging into an AAV vector. For protein visualization and detection, RHO was fused to a citrin (for B) or myc tag (for C) at the C-terminus. Primers, indicated by arrows B and C, were used for the specific detection of wild-type (WT) or mutant splicing products derived from HEK293 cells (D) or transduced photoreceptors (E). D, RT-PCR analysis from HEK293 cells transiently transfected with WT and mutant RHO minigenes. E, left, schematic diagram of subretinal RHO minigene delivery to the retina of 14-day-old (P14) mice. Right, RT-PCR from injected mouse retinas containing their respective WT or mutant RHO minigenes. RT-PCR was performed 4 weeks after injection. All experiments were repeated once. [Figure 2]The most efficient identification of the ASS_620 sequence. A. Composition of a functional single element of ASS. Branch points (BPs) are underlined to represent the consensus sequence of the human branch point, and the branch point nucleoside adenosine is highlighted in bold. Polypyrimidine regions (Poly-C / T) are represented as empty boxes, and ASSs spanning intron-exon boundaries are represented as filled gray boxes. B. Exon-intron composition of the human RHO gene and enlarged view of the DNA sequence of exon 3 of the human RHO gene for wild-type (WT, upper panel) and c.620T>G mutant (lower panel). Intron sequences are shown in lowercase, and exon sequences are shown in uppercase (bold). Single ASS elements are highlighted according to the scheme shown in A, with BP sequences underlined (bold), Poly-C / T sequences marked as empty boxes, and ASS sequences marked as filled gray boxes. The WT ATG sequence converted to the c.620T>G mutant AGG sequence is marked with a thin underline. Note that the c.620T>G mutant generates a new standard ASS sequence. The other two elements required for a functional ASS (BP and Poly-C / T) are already present in WT RHO exon 3. C, Structure of the human ribosomal protein 27 (RPS27) minigene used in splicing experiments. The primers used for RT-PCR shown in (D) are indicated by arrows. Individual sequences containing potential elements of ASS_620, called RHO_E3a-g, shown below, were inserted into exon 3 of the RPS27 gene as shown. RHO_E3a is the WT RHO sequence without a functional ASS. Potential BP, Poly-C / T, or ASS sequences are shown above. D, RT-PCR from HEK293 cells transfected with a single chimeric RPS27 minigene, as shown. CS: A correctly spliced ​​RPS27 minigene (i.e., using native exon 3 ASS). AS: A more spliced ​​RPS27 minigene (i.e., using ASS_620). [Figure 3]ASS_620 is a strong receptor splice site. A. In silico receptor splice site (ASS) strength prediction using two commonly available prediction tools: NNSplice (version 0.9; January 1997) (http: / / www.fruitfly.org / seq_tools / splice.html) or human splicing finder (version 3.1) (HSF, http: / / www.umd.be / HSF3 / ). B. Construction and sequence of a single element of a 26 bp sequence called vgASS_620, which includes ASS, PolyC / T, and seven additional nucleotides at 5' of PolyC / T. C. Schematic diagrams of various minigenes used to determine the strength of vgASS_620. The location of the vgASS_620 insertion within a single minigene is indicated by an asterisk and a dashed line. D. Arrows indicate the binding sites of the primers used in the RT-PCR shown. RT-PCR from HEK293 cells transfected with either the native (nat) receptor splice site only or both the native receptor splice site and vgASS_620(620) minigenes. All bands were confirmed by sequencing. [Figure 4]Cerulean reconstitution assay testing various binding domains. A, Schematic diagram of the RHO intron 2 sequence used as a binding domain for cerulean reconstitution by mRNA transsplicing. The entire RHO intron 2 sequence (a) and different 5' (b, d, f, h) and 3' (c, e, g, i) portions, or a small 5' portion fused to a small 3' portion (h+i) of intron 2 were tested, and the results shown in B-G were obtained. B and C, control qRT-PCR (n=3) from transfected HEK293 cells to compare mRNA levels of single constructs containing different binding domains shown in A. Housekeeper aminolevulinic acid synthase (ALAS) related delta-CT (ΔCT) values ​​are shown. Primer binding sites (p1+p2 in B and p3+p4 in C) are shown in D. Statistical analysis (n=3 for each transfection) was performed by one-way ANOVA followed by Tukey's test for multiple comparisons. Principle of the cerulean reconstitution assay using examples of D,h+i binding domains, donor splice sites (DSS), and acceptor splice sites ASS_620. The cerulean was split at nucleotide position 154 downstream of the start codon of the full-length cerulean sequence (c1), as shown by the dashed line. In the control construct (c2), an artificial intron was introduced at the indicated position 154 of the cerulean coding sequence to create two artificial cerulean exons. The antibody (α-cerNT) used for Western blotting binds to the N-terminal half of the cerulean. The control construct (c2) served as a reference for quantification in confocal imaging and Western blotting experiments. Various sequences shown in (A) were tested as binding domains using a dual-vector approach. The dual-vector approach scheme for cerulean reconstruction is illustrated with the use of the h+i binding domain combined with either vgASS_620(c3) or the native RHO exon 3 (RHO_E3) receptor splice site (c4). The cerulean reconstruction efficiency (CRE) for the different binding domains was calculated from the Western blot band intensities obtained from three independent transfections.For quantification, band intensity was first normalized against the internal tubulin control. Normalized values ​​are given as a percentage of the reference construct intensity (c2). F, Representative confocal imaging of living HEK293 cells transfected with c1, c2, c3, or c4 constructs driven by the CMV promoter. Cerulean-specific laser and filter settings were used for imaging. Scale bar, 50 μm. G, Representative Western blot from protein lysates of transfected HEK293 cells (φ, untransfected cells; IB, immunoblotting; α-Tub, beta-tubulin-specific antibody). [Figure 5] Sequence of the first dual AAV containing the 5' coding sequence of ABCA4 (SEQ ID NO: 19): The 5' and 3' terminal ITR sequences are highlighted in gray without an underline (NNN). Spacer sequences are shown in lowercase. The CMV promoter is highlighted in gray and underlined with a solid line (NNN). The 5' coding sequence of the ABCA4 protein is underlined with a dotted line (NNN). DSS is shown in italics and underlined (Nnn, uppercase letters represent coding sequences, lowercase letters represent non-coding sequences). The binding domain is highlighted in gray and underlined with a broken line (NNN). [Figure 6] The sequence of the second dual AAV containing the 3' coding sequence of ABCA4 (SEQ ID NO: 20): The 5' and 3' terminal ITR sequences are highlighted in gray without an underline (NNN). The spacer sequence is shown in lowercase. The CMV promoter is highlighted in gray and underlined with a solid line (NNN). The binding domain is highlighted in gray and underlined with a broken line (NNN). The receptor splice site is shown in italics and underlined (NNN). The 3' coding sequence of the ABCA4 protein is underlined with a dotted line (NNN). The poly(A) sequence is highlighted in dark gray and underlined with a wave (NNN). [Figure 7]Sequence of the first dual AAV (SEQ ID NO: 21) including the 5' coding sequence of ABCA4 and the ABCA4 promoter: The 5' and 3' terminal ITR sequences are highlighted in gray without underlining (NNN). Spacer sequences are shown in lowercase. The ABCA4 promoter is highlighted in gray and underlined with a solid line (NNN). The 5' coding sequence of the ABCA4 protein is underlined with a dotted line (NNN). DSS is shown in italics and underlined (Nnn, uppercase letters represent coding sequences, lowercase letters represent non-coding sequences). Binding domains are underlined with a break line (NNN). [Figure 8] Sequence of the second dual AAV (SEQ ID NO: 22) including the 3' coding sequence of ABCA4 and the ABCA4 promoter: The 5' and 3' terminal ITR sequences are highlighted in gray without underlining (NNN). Spacer sequences are shown in lowercase. The ABCA4 promoter is highlighted in gray and underlined with a solid line (NNN). The binding domain is underlined with a break line (NNN). ASS is shown in italics and underlined (NNN). The 3' coding sequence of the ABCA4 protein is highlighted in gray and underlined with a dotted line (NNN). The poly(A) sequence is highlighted in dark gray and underlined with a wave (NNN). [Figure 9]Effect of acceptor splicing sites and binding domains on cerulean reconstruction efficiency. A, In this experiment, binding domains (BDs) and acceptor splicing sites (ASSs) were tested. All BD sequences are derived from the human RHO gene. BDs and ASSs expected to have high efficiency are shown in bold and italics. B, Confocal live images of HEK293 cells transfected with constructs containing different combinations of the three BDs and the three ASSs shown in A. The intensities of each BD and ASS are shown. Scale bar, 50 μm. C, Upper panel, RT-PCR of different combinations of BDs and ASSs. Lower panel, Western blot of different combinations of BDs and ASSs. GAPDH and beta-tubulin served as loading references. D, Quantification of reconstruction efficiency by radioanalysis of cerulean protein bands relative to cis-ctrl (n = 3 - 8). All protein bands were normalized to beta-tubulin prior to quantification. [Figure 10] In vivo mRNA trans-splicing rAAV dual-vector approach. A, 5' vector construct and 3' vector construct used for in vivo expression. As expression references, the citrine and mCherry sequences were fused to the 5' of the cerulean 5' coding sequence (CDS) and the 3' of the cerulean 3' CDS, respectively. B, Representative confocal images of retinal sections 2 weeks after injection expressing the construct containing BD_h+i. Fluorophore expression is present in the retinal pigment epithelium (RPE). ONL, outer nuclear layer. Scale bar, 20 μm. C, Confocal images of retinal pigment epithelial cells before (upper panel) and after (lower panel) selective photobleaching of citrine and mCherry fluorophores using a 514 nm laser. Scale bar, 2 μm. [Figure 11]Identification of a suitable BD derived from the lacZ gene. A, A binding domain (BD) obtained from the bacterial lacZ gene and modified to have no detectable homology to the human genome. B, Confocal live images of HEK293 cells transiently co-transfected with the construct containing the BD shown in A. Scale bar, 50 μm. C, Western blot from the lysates of transfected HEK293 cells. D, Quantification of the CelLIA reconstruction efficiency based on the densitometric analysis of the Western blot band intensities (n = 3 - 8). BD_g efficiency served as the measure of the highest reconstruction obtained so far (see Fig. 9). [Figure 12] Removal of regulatory elements and their impact on mRNA splicing efficiency. A, Confocal live images of HEK293 cells transiently co-transfected with the CelLIA construct containing BD_k.5’polyAdel, a 5’ vector without a polyA signal, and 3’promdel, a 3’ vector without a promoter sequence, as shown. Scale bar, 50 μm. B, Western blot from the transfected HEK293 cells shown in A. Beta-tubulin served as a loading reference. [Figure 13] Reconstitution of SpCas9-VPR. A, Plasmids (5’ and 3’ vectors) used for mRNA trans-splicing of SpCas9-VPR in HEK293 cells. As a positive control, a plasmid containing the full-length (FL) SpCas9-VPR CDS (FL vector) was used. Primer pairs spanning the junction were used for RT-PCR (black arrows). B, RT-PCR from HEK293 cells co-transfected with 5’ and 3’ vectors containing BD_k (n = 3) or the FL vector (n = 3). C, Representative sequencing results of the reconstituted SpCas9-VPR product. D, Western blot of protein lysates from each transfection. φ, untransfected cells. Beta-tubulin served as a loading control. [Figure 14]Reconstruction of ABCA4. A. Plasmids (5' and 3' vectors) used for mRNA transsplicing of ABCA4 in HEK293 cells. In addition, six short introns from six different genes were incorporated into the CDS of ABCA4. Specifically, three were incorporated into the 5' CDS (5' vector with introns, 5'wi) and three into the 3' CDS (3' vector with introns, 3'wi). Primer pairs spanning the connection were used for RT-PCR (black arrows). myc, myc tag. B. RT-PCR performed at various cycle counts from HEK293 cells co-transfected with each construct, as shown. GAPDH served as a loading control. φ, untransfected cells. C. Representative sequencing results of the reconstructed ABCA4. [Figure 15] In vivo rAAV dual-vector mRNA transsplicing of ABCA4. A, 5' and 3' vector constructs containing BD_k used for in vivo expression. hRho, human rhodopsin promoter. B, RT-PCR was performed from retinal lysates of C54Bl / 6J wild-type mice with different cycle counts, and co-transduced in each construct as shown. Uninjected wild-type (WT) mice were used as negative controls. NN / GL, capsid variant of AAV2. -RT, negative control without reverse transcriptase. GAPDH was used as a loading control. C, representative sequencing results of reconstituted ABCA4. D, preliminary results of qRT-PCR performed from the same retina shown in B. ABCA4 expression obtained at co-transduced was normalized to non-injected WT retina. E, Western blots from retinal lysates of the same mice shown in B-D. Human ABCA4 protein was detected with anti-myc antibody and indicated by arrows. Beta-tubulin was used as a loading control. [Figure 16]Sequence number 35 of the minigene encoding the 5' coding sequence of cerulean and the binding domain BD_g. The CMV promoter is highlighted in gray. The 5' coding sequence of the cerulean protein (bold) is highlighted in gray and underlined with a thick solid line (NNN). The DSS is underlined with a wavy line (NNN). The binding domain is marked in italics and underlined with a dotted line (NNN), and the polyadenylation signal is underlined with a double line (NNN). [Figure 17] Sequence number 36 of the minigene encoding the 3' coding sequence of cerulean and the binding domain BD_g. The CMV promoter is highlighted in gray. The binding domain is marked in italics and underlined with a dotted line (NNN). The ASS is underlined with a wavy line and bold (NNN). The 3' coding sequence of the cerulean protein is highlighted in gray and underlined with a thick solid line (NNN), and the polyadenylation signal is underlined with a double line (NNN). [Figure 18] Sequence ID 37 of the minigene encoding the 5' coding sequence of SpCas9-VPR and the binding domain BD_k. The CMV promoter is highlighted in gray. The 5' coding sequence of the SpCas9-VPR protein is highlighted in bold and underlined with a thick solid line (NNN). The DSS is underlined with a wavy line (NNN). The binding domain is marked in italics and underlined with a dotted line (NNN), and the polyadenylation signal is underlined with a double line (NNN). [Figure 19]Sequence ID 38 shows the 3' coding sequence of SpCas9-VPR and the sequence of the minigene encoding the binding domain BD_k. The CMV promoter is highlighted in gray. The binding domain (NNN) is marked in italics and underlined with a dotted line. The ASS is underlined with a wavy and bold line (NNN). The 3' coding sequence of the SpCas9-VPR protein is highlighted in gray and underlined with a thick solid line (NNN), and the polyadenylation signal is underlined with a double line (NNN). [Figure 20] Sequence of the first dual AAV containing the 5' coding sequence of ABCA4 including introns (SEQ ID NO: 39): The ITR sequences at the 5' and 3' ends are highlighted in gray without underlining (NNN). Spacer sequences are shown in lowercase. The CMV promoter is highlighted in gray and underlined with a solid line (NNN). The 5' coding sequence of the ABCA4 protein is underlined with a dotted line interrupted by introns indicated by wavy underlines (NNNNNNNNN). The DSS is shown in italics and underlined (Nnn, uppercase letters represent coding sequences, lowercase letters represent non-coding sequences). The binding domain is highlighted in gray and underlined with a broken line (NNN). The poly-A sequence is highlighted in dark gray and underlined with a wavy line (NNN). [Figure 21] Sequence of the second dual AAV containing the 3' coding sequence of ABCA4 (SEQ ID NO: 40): The 5' and 3' terminal ITR sequences are highlighted in gray without underlining (NNN). Spacer sequences are shown in lowercase. The CMV promoter is highlighted in gray and underlined with a solid line (NNN). The binding domain is highlighted in gray and underlined with a broken line (NNN). The receptor splice site is shown in italics and underlined (NNN). The 3' coding sequence of the ABCA4 protein is underlined with a dotted line interrupted by an intron indicated by a wavy underline (NNNNNNNNN). The poly(A) sequence is highlighted in dark gray and underlined with a wavy underline (NNN). [Modes for carrying out the invention]

[0022] Detailed description of the invention The inventors have discovered a novel receptive splice region, as described in the examples. This receptive splice region is highly efficient and can be used in a variety of applications where splicing is utilized. Therefore, the receptive splice region of the present invention can be used, among other things, for reconstitution of split AAV vectors, trans-splicing using premRNA trans-splicing molecules, cis-splicing, and SMaRT technology (splicosome-mediated RNA trans-splicing) for AAV vector systems including two AAV vectors and / or trap vectors. However, the receptive splice region described herein can also be used for further applications where splicing is the objective.

[0023] The present invention (i) Receptive splice regions including the following, (ia) The pyrimidine region including the following, (aa) 5-25 nucleotides; (ab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and bb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence; where the target nucleotide sequence is (iia) Localized to the 3' or 5' side of the receptive splice region, preferably on the 3' side of the receptive splice region; With respect to nucleic acid sequences including the above, the nucleic acid sequence according to the present invention is preferably cleaved at the acceptor splice region, thereby separating the target nucleotide sequence from the acceptor splice region sequence. The present invention further relates to the use of the above nucleic acid sequence for cleaving the receptive splice region and thereby separating the desired nucleotide sequence from the receptive splice region sequence.

[0024] The terms “nucleic acid molecule,” “nucleic acid sequence,” or “nucleotide sequence” are used herein as synonyms and encompass any nucleic acid molecule having a nucleotide sequence containing purine and pyrimidine bases contained in the above nucleic acid molecule / sequence, thereby representing the primary structure of the nucleic acid molecule. A nucleic acid sequence may include DNA, cDNA, genomic DNA, RNA, sense strands, and antisense strands. RNA may be, for example, pre-mRNA, mRNA, tRNA, or rRNA. The polynucleotides of the present invention can consist of any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA, or modified RNA or DNA. Those skilled in the art will understand that thymine (T) in polydeoxyribonucleotides is transcribed to uracil (U) in polyribonucleotides. Sequences referred to herein are typically provided as DNA sequences that can be transcribed to the corresponding RNA sequence (before the splicing event). Thus, a nucleic acid sequence containing T also discloses a corresponding (transcribed) RNA sequence, preferably a pre-mRNA sequence containing U.

[0025] DNA and RNA can be modified in various ways. Therefore, the terms “nucleic acid molecule” or “nucleotide” may include chemically, enzymatically, or metabolically modified forms. Modified bases / nucleotides include, for example, unusual bases such as tritylated bases and inosine.

[0026] The receptive splice region sequence of the present invention comprises two features: a receptive splice site and a pyrimidine region. The pyrimidine region comprises 5 to 25 nucleotides, and at least 60% of these (total) 5 to 25 nucleotides are pyrimidine bases such as cytosine (C), thymine (T), and / or uracil (U). It is also conceivable that the pyrimidine region comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, preferably 10 to 18 nucleotides, more preferably 12 to 16 nucleotides. Additionally or alternatively, at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% of these (total) 5–25 nucleotides are pyrimidine bases such as cytosine (C), thymine (T), and / or uracil (U). For example, the pyrimidine region may contain 6 nucleotides. The pyrimidine region is further assumed to contain or consist of the sequence TTTTTT. The pyrimidine region is further intended to contain or consist of the sequence TCTTTT. The pyrimidine region is further intended to contain or consist of the sequence TTTTTTGTCATTT (SEQ ID NO: 11). The pyrimidine region is further intended to contain or consist of the sequence TCTTTTGTCATCTA (SEQ ID NO: 12). Furthermore, it is intended that the pyrimidine region is preceded by seven nucleotides containing or consisting of the sequence CAACGAGTCTTTTGTCATCTA (SEQ ID NO: 13). The pyrimidine region may also contain or consist of the sequence TCTTTTGTCATCT (SEQ ID NO: 1). It is also intended that the pyrimidine region described herein be at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the sequence SEQ ID NO: 1, 11, 12, or 13, or the sequence TTTTTT, or TCTTTT. In one embodiment, 5 to 25 nucleotides of the pyrimidine region contain the sequence TTTTTT, or TCTTTT.Preferably, the sequence between the last pyrimidine of the pyrimidine region and the acceptor splice site is less than 10 bases, preferably less than 5 bases, and more preferably less than 3 bases. The term “pyrimidine region” is used herein interchangeably with “polypyrimidine region” and is abbreviated as PPT or PolyC / T. “Last pyrimidine of the pyrimidine region” refers to the 3'-most pyrimidine between nucleotides 5 and 25 of the pyrimidine region.

[0027] According to the present invention, the terms “identical” or “percent identity” in the context of two or more nucleic acid molecules refer to two or more sequences or subsequences that are identical or have a specific percentage of identical nucleotides (e.g., at least 95%, 96%, 97%, 98%, or 99% identity) when compared and aligned to obtain the maximum correspondence over the entire comparison window, or over a specified region measured using a sequence comparison algorithm known in the art, or over a specified region measured by manual alignment and visual inspection. For example, sequences with 80% to 95% or more sequence identity are considered substantially identical. Such definitions also apply to the complement of a test sequence. Those skilled in the art will know how to determine between / among sequences percent identity using methods such as the CLUSTALW computer program (Thompson Nucl. Acids Res. 2 (1994), 4673-4680) or algorithms based on FASTDB (Brutlag Comp. App. Biosci. 6 (1990), 237-245), as is known in the art.

[0028] The BLAST and BLAST2.0 algorithms (Altschul Nucl. Acids Res. 25 (1977), 3389-3402) are also available to those skilled in the art. The BLASTN program for nucleic acid sequences uses, by default, a word size (W) of 28, an expected threshold (E) of 10, a match / mismatch score of 1, -2, a linear gap cost, and comparison of both strands. For amino acid sequences, the BLASTP program uses, by default, a word size (W) of 6, an expected threshold (E) of 10, and gap costs of Existence: 11 and Extension: 1. Furthermore, the BLOSUM62 scoring matrix can also be used (Henikoff Proc. Natl. Acad. Sci., USA, 89, (1989), 10915).

[0029] For example, BLAST2.0 is an abbreviation for Basic Local Alignment Search Tool (Altschul, Nucl. Acids Res. 25 (1997), 3389-3402; Altschul, J. Mol. Evol. 36 (1993), 290-300; Altschul, J. Mol. Biol. 215 (1990), 403-410), and can be used to search for local sequence alignments.

[0030] As outlined herein, in addition to the pyrimidine region, the receptive splice region sequence of the present invention includes a receptive splice site. The term “receptive splice site” as used herein is known to those skilled in the art and has the meaning described, in particular, under the heading “DNA to RNA” in Alberts B, Johnson A, Lewis J, et al. (2002) “Molecular Biology of the Cell. 4th edition.” New York: Garland Science. The receptive splice site of the present invention comprises or consists of the nucleotide NAGG, preferably CAGG or CAGGT (or CAGG or CAGGU in RNA). The receptive splice site is typically located within a sequence defined as a “receptive splice region.” The term “receptive splice site” (abbreviated as ASS) as used herein refers to a consensus receptive splice sequence, also abbreviated as “splice receptor site” (SAS). In the context of this invention, the terms “receptive splice region” and “receptive splice site” are used as distinct terms to distinguish this region from the consensus receptive splice site, and the receptive splice region includes the receptive splice site. In the literature, the receptive splice region and receptive splice site are sometimes referred to as ASS or SAS.

[0031] The receptive splice site is so called because it is at this site that nucleic acids are cleaved by a so-called spliceosome or an artificial variant thereof. Spliceosomes and how they function are known to those skilled in the art. The structure of a human spliceosome is described, for example, in Zhang et al. (2017) “An atomic structure of the human spliceosome” Cell 169, 918-926. An artificial spliceosome contains, for example, an enzyme that mediates the same cleavage at the splice site as a spliceosome. As described in Coppins and Silvermann (2005) “Mimicking the First Step of RNA Splicing: An Artificial DNA Enzyme Can Synthesize Branched RNA Using an Oligonucleotide Leaving Group as a 5'-Exon Analogue” Biochemistry, 44 (41), pp 13439-13446 and Muller (2017) “Design and Experimental Evolution of trans-Splicing Group I Intron Ribozymes.” Molecules. 22(1). pii: E75. doi: 10.3390 / molecules22010075, the artificial spliceosome may contain a DNA enzyme. The receptive splice site described herein has a NAGG sequence, where N may be any nucleotide. For example, N is a nucleotide selected from A, C, T, G, or U. The receptive splice site described herein may have a CAGG sequence. The receptive splice sites described herein may also have the sequence CAGGT (or CAGGU in the case of RNA).

[0032] The cleavage at the acceptor splice site of the present invention results in two fragments containing NAG from the NAGG and / or NAGGT splice site, or CAG from the CAGG and / or CAGGT splice site; the last G from the NAGG or CAGG splice site, or the last GT from the NAGGT or CAGGT splice site. Thus, in the uses, nucleic acid sequences, AAV vectors, AAV vector systems, and methods described herein, it is assumed that the (target) nucleotide sequence finally obtained (after cleavage / splicing) will contain the last G from the NAGG or CAGG sequence, or the GT from the NAGGT or CAGGT sequence. Those skilled in the art will understand that the splicing referred to herein occurs at the RNA level, and therefore the (target) RNA nucleotide sequence finally obtained (after cleavage / splicing) will contain the last G from the NAGG or CAGG sequence, or the GU from the CAGGU sequence of the premRNA nucleotide sequence. However, in this method and use, the (target) final nucleic acid sequence is also intended to include NAG of the NAGG splice site sequence and / or CAG of the CAGG or CAGGT splice site sequence. Therefore, cleavage at the acceptor splice site is intended to include cleavage between G and G of the acceptor splice site sequences of NAGG, CAGG, and / or CAGGT (or CAGGU), thereby separating the (target) nucleotide sequence from the intron acceptor splice region sequence.

[0033] The receptive splice region of the present invention can be used, in particular, for applications involving not only trans-splicing but also cis-splicing or other splicing. For example, the occurrence of splicing can be measured as described in Berger et al. (2016) “mRNA trans-splicing in gene therapy for genetic diseases” WIREs RNA 7: 487-498. For example, the spliced ​​nucleotide sequence can be quantified by endpoint quantitative RT-PCR using specific primers and probes to identify the desired spliced ​​product. Further measurement of splicing can be carried out as described in the examples herein. For example, splicing can be measured using a marker gene described in Orengo et al. (2006) “A bichromatic fluorescent reporter for cell-based screens of alternative splicing.” Nucleic Acids Research 34(22):e148. Further splicing can be detected using restriction enzyme analysis, as described in Berger et al., (2016) “Repair of rhodopsin mRNA by spliceosome-mediated RNA trans-splicing: a new approach for autosomal dominant retinitis pigmentosa.”, Mol Ther.; 23(5):918-930.

[0034] When present in premRNA, the acceptor splice site typically corresponds to the 3' end of an intron and the 5' end of the following exon. When an acceptor splice site, preferably an acceptor splice region, is artificially introduced, it is not necessarily required that the acceptor splice site be located at an intron-exon boundary; it may be located within an open reading frame, within an intron, or at the 5' end of a complete or partial open reading frame. It is also conceivable that the acceptor splice site may be located at the 5' end of an intron. Furthermore, it is conceivable that the acceptor splice site may be located not in a premRNA molecule, but within an artificial molecule such as any nucleic acid molecule.

[0035] The receptive splice site of the present invention is included in the receptive splice region. In particular, the receptive splice site of the present invention is located on the 3' side of the pyrimidine region.

[0036] The receptive splice region (or receptive splice site module) may further include branch points and / or branch point sequences. In principle, the present invention assumes any suitable branch point or branch point sequence. Exemplary branch points or branch point sequences are described, among others, in Gao et al. (2008) “Human branch point consensus sequence is yUnAy” Nucleic Acid Research, vol. 36, no.7, pp.2257-2267; Mercer et al. (2016) “Genome-wide discovery of human splicing branch points” Genome Research 25: 290-303.

[0037] For example, the branching point array is the array UACUA A It may contain or consist of C. Additionally or alternatively, the branching sequence is the sequence YNYUR where Y is U or C and R is A or G. AY may be included or consist of Y. Additionally or alternatively, the branching sequence is the sequence YNCUR where Y is U or C and R is A or G. A Y may be included or consist of Y. Additionally or alternatively, the branching sequence is the sequence CUR where Y is U or C and R is A or G. A Y may be included or consist of Y. Additionally or alternatively, the branching sequence is the YUV sequence where Y is U or C, R is A or G, and V is A, C, or G. A Y may be included or consist of Y. Additionally or alternatively, the branching sequence is the sequence CUS where Y is U or C and S is G or C. A Y may be included or consist of Y. Additionally or alternatively, the branching sequence is sequence CUG A It may contain or consist of C. Additionally or alternatively, the branching sequence is sequence CUA A It may contain or consist of C. The branch point is C / UUN- A -C / U, CAACGA, or CUC A A or GUC A It may exist within the branching sequence of A (where the branching sequence is C / TTN- A -C / T, CAACGA, or CTC A A or GTC A Each DNA sequence in A is encoded by the underlined adenosine in each sequence, which represents a branching nucleotide.

[0038] The acceptor splice region of the present invention may further include a branching nucleotide sequence (c), the branching nucleotide sequence being (ca) Contains 1 to 15 nucleotides; (cb) comprising a branching nucleotide, preferably adenosine (A); and (cc) Located 5' to the pyrimidine region and the receptor splice site.

[0039] It is also intended that the branching sequence may contain approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more nucleotides. It is further intended that the branching sequence may contain 6 to 8 nucleotides. It is also conceivable that the branching sequence may contain 8 nucleotides. However, in particular, the nucleotides of the branching sequence can exist consecutively, and therefore may contain more than 15 nucleotides in total, for example, 30 (15+15), 40, 50, 100, 200 or more nucleotides in total.

[0040] The branching nucleotide may be any nucleotide. Therefore, the branching nucleotide may be any of A (adenosine), T (thymine), G (guanine), C (cytosine), and U (uracil). Preferably, the branching nucleotide is A (adenosine). The branching nucleotide is located within the branching sequence.

[0041] The receptive splice region may, additionally or alternatively, include an intronic splice enhancer. Such splice enhancers are known to those skilled in the art, and are described, in particular, in Wang et al. (2012) “Intronic splicing enhancers, cognate splicing factors and context-dependent regulation rules” Nature Structural & Molecular Biology, vol. 19, no. 10, pp. 1044-1053. Two examples are the splice enhancer sequences “AACG” (group F) and “CGAG” (group D). However, this term includes any suitable intronic splice region.

[0042] An exemplary intron splice enhancer has the sequence TGGGGGGAGG (SEQ ID NO: 2). Another exemplary intron splice enhancer has the sequence GTAACGGC. It is further intended that the intron splice enhancer has the sequence AACG. It is also intended that the acceptor splice region described herein has a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the sequence SEQ ID NO: 2, GTAACGGC, or AACG.

[0043] The acceptor splice region of the present invention preferably further comprises about 7 nucleotides (e.g., 5 to 12 nucleotides, preferably 6 to 10 nucleotides, more preferably 6 to 8 nucleotides) on the 5' side of the polypyrimidine region. In a preferred embodiment, the acceptor splice region comprises: (a) 7 nucleotides on the 5' side of a pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (b) 7 nucleotides on the 5' side of a pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (c) 7 nucleotides on the 5' side of a pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (d) 7 nucleotides on the 5' side of a pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (e) 7 nucleotides on the 5' side of a pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where (f) the first 5' nucleotide is CAAC; (g) the 5' side of a pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (h) the 5' side of a pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (i) the 5' side of a pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; or (j) further including the 5' side of a pyrimidine region having the sequence CAACGAG. Although not bound by theory, this sequence may function as a splice enhancer.

[0044] The receptive splice region is further assumed to contain 1, 2, 3, 4, 5, or more different / identical branching point sequences. The receptive splice region is further assumed to contain 1, 2, 3, 4, 5, or more different or identical intron splice enhancers (sequences).

[0045] A pyrimidine region, a receptive splice site, and optionally further branching sequences and / or intron splice enhancers are assumed, and therefore the entire receptive splice region contains a total of approximately 1000, 500, 250, 100, 50, 45, 40, 35, 30, 25, 20, 15 or fewer nucleotides, preferably 26 nucleotides.

[0046] In some embodiments, the branching sequence or branching nucleotide used by a particular receptive splice site may be flexible. This means that various branching points can be used, such as 3 or more, 5 or more, 7 or more, 9 or more, or 11 or more. In one embodiment, the usage frequency of each branching point is less than 30% or less than 20%. When the selection of branching sequence or branching nucleotide used by a particular receptive splice site is flexible, the strength of the receptive splice region is not dependent from the presence of the specific branching sequence or branching nucleotide it contains. The flexibility in using any branching sequence or branching nucleotide makes the receptive splice region highly efficient and versatile, and may be particularly suitable for use with a variety of nucleic acid sequences to induce efficient splicing in a sequence-independent manner.

[0047] The receptive splice regions described herein, present in nucleic acids, premRNA trans-splicing molecules, AVV vectors, AVV vector systems, and those used in the methods according to the present invention, further include nucleotides at the 5' end of the polypyrimidine region, in addition to the receptive splice site and the polypyrimidine region. In preferred embodiments, the receptive splice region includes about 7 nucleotides (e.g., 5 to 12 nucleotides, preferably 6 to 10 nucleotides, more preferably 6 to 8 nucleotides) at the 5' end of the polypyrimidine region. In particularly preferred embodiments, the receptive splice region includes the sequence CAACGAG at the 5' end of the polypyrimidine region. The receptive splice region containing the receptive splice site, the polypyrimidine region, and the nucleotides at the 5' end of the further polypyrimidine region, preferably an additional 7 nucleotides at the 5' end of the polypyrimidine region, function as a minimal receptive splice region and can be inserted into any nucleic acid sequence to introduce a very potent functional receptive splice region.

[0048] The receptive splice region of the present invention is further intended to include or consist of the sequence CAACGAGTCTTTTGTCATCTACAGGT (SEQ ID NO: 3). The receptive splice region of the present invention is further intended to include or consist of the sequence CAACGAGTTTTTTGTCATCTACAGGT (SEQ ID NO: 4). The receptive splice region of the present invention is also intended to include or consist of any of the sequences CTACACGCTCAAGCCGGAGGTCAACAACGAGTCTTTTGTCATCTACAGGT (SEQ ID NO: 5), GCCGGAGGTCAACAACGAGTCTTTTGTCATCTACAGGT (SEQ ID NO: 6), GTCTTTTGTCATCTACAGGT (SEQ ID NO: 7), GTCTTTTGTCATCTACAGGTGTTCGTG (SEQ ID NO: 26), or GTCTTTTGTCATCTACAGGTGTTCGTGGTTCGTGGTCCA (SEQ ID NO: 8). Preferably, the acceptive splice region of the present invention comprises or consists of the sequence CAACGAGTCTTTTGTCATCTACAGGT (SEQ ID NO: 3) or CAACGAGTTTTTTGTCATCTACAGGT (SEQ ID NO: 4) (or is encoded by a nucleic acid sequence comprising or consisting of the sequence SEQ ID NO: 3 or SEQ ID NO: 4).

[0049] The acceptor splice regions described herein are also intended to have a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to any one of sequence numbers 3, 4, 5, 6, 7, 26, or 8. Preferably, the acceptor splice region includes a nucleotide sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to any one of sequence numbers 3, 4, 5, 6, 7, 26, or 8. More preferably, the acceptor splice region includes a nucleotide sequence that is at least 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to any sequence number 3 or 4. More preferably, the acceptive splice region comprises a nucleotide sequence that is at least 90%, 95%, 97%, 98%, 99%, or 100% identical to any sequence of SEQ ID NO: 3 or 4.

[0050] The nucleic acid sequence according to the present invention may further include a target nucleotide sequence in addition to the acceptor splice site. The target nucleotide sequence may be any suitable nucleotide sequence. The terms “target nucleotide sequence” and “target nucleic acid sequence” are used interchangeably herein. Typically, this term is referred to as the “target nucleotide sequence” to better distinguish it from the nucleic acid sequence or nucleic acid molecule according to the present invention. For example, the target nucleotide sequence may be an intron or exon nucleotide sequence, or may include both intron and exon (i.e., non-coding and coding) sequences. The target nucleotide sequence is further intended to be cDNA, mRNA, rRNA, or tRNA. The target nucleotide sequence or a portion thereof may be located at 3' or 5', preferably 3', of the acceptor splice region. In certain embodiments, the target nucleotide sequence or a portion thereof, contained in any of the nucleic acid sequence, premRNA trans-splicing molecule, AAV vector, AAV vector system, or used in any of the methods according to the present invention, may be a transgene or a portion thereof. Splicing efficiency, particularly trans-splicing efficiency, has been found to be improved by the presence of introns in the target nucleotide sequence or a portion thereof. Introducing or retaining introns in the sequence may be advantageous, especially when the target nucleotide sequence or a portion thereof exceeds 1000 bp. Preferably, introns are present approximately every 200–1000 bp in the target nucleotide sequence or a portion thereof, although they may occur at lower or higher sequence intervals. Introns may originate from the target nucleotide sequence and / or from nucleotide sequences of different genes and / or from artificial nucleotide sequences.

[0051] The nucleotide sequence of interest (also called the nucleic acid sequence of interest) used herein may be a coding sequence, for example, a sequence that codes for the polypeptide of interest, or a portion thereof. In preferred embodiments, the nucleotide sequence of interest is a coding sequence, more preferably a transgene, a sequence that codes for the polypeptide of interest, or a portion thereof.

[0052] The present invention further envisions that the target nucleotide sequence encodes a therapeutic polypeptide, a therapeutic nucleic acid (e.g., therapeutic RNA), or a portion thereof.

[0053] Therapeutic nucleic acids or therapeutic polypeptides are used to treat eye diseases such as autosomal recessive severe early-onset retinal degeneration (Leber congenital amaurosis), congenital color blindness, Stargardt disease, Best's disease (vitiligo macular degeneration), and Doyne's disease. Retinitis pigmentosa (especially autosomal dominant, autosomal recessive, X-linked, bigenic, or polygenic retinitis pigmentosa), (X-linked) retinal schizophrenia, macular degeneration (AMD), age-related macular degeneration, atrophic age-related macular degeneration, neovascular AMD, diabetic maculopathy, proliferative diabetic retinopathy (PDR), cystic macular edema, central serous retinopathy, retinal detachment, endophthalmitis, glaucoma, posterior uveitis, congenital stasis nyctinitis, total choroidal atrophy, early-onset retinal dystrophy, cone dystrophy, rod-cone dystrophy or cone-rod dystrophy, pattern dystrophies, Usher syndrome and other symptomatic ciliary disorders. It can be used to treat ciliopathies, such as Valde-Vidl syndrome, Joubert syndrome, Senior-Loken syndrome, or Alstrom syndrome.

[0054] Nucleic acids, therapeutic nucleic acids, therapeutic proteins / polypeptides, or therapeutic molecules can be used to treat disorders affecting photoreceptor cells such as rods and / or cones (photoreceptor diseases). Non-limited examples of photoreceptor diseases include color blindness, age-related macular degeneration, retinal degeneration, retinal dystrophy, retinitis pigmentosa, cone dystrophy, rod-cone dystrophy, color blindness, macular degeneration, night blindness, retinoschiosis, total choroidal atrophy, diabetic retinopathy, hereditary optic neuropathy, type I optic neuropathy, retinal retinitis (RPA), progressive retinal atrophy (PRA), retinal fossa (FA), or congenital stasis nyctinus (CSNB).

[0055] Therapeutic nucleic acids or therapeutic polypeptides can be used to treat hereditary retinal diseases (IRDs). IRDs are a group of disorders that are heterogeneous both genetically and phenotypically. IRDs are the leading cause of blindness in people aged 15 to 45 years, with an estimated prevalence of 1 in 1,500 to 1 in 3,000. IRDs can be classified according to the type of retinal cells affected, namely rod or cone photoreceptors, and the state of the disease. Non-exclusive examples of IRD include color blindness, age-related macular degeneration, retinal degeneration, retinal dystrophy, retinitis pigmentosa, cone dystrophy, rod-cone dystrophy, color blindness, macular degeneration, retinoschiosis, total choroidal atrophy, diabetic retinopathy, hereditary optic neuropathy, type I optic neuropathy, retinitis pisciata (RPA), progressive retinal atrophy (PRA), follicular retina (FA), or congenital cystic necrotizing nyctina (CSNB).

[0056] The most common progressive IRD, primarily affecting the cones, is Stargardt macular dystrophy. It is inherited in an autosomal recessive manner and is primarily caused by mutations in the ABCA4 gene, which encodes the retinal transporter ABCR. In one embodiment, a therapeutic nucleic acid encodes ABCA4 or a portion thereof, and the therapeutic nucleic acid is used to treat Stargardt macular dystrophy.

[0057] The most common progressive IRD, primarily affecting the rods, is retinitis pigmentosa (RP). RP is a progressive disease that leads to night blindness and visual field constriction. In later stages, secondary cone photoreceptor cell death is induced, ultimately resulting in complete vision loss. Some forms of retinitis pigmentosa are associated with mutations in the gene encoding rhodopsin. In one embodiment, therapeutic nucleic acids encode rhodopsin or a portion thereof, and these therapeutic nucleic acids are used to treat retinitis pigmentosa.

[0058] The nucleic acid sequence according to the present invention may also include a donor splice site, where the donor splice site is localized at the 3' of the target nucleotide sequence or a portion thereof. The term “donor splice region” is used herein interchangeably with “donor splice site” (abbreviated as DSS) or “splice donor site” (abbreviated as SDS). Thus, the nucleic acid sequence according to the present invention may also include a donor splice site. Donor splice sites are known to those skilled in the art, and are described in particular in Buckley et al. (2009) “A method for identifying alternative or cryptic donor splice sites within gene and mRNA sequences. Comparisons among sequences from vertebrates, echinoderms and other groups” BMC Genomics 10: 318 and Qu et al. (2017) “A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals” Front. Genet., vol. 8 Art. 38. Here, any suitable donor splice site is intended by this term. Donor splice sites are typically located at the 3' end of an exon and the 5' end of an adjacent intron. However, in the context of the present invention, donor splice sites may also be located anywhere within the nucleotide sequence of interest. Similar to acceptor splice sites, donor splice sites allow spliceosomes to cleave at that site.

[0059] In principle, the donor splice sites described herein may be located at any position on the nucleic acid molecule. It is also conceivable that the donor splice site may be located at the 3' end of the (first) nucleic acid sequence. For example, the donor splice site sequence may include or consist of the sequences AAGGTAAGT, AAGGTGAGT, CAGGTAAGT, CAGGTGAGT, AAGGTAAG, AAGGTGAG, CAGGTAAG, or CAGGTGAG. It is also conceivable that the donor splice site sequence has at least 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the sequences AAGGTAAGT, AAGGTGAGT, CAGGTAAGT, CAGGTGAGT, AAGGTAAG, AAGGTGAG, CAGGTAAG, or CAGGTGAG.

[0060] Similarly, the receptive splice regions described herein may be located at any position on the nucleic acid molecule. It is also conceivable that the receptive splice site may be located at the 5' end of the (second) nucleic acid sequence.

[0061] The target nucleotide sequence may additionally or alternatively include the polyadenylation signals and / or promoters described herein.

[0062] The present invention also, (A) A step of providing a first nucleic acid sequence comprising one or more donor splice site sequences; (B) A step of providing a second nucleic acid sequence including the following; (i) Receptive splice regions including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; The present invention also relates to a method for producing nucleic acid sequences, which includes obtaining a nucleic acid sequence. The method may also include (C) a step of cleaving a first nucleic acid sequence at one or more donor splice site sequences and a second nucleic acid sequence at a recipient splice site, and (D) a step of ligating the first cleaved nucleic acid sequence to the second cleaved nucleic acid sequence.

[0063] This method reflects so-called trans-splicing. In particular, trans-splicing is a type of splicing in which exons from two separate nucleic acid molecules (preferably pre-mRNA molecules) are joined together to form a single nucleic acid molecule. For example, this occurs when pre-mRNA is spliced ​​into the final mRNA, tRNA, or rRNA. This process is known to those skilled in the art and is described, in particular, under the heading "DNA to RNA" in Alberts B, Johnson A, Lewis J, et al. (2002) “Molecular Biology of the Cell. 4th edition.” New York: Garland Science. Therefore, the spliced ​​nucleic acid sequence is preferably an mRNA, rRNA, or tRNA sequence. Thus, the nucleotide sequence of interest may be pre-mRNA.

[0064] The first and second nucleic acid sequences may be DNA or RNA sequences. If the first and second nucleic acid sequences are DNA sequences, both the first and second nucleic acid sequences further include promoters, and at least the second, preferably both nucleic acid sequences, also include a transcription termination sequence such as a poly(A) sequence. If the first and second nucleic acid sequences are RNA sequences, at least the second, preferably both nucleic acid sequences, include a termination sequence such as a poly(A) sequence. Preferably, the nucleic acid sequences are DNA sequences, and more preferably, a vector or plasmid containing DNA sequences.

[0065] In one embodiment, the first and second nucleic acid sequences further comprise binding domains. In yet another embodiment, the first and second nucleic acid sequences are premRNA transsplicing molecules or DNA sequences encoding premRNA transsplicing molecules as described herein.

[0066] Without being bound by theory, the cleavage of a first nucleic acid sequence at one or more donor splice site sequences, the cleavage of a second nucleic acid sequence at a receptor splice region sequence, and the ligation of the first and second cleaved nucleic acid sequences are carried out using two transesterification reactions in cis-splicing and trans-splicing, which are referred to herein as “splicing.” The term “trans-splicing” as used herein refers to RNA splicing, in particular to preRNA splicing of two distinct RNA or preRNA molecules to form mature RNA such as terminal mRNA, tRNA, or rRNA.

[0067] The term "in vitro method" refers to a method outside the body, i.e., outside the body of a human or animal, but includes extracorporeal cell lines or primary cells.

[0068] The methods and uses described herein can be carried out with any suitable cell-free system, such as cell lysates, or any suitable host cells.

[0069] Such suitable host cells are known to those skilled in the art. For example, suitable host cells include splicing mechanisms, i.e., spliceosomes. Those skilled in the art can select regulatory elements for use in a suitable host, e.g., mammalian or human host cells. Regulatory elements include, for example, promoters, termination sequences (e.g., transcription termination sequences, translation termination sequences), enhancers, and polyadenylation elements. Furthermore, the expression level of the transgene (the nucleic acid sequence of interest) can be enhanced by using regulatory elements such as enhancer sequences or the post-transcriptional response element (WPRE) of woodchuck hepatitis virus. However, these elements further limit the package capacity of rAAV. Therefore, in some cases, especially when size limitations are important, it is recommended to omit any such elements and, preferably, use small essential regulatory elements such as short polyadenylation signals as the termination sequences of the AAV vector according to the present invention, and in particular dual rAAV vector systems. The host cell may be a eukaryotic cell or a mammalian cell such as a human or rodent cell line. Host cells can be obtained from HEK cells, such as HEK293(T) cells, Cos7 cells, CHO cells, fibroblasts, such as human or mouse-derived fibroblasts, retinoblastoma cells, 661W cells, induced pluripotent stem cells (iPSCs), such as human iPSCs, photoreceptor cells, such as vertebrate-derived photoreceptor cells, neurons, or glial cells.

[0070] In one embodiment, the method is performed in vitro (i.e., outside the body) in host cells and includes introducing the first nucleic acid sequence and the second nucleic acid sequence. The first and second nucleic acid sequences may be introduced by transfection or transduction, and more specifically by co-transfection or simultaneous transduction.

[0071] Therefore, one embodiment, the method (A) A step of providing a first nucleic acid sequence comprising one or more donor splice site sequences; (B) A step of providing a second nucleic acid sequence including the following; (i) Receptive splice regions including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) the target nucleotide sequence, where the target nucleotide sequence (iia) is located on the 3' side of the receptive splice region. The method includes (C) cleaving a first nucleic acid sequence at one or more donor splice site sequences and cleaving a second nucleic acid sequence at a recipient splice site, and (D) ligating the first cleaved nucleic acid sequence to the second cleaved nucleic acid sequence to obtain a nucleic acid sequence.

[0072] If both nucleic acid sequences contain the target nucleotide sequence, the method further includes the feature that the first nucleotide sequence (ii) contains the target nucleotide sequence, where the target nucleotide sequence is located 5' to the donor splice site.

[0073] Both the second and first nucleic acid sequences may include the nucleotide sequence of interest as described herein. Such the nucleotide sequence of interest may be located at 5' of the donor splice site. The nucleotide sequence of interest may additionally or alternatively be located at 3' of the acceptor splice region. In another embodiment of the present invention, the polynucleotides include the following arrangement: preferably, 5'-(sequence of interest)-(donor splice site)-3' and 5' binding-(acceptor splice region)-(sequence of interest)-3'. Or, 5'-(sequence of interest)-(acceptor splice region)-3' and 5' binding-(donor splice site)-(sequence of interest)-3'.

[0074] In a preferred embodiment, the nucleotide sequence of interest is a sequence encoding a polypeptide, where the first nucleic acid sequence comprises the 5' portion of the polypeptide encoding sequence, and the second nucleic acid sequence comprises the 3' portion of the polypeptide encoding sequence, and trans-splicing reconstructs the 5' and 3' portions of the polypeptide encoding sequence.

[0075] Ligation of cleaved nucleic acid sequences is a process known to those skilled in the art. For example, this ligation process can be carried out by a ligating molecule. For example, the ligation molecule may be an RNA ligase or a protein having RNA ligase function. Such RNA ligases are known to those skilled in the art and are described, in particular, for example, in Chambers and Patrick (2015) “Archaeal Nucleic Acid Ligases and Their Potential in Biotechnology” Hindawi Publishing Corporation Archaea Volume 2015, paper ID 170571, page 10. Some (t)RNA ligases are described, for example, in Popow et al. (2012) “Diversity and roles of (t)RNA ligases” Cell Mol Life Sci. 69(16):2657-70. Thus, a method comprising a ligation step may further comprise a step of adding an RNA ligase. The RNA ligase may be, for example, mRNA ligase, tRNA ligase, or rRNA ligase. An example illustrates how the ligated mRNA molecule can be analyzed.

[0076] In preferred embodiments, the method is carried out in a host cell, and more preferably in vitro (i.e., outside of a host). Thus, the first and second nucleic acid sequences are introduced into a host cell, where the first and second nucleic acid sequences are recombinant nucleic acid sequences and / or heterologous to the host cell. Introducing the first and second nucleic acid sequences into a host cell involves transfection or transduction. Transfection may be DNA or RNA transfection, and methods for transfecting DNA or RNA are known to those skilled in the art. Preferably, the nucleic acid sequence is a DNA sequence, and the DNA sequence is transfected in the form of a plasmid or vector containing the DNA sequence. Transduction as referred to herein means introducing a nucleic acid using a viral vector, where the viral vector may contain DNA or RNA. In preferred embodiments, the viral vector is a DNA viral vector, and may contain single-stranded DNA (e.g., AAV) or double-stranded DNA.

[0077] In one embodiment, the method according to the present invention comprises: (A) introducing a first nucleic acid sequence comprising a premRNA transsplicing molecular sequence or a nucleic acid sequence encoding the premRNA transsplicing molecule into a host cell, wherein the first premRNA transsplicing molecule comprises the following from 5' to 3': (a) the 5' portion of the nucleotide acid sequence of interest; (b) a donor splice site; (c) optionally a spacer sequence; (d) a first binding domain; and (e) optionally a stop sequence, preferably a poly-A sequence; and (B) introducing a second nucleic acid sequence comprising a premRNA transsplicing molecular sequence or a nucleic acid sequence encoding the premRNA transsplicing molecule into a host cell, wherein the second premRNA transsplicing molecule comprises the following from 5' to 3': (i) a second binding domain complementary to the first binding domain of the first nucleic acid sequence; and (ii) a receptor splice site comprising the following Rice region sequence; (iia) pyrimidine region containing the following, (iiaa) 5-25 nucleotides; (iiab) where at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (iib) acceptor splice site, (iiba) where the acceptor splice site is located on the 3' side of the pyrimidine region; and (iibb) where the acceptor splice site contains a NAGG sequence from 5' to 3', where N is A, C, T / U, or G; and (iii) the 3' portion of the desired nucleotide sequence. The method may further include the steps of (C) cleaving a first nucleic acid sequence at a donor splice site sequence and cleaving a second nucleic acid sequence at a recipient splice site; and (D) ligating the first cleaved nucleic acid sequence containing the 5' portion of the target nucleotide sequence to a second cleaved nucleic acid sequence containing the 3' portion of the target nucleotide sequence to obtain the target nucleic acid sequence. In a preferred embodiment, the first and second nucleic acid sequences are DNA sequences encoding the premRNA trans-splicing molecule, the first nucleic acid sequence further includes a promoter 5' of the 5' portion of the target nucleic acid sequence, and the second nucleic acid sequence further includes a promoter 5' of a second binding domain.

[0078] The present invention also relates to nucleic acid sequences comprising the following, wherein the nucleotide sequence of interest is not exon 3 of the rhodopsin gene of SEQ ID NO: 9, or the nucleotide sequence of interest does not include the sequence defined by SEQ ID NO: 9 and / or 10, or the nucleic acid sequence of interest does not include exon 3 of the rhodopsin gene of SEQ ID NO: 9: (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) the target nucleotide sequence, where the target nucleotide sequence (iia) is located on the 3' or 5' side of the receptive splice region.

[0079] The present invention also relates to nucleic acid sequences comprising the following, wherein the nucleotide sequence of interest is not the rhodopsin mRNA of SEQ ID NO: 10: (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) the target nucleotide sequence, where the target nucleotide sequence (iia) is located on the 3' or 5' side of the receptive splice region.

[0080] The nucleic acid sequence of the present invention is expected to have a maximum length of 5800 nucleotides. Furthermore, the nucleic acid sequence of the present invention is expected to have a maximum length of 5500, 5000, 4500, 4000, 3500, 3000, 2500, 2000, 1500, 1000, 500, 400, 300, 200, or a maximum of 150 nucleotides.

[0081] A further application of the receptive splice region of the present invention in nucleic acid molecules is so-called exogenous premRNA trans-splicing molecules for Smart technologies. Such premRNA trans-splicing molecules into which the receptive splice region of the present invention can be introduced are described, in particular, in International Publication No. 2011 / 042556, International Publication No. 2013 / 025461, and in Berger et al. (2016) “mRNA trans splicing in gene therapy for genetic diseases” WIREs RNA, 7:487-498, Puttaraju et al. (1999) “Spliceosome-mediated RNA trans-splicing as a tool for gene therapy” Nature Biotechnology, vol. 17, pp. 246-252; and Mansfield et al. (2003) “5' Exon replacement and repair by spliceosome-mediated RNA trans-splicing” RNA, vol. 9: 1290-1297. From these references, those skilled in the art will also know how to construct such premRNA trans-splicing molecules. Several exemplary premRNA trans-splicing molecule nucleic acid molecules are also described herein.

[0082] The present invention also relates to premRNA transsplicing molecules, including: (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence; here the receptive splice region is localized to the 5' end of the target nucleotide sequence; (iii) A binding domain that targets premRNA and is localized to the 5' end of the target nucleic acid sequence; and (vi) Optionally, a spacer sequence, which is localized between the binding domain and the receptor splice region.

[0083] In preferred embodiments, the receptive splice region is localized to the 5' end of the target nucleotide sequence, and the binding domain is localized to the 5' end of the receptive splice region. Preferably, the nucleic acid sequence or premRNA trans-splicing molecule further comprises a stop sequence, preferably a poly(A) sequence.

[0084] The present invention further relates to a premRNA trans-splicing molecule comprising the following: (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence, where the receptive splice region is localized to the 5' end of the target nucleotide sequence; (iii) a donor splice site, which is localized to the 3' end of the target nucleotide sequence; (iv) A first binding domain that targets the premRNA located at the 5' end of the target nucleotide sequence; (v) A second binding domain that targets premRNA located at the 3' end of the target nucleotide sequence; (vi) Optionally, a first spacer sequence, where the first spacer is localized between the first binding domain and the receptive splice region; (vii) Optionally, a second spacer sequence, where the second spacer is localized between the second binding domain and the donor splice site.

[0085] In one embodiment, the first binding domain is localized to the 5' side of the receptive splice region, and the second binding domain is localized to the 3' side of the donor splice site. Those skilled in the art will understand that the DNA sequence encoding the premRNA trans-splicing molecule contains a promoter for transcribing the premRNA trans-splicing molecule, which is an RNA molecule. The term “premRNA-targeting binding domain” is sometimes called the “premRNA target binding domain,” and it may be located at the 5' or 3' side of the nucleotide sequence of interest.

[0086] The nucleic acid sequences described herein may reflect pre-mRNA trans-splicing molecules. Those skilled in the art will understand that the nucleic acid sequences and pre-mRNA trans-splicing molecules described herein are recombinant sequences or recombinant molecules. These pre-mRNA trans-splicing molecules are known in the art, particularly in International Publication Nos. 2011 / 042556, International Publication Nos. 2013 / 025461, and Berger et al. (2016) “mRNA trans splicing in gene therapy for genetic diseases” WIREs RNA, 7:487-498, Puttaraju et al. (1999) “Spliceosome-mediated RNA trans-splicing as a tool for gene therapy” Nature Biotechnology, vol. 17, pp. 246-252; Mansfield et al. (2003) “5' Exon replacement and repair by spliceosome-mediated RNA trans-splicing” RNA, vol. 9: 1290-1297, and Berger et al. (2016) “mRNA trans-splicing in gene therapy for genetic diseases” WIREs RNA, This is described in 7:487-498. Therefore, those skilled in the art know how to construct these premRNA transsplicing molecules. It is assumed that the premRNA transsplicing molecule binds to a target premRNA, where the premRNA may be a native premRNA, in particular an endogenous premRNA in the host cell, or a recombinant premRNA, in particular another premRNA transsplicing molecule. It is also intended that the premRNA transsplicing molecule preferentially induces a transsplicing reaction more efficiently than a cissplicing reaction.

[0087] As used herein, the term “premRNA-targeting binding domain” may be any suitable “premRNA-targeting binding domain,” meaning that it is complementary to the sequence of the target premRNA located at the 5' or 3' end of the nucleotide sequence of interest. As used herein, the “premRNA-targeting binding domain” may also be called a “target binding domain,” “binding domain” (abbreviated as BD), or “binding sequence.” For example, a binding domain can recognize a target premRNA or mRNA by base pairing. For example, the target of the mRNA may be an intron. The target binding domain of the premRNA trans-splicing molecule described herein may comprise one or two binding domains of at least 15 to 30 nucleotides, preferably 80 to 120 nucleotides, more preferably about 100 nucleotides; or it may have a longer target binding domain of up to several hundred nucleotides that is complementary to the target region of a selected (e.g., endogenous) premRNA and is antisense oriented, as described in U.S. Patent Publication US 2006-0194317 A1. This confers binding specificity and tightly fixes the endogenous premRNA in space, so that, for example, a spliceosome in the nucleus of a host cell can transsplice a portion of a premRNA transsplicing molecule to a portion of (e.g., endogenous) premRNA. Alternatively, the binding domain may be inversely complementary to the binding domain of another recombinant premRNA, such as another premRNA transsplicing molecule. This confers binding specificity and tightly fixes the two premRNA transsplicing molecules in space, so that, for example, a spliceosome in the nucleus of a host cell can transsplice a portion of one premRNA transsplicing molecule to a portion of another premRNA transsplicing molecule. Therefore, the binding domain is expected to contain between approximately 15 and 250 nucleotides, between approximately 15 and 200 nucleotides, between approximately 100 and 200 nucleotides, or less than 500, 400, 300, or 200 nucleotides.In one embodiment, the binding domain comprises 50–150 nucleotides, preferably 80–120 nucleotides, more preferably 90–110 nucleotides, or about 100 nucleotides. Alternatively, or more preferably, an efficient binding domain has a GC content of 45–65% and / or originates from an intronic eukaryotic or bacterial sequence and / or contains at least one branch in the last 30 bp (as assessed, for example, using human splicing finder 3.1 (http: / / www.umd.be / HSF / index.html)).

[0088] Within the host cell, the binding domain can bind to endogenous premRNA or a second heterologous or recombinant premRNA (provided or introduced into the host cell) insofar as the endogenous premRNA or the second heterologous or recombinant premRNA contains a sequence inversely complementary to the target binding domain. Therefore, with respect to the second heterologous or recombinant premRNA, it contains a binding domain inversely complementary to the binding domain of the first heterologous premRNA. The terms “endogenous” and “heterologous” are used herein in reference to the host cell. Targeting endogenous premRNA is also called RNA transsplicing via spliceosomes and is typically used to replace a portion of endogenous premRNA. Targeting a second heterologous or recombinant premRNA is also called transsplicing and generates a novel recombinant mRNA by linking a first nucleotide sequence or portion (5') from one premRNA transsplicing molecule to a second nucleotide sequence or portion (3') from another premRNA transsplicing molecule. As used herein, the term "recombinant" refers to DNA molecules or sequences formed by experimental methods of genetic recombination, such as molecular cloning, and RNA or polypeptide molecules / sequences encoded by such recombinant DNA molecules or sequences.

[0089] The term "pre-mRNA" or "preRNA" refers to RNA before trans-splicing, and usually refers to RNA molecules before cis-splicing (e.g., including introns and exons). However, it can also refer to RNA molecules after cis-splicing (e.g., including only exons) when the binding domain targets sequences that span exon-exon boundaries.

[0090] As used herein, the term “heterogeneous” refers to a protein or nucleic acid molecule or sequence that is experimentally transferred or introduced into a cell and is therefore not endogenous to that cell. If a heterogeneous protein or nucleic acid molecule or sequence may originate from a different cell type or species than the recipient, it may originate from the same cell type or species as the recipient, insofar as it is introduced into the recipient host cell. As used herein, the terms “heterogeneous” and “recombinant” are used interchangeably.

[0091] Exemplary binding domains suitable for use in the present invention are, but are not limited to, binding domains having RNA sequences encoded by sequence numbers: 27, 28, 32, 33, or 18. Further target binding domains are described and used in Examples 2 and 5, or can be identified using reporter reconstitution assays such as cerulean reconstitution assays to determine reconstitution efficiency, as described in Riedmayr LM. (2020, SMaRT for Therapeutic Purposes. Methods Mol Biol 2079:219-32. doi: 10.1007 / 978-1-4939-9904-0_17) or Dallinger G. et al. (2003, Development of spliceosome-mediated RNA trans-splicing (SMaRT) for the correction of inherited skin diseases. Exp Dermatol 12:37-46).

[0092] The second binding region may be located at the 3'' end of the molecule and can be incorporated into the premRNA trans-splicing molecule of the present invention. Absolute complementarity is desirable but not required. As referred herein, a sequence “complementary” to a portion of endogenous premRNA means a sequence that is sufficiently complementary to the endogenous premRNA to form a stable double helix. The ability to hybridize depends on both the degree of complementarity and the length of the nucleic acid (see, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

[0093] Therefore, the complementarity used with respect to a binding domain targeting premRNA means that the binding domain is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to the target sequence on the premRNA, and preferably at least 90%, 95%, 98%, 99%, or 100% complementary to the target sequence on the premRNA.

[0094] A spacer region for separating the splice site from the binding domain is also preferably included in the premRNA trans-splicing molecule. The spacer sequence is a region of the premRNA trans-splicing molecule that covers the elements of the 3' and / or 5' splice site of the premRNA trans-splicing molecule by relatively weak complementarity, thereby preventing nonspecific trans-splicing.

[0095] The spacer separating the 5' donor splice site and the 3' terminal binding domain may include a length of about 10 to 100 nucleotides, preferably between 10 to 70 nucleotides, between 20 to 70 nucleotides, between 20 to 50 nucleotides, and more preferably between 30 to 50 nucleotides. This spacer may include a downstream intron splice enhancer (DISE). The spacer sequence separating the 3' acceptor splice region from the 5' terminal binding domain may include a length of about 2 to 100 nucleotides, or between 10 to 100 nucleotides, preferably between 2 to 50 nucleotides, and more preferably between 5 to 20 nucleotides.

[0096] The spacer may be a non-coding sequence, but may be designed to include features such as a stop codon that blocks the translation of the spliced ​​premRNA trans-splicing molecule. Additional features can be added to the premRNA trans-splicing molecule, as are known to those skilled in the art. It is further assumed that the nucleic acid sequences or premRNA trans-splicing molecules described herein may be contained in a (recombinant) vector. Such vectors are also known to those skilled in the art. A vector containing the nucleotide sequences of the present invention, such as the premRNA trans-splicing molecule of interest, may be a plasmid, virus, or other known in the art used for replication and expression in mammalian cells.

[0097] The expression of a target nucleotide sequence or any nucleotide sequence described herein, such as a premRNA trans-splicing molecule, can be regulated by any promoter / enhancer sequence known in the Art to act in mammalian cells, preferably human cells. Such promoter / enhancer sequences may be inductive or constitutive. Such promoters are also described elsewhere herein. One exemplary promoter is a human rhodopsin promoter or a mouse rhodopsin promoter or a short-wavelength sensitive opsin promoter or a medium-wavelength sensitive opsin promoter or a long-wavelength sensitive opsin promoter, etc. Recombinant DNA constructs that can be directly introduced into tissue sites can be prepared using any type of plasmid, cosmid, YAC, or viral vector. Alternatively, a viral vector that selectively infects desired target cells can be used. Vectors for use in the implementation of the present invention include, but are not limited to, any eukaryotic expression vectors, including viral expression vectors derived from the retrovirus, adenovirus or adeno-associated virus classes. In preferred embodiments, the recombinant vector of the present invention is a eukaryotic expression vector.

[0098] In another specific embodiment, the present invention includes delivering a nucleic acid sequence, such as the premRNA transsplicing molecule of the present invention or a nucleic acid sequence encoding the premRNA transsplicing molecule of the present invention, to a target cell. Various delivery systems are known and can be used to deliver the composition of the present invention into cells. For example, encapsulation into liposomes, microparticles, microcapsules, recombinant cells capable of expressing the composition, receptor-mediated endocytosis, construction of nucleic acids as part of retroviruses, adenoviruses, adeno-associated viruses or other vectors, DNA injection, electroporation, calcium phosphate-mediated transfection, etc. The present invention also relates to cells containing nucleic acid sequences, such as the premRNA transsplicing molecule of the present invention, a nucleic acid sequence encoding the premRNA transsplicing molecule, or a recombinant vector containing a nucleic acid sequence encoding the premRNA transsplicing molecule of the present invention.

[0099] Using the target nucleic acid sequence or any nucleic acid sequence disclosed herein, the expression of a gene encoding a functionally biologically active molecule, either a knockout gene product or a mutant gene product, can be delivered to cells of an individual with an inherited genetic disorder that produces a normal phenotype. This can be achieved, among other things, by an adeno-associated virus vector, as also disclosed herein.

[0100] The present invention also relates to a deoxyribonucleic acid (DNA) molecule comprising a promoter and a sequence encoding a premRNA transsplicing molecule described herein. Preferably, the DNA molecule is a vector or plasmid, where the vector may be a viral vector such as an AAV, adenovirus, or lentiviral vector or plasmid. DNA molecules such as premRNA transsplicing molecules or viral vectors can be used in therapeutic applications, specifically gene therapy, and more specifically gene therapy for treating eye diseases.

[0101] Further applications of the receptor splice site of the present invention include any AAV vector or AAV vector system. Such vector systems and how they can be constructed are known to those skilled in the art, and are described, among other things, in Carvalho et al. (2017) “Evaluating efficiencies of dual AAV approaches for retinal targeting” Frontiers in Neuroscience, vol. 11, Article 503, U.S. Patent Application No. 2014 / 0256802, or Trapani et al. (2013) “Effective delivery of large genes to the retina by dual AAV vectors” EMBO Molecular Medicine, vol. 6, no. 2, pp. 194-211. Some exemplary AAV vectors and AAV vector systems are also described herein.

[0102] The present invention also relates to an adeno-associated virus (AAV) vector comprising at least two reverse-terminal repeats comprising a nucleic acid sequence between these two reverse-terminal repeats, wherein the nucleic acid sequence is 5' to 3' (i) promoter; (ii) Joint domain; (iii) Optional spacer arrangement; (iv) Receptive splice regions including the following (a) Pyrimidine region including the following: (aa) 5-25 nucleotides; (ab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (b) Receptor splice site, ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and bb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (v) Target nucleotide sequence (vi) Optionally, a terminal sequence, for example, a poly-A sequence. Includes.

[0103] Structurally, AAV is a small (25 nm), single-stranded DNA non-enveloped virus with an icosahedral capsid. Native or modified AAV variants (and AAV serotypes) with differing capsid (cap) protein composition and structure exhibit diverse directivity, i.e., the ability to transduce different (retinal) cell types (Boye et al. (2013) “A comprehensive review of retinal gene therapy” Molecular therapy 21 509-519). When combined with a ubiquitously active promoter, this directivity clarifies the site of gene expression. On the other hand, in combination with cell type-specific promoters, the degree of site specificity (i.e., expression of the transgene only in rod or cone photoreceptors) is clarified by the combination of both AAV serotype targeting and promoter specificity (Schon et al. (2015) “Retinal gene delivery by adeno-associated virus (AAV) vectors: Strategies and applications” Eur J Pharm Biopharm. 95(Pt B):343-52).

[0104] The terms “adeno-associated viral vector,” “recombinant AAV,” or “rAAV,” all used interchangeably, mean any AAV containing a heterogeneous polynucleotide sequence (also referred to herein as the nucleotide sequence of interest) in its viral genome. Generally, the heterogeneous polynucleotide / nucleotide sequence of interest is flanked by at least one, generally two, native or variant AAV reverse-terminal repeat sequences (ITRs). The term rAAV vector encompasses both rAAV vector particles and rAAV vector plasmids. Therefore, for example, an rAAV containing a heterogeneous polynucleotide may also contain nucleic acid sequences not typically found in naturally occurring wild-type AAV, such as transgenes (e.g., non-AAV RNA-coding polynucleotide sequences, non-AAV protein-coding polynucleotide sequences), non-AAV promoter sequences, non-AAV polyadenylated sequences, etc.

[0105] Such recombinant AAV vectors are common technical knowledge in the art, and those skilled in the art are also familiar with methods for constructing such recombinant AAVs.

[0106] An "rAAV vector genome" or "rAAV genome" is an AAV genome (i.e., vDNA) containing one or more heterologous nucleic acid sequences. rAAV vectors typically require only terminal repeats (TRs) to generate the virus. All other viral sequences are considered unnecessary and may be supplied trans (Muzyczka, (1992) Curr Topics Microbiol. Immunol. 158:97). Typically, rAAV vector genomes retain only one or more TR sequences to maximize the size of the transgene / target nucleotide sequence / heterologous nucleic acid sequence so that it can be efficiently packaged by the vector / capsid. Structural and non-structural protein-coding sequences may be supplied trans (e.g., from a vector such as a plasmid, or by stably incorporating the sequences into packaging cells). In embodiments of the present invention, the rAVV vector genome comprises at least one TR sequence (e.g., an AAV TR sequence), and optionally two TRs (e.g., two AAV TRs), which are typically located at the 5' and 3' ends of the vector genome and are adjacent to, but not necessarily adjacent to, heterologous nucleic acids. The TRs may be identical or different from each other.

[0107] The terms “reverse terminal repeat,” “terminal repeat,” or “TR,” all used interchangeably, include any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as a reverse terminal repeat (i.e., through desired functions such as replication, viral packaging, integration, and / or proviral rescue). A TR may be an AAV TR or a non-AAV TR. For example, a non-AAV TR sequence such as other parvoviruses (e.g., canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19) or any other suitable viral sequence (e.g., an SV40 hairpin that functions as an origin for SV40 replication) can be used as a TR and can be further modified by truncation, substitution, deletion, insertion, and / or addition. Furthermore, a TR may be partially or completely synthetic, such as the “double D sequence” described in U.S. Patent No. 5,478,745. Terminal repeats may have nucleotides of about 50, 100, 150, 200, 250, 300 or more in length. For example, a terminal repeat has about 145 nucleotides. For example, the reverse terminal repeat may have sequences of sequence numbers 14 and / or 15. The reverse terminal repeat may also have at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% sequence identity with sequences of sequence numbers 14 and / or 15. Preferably, the AAV vector contains sequences that have at least 60% sequence identity with both sequence numbers 14 and 15, or sequences that have at least 60% sequence identity with sequence numbers 14 and 15.

[0108] The “AAV terminal repeat” or “AAV TR” may be derived from any currently known or hereafter discovered AAV, including but not limited to serotypes 1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 or any other AAV. The AAV terminal repeat does not need to have a native terminal repeat sequence, as long as the terminal repeat mediates a desired function, such as replication, viral packaging, integration, and / or proviral rescue (for example, the native AAV TR sequence may be modified by insertions, deletions, truncations, and / or missense mutations). The viral vectors of the present invention may further be “targeted” viral vectors (e.g., having directional directivity) and / or “hybrid” parvoviruses (i.e., viral TRs and viral capsids derived from different parvoviruses), as described in International Patent Publication 00 / 28004.

[0109] Recombinant AAVs or AAV vectors may contain, or be expected to contain, sequences with at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity with naturally occurring AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV3B, AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), AAV9, AAV10, AAV11, AAV12, rh10, bird AAV, bovine AAV, canine AAV, horse AAV, primate AAV, non-primate AAV, and sheep AAV.

[0110] According to the present invention, the nucleic acid sequence between two reverse terminal repeats further comprises the promoter described herein. The choice of promoter used in AAV can be from a number of constitutive or inducible promoters capable of expressing the desired selected transgene / nucleotide sequence in the desired target cells. The promoter may be derived from any species, including humans.

[0111] The promoters described herein may be “cell-specific.” The term “cell-specific” means that a particular promoter selected for a recombinant vector can direct the expression of a selected transgene / nucleotide sequence of interest in a particular cell or ophthalmic cell type. Useful promoters include rod opsin promoter, red-green opsin promoter, blue opsin promoter, cGMP-P-phosphodiesterase promoter, mouse opsin promoter (Beltran et al. (2010) “rAAV2 / 5 gene-targeting to rods: dose-dependent efficiency and complications associated with different promoters.” Gene Ther. 17(9):1162-74), rhodopsin promoter (Mussolino et al, Gene Ther, July 2011, 18(7):637-45); cone transducin alpha subunit (Morrissey et al, BMC Dev, Biol, Jan 2011, 11:3); beta-phosphodiesterase (PDE) promoter; retinitis pigmentosa (RP1) promoter (Nicord et al, J. Gene Med, Dec 2007, 9(12): 1015-23); NXNL2 / NXNL1 promoter (Lambard et al, PLoS This includes, but is not limited to, the PE65 promoter; the retinal degeneration slow / peripherin 2 (Rds / perph2) promoter (Cai et al, Exp Eye Res. 2010 Aug;91(2): 186-94); and the VMD2 promoter (Achi et al, Human Gene Therapy, (2009) 20:3-9).

[0112] Useful promoters used in this invention also include rod opsin promoter (RHO), red-green opsin promoter, blue opsin promoter, cGMP-phosphodiesterase promoter, SWS promoter (blue short-wavelength sensitive (SWS) opsin promoter), mouse opsin promoter (Beltran et al. 2010 above), rhodopsin promoter (Mussolino et al, Gene Ther, July 2011, 18(7):637-45); cone transducer alpha subunit (Morrissey et al, BMC Dev, Biol, Jan 2011, 11:3); cone arrestin (ARR3) promoter (Kahle NA et al., Hum Gene Ther Clin Dev, September 2018, 29(3):121-131), beta-phosphodiesterase (PDE) promoter; retinitis pigmentosa (RP1) promoter (Nicord et al, J. Gene Med, Dec 2007, This includes, but is not limited to, the NXNL2 / NXNL1 promoter (Lambard et al, PLoS One, Oct. 2010, 5(10):el3025), the RPE promoter; retinal degeneration slow / peripherin 2 (Rds / perph2) promoter (Cai et al, Exp Eye Res. 2010 Aug;91(2):186-94); the VMD2 promoter (Achi et al, Human Gene Therapy, 2009 (20:3-9)), and the ABCA4 promoter or any hybrid promoter consisting of at least two different promoters.

[0113] The nucleic acid sequence between the two reverse-terminal repeats is also intended to further include a termination signal, such as a polyadenylation signal located at the 3' end of the target nucleic acid sequence. Since the preRNA may be trans-spliced ​​into endogenous preRNA or further recombinant preRNA to form the 5' end of mature RNA such as mature mRNA, the termination signal, such as a polyadenylation signal located at the 3' end of the target nucleic acid sequence, is optional. However, the effectiveness of trans-splicing has been shown to be higher in the presence of a polyadenylation signal.

[0114] While a promoter is required to transcribe preRNA, the nucleic acid sequence does not necessarily require an ATG (translation start) and / or a Kozak consensus sequence. If the preRNA can be transspliced ​​into endogenous preRNA or further recombinant preRNA to form the 3' end of mature RNA such as mature mRNA, the absence of an ATG and / or a Kozak consensus sequence may be advantageous in avoiding undesirable translation from the preRNA prior to transsplicing.

[0115] The selection of these and other common vectors and regulatory elements is conventional, and many such sequences are available. See, for example, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989. Of course, not all vectors and regulatory sequences work equally well to express all transgenes as described herein. However, those skilled in the art can make selections from these and other regulatory sequences without departing from the scope of the present invention.

[0116] The present invention also relates to adeno-associated virus (AAV) vector systems, including: (I) A first AAV vector comprising at least two reverse end repeats, wherein the nucleic acid sequence between these two reverse end repeats is from 5' to 3'. (a) promoter, (b) The nucleotide sequence encoding the N-terminal portion of the target polypeptide; (c) Donation splice site; (d) Optional spacer arrangement; (e) the first binding domain; and (f) Optionally, a stop sequence, preferably a poly-A sequence; The first AAV vector, (II) A second AAV vector comprising a nucleic acid sequence comprising at least two reverse terminal repeats, the nucleic acid sequence comprising the nucleic acid sequence between these two reverse terminal repeats, Here, the nucleic acid sequence between these two reverse end repeats changes from 5' to 3'. (i) promoter; (ii) A second binding domain complementary to the first binding domain of the first AAV vector; (iii) Optionally, spacer arrangement, (iv) Receptor splice region sequence including the following, (a) Pyrimidine region including the following, (aa) 5-25 nucleotides; (ab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (b) Receptor splice site, (ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (bb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (v) The nucleotide sequence encoding the C-terminal portion of the target polypeptide; (vb) Here the C-terminal portion and the N-terminal portion of the target polypeptide reconstitute the target polypeptide; and (vi) Termination sequence, preferably poly(A) sequence Adeno-associated virus (AAV) vector systems, including those containing this type of virus.

[0117] Therefore, the C-terminal portion of the target polypeptide corresponds to the portion of the target polypeptide that is missing from the N-terminal portion of the polypeptide contained in the first AAV vector. In one embodiment, the polypeptide is a full-length polypeptide, the first AAV vector contains the N-terminal portion of the target full-length polypeptide, and the second AAV vector contains the C-terminal portion of the target full-length polypeptide, and the C-terminal portion and the N-terminal portion of the target full-length polypeptide reconstitute the target polypeptide. Therefore, the C-terminal portion of the target full-length polypeptide corresponds to the portion of the target full-length polypeptide that is missing from the N-terminal portion of the full-length polypeptide contained in the first AAV vector. More specifically, following trans-splicing, the mRNA contains sequences encoding the N-terminal portion and the C-terminal portion of the target polypeptide (within a frame), where the mRNA encodes the target (full-length) polypeptide, and thus the target polypeptide is reconstituted.

[0118] In particular, the packaging capacity of rAAV or AAV vector genomes is limited to approximately 5kb. Since the cDNAs of many therapeutic proteins are large, devising strategies to deliver large transgenes using rAAV vectors can significantly expand the clinical application of rAAV-mediated gene therapy. Therefore, in one embodiment, the target polypeptide is the polypeptide encoded by the transgene. To provide transgenes that already exceed the AAV packaging capacity, a trans-splicing approach has been developed. Simply put, two separate rAAV vectors deliver two portions of the transgene to target cells. One portion contains a splicing donor signal at the 3' end of the 5' portion of the transgene, and the other portion contains a splicing acceptor signal at the 5' end of the 3' portion of the transgene. In conventional systems, intermolecular recombination between the two vector genomes generates an intervening ITR junction or intervening sequence containing the recombinant gene sequence. This is then excised from a single premRNA molecule by the cell's cis-splicing mechanism to form a complete, full-length transgene cassette. In the AAV vector system according to the present invention, the two vector genomes are transcribed separately, the premRNAs interact via their complementary binding domains, and the two premRNAs are trans-spliced ​​to form a complete (full-length) transgene transcript.

[0119] The efficiency of the vector system can be evaluated by measuring the expression of the (full-length) target protein or the mRNA encoding the target protein provided by the dual AAV vector approach, for example, by means and techniques described herein or known to those skilled in the art.

[0120] The second binding domain is complementary to the first binding domain of the first AAV vector. Perfect complementarity is preferred but not required. As referred herein, a sequence “complementary” to a portion of the first binding domain means a sequence that is sufficiently complementary to the first binding domain to form a stable double helix. The ability to hybridize depends on both the degree of complementarity and the length of the nucleic acid (see, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Therefore, the complementarity used with respect to the second binding domain means that the second binding domain contains a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to the first binding domain contained in the first AAV, and preferably at least 90%, 95%, 98%, 99%, or 100% complementary to the first binding domain contained in the first AAV.

[0121] The first binding domain may have, or contain, the sequence shown in SEQ ID NO: 17, or a sequence having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the sequence in SEQ ID NO: 17. The second binding domain may have, or contain, the sequence shown in SEQ ID NO: 18, or a sequence having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the sequence in SEQ ID NO: 18. A person skilled in the art will understand that the first and second binding domains are interchangeable, insofar as the second binding domain is complementary to the first binding domain. Therefore, the first binding domain may have, or contain, a sequence having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the sequence shown in sequence number 18.

[0122] Alternatively, the second binding domain has or includes a sequence having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of sequence numbers: 18, 27, 28, 32, or 33, and the first binding domain has or includes a sequence complementary to the second binding domain, preferably a sequence complementary to the second binding domain, preferably a sequence at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to the second binding domain, more preferably a sequence at least 90%, 95%, 98%, 99%, or 100% complementary to the second binding domain, and even more preferably a sequence at 98%, 99%, or 100% complementary to the second binding domain. Those skilled in the art will understand that the first and second binding domains may be interchangeable, as long as the binding domains are complementary to each other. Therefore, the first binding domain may have or include a sequence having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with any one of sequence numbers: 18, 27, 28, 32, and 33, and the second binding domain may have or include a sequence complementary to the first binding domain, preferably a sequence at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to the first binding domain, more preferably a sequence at least 90%, 95%, 98%, 99%, or 100% complementary to the first binding domain, and even more preferably a sequence at 98%, 99%, or 100% complementary to the first binding domain.

[0123] Furthermore, it has been shown that nucleotides 50-100 of SEQ ID NO: 27 or 28 are effective as binding domains. Therefore, in one embodiment, the second or first binding domain includes the sequence of nucleotides 50-100 of SEQ ID NO: 27 or 28, or a sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with respect to the sequence of nucleotides 50-100 of SEQ ID NO: 27 or 28. Preferably, the binding domain has at least 80 nucleotides including the sequence of nucleotides 50-100 of SEQ ID NO: 27 or 28, or a sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with respect to the sequence of nucleotides 50-100 of SEQ ID NO: 27 or 28. Those skilled in the art will understand that the other binding domains each have or include sequences that are complementary to the first or second binding domain, preferably at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to the first or second binding domain, more preferably at least 90%, 95%, 98%, 99%, or 100% complementary to the first or second binding domain, and even more preferably 98%, 99%, or 100% complementary to the first or second binding domain, respectively.

[0124] In another embodiment, the second or first binding domain includes nucleotides 1-50 of SEQ ID NO: 18, 32, or 33, or a sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to nucleotides 1-50 of SEQ ID NO: 18, 32, or 33. Preferably, the binding domain has at least 80 nucleotides including nucleotides 1-50 of SEQ ID NO: 18, 32, or 33, or a sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to nucleotides 1-50 of SEQ ID NO: 18, 32, or 33. Those skilled in the art will understand that the other binding domains each have or include sequences that are complementary to the first or second binding domain, preferably at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to the first or second binding domain, more preferably at least 90%, 95%, 98%, 99%, or 100% complementary to the first or second binding domain, and even more preferably 98%, 99%, or 100% complementary to the first or second binding domain, respectively.

[0125] The binding domain may have between approximately 15 and 250 nucleotides, between approximately 15 and 200 nucleotides, between approximately 100 and 200 nucleotides, or 500, 400, 300, or less. In one embodiment, the binding domain comprises 50 to 150 nucleotides, preferably 80 to 120 nucleotides, more preferably 90 to 110 nucleotides, or about 100 nucleotides. The binding domains described herein can also be used in premRNA transsplicing molecules or in methods according to the present invention.

[0126] The first and second binding domains used in accordance with the present invention may be derived from human sequences or non-human sequences such as bacterial sequences. For use in humans in therapeutic applications (especially gene therapy), non-human sequences are preferred in order to avoid off-target effects in human cells.

[0127] The second AAV vector described herein, and optionally the first AAV vector, may include a termination signal, such as a polyadenylation (poly-A) signal located at the 3' end of the nucleic acid sequence. Poly-A signals / sequences are known to those skilled in the art and may be derived from many suitable species, including but not limited to SV-40, human, and bovine. "Poly-A" (A = adenylate) refers to a nucleic acid sequence containing multiple adenosine monophosphates, such as a nucleic acid sequence containing an AAUAAA consensus sequence that enables polyadenylation of the processed transcript. In gene disruption or selection cassettes (GDSCs), the poly-A sequence is located downstream of the reporter and / or selectable marker gene and signals the end of the transcript to RNA polymerase. It is assumed that the AAV vector may contain the poly-A sequence of SEQ ID NO: 16, or a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% sequence identity to the sequence shown in SEQ ID NO: 16.

[0128] The AAV vector or other vector of the present invention may optionally further include one or more transcription termination sequences, one or more translation termination sequences, one or more signal peptide sequences, one or more intra-sequence ribosome entry sites (IRESs), and / or one or more enhancer elements, or any combination thereof. Transcription termination regions can typically be obtained from the 3'' untranslated region of a eukaryotic or viral gene sequence. Transcription termination sequences can be placed downstream of coding sequences to provide efficient termination. Signal peptide sequences are, for example, amino-terminal peptide sequences that encode information related to one or more post-translational cellular destinations, including specific organelle compartments, or sites of protein synthesis and / or activity, or even the position of an operablely linked polypeptide to the extracellular environment.

[0129] Enhancers—cis-acting regulatory elements that increase gene transcription—may be included in the disclosed AAV vector or one of the vectors. Various enhancer elements are known to those skilled in the art and include, but are not limited to, the CaMV 35S enhancer element, the cytomegalovirus (CMV) initial promoter enhancer element, the SV40 enhancer element, and combinations and / or derivatives thereof. One or more nucleic acid sequences that direct or regulate the polyadenylation of mRNA encoded by the structural gene of interest may also be optionally included in one or more vectors of the present invention.

[0130] The disclosed dual-vector systems may be introduced into one or more selected mammalian cells using one or more methods known to those skilled in the art of gene therapy and / or viral technology. Such methods include, but are not limited to, transfection, microinjection, electroporation, lipofection, cell fusion, and calcium phosphate precipitation, as well as particulate gun methods. In one embodiment, the vectors of the present invention may be introduced in vivo, for example, by lipofection (i.e., DNA transfection via liposomes prepared from one or more cationic lipids). Synthetic cationic lipids (LIPOFECTIN, Invitrogen Corp., La Jolla, California, USA) can be used to prepare liposomes that encapsulate the vector and facilitate its introduction into one or more selected cells. The vector systems of the present invention may also be introduced in vivo as "naked" DNA using methods known to those skilled in the art.

[0131] The present invention also relates to a kit comprising the nucleic acid sequence and / or AAV vector and / or AAV vector system of the present invention.

[0132] The present invention also relates to a method for producing a target nucleic acid sequence, the method comprising the following steps: (A) A step of bringing a nucleic acid sequence into contact with a host cell, wherein the nucleic acid sequence includes the following steps (i) One or more donor splice site sequences; (ii) Receptor splice region sequence including the following (a) The pyrimidine region including the following; (aa) 5-25 nucleotides; (ab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (b) Receptor splice site, ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and bb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (III) A nucleic acid sequence or a portion thereof, the nucleotide sequence or a portion thereof (a) is located on the 3' side of the donor splice site and the 5' side of the recipient splice area; and (B) A step of cleaving a nucleic acid sequence at one or more donor splice site sequences of (i) and the acceptor splice region of (ii), thereby separating the target nucleotide sequence or a portion thereof from the donor splice site and the acceptor splice region.

[0133] As those skilled in the art know, splicing can be carried out in various ways. Known to those skilled in the art are, for example, cis-splicing and trans-splicing. Cis-splicing is the process of excising intron sequences from cis-RNA transcripts (mRNA or other RNA). In host cells, this process occurs in the nucleus. Cis-splicing is known to those skilled in the art and is described, in particular, under the heading "DNA to RNA" in Alberts B, Johnson A, Lewis J, et al. (2002) “Molecular Biology of the Cell. 4th edition.” New York: Garland Science.

[0134] Generally, the therapy or treatment or prevention of a disease involves administering to a mammalian subject in need a composition comprising an effective amount of an AAV vector, an AAV vector system, a vector, or a nucleic acid molecule as described herein, such as a premRNA trans-splicing molecule possessing a nucleic acid sequence encoding a target transgene / nucleotide sequence or a fragment thereof, under the control of a regulatory sequence that expresses a gene product in target cells of the subject, such as eye cells, and optionally further pharmaceutically acceptable carriers.

[0135] The present invention also relates to pharmaceutical compositions comprising the AAV vector, AAV vector system, vector, or nucleic acid sequence (e.g., premRNA trans-splicing molecule) described in the present invention. Such pharmaceutical compositions may further comprise a carrier, preferably a pharmaceutically acceptable carrier.

[0136] The pharmaceutical composition may be in the form of an injectable solution. The injectable solution or suspension may be formulated according to known techniques using a suitable non-toxic, pharmaceutically acceptable diluent or solvent such as mannitol, 1,3-butanediol, water, Ringer's solution, or isotonic sodium chloride solution, or a suitable dispersant or wetting agent and suspending agent, such as a sterile, aseptic, synthetic monoglyceride, synthetic diglyceride, or a fixative oil containing fatty acids including oleic acid.

[0137] For injectable formulations, the pharmaceutical composition may be in the form of a lyophilized powder mixed with suitable excipients in a suitable vial or tube. Before use in a clinic, the drug can be reconstituted by dissolving the lyophilized powder in a suitable solvent system to form a composition suitable for intravenous or intramuscular injection, or for subretinal, intravitreous, or subconjunctival injection.

[0138] The pharmaceutical composition of the present invention is also intended to be formulated and administered as eye drops.

[0139] The AAV vectors, AAV vector systems, vectors, or nucleic acid sequences (e.g., premRNA trans-splicing molecules) described in the present invention, or the pharmaceutical compositions of the present invention, can be administered in therapeutically effective doses. The "therapeutically effective dose" of nucleic acid sequences or vectors such as AAV vectors, AAV vector systems, or premRNA trans-splicing molecules can vary depending on factors including, but not limited to, the stability of the active compound in the patient's body, the severity of the condition to be alleviated, the total weight of the patient being treated, the route of administration, the ease of absorption, distribution, and excretion of the active compound by the body, the age and sensitivity of the patient being treated, and adverse events, as will be apparent to those skilled in the art.

[0140] In principle, the AAV vectors, AAV vector systems, vectors, nucleic acid sequences such as premRNA trans-splicing molecules, or pharmaceutical compositions of the present invention can be administered by any preferred method. For example, the AAV vectors, AAV vector systems, vectors, nucleic acid sequences, or pharmaceutical compositions of the present invention containing a desired trans gene (i.e., the nucleotide sequence of interest) for use in target tubes of photoreceptor cells can be formulated into pharmaceutical compositions intended for subretinal or intravitreous injection. Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to the desired organ (e.g., eyes, e.g., eye drops), oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parenteral routes. The routes of administration can be combined as needed.

[0141] Furthermore, non-invasive retinal imaging and functional studies may be desirable to identify specific areas of eye cells that should be treated.

[0142] The AAV vectors, AAV vector systems, vectors, or nucleic acid sequences such as premRNA trans-splicing molecules described herein, or the pharmaceutical compositions of the present invention, can be administered to a subject using a physiologically acceptable carrier as described herein. The concentration of AAV in the pharmaceutical composition or at administration may be between 10E8 and 10E12 total vector genomes per μl, preferably between 6 × 10E8 and 6 × 0E10 per μl. The AAV vector can also be administered at a concentration of approximately 10E9 vector genomes per μl.

[0143] The AAV vector, AAV vector system, vector, or nucleic acid sequence (e.g., premRNA trans-splicing molecule) or pharmaceutical composition of the present invention may be administered with a carrier or in combination with other treatments. Accordingly, the pharmaceutical composition may also additionally or alternatively contain one or more further active ingredients.

[0144] The pharmaceutical compositions, AAV vectors, AAV vector systems, vectors, premRNA trans-splicing molecules, or nucleic acid sequences described herein can be administered to a subject. The AAV vectors, AAV vector systems, vectors, premRNA trans-splicing molecules, nucleic acid sequences, or pharmaceutical compositions described herein are applicable to both human therapeutic and animal use, preferably for the treatment of eye diseases, particularly gene therapy for eye diseases. Examples of suitable eye diseases include autosomal recessive severe early-onset retinal degeneration (Leber congenital amaurosis), congenital color blindness, Stargardt disease, Best's disease (vitiligo macular degeneration), and Doyne's disease. Retinitis pigmentosa (especially autosomal dominant, autosomal recessive, X-linked, bigenic, or polygenic retinitis pigmentosa), (X-linked) retinal schizophrenia, macular degeneration (AMD), age-related macular degeneration, atrophic age-related macular degeneration, neovascular AMD, diabetic maculopathy, proliferative diabetic retinopathy (PDR), cystic macular edema, central serous retinopathy, retinal detachment, endophthalmitis, glaucoma, posterior uveitis, congenital stasis nyctinitis, total choroidal atrophy, early-onset retinal dystrophy, cone dystrophy, rod-cone dystrophy or cone-rod dystrophy, pattern dystrophies, Usher syndrome and other symptomatic ciliary disorders. Ciliopathies include, but are not limited to, Valde-Vidl syndrome, Joubert syndrome, Senior-Loken syndrome, or Alstrom syndrome.

[0145] The subjects are mammals or any other vertebrates. Preferred mammals include, but are not limited to, mice, rats, cattle, goats, sheep, pigs, dogs, cats, horses, guinea pigs, canines, hamsters, minks, seals, whales, camels, chimpanzees, rhesus monkeys, and humans, with humans being preferred. Other vertebrates include, but are not limited to, zebrafish, salamanders, turkeys, chickens, geese, ducks, teal, mallards, starlings, pintails, seagulls, swans, guinea fowl, or some other waterfowl.

[0146] The present invention also relates to AAV vectors, AAV vector systems, vectors, nucleic acid sequences (e.g., premRNA trans-splicing molecules), or pharmaceutical compositions for use in the treatment of photoreceptor cell diseases. In these embodiments, the AAV vector (e.g., rAAV), AAV vector, AAV vector system, vector, nucleic acid sequence (e.g., premRNA trans-splicing molecules), or pharmaceutical composition may contain a target nucleotide sequence which is a heterogeneous nucleic acid encoding a therapeutic polypeptide or a portion thereof, a therapeutic nucleic acid or a portion thereof, a therapeutic protein / polypeptide or a portion thereof, or a therapeutic molecule or a portion thereof.

[0147] Similar to mRNA splicing, which evolved to remove non-coding RNA sequences, unwanted protein sequences can be excised during a process known as protein splicing. In this context, protein fragments called extaines (analogs of exons) can be spliced ​​together with so-called intaines (analogs of introns) during excision. In contrast to mRNA splicing, which requires a complex splicing mechanism, protein splicing is an autocatalytic chemical process. Protein splicing can also occur between two different proteins; this is a process known as protein trans-splicing. For this purpose, the intaine is split into two parts, each of which is tagged with the protein to be fused. This approach results in a flawless fusion of two proteins or polypeptides, or parts thereof, without the need for additional factors. Split-intein techniques can be further combined with mRNA trans-splicing to further enhance the efficiency of protein reconstitution. Accordingly, in one embodiment, the first nucleic acid sequence or first AAV vector further comprises a nucleic acid sequence encoding the N-terminal portion of the intent between nucleotide sequences encoding the N-terminal portion of the polypeptide of interest (or the 5' portion of the nucleic acid of interest) and a donor splice site, and the second nucleic acid sequence or second AAV vector further comprises a nucleic acid sequence encoding the C-terminal portion of the intent between nucleotide sequences encoding the C-terminal portion of the polypeptide of interest (or the 3' portion of the nucleic acid of interest) and a acceptor splice region.

[0148] It is clear that all possible embodiments of the ASS of the present invention can be used with modifications as necessary in the method described herein, the nucleic acid sequences such as premRNA transsplicing molecules, kits, AAV vectors, AAV vector systems, and in use.

[0149] The present invention is further characterized by the following:

[0150] 1. Use of nucleic acid sequences including the following to separate the target nucleotide sequence from the acceptor splice region sequence by cleaving the acceptor splice region: (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and bb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence; where the target nucleotide sequence is, (iia) It is localized on the 3' or 5' side of the splice region.

[0151] 2. A nucleic acid sequence containing the following, for selectively separating the target nucleotide sequence from the acceptor splice region by cleaving the acceptor splice region: (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and bb) Here the receptive splice site contains a NAGG sequence from 5' to 3', where N is A, C, T / U, or G.

[0152] 3. Use of the nucleic acid sequence of item 1 or item 2, wherein the receptive splice region further comprises a branching nucleotide, preferably adenosine and / or an intronic splice enhancer.

[0153] 4. The receptive splice region further includes a branching nucleotide sequence (c), the branching nucleotide sequence is (ca) Contains 1 to 15 nucleotides; (cb) comprising a branching nucleotide, preferably adenosine (A); and (cc) Located 5' to the pyrimidine region and the receptor splice site, Use or nucleic acid sequence as described in any one of items 1-3.

[0154] 5. Use of a nucleic acid sequence or nucleic acid sequence described in any one of items 1 to 4, wherein the pyrimidine region, the receptive splice region, and optionally further branching point sequences and / or intron splice enhancers contain approximately 200, 150, 1000, 500, 250, 100, 50, 45, 40, 35, 30, 25, 20, 15 or fewer nucleotides in total, preferably 26 nucleotides.

[0155] 6. (a) The pyrimidine region contains a sequence of TTTTTT or TCTTTT between 5 and 25 nucleotides; (b) The sequence between the last pyrimidine in the pyrimidine region and the acceptor splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases; and / or (c) The receptive splice site has a CAGG sequence, Use of a nucleic acid sequence or nucleic acid sequence listed in any one of items 1-5.

[0156] 7. The receptive splice region further includes the use of any one of the nucleic acid sequences described in items 1-6: (a) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (b) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (c) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is C; (d) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (e) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (f) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (g) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (h) 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is CAA; or (i) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC.

[0157] 8. The receptive splice region has the sequence of sequence number 3 or 4, or the use of any nucleic acid sequence described in any one of items 1 to 7.

[0158] 9. Use of a nucleic acid sequence described in any one of items 1 to 8, further comprising a donor splice site or a nucleic acid sequence.

[0159] 10. Use of a nucleic acid sequence or nucleic acid sequence as described in any one of items 1 to 9, wherein the nucleic acid sequence further comprises a promoter, preferably where the nucleic acid sequence is a DNA sequence and further comprises a promoter.

[0160] 11. Use of nucleic acid sequences listed in any one of items 1-10, including the following: (i) Receptor splice region sequence including the following, The pyrimidine region including (iia) and below, (iiaa) 5-25 nucleotides; (iiab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (iib) Receptor splice site, (iiba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (iibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence; where the receptive splice region is localized to the 3' or 5' side of the target nucleotide sequence; (iii) A premRNA-targeting binding domain localized to the 3' or 5' end of the target nucleotide sequence; and (iv) Optionally, a spacer sequence, where the spacer sequence is localized between the binding domain and the receptor splice region.

[0161] 12. Use of nucleic acid sequences listed in any one of items 1-11, including the following: (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iiiaa) 5-25 nucleotides; (iiiab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence; here the receptive splice region is localized to the 5' end of the target nucleotide sequence; (iii) A donor splice site located at the 3' end of the target nucleotide sequence; (iv) A primary binding domain located at the 5' end of the target nucleic acid sequence, which targets premRNA; (v) A second binding domain located at the 3' end of the target nucleic acid sequence, which targets premRNA; (vi) an optional first spacer sequence, where the first spacer sequence is localized between the first binding domain and the receptive splice region; and (vii) Optionally, a second spacer sequence, localized between the second binding domain and the receptive splice region.

[0162] 13. The nucleic acid sequence comprises at least two reverse terminal repeats, and the adeno-associated virus (AAV) vector comprises the nucleic acid sequence between these two reverse terminal repeats, where the nucleic acid sequence is from 5' to 3'. (i) promoter; (ii) Optionally selected joining domain; (iii) Receptor splice region sequence including the following (a) Pyrimidine region including the following, (aa) 5-25 nucleotides; (ab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (b) Receptor splice site, ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and bb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (v) The target nucleotide sequence; (vi) Optionally, a termination sequence, preferably a poly-A sequence. The use of any nucleic acid sequence described in any one of items 1 through 12, including or including any nucleic acid sequence.

[0163] 14. Use of any nucleic acid sequence described in item 1-13, or a nucleic acid sequence in which the receptive splice region is localized within the vector, within the AAV vector, or within the premRNA transsplicing molecule.

[0164] 15. The receptive splice region is used for trans-splicing, using any one of the nucleic acid sequences described in items 1-14 or a nucleic acid sequence.

[0165] 16. Methods for constructing nucleic acid sequences, including the following: (A) A step of providing a first nucleic acid sequence comprising one or more donor splice site sequences; (B) A step of providing a second nucleic acid sequence including the following; (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence, where the target nucleotide sequence is (iia) Located on the 3' side of the receptive splice region; and (C) Steps to obtain a nucleic acid sequence.

[0166] 17. The method described in item 16, further comprising the following steps: (D) A step of cleaving the first nucleic acid sequence at one or more donor splice site sequences and cleaving the second nucleic acid sequence at the recipient splice site. (E) A step of ligating a first cleaved nucleic acid sequence to a second cleaved nucleic acid sequence to obtain a nucleic acid sequence.

[0167] 18. The method according to item 16 or 17, wherein the first nucleic acid sequence further comprises the nucleotide sequence of interest or a portion thereof, wherein at least a portion of the nucleotide sequence of interest is located on the 5' side of the donor splice site, and the second nucleic acid sequence further comprises the nucleotide sequence of interest or a portion thereof, wherein at least a portion of the nucleotide sequence of interest is located on the 3' side of the splice-receiving splice region.

[0168] 19. The method according to any one of items 16-18, wherein the first and second nucleic acid sequences are introduced into a host cell, and preferably the first and second nucleic acid sequences are recombinant nucleic acid sequences.

[0169] 20. Methods for constructing nucleic acid sequences, including the following: (A) A step of providing a first nucleic acid sequence comprising one or more donor splice site sequences; (B) A step of providing a second nucleic acid sequence including the following; (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (C) A step of cleaving a first nucleic acid sequence at one or more donor splice site sequences and cleaving a second nucleic acid sequence at a recipient splice site. (D) A step of ligating a first cleaved nucleic acid sequence to a second cleaved nucleic acid sequence to obtain a nucleic acid sequence.

[0170] 21. The method according to any one of items 16-20, wherein the first nucleic acid sequence further comprises the nucleotide sequence of interest or a portion thereof, wherein at least a portion of the nucleotide sequence of interest is located on the 5' side of the donor splice site, and the second nucleic acid sequence further comprises the nucleotide sequence of interest or a portion thereof, wherein at least a portion of the nucleotide sequence of interest is located on the 3' side of the splice-receiving splice region.

[0171] 22. Methods for preparing nucleic acid sequences, including the following, or methods according to any one of items 16-21: (A) A step of introducing a first nucleic acid sequence containing a premRNA transsplicing molecular sequence or a nucleic acid sequence encoding the premRNA transsplicing molecule into a host cell, wherein the first premRNA transsplicing molecule comprises the following from 5' to 3'. (a) The 5' portion of the target nucleotide acid sequence; (b) Donation splice site; (c) Optional spacer arrangement; (d) the first binding domain; and (e) optionally a stop sequence, preferably a polyA sequence, and (B) A step of introducing a second nucleic acid sequence containing a premRNA transsplicing molecular sequence or a nucleic acid sequence encoding the above-mentioned premRNA transsplicing molecule into a host cell, wherein the second premRNA transsplicing molecule comprises the following from 5' to 3': (i) A second binding domain complementary to the first target domain of the first nucleic acid sequence; (ii) Receptor splice region sequence including the following; The pyrimidine region including (iia) and below, (iiaa) 5-25 nucleotides; (iiab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (iib) Receptor splice site, (iiba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (iibb) Hereinafter, the receptor splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (iii) the 3' portion of the target nucleotide sequence, and This process involves obtaining the target nucleic acid sequence, optionally. (C) A step of cleaving the first nucleic acid sequence at the donor splice site sequence and the second nucleic acid sequence at the acceptor splice site; and (D) A step of obtaining the target nucleic acid sequence by concatenating a first cleaved nucleic acid sequence containing the 5' portion of the target nucleotide sequence with a second cleaved nucleic acid sequence containing the 3' portion of the target nucleotide sequence. It also includes.

[0172] 23. (a) The pyrimidine region contains the sequence TTTTTT or TCTTTT; (b) The sequence between the last pyrimidine in the pyrimidine region and the acceptor splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases; and / or (c) The receptive splice site has a CAGG sequence, The method described in any one of items 16-22.

[0173] 24. The receptive splice area further includes any one of the methods described in items 16-23: (a) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (b) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (c) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is C; (d) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (e) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (f) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (g) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (h) 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is CAA; or (i) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC.

[0174] 25. Nucleic acid sequences including the following: (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence; where the target nucleotide sequence is, (iia) It is localized to the 3' or 5' side of the receptor splice region.

[0175] 26. Includes the following: (i) Receptor splice region sequence including the following, (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence; where the target nucleotide sequence is, (iia) Localized to the 3' or 5' side of the receptive splice region; And optionally, the nucleotide sequence of interest here is not the rhodopsin gene of SEQ ID NO: 10 and / or not exon 3 of the rhodopsin gene of SEQ ID NO: 9 and / or not exon 3 of the rhodopsin gene of SEQ ID NO: 9 and / or the nucleotide sequence of interest here does not contain the sequence shown in SEQ ID NO: 9 and / or SEQ ID NO: 10.

[0176] 27. The nucleic acid sequence is a nucleic acid sequence described in item 25 or 26, having a length of up to 150 nucleotides.

[0177] 28. A nucleic acid sequence is a nucleic acid sequence described in any one of items 25-27, having a length of up to 5500 nucleotides.

[0178] 29. A nucleic acid sequence according to any one of items 25-28, wherein (a) 5-25 nucleotides of the pyrimidine region contain the sequence TTTTTT or TCTTTT, and / or (b) the sequence between the last pyrimidine of the pyrimidine region and the acceptor splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases.

[0179] 30. Receptor splice region sequences including the following: (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G.

[0180] 31. (a) The pyrimidine region contains the sequence TTTTTT or TCTTTT; (b) The sequence between the last pyrimidine in the pyrimidine region and the acceptor splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases; and / or (c) The receptive splice site has a CAGG sequence, A nucleic acid or receptive splice region sequence described in any one of items 25-30.

[0181] 32. The receptive splice region is a nucleic acid or receptive splice region sequence described in any one of items 25-31, further including: (a) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (b) The 7 nucleotides on the 5' side of a pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (c) The 7 nucleotides on the 5' side of a pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (d) The 7 nucleotides on the 5' side of a pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (e) The 7 nucleotides on the 5' side of a pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (f) The 7 nucleotides on the 5' side of a pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (g) The 7 nucleotides on the 5' side of a pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (h) The 7 nucleotides on the 5' side of a pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; or (i) The 7 nucleotides on the 5' side of a pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC.

[0182] 33. A pre-mRNA trans-splicing molecule comprising: (i) An acceptor splice region comprising: (iia) A pyrimidine region comprising: (iiaa) 5 to 25 nucleotides; (iiab) wherein at least 60% of the nucleotides within these 5 to 25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (iib) An acceptor splice site, (iiba) wherein the acceptor splice site is located on the 3' side of the pyrimidine region; and (iibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) the target nucleotide sequence or a portion thereof; where the receptive splice region is localized to the 3' or 5' end of the target nucleotide sequence or a portion thereof; (iii) A binding domain that targets premRNA localized to the 5' end of the target nucleic acid sequence or a portion thereof; and (iv) Optionally, a spacer sequence, which is localized between the binding domain and the receptor splice region.

[0183] 34. A pre-mRNA trans-splicing molecule as described in item 33, further comprising a nucleic acid molecule and a donor splice site on the 3' side of the receptive splice region.

[0184] 35. Pre-mRNA trans-splicing molecules described in item 33 or 34, including the following: (i) Acceptance splice region including the following (ia) The pyrimidine region including the following, (iiiaa) 5-25 nucleotides; (iiiab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (ii) The target nucleotide sequence, where the receptive splice region is localized to the 5' end of the target nucleotide sequence; (iii) A donor splice site located at the 3' end of the target nucleotide sequence; (iv) A first binding domain that targets premRNA located at the 5' end of the target nucleotide sequence; (v) A second binding domain that targets premRNA located at the 3' end of the target nucleotide sequence; (vi) Optionally, a first spacer sequence, where the first spacer is localized between the first binding domain and the receptive splice region; (vii) Optionally, a second spacer sequence, where the second spacer is localized between the second binding domain and the receptive splice region.

[0185] 36. A premRNA transsplicing molecule described in any one of items 33-35, wherein the receptive splice region is localized to the 5' end of the target nucleotide sequence or a portion thereof, and the binding domain is localized to the 5' end of the receptive splice region.

[0186] 37. A premRNA transsplicing molecule according to any one of items 33-36, further comprising a stop sequence, preferably a poly(A) sequence.

[0187] 38. (a) The pyrimidine region contains the sequence TTTTTT or TCTTTT between 5 and 25 nucleotides; (b) The sequence between the last pyrimidine in the pyrimidine region and the acceptor splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases; and / or (c) The receptive splice site has a CAGG sequence, A premRNA transsplicing molecule described in any one of items 33-37.

[0188] 39. The receptive splice region further includes any one of the premRNA trans-splicing molecules listed in items 33-38: (a) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (b) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (c) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is C; (d) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (e) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (f) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (g) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (h) 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is CAA; or (i) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC.

[0189] 40. A DNA molecule containing a promoter and a sequence encoding a premRNA trans-splicing molecule described in any one of items 33-39.

[0190] 41. Adeno-associated virus (AAV) vector systems including the following: (I) A first AAV vector comprising at least two reverse end repeats comprising the nucleic acid sequence between these two reverse end repeats, wherein the nucleic acid sequence between these two reverse end repeats is from 5' to 3' (a) promoter, (b) The nucleotide sequence encoding the N-terminal portion of the target polypeptide; (c) Donation splice site; (d) Optional spacer arrangement; (e) a first binding domain; and (f) optionally, a termination sequence, preferably a polyA sequence; A first AAV vector comprising (II) A second AAV vector comprising a nucleic acid sequence comprising at least two inverted terminal repeats, wherein the nucleic acid sequence between these two inverted terminal repeats is from 5' to 3' (i) a promoter; (ii) a second binding domain complementary to the first binding domain of the first AAV vector; (iii) a receptor splice region sequence comprising (a) a pyrimidine region comprising (aa) 5 to 25 nucleotides; (ab) wherein at least 60% of the nucleotides within these 5 to 25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (b) a receptor splice site (ba) wherein the receptor splice site is located on the 3' side of the pyrimidine region; and (bb) wherein the receptor splice site comprises the sequence NAGG from 5' to 3', where N is A, C, T / U, or G; (iv) a nucleotide sequence encoding the C-terminal portion of the polypeptide of interest; (iva) wherein the C-terminal portion of the polypeptide of interest and the N-terminal portion of the polypeptide of interest reconstruct the polypeptide of interest; and (v) a termination sequence, preferably a polyA sequence.

[0191] 42. The AAV vector system according to item 41, wherein the polypeptide is a full-length polypeptide, the first AAV vector comprises the N-terminal portion of the full-length polypeptide of interest, and the second AAV vector comprises the C-terminal portion of the full-length polypeptide of interest.

[0192] 43. The AAV vector system described in item 41 or 42, wherein the C-terminal portion of the target polypeptide corresponds to a portion of the target polypeptide, or optionally, the full-length target protein from which the N-terminal portion contained in the first AAV vector has been deleted.

[0193] 44. An AAV vector system according to any one of items 41-43, wherein the first and second AAV vectors include a stop sequence, preferably a poly-A sequence.

[0194] 45. An adeno-associated virus (AAV) vector comprising at least two reverse-terminal repeats, wherein the nucleic acid sequence is located between the two reverse-terminal repeats, and the nucleic acid sequence is located from 5' to 3'. (i) promoter; (ii) Optional spacer arrangement; (III) Joint domain; (iv) Receptor splice region sequence including the following (a) Pyrimidine region including the following, (aa) 5-25 nucleotides; (ab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (b) Receptor splice site, ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and bb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; (iv) the target nucleotide sequence; and (v) Optionally, a stop sequence, preferably a poly(A) sequence. Adeno-associated virus (AAV) vectors containing this virus.

[0195] 46. ​​(a) The pyrimidine region contains the sequence TTTTTT or TCTTTT between 5 and 25 nucleotides; (b) The sequence between the last pyrimidine in the pyrimidine region and the acceptor splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases; and / or (c) The receptive splice site has a CAGG sequence, An AAV vector or AAV vector system listed in any one of items 41-45.

[0196] 47. The receptive splice region further includes any of the AAV vectors or AAV vector systems described in items 41-46: (a) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (b) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (c) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is C; (d) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (e) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (f) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (g) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (h) 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is CAA; or (i) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC.

[0197] 48. Receptive splice regions, including the following: (ia) The pyrimidine region including the following, (iaa) 5-25 nucleotides; (iab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, (iba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and (ibb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G.

[0198] 49. A receptive splice region according to any one of items 1 to 48 for use in a vector, AAV vector, or premRNA transsplicing molecule according to the present invention.

[0199] 50. (a) The pyrimidine region contains the sequence TTTTTT or TCTTTT; (b) The sequence between the last pyrimidine in the pyrimidine region and the acceptor splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases; and / or (c) The receptive splice site has a CAGG sequence, The receptor splice region sequence described in either item 48 or 49.

[0200] 51. The receptive splice region further includes any of the receptive splice region sequences described in any one of items 48-50: (a) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (b) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; (c) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is C; (d) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (e) The 7 nucleotides at the 5' end of the pyrimidine region having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (f) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; (g) The 7 nucleotides at the 5' end of the pyrimidine region having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; (h) 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of sequence CAACGAG, where the first 5' nucleotide is CAA; or (i) The 7 nucleotides at the 5' end of the pyrimidine region having at least 6 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC.

[0201] 52. A kit comprising a receptive splice region, an AAV vector, an AAV vector system, a vector, DNA, a nucleic acid sequence, or a premRNA trans-splicing molecule according to the present invention.

[0202] 53. Method for producing the target nucleic acid sequence, including the following: (A) The process of providing a nucleic acid sequence to a host cell, comprising the following steps: (i) One or more donor splice site sequences; (ii) Receptor splice region sequence including the following (a) Pyrimidine region including the following, (aa) 5-25 nucleotides; (ab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (b) Receptor splice site, ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and bb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G. (iii) the target nucleotide sequence, where the target nucleotide sequence is; (a) is located on the 3' side of the donor splice site and the 5' side of the recipient splice area; and (B) A step of cleaving a nucleic acid sequence between G and G in one or more donor splice site sequences of (i) and in the splice acceptor sequence (site) of NAGG, thereby separating the target nucleotide sequence from the donor splice site and the acceptor splice region.

[0203] 54. Methods for producing / cutting the target nucleic acid sequence, including the following: (a) A step of providing a nucleic acid sequence including the following (i) Receptor splice region sequence including the following (ia) The pyrimidine region including the following, (aa) 5-25 nucleotides; (ab) Here, at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, such as cytosine (C), thymine (T), and / or uracil (U); (ib) Receptor splice site, ba) Here the receptive splice site is located on the 3' side of the pyrimidine region; and bb) Here the receptive splice site contains a sequence of NAGG from 5' to 3', where N is A, C, T / U, or G; and (ii) The target nucleotide sequence, where the target nucleotide sequence is (iia) Located on the 3' or 5' side of the splice region; (b) A step of cleaving the acceptor splice region, thereby separating the target nucleotide sequence from the acceptor splice region sequence.

[0204] 55. A nucleotide molecule, premRNA transsplicing molecule, AAV vector, AAV vector system, or pharmaceutical composition containing a vector, as described in any of items 1 to 54.

[0205] 56. Nucleic acid molecules, premRNA transsplicing molecules, AAV vectors, AAV vector systems, vectors, DNA molecules, or pharmaceutical compositions described in any of items 1 to 54, for use in the treatment, preferably in the treatment of eye diseases.

[0206] 57. Methods of treating the target nucleic acid sequence, including the following: (a) A step of administering to a subject (in a therapeutically effective amount) a nucleic acid molecule, premRNA transsplicing molecule, AAV vector, AAV vector system, vector, DNA molecule, or pharmaceutical composition described in any of items 1 to 56.

[0207] 58. Nucleic acid molecules, premRNA transsplicing molecules, AAV vectors, AAV vector systems, vectors, DNA molecules, or pharmaceutical compositions described in any of items 1 to 57, for the manufacture of pharmaceuticals.

[0208] 59. Eye diseases include autosomal recessive severe early-onset retinal degeneration (Leber congenital amaurosis), congenital color blindness, Stargardt disease, Best's disease (vitiligo macular degeneration), and Doyne's disease. Retinitis pigmentosa (especially autosomal dominant, autosomal recessive, X-linked, bigenic, or polygenic retinitis pigmentosa), (X-linked) retinal schizophrenia, macular degeneration (AMD), age-related macular degeneration, atrophic age-related macular degeneration, neovascular AMD, diabetic maculopathy, proliferative diabetic retinopathy (PDR), cystic macular edema, central serous retinopathy, retinal detachment, endophthalmitis, glaucoma, posterior uveitis, congenital stasis nyctinitis, total choroidal atrophy, early-onset retinal dystrophy, cone dystrophy, rod-cone dystrophy or cone-rod dystrophy, pattern dystrophies, Usher syndrome and other symptomatic ciliary disorders. Nucleic acid molecules, premRNA transsplicing molecules, AAV vectors, AAV vector systems, vectors, DNA molecules, pharmaceutical compositions, or methods for use as described in any of items 1 to 58, selected from the group consisting of ciliopathies, such as Valde-Vidl syndrome, Joubert syndrome, Senior-Loken syndrome, or Alstrom syndrome.

[0209] It should be noted that, as used herein, the singular forms “a,” “an,” and “the” include multiple references unless the context clearly indicates otherwise. For example, a reference to “reagent” includes one or more such different reagents, and a reference to “method” includes a reference to an equivalent process or method known to those skilled in the art that can be modified or substituted for the method described herein.

[0210] Furthermore, as used herein, the term “about” when referring to measurable values ​​such as the amount or length, dose, time, or temperature of a polynucleotide or polypeptide sequence means to include a variation of ±20%, ±10%, ±5%, ±1%, ±0.5%, or ±0.1% of the specified amount. Also, as used herein, “and / or” means and includes the absence of the relevant enumerated items, as well as the combination when interpreted as an alternative ("or").

[0211] Unless the context clearly indicates otherwise, it is particularly intended that the various features of the invention described herein may be used in any combination.

[0212] Furthermore, the present invention also intends that, in some embodiments of the present invention, any feature or combination of features described herein may be excluded or omitted.

[0213] All publications and patents cited in this disclosure are incorporated in their entirety by reference. In the event that any material incorporated by reference conflicts with or is in conflict with this Specified

[0214] Unless otherwise specified, the term “at least” preceding a set of elements should be understood to refer to all elements of that set. Those skilled in the art will recognize, or can verify by routine experimentation alone, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be incorporated into the invention.

[0215] Throughout this specification and the following claims, unless otherwise specified in the context, the words “comprise,” and variations such as “comprises,” and “comprising,” are understood to mean that they include the integer or process or group of integers or processes described, but not any other integer or process or group of integers or processes. As used herein, the term “comprising” may be replaced with the term “containing,” or, as used herein, with the term “having.” However, as used herein, “comprising of” or equivalent terms encompasses and may be replaced with “consisting of” or “consisting essentially of,” as defined below.

[0216] As used herein, "comprising of" excludes any elements, processes, or components not specified in the claims. As used herein, "consisting essentially of" does not exclude any materials or processes that do not substantially affect the basic and novel features of the claims.

[0217] The arrangement used in this invention:

[0218] The following sequences, which exceed 10 nucleotides, are referenced herein:

[0219] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] Table 1: Presumed branching point sequences are underlined, branching points are underlined twice, and shown in bold. Pyrimidine region sequences are shown in italics, and acceptor splice sites are shown in bold. Underlined sequences 9 and 10 are mutations from 620T>G and the start and stop codons. [Examples]

[0220] The following examples illustrate the present invention. These examples should not be construed as limiting the scope of the invention. The examples are included for illustrative purposes only, and the invention is limited only by the claims.

[0221] material and method Cell culture and transfection Human fetal kidney 293 (HEK293) cells (DMSZ) were maintained in a CO2 incubator (Heraeus, Thermo Fisher Scientific) at 37°C and 10% CO2 in DMEM medium + GlutaMAX + 1 g / l glucose + pyruvate + 10% FBS (Biochrom) + 1% penicillin / streptomycin (Biochrom). HEK293-derived Lenti-X 293T (HEK293T) cells (Clontech, Takara) were cultured under the same conditions in DMEM medium + GlutaMAX + 4.5 g / l glucose + 10% FBS + 1% penicillin / streptomycin. Both cell lines were passaged twice weekly at approximately 90% confluence.

[0222] Transient transfection was performed using the calcium phosphate method. For this purpose, cells were seeded in 6 cm cell culture plates. When transfecting with a plasmid containing SpCas9 for Western blotting, 10 cm cell culture plates were used. Cells were incubated overnight until the desired confluence of approximately 70% was reached. The transfection mix components were added to 15 ml Falcon tubes in the order shown. 2 × BBS were added dropwise during vortexing.

[0223] The transfection mix was incubated at room temperature for 3–4 minutes and then added to the culture medium. In the initial experiment (Example 2, Figure 4), cells were incubated at a 5% CO2 setting for 24 hours and harvested without changing the medium. In the optimized protocol (Examples 3, 5–8; Figures 9 and 11–14), cells were incubated at a 5% CO2 setting for 3–4 hours, the medium was changed, and the cells were maintained at 10% CO2 for approximately 48 hours. When plasmids containing fluorophores were transfected, the success of transfection and expression was assessed via the EVOS® FL cell imaging system (Life Technologies, Thermo Fisher Scientific).

[0224] 661W cells were provided by Professor Muayyad Al-Ubaidi (University of Houston). This cell line was cloned from mouse retinal tumors and found to exhibit the molecular characteristics of cone photoreceptors (al-Ubaidi et al., 1992, Tan et al., 2004). 661W cells were maintained in a CO2 incubator (Heraeus, Thermo Fisher Scientific) at 37°C and 10% CO2 on DMEM medium + GlutaMAX + 1 g / l glucose + pyruvate + 10% FBS (Biochrom) + 1% antibiotic-antifungal agent. They were passaged twice weekly at approximately 90% confluence. Transient transfection was performed using the calcium phosphate method described above.

[0225] Mouse embryonic fibroblasts (MEFs) were generated as described (Jat et al., 1986, Xu, 2005). Cells were maintained in a CO2 incubator (Heraeus, Thermo Fisher Scientific) at 37°C and 5% CO2 in DMEM medium + GlutaMAX + 1 g / l glucose + pyruvate + 10% FBS (Biochrom) + 1% penicillin / streptomycin (Biochrom). They were passaged weekly at approximately 90% confluence. MEFs were transiently transfected using TurboFect™ transfection reagent (Thermo Fisher Scientific). Cells were seeded in 6 cm cell culture plates and incubated until 70–90% confluence was reached. The reaction mixture was prepared in the following order:

[0226] After adding each component, the solution was vigorously mixed by vortexing. The transfection mix was incubated at room temperature for 15-20 minutes before being dropped onto culture plates. The medium was changed after 3 hours, and cells were harvested 48 hours after transfection. When plasmids containing fluorophores were transfected, the success of transfection and expression was evaluated via the EVOS® FL cell imaging system (Life Technologies, Thermo Fisher Scientific).

[0227] Production of recombinant adeno-associated virus Recombinant adeno-associated virus (rAAV) was produced by transfection of the pAAV2.1 plasmid containing the target gene, pAD, a helper plasmid, and a plasmid encoding the desired capsid. For subretinal injection into the mouse retina, the 2 / 8Y733F capsid variant was selected due to its high efficiency in photoreceptor and RPE transmission (Petrs-Silva et al., 2009, Mol. Ther, 17, 463-71). HEK293T cells were seeded in 15 × 15 cm cell culture plates and incubated overnight until 60–80% confluence was reached. Prior to transfection, the medium containing FBS was replaced with serum-free medium. The transfection reagents were added to a 50 ml Falcon tube in the order shown: 270 μg of pAAV2.1 plasmid, X μg of pAD helper plasmid, Y μg of capsid plasmid, 11.85 ml of H2O ad, 15 μl of polyblen (8 mg / ml), 1.5 ml of dextran (10 mg / ml), 1.5 ml of CaCl2 (2.5 M), and 15 ml of 2 × BBS. The required amounts of pAD helper and capsid plasmids were calculated using the following formulas: X μg = MM of 270 μg × pAAV2.1 pAD helper plasmid, Y μg = MM of 270 μg × pAAV2.1 capsid plasmid. CaCl2 and 2 × BBS were added dropwise to the vortex. 2 ml of the transfection mix was added dropwise to each of the 15 culture plates. The plate was gently shaken, and then left for 24 hours at a 5% CO2 setting. After that, the culture medium was changed, and the plate was left for another 48 hours at a 10% CO2 setting.

[0228] The virus-containing culture medium was collected twice. The first collection was performed 72 hours after transfection by collecting the entire medium from all plates and adding fresh medium. The second collection was performed after a further 72-hour incubation period. The medium was collected in a 500 ml centrifuge tube. Residual cells were removed from the medium by centrifugation at 4,000 rpm at 4°C for 15 minutes (JA-10 rotor, J2-MC high-speed centrifuge, Beckman Coulter) and filtering the supernatant through a 0.45 μm PES filter unit (Nalgene, Thermo Fisher Scientific). A 40% polyethylene glycol (PEG) solution was added to the flow-through to a final concentration of 8%, and the mixture was held overnight at 4°C to precipitate the virus particles. The solution was then centrifugated at 4,000 rpm at 4°C for 15 minutes (JA-10 rotor, J2-MC high-speed centrifuge, Beckman Coulter). The supernatant was discarded, and the virus-containing pellet was stored at -20°C until further processing.

[0229] For iodixanol density gradient centrifugation, the pellet was resuspended in 7.5 ml of sterile filtered PBS and incubated for 30 minutes in a 37°C water bath (Haake) with a final concentration of 50 U / ml Benzonase® (VWR) to remove any remaining unpackaged DNA. Next, the virus suspension was pipetteed into quick-seal polypropylene tubes (39 ml, Beckman Coulter) and a density gradient was established by adding solutions of lower iodixanol concentrations than the virus suspension in the following order: 7 ml of 15% iodixanol solution, 6 ml of 25% iodixanol solution, 5 ml of 40% iodixanol solution, and 6 ml of 60% iodixanol solution. A MINIPULS 3 peristaltic pump (Gilson) and long glass pipettes were used for this purpose. The tubes were then sealed with Beckman tube toppers and centrifuged in an Optima L-80K ultracentrifuge (70 Ti rotor, Beckman Coulter) at 70,000 rpm at 18°C ​​for 1 hour and 45 minutes. Subsequently, a cannula was opened at the top of the tube to ensure airflow. The 40% iodixanol phase, rich in virus particles, was collected from the gradient by puncturing the tube laterally at the boundary between the 40% and 60% phases using a 20G cannula and a 20ml syringe. The virus-containing solution was stored at -80°C until further processing was required.

[0230] To further purify the virus, anion exchange chromatography was performed using an AKTAprimeplus chromatography system (GE Healthcare), a 5 ml HiTrap™ Q FF anion exchange chromatography column (GE Healthcare), and PrimeView 5.31 software (GE Healthcare). Before starting, the column was equilibrated with buffer A (20 mM Tris, 15 mM NaCl, pH 8.5), and the virus-containing solution was diluted with this buffer in a 1:1 ratio. The solution was loaded onto the column via a loop injector (50 ml Superloop, GE Healthcare). The UV light absorption and conductance characteristics of the collected fractions were monitored to provide information about the amount of virus contained. Remaining bound molecules were removed from the column using a 2.5 M NaCl solution. All virus-containing fractions were pooled and used for subsequent processing. 3.5.4 Increasing rAAV Concentration

[0231] To increase the virus concentration, an Amicon® Ultra-4 centrifuge filter unit (Merck) with a molecular weight cutoff of 100 kDa was used. The virus-containing solution was loaded onto the top of the filter unit and centrifuged at 4,000 rpm (JA-10 rotor, J2-MC high-speed centrifuge, Beckman Coulter) at 4°C at 20-minute intervals until the volume decreased to 500 μl. Subsequently, the filter unit was washed with 1 ml of 0.014% Tween / PBS-MK (50 ml of 10×PBS, 500 μl of 1 M MgCl, 500 μl of 2.5 M KCl, with 500 ml of water added). The solution was further centrifuged under the same conditions until the volume decreased to 100 μl of concentrated virus solution. 10 μl aliquots were prepared and stored at -80°C until use.

[0232] To determine the titer of the generated rAAV, qPCR was performed using the StepOnePlus real-time PCR system (Applied Biosystems, Thermo Fisher Scientific). A calibration curve was created for reference. For this purpose, fragments containing a portion of the ITR were amplified by PCR using the following primers. ITR2 forward: 5' GGAACCCCTAGTGATGGAGTT 3' (Sequence ID: 30) ITR2 reverse: 5' CGGCCTCAGTGAGCGA 3' (Sequence ID: 31)

[0233] Next, the amplified product was purified and its concentration was determined using a Nanodrop™ 2000c spectrophotometer (Thermo Fisher Scientific). After preparing a standard solution of concentration c, 10 10 ~10 1 A dilution series covering the copy range was created. To achieve a calibration curve, qPCR was performed using three technical replications of the standard dilution series. For this purpose, a MicroAmp® high-speed optical 96-well reaction plate (Applied Biosystems, Thermo Fisher Scientific) and PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific) were used. The virus solution was diluted 100-fold with H2O and performed on the same reaction plate for three technical replications. The reaction mixture was prepared as follows. The obtained data were analyzed using StepOnePlus real-time PCR system software (Applied Biosystems, Thermo Fisher Scientific). Baseline settings and cycling threshold positions were manually adjusted as needed. The calibration curve was obtained by plotting the obtained cycle threshold (Ct) values ​​against the logarithm of the dilutions. The number of viral genomes per μl (vg / μl) of the generated rAAV can be estimated from the calibration curve.

[0234] subretinal injection For subretinal injection, C57Bl6 / J mice at 21 days postnatal (P21) were anesthetized by intraperitoneal injection of ketamine (40 mg / kg body weight) and xylazine (20 mg / kg body weight). After complete elimination of the paw withdrawal reflex, the pupils were dilated by administration of eye drops containing atropine (1%) and tropicamide (0.5%) (Mydriaticum Stulln, Pharma Stulln GmbH). The fundus was focused using a surgical microscope (OPMI 1 FR pro, Zeiss). 1 μl containing 1010 rAAV particles was injected subretinally in a single injection using a NANOFIL 10 μl syringe (World Precision Instruments) and a 34 G beveled needle (World Precision Instruments). The injected eye was treated with an eye ointment containing 5 mg / g gentamicin and 0.3 mg / g dexamethasone. Mice were placed on a 37°C heating plate (Leica HI1120, Leica Biosystems) until they had fully recovered from anesthesia. Two to four weeks after injection, all injected retinas were collected and processed for RT-PCR analysis or immunohistochemistry.

[0235] immunohistochemistry For immunohistochemistry, mice injected subretinally were euthanized via cervical dislocation. The eyes were removed and placed in 0.1 M phosphate buffer (PB). Subsequently, the eyeball was punctured with a 21 G cannula along the serrated edge and fixed with 4% paraformaldehyde (PFA, Sigma Aldrich, adjusted to pH 7.4) for 5 minutes. The eye was then placed under a stereomicroscope (Stemi 2000, Zeiss) on filter paper soaked in 0.1 M PB. The cornea, lens, and vitreous humor were removed by cutting along the serrated edge using surgical scissors (SuperFine Vannas, World Precision Instruments). The remaining part of the eyeball, including the retina, was fixed in 4% PFA at room temperature for 45 minutes, followed by three washes of 0.1 M PB for 5 minutes each. For cryopreservation, the eyeballs were placed overnight in 30% sucrose solution (w / v) at 4°C.

[0236] The following day, the eyeballs were embedded in tissue freezing medium (Sakura) and cooled on dry ice until the medium solidified. The retina was sliced ​​into 10 μm thick slices using a cryostat (Leica CM3050 S, Leica Biosystems), collected on coated glass object slides (Superfrost Plus microscope slides, Thermo Fisher Scientific), and stored at -20°C.

[0237] For immunohistochemical staining, retinal sections were thawed at room temperature and surrounded using a Super PAP Pen Liquid Blocker (Science Services). The sections were then rehydrated with 0.1 M PB for 5 minutes and fixed with 4% PFA for 10 minutes. After washing the sections three times with 0.1 M phosphate buffer, pH 7.4 (PB) for 5 minutes each, a solution containing primary antibody in 0.1 MPB, 5% ChemiBLOCKER (Merck), and 0.3% Triton X-100 was applied. The frozen sections were incubated overnight at 4°C with the primary antibody solution. The following day, the retinas were washed three times with 0.1 M PB for 5 minutes each and incubated at room temperature for 1.5 hours with a solution containing secondary antibody in 0.1 M PB and 2% ChemiBLOCKER. After washing three times with 0.1 M PB for 5 minutes each, the cell nuclei were stained with 5 μg / ml Hoechst 33342 solution (Invitrogen). Finally, the sections were washed with 0.1M PB, embedded in Fluoromount-G Mounting Medium (Thermo Fisher Scientific), covered with a coverslip, and stored at 4°C.

[0238] Confocal microscope Images of stained retinas were obtained using a Leica TCS SP8 inverted confocal laser scanning microscope (Leica Microsystems) equipped with a 405 nm diode suitable for excitation of Hoechst 33342, Cy3, and Cy5, respectively, as well as 552 nm and 633 nm optically pumped semiconductor lasers. Filter settings were selected according to the emission spectra of each dye. Images were acquired as z-stacks (1 μm steps) using LAS X software (Leica Microsystems) with an HC PL APO 40× / 1.30 oil CS2 objective lens (Leica Microsystems) and a Type F immersion solution (Leica Microsystems). The z-stacks were condensed into 2D images by applying maximum intensity projection using the same software. Images were further processed with ImageJ 1.48v software (National Institutes of Health).

[0239] Images of transiently transfected living cells were acquired using a Leica TCS SP8 spectral confocal laser scanning microscope (Leica Microsystems) equipped with optically pumped semiconductor lasers at 448 nm, 514 nm, and 552 nm, respectively, suitable for excitation of cerulean, citrin, and mCherry. Filter settings were selected according to the emission spectrum of each fluorophore. Images were acquired using an HCX APO 20× / 1.00W objective lens (Leica Microsystems). All images were processed with ImageJ 1.48v software.

[0240] RNA extraction For RNA extraction from injected retinas, mice were euthanized via cervical dislocation. The retinas were collected by placing blunt forceps under the eye, incising the eyeball with a sterile scalpel (Swann-Morton), and gradually moving the forceps upward. Three retinas were pooled per construct, and RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. For disruption, 350 μl of RLT buffer (Qiagen, included in the kit) + 3.5 μl of β-mercaptoethanol (β-ME, Sigma Aldrich) was added, and the tissue was homogenized at least five times by passing it through a 20 G needle attached to a sterile syringe. The remaining steps were carried out according to the protocol. RNA was eluted with 30 μl of RNAse-free H2O.

[0241] RNA extraction from transiently transfected cells was performed using the RNeasy Mini Kit Plus (Qiagen). For this purpose, the culture medium was removed from a 6 cm culture plate, and the cells were scraped off using a 16 cm cell scraper (Sarstedt). The cells were collected in 2 ml SafeLock tubes (Eppendorf) in 500 μl of medium and centrifuged at 3,000 × g at 4°C for 10 minutes. The supernatant was discarded, and the pellet was resuspended in 600 μl of RLT Plus buffer (Qiagen, included in the kit) + 6 μl of β-ME (Sigma Aldrich). Steel balls were placed in each tube, and the cells were lysed at 30 Hz for 1 minute using a Mixer Mill MM400 (Retsch). The balls were then removed, and the suspension was centrifuged at 21,000 × g at room temperature for 5 minutes. The remaining steps were performed according to a protocol that included an optional step of removing genomic DNA via a gDNA eliminator spin column. RNA was eluted with 30 μl of RNAse-free H2O.

[0242] RNA concentrations were measured using a Nanodrop™ 2000c spectrophotometer (Thermo Fisher Scientific). The RNA was kept on ice until further use, or stored at -20°C for short-term storage and -80°C for long-term storage.

[0243] cDNA synthesis For cDNA synthesis, the Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) was used according to the manufacturer's instructions. Equal amounts of RNA were used in each experiment. The cDNA reaction mix was incubated with a Mastercycler® nexus gradient. The cDNA was kept on ice until further use, or stored at -20°C for short-term storage and -80°C for long-term storage.

[0244] Reverse transcription PCR Reverse transcription PCR (RT-PCR) was performed using Herculase II fusion DNA polymerase (Agilent Technologies) or VWR Taq DNA polymerase (VWR).

[0245] Branch point analysis For nested lariat RT-PCR, RNA was extracted as described above. Following the manufacturer's instructions, 10 μg of RNA was incubated with RNase R (Lucigen) to remove all acyclic RNA. Subsequent cDNA synthesis (Revert Aid First Strand cDNA Synthesis Kit, Life Technologies) was performed as described above. Only random hexamer primers were used in this reaction. The lariat was then amplified by nested RT-PCR using Herculase II fusion DNA polymerase (Agilent Technologies). For the first amplification, the reaction mix was prepared as described in 3.12. For the second amplification, 5 μl of the initial PCR was added to the reaction mix instead of cDNA. Furthermore, a second primer pair was used, which bound 25–30 bp downstream of the first primer pair. The applied cycling conditions are shown in Table 11.

[0246] For TOPO cloning and lariat analysis, nested RT-PCR products were subcloned into plasmids. For this purpose, a 3'-adenine overhang was added to the DNA fragment after amplification by incubating one unit of Taq polymerase (VWR) with the PCR reaction at 72°C for 10 minutes. Subsequently, the lariat was subcloned into a TOPO vector (TOPO TA Cloning Kit, Thermo Fisher Scientific) according to the manufacturer's instructions. Plasmids were transformed into bacteria, and small-scale plasmid preparations were performed. The resulting plasmids were sequenced (Eurofins Genomics), and the resulting lariat sequences were analyzed by alignment with introns examined using DNAMAN software (Lynnon Biosoft).

[0247] Protein extraction For protein extraction, the culture medium was removed from 6 cm or 10 cm culture plates. Cells were scraped off using a 16 cm cell scraper (Sarstedt) and collected in 2 ml SafeLock tubes (Eppendorf) in 500 μl of medium. The cell suspension was centrifuged at 3,000 × g, 4 °C for 10 minutes, the supernatant was discarded, and the pellet was added to 150 μl and 250 μl of TritonX-100 (TX) lysis buffer (2.5 ml TritonX-100, 15 ml 5 mM NaCl, 0.4 ml 2.5 M CaCl2, 500 ml water; c0mplete® ULTRA protease inhibitor cocktail tablets (Roche) were added to the 6 cm and 10 cm plates respectively immediately before use (1 tablet / 10 ml)). Steel balls were added to each SafeLock tube, and the cells were lysed using a Mixer Mill MM400 (Retsch) at 30 Hz for 1 minute. Next, the tube containing the ball was rotated upside down at 4°C for 20 minutes (using a VWR™ tube rotator). Then, the ball was removed, and the lysate was centrifuged at 5,000 × g for 10 minutes at 4°C. The supernatant containing the protein was transferred to a new reaction tube and stored at -20°C.

[0248] Total protein concentration was quantified using the Bradford assay. 5 μl of protein lysate was mixed with 95 μl of 0.15 M NaCl solution and transferred to a PMMA standard disposable cuvette (BRAND). Subsequently, 1 ml of Coomassie blue solution was added and thoroughly mixed by pipetting, and incubated at room temperature for 2 minutes. The absorption of the solution against a blank control containing 5 μl of TX lysis buffer was measured using a BioPhotometer (Eppendorf). The obtained value represents the total amount of protein contained in 5 μl of lysate.

[0249] Example 1: Identification of an optimized ASS module The impact of disease-associated rhodopsin mutations on mRNA splicing has been analyzed using human rhodopsin (RHO) minigenes in HEK293 cells and transduced mouse photoreceptors. Among these, a single mutation in exon 3 of the RHO gene (c.620T>G) generates a novel ASS (Figure 1). The ASS sequence and predicted ASS elements are shown in Figures 2A and 2B.

[0250] In silico predictions showed that the receptor splice site formed by the c.620T>G mutation (hereinafter referred to as ASS_620) has a similar splice score to the native rhodopsin receptor splice site in exon 3 (see Figure 3A). This suggests that both splice sites can be used interchangeably by the splicing mechanism. However, experimental data showed that ASS_620 was exclusively used in both HEK293 cells (Figure 1D) and mouse photoreceptors (Figure 1E). This indicates that ASS_620 is a potent receptor splice site.

[0251] For promising biotechnological applications, the strength and function of ASS need to be independent of the genetic environment. To test whether ASS_620 functions in a different non-native environment and to determine the ASS_620 element required for the most efficient splicing, a variable-length sequence adjacent to the c.620T>G mutation was introduced into exon 3 of the RPS27 gene (Figure 2C). A single sequence resulted in varying splicing efficiency at the ASS_620 location (Figure 2D). The best splicing efficiency (close to 100%) was obtained using RHO-E3d containing the RPS27 minigene, i.e., a 26bp sequence with a 7bp sequence at the 5' end (CAACGAGTCTTTTGTCATCTACAGGT; SEQ ID NO: 3), poly-fine, and a minigene containing a standard ASS. Surprisingly, this sequence did not contain the predicted branch point present in RHO exon 3. The 7bp sequence at the 5' end (CAACGAG) may contain an effective branching point sequence whose characteristics have not yet been elucidated, or an intron splice enhancer recognition site necessary for the efficient use of ASS. The 26bp sequence (SEQ ID NO: 3) is referred to herein as "vgASS_620".

[0252] To further confirm the splicing efficiency of vgASS_620, it was introduced into four additional genes (HBQ1, S100A12, CLRN1, and CNGB1) with variable receptive splice site strength, randomly selected (Figure 3C). Compared to vgASS_620, the predicted strength of the native exon receptive splice site was high for RPS27, similar for S100A12, CLRN1, and HBQ1, and low for CNGB1 (Figure 3A). Subsequent RT-PCR experiments showed that vgASS_620 was used not only in RPS27 but also in all the additional genes tested here (Figures 3D-E). These results indicate that vgASS_620 is a very strong receptive splice site that is independent of the genetic environment. Therefore, it was hypothesized that vgASS_620 could be used to improve the currently quite low trans-splicing efficiency in SMaRT or dual adeno-associated virus (AAV) vector hybrid technologies.

[0253] Example 2: Cerulean reporter assay for in vitro use To test this hypothesis, a splice reporter assay was generated by splitting the cerulean coding sequence into two artificial exons interrupted by an artificial intron (Figure 4D). This intron contained vgASS_620 and a robust donor splice site separated from each other by an artificial 145 bp. Confocal imaging of transfected HEK293 cells revealed strong, robust cerulean fluorescence when both splice sites were donated in cis configuration (Figure 4F(c1)). RT-PCR experiments and sequencing of the corresponding bands confirmed that both cerulean exons were efficiently spliced ​​in this configuration (data not shown). Western blotting experiments using a specific antibody against the N-terminal portion of the cerulean, as shown in Figure 4G, detected a specific immune signal at the expected size (27 kDa). In summary, these findings suggest that the reporter assay is functional and highly efficient in the cis configuration. Therefore, in subsequent experiments, this construct was used as a reference to determine the efficiency of cerulean reconstitution when two cerulean splice fragments were provided in trans (i.e., on separate plasmids). The DSS used in this experiment had the sequence AAGGTAAG.

[0254] Next, the effects of binding domain and receptor splice site strength on cerulean rearrangement efficiency were analyzed using a reporter assay. Here, mRNA trans-splicing is required for reporter rearrangement.

[0255] For this purpose, a fluorescence reporter-based assay was developed in which the coding sequence of the cyan fluorescent protein "cerulean" was split again at position 154 (Figure 4D). As shown in Figure 4D(c3), the first DNA construct containing the 5' portion under the control of the CMV promoter further comprises a strong DSS (AAGGTAAG) and a subsequent binding domain, while the second DNA construct containing the 3' portion under the control of the CMV promoter comprises vgASS_620 as an ASS following a binding domain complementary to the binding domain of the first DNA construct. After transcription, base pairing of the BD brings the splicing elements into close proximity, facilitating trans-splicing and yielding full-length mature cerulean mRNA. Cerulean reconstruction can be detected optically, for example, by microscopy (as shown in Figure 4F) or flow cytometry, at the mRNA level (e.g., using RT-PCR) or at the protein level (e.g., using Western blotting as shown in Figure 4G).

[0256] Intron 2 of the human rhodopsin gene was selected as an exemplary template for optimizing the binding domain for two reasons: (1) Since the c.620T>G splice mutation is localized to exon 3, the optimized type of RHO intron 2 binding domain can be used for SMaRT-based substitution of the c.620T>G splice mutation (Figure 1). (2) The RHO intron 2 sequence is not homologous to any sequence in the mouse genome (data not shown), so it is not expected to cause off-target effects. Consequently, the optimized RHO intron 2 binding domain can also be used for rearranging other large human genes in the mouse retina using a dual AAV vector approach.

[0257] HEK293 cells were transiently co-transfected with the first and second DNA constructs as described above, as shown as an example of BD_h+i in Figure 4D(c3), and the presence of cerulean fluorescence was assessed by confocal live-cell imaging. Constructs containing both cis cerulean moieties interposed by artificial introns containing the same splicing element were used as a cis-splicing reference control (cis-ctrl). When the two halves were transfected separately, no fluorescence was detected. When both constructs were co-transfected, fluorescent cells were observed, indicating successful trans-splicing and rearrangement of the cerulean coding sequence.

[0258] The RHO intron 2 binding domain was optimized by altering its size and position (Figure 4A). Furthermore, artificial BDs, as with BD_h+i, were created and tested by fusing sequences derived from the 5' and 3' ends of the intron.

[0259] Following cotransfection of HEK293 cells, mRNA expression of the two constructs was analyzed compared to the housekeeping gene ALAS, using primers p1 and p2 for the 5' construct and primers p3 and p4 for the 3' construct, showing only small differences at the premRNA level (Figure 4B and C). Reconstruction efficiency was determined by radiometric analysis of cerulean protein bands compared to cis-ctrl, and varied significantly with different BDs (Figure 4E). All protein bands were normalized to beta-tubulin before quantification. The two binding domains BD_g (SEQ ID NO: 27) and BD_h+i (SEQ ID NO: 28), both approximately 100 bp in length, resulted in high cerulean reconstruction efficiencies reaching >30%. Importantly, this high efficiency far exceeded what had been known from previous studies using alternative approaches based on genomic-level split gene reconstruction (hybrid, overlap, and genomic "trans" splicing approaches) (Carvalho et al., 2017, Frontiers in Neurosciences, 11, Article 503). All three strategies were tested in vitro using the reporter gene lacZ. The highest rearrangement efficiency reported in this setting was 17.7%.

[0260] Recent studies have hypothesized that trans-splicing efficiency is not affected by the strength of the splice site (Lorain et al., 2013). To test this hypothesis, the cerulean reconfiguration efficiency of vgASS_620 was compared to that of the native receptor splice site of RHO exon 3 combined with the most efficient binding domain BD_h+i (SEQ ID NO: 28). As can be seen in Figure 4E, the reconfiguration efficiency derived from the native ASS was significantly lower than that of vgASS_620 (35.7±4.6% vs. 0.7±0.1%). This finding provides clear evidence that trans-splicing efficiency in dual-vector approaches is strongly dependent on the strength of the receptor splice site (Figures 4D-G).

[0261] The reconstruction effect may increase in later experiments (see, for example, Example 3, Figure 9D). Firstly, the number of independent samples (n) is still very small in the initial experiment. By increasing the number of independent samples (n) and optimizing the transfection protocol, the reconstruction efficiency can be more reliably quantified, and by improving the cotransfect efficiency, higher values ​​such as 60% or even higher (Figure 9) can be achieved.

[0262] In addition to HEK293 cells, the reconstitution effect of trans-splicing was also tested in 661W and MEF cells. Using the binding domain, >40% BD_g reconstitution effect was observed in 661W cells and >50% in MEF cells (data not shown). No significant difference in trans-splicing effect was detected when comparing the two cell lines. This suggests that the mRNA trans-splicing approach is cell type independent.

[0263] In summary, the in vitro results demonstrate that trans-splicing efficiency can be significantly increased not only by altering the sequence and length of the binding domain, but also by optimizing the strength of the receptor splice site. These promising findings open new avenues for further optimizing trans-splicing-based technologies.

[0264] In combination with vgASS_620, an SMaRT-based gene therapy approach for rhodopsin mutations within or downstream of exon 3 can be established using the binding domain "g" shown in Figure 4. Furthermore, vgASS_620 can also be combined with various other binding domains to treat other hereditary retinal disease (IRD) genes via SMaRT or dual AAV vector approaches. The disclosures provided herein apply to the use of any DNA or RNA sequence containing the vgASS_620 splice module, apart from its naturally occurring context (i.e., apart from the rhodopsin gene in patients with the c.620T>G mutation). Nucleotide sequences having at least 70% sequence identity to vgASS_620 of SEQ ID NO: 3 or SEQ ID NO: 3 can be used for the following applications: 1) Design of minigenes (for example, for analyzing mRNA splicing mutations) 2) Targeting endogenous mRNA in a biological or therapeutic context (for example, using SMaRT technology) 3) Reconstitution of the two mRNA fragments in trans. This is particularly important in overcoming the limited genomic packaging capacity of adeno-associated virus (AAV) vectors (approximately 5.0 kb, preferably <4.7 kb). Figures 5–8 show sequences of AAV vectors that can be used in the dual AAV vector systems described herein. 4) Design of gene expression or targeting cassettes to selectively increase the presence of specific splice products in alternative splicing genes containing weak ASS sites.

[0265] Example 3: Effects of the receptor splice site and binding domain (BD) on the reconstitution effect. The length and sequence of the BD represent important determinants of reconstitution efficiency. While the BD is most likely to influence tight mRNA binding and, in some cases, folding, it is not expected to directly enhance the efficiency or accuracy of the subsequent splicing process. As described above, DSSs are well-characterized, and predictions of their strength agree well with experimental performance. Therefore, the need to optimize this splice site within the framework of the split fluorophore reconstitution assay is not clear. In contrast, due to their complexity, the strength of ASSs cannot be reliably predicted. The results suggest that vgASS_620 is a very strong receptor splice site. Given that the strength of a splice site may affect the reconstitution efficiency of the split fluorophore assay, vgASS_620 should yield a high value compared to other receptor splice sites.

[0266] To analyze this, we compared the reconstitution efficiency in the presence of vgASS_620 or two other ASSs, namely the native ASS of RHO exon 3 (S3, Figure 9) and a hybrid ASS (S2) created by substituting the polypyrimidine region (PPT) of vgASS_620 with the PPT of the native RHO exon 3 ASS. Furthermore, each ASS was combined with three different binding domains: strong (BD_g, B1; SEQ ID NO: 27) and weak (BD_f, B3) binding domains derived from this study, and the published BD sequence (PTM1, B2) obtained from RHO intron 1 (SEQ ID NO: 29). This sequence was shown to result in high efficiency in repairing mutant RHO transcripts via spliceosome-mediated mRNA trans-splicing (Berger et al., “Repair of rhodopsin mRNA by spliceosome-mediated RNA trans-splicing: A new approach for autosomal dominant retinitis pigmentosa”, (2015) Mol. Ther. 23(5):918-930). All combinations were analyzed by confocal live-cell imaging, RT-PCR, and Western blotting (Figure 9). The results of this experiment yielded several important findings. First, it was revealed that both BD and ASS are important factors in determining the reconstitution efficiency. Second, the most potent BD identified in this study (BD_g, B1) was superior to the publicly available RHO-binding domain (B2). Thirdly, combining the strongest BD and the strongest ASS (B3+S1) yields detectable transsplicing, whereas the strongest BD and the weakest ASS (B1+S3) does not result in detectable reconstruction of the code sequence.

[0267] vgASS_620 consists of the ASS, PPT, and an additional 7bp upstream sequence, and deleting these impairs the recognition of ASS_620. Therefore, it is hypothesized that this 7bp sequence may contain a very strong branching point that could explain the universal and efficient recognition of vgASS_620 independent of the genetic environment. However, no strong branching point was predicted within this sequence. Instead, several other sequences were predicted to function as a branching point located up to 40bp upstream of c.620T>GASS. Nevertheless, simultaneous mutation of all predicted branching nucleotides and all possible branching adenines contained in the 7bp sequence upstream of the PPT did not alter the splicing of the c.620T>G mutant (data not shown). This finding suggests that the branching point is located elsewhere, or that c.620T>GASS has high flexibility in branching point selection. To more directly identify the branching points used for splicing in c.620T>GASS, nested lariat RT-PCR was performed using HEK293 cells transiently expressing the RHO c.620T>G mini-gene. HEK293 cells transfected with the RHO WT mini-gene served as a reference. When lariat RT-PCR was performed, one band was obtained for both the WT and mutant mini-genes, both of different sizes. Both bands appeared somewhat diffuse, suggesting that the corresponding lariat were of different sizes. To identify the single sequence contained within these diffuse bands, the lariat RT-PCR products were subcloned into TOPO vectors, and the resulting clones were analyzed individually by sequencing. Studying the RHO WT lariat identified two major branching points (used in 42% and 33% of cases) and three minor branching points (each in 8% of cases) (Table 2). The two major branching points were very similar to the consensus sequence and yielded high predictive scores. All RHO WT bifurcations were found 57–184 bp upstream of the intron-exon junction.Since more than 90% of human branching points are located 50 bp upstream of the ASS sequence, mRNA splicing of RHO exon 3 appears to be unique (Corvelo et al., 2010, PLoS Comput. Biol., 6(11): e1001016).

[0268] [Table 2]

[0269] Nevertheless, the branching profile obtained with RHO c.620T>G differed significantly from that obtained with the WT mini gene. Firstly, various branching points were identified in the c.620T>G mutant. However, the major branching points were not detected, and none were identical to those obtained with the WT mini gene. Secondly, the branching points were located further upstream of the ASS used, i.e., 107–245 bp, corresponding to 21–159 bp upstream of the native exon 3 ASS. Thirdly, nearly half of the detected branching points were hardly similar to the consensus sequence and therefore were not predicted using the Human Splice Finder (HSF) splice prediction tool. Overall, these data suggest that the strength of vgASS_620 may be partially caused by high flexibility in branching point selection rather than by the presence of very strong branching points. This could explain its unusually efficient performance and make it a very attractive tool for biotechnology applications requiring efficient splicing.

[0270] Example 4: Study of mRNA transsplicing-based rAAV dual vectors in vivo The most powerful application of the mRNA trans-splicing-based assays evaluated in the previous section is the rearrangement of large genes in a dual rAAV vector framework. Therefore, the mRNA trans-splicing approach was tested in mouse retina using rAAV. For this purpose, a slightly modified version of the split fluorophore assay was used. To control rAAV vector-derived expression in cells transduced with a single virus, both dual rAAV vector cassettes were fitted with fluorophore sequences, namely citrin at the 5' end of the coding sequence of the 5' vector and mCherry at the 3' end of the coding sequence of the 3'' vector. One of the BDs, namely BD_h+i, which yielded the best rearrangement efficiency in vitro, was used in vivo (Figure 10A). In this experimental setup, cerulean fluorescence should also be present in cells expressing citrin and mCherry.

[0271] Matched titer viruses were injected subretin into WT C57Bl6 / J mice on postnatal day 21 (P21). After retinal harvesting two weeks after injection, solid fluorophore expression was detected in the RPE (Figure 10B). Furthermore, cerulean fluorescence was observed in all regions where citrin and mCherry were expressed, indicating successful mRNA transsplicing in cells co-transduced with both AAVs. However, citrin and cerulean have partially overlapping excitation and emission spectra. To rule out the possibility that the cerulean fluorescence is an artifact caused by, for example, the bleeding of citrin or mCherry, both fluorophores were selectively bleached in small regions of the RPE by exciting the fluorophores with a high-intensity 514 nm laser. This procedure allowed for the complete removal of the fluorescence of citrin and mCherry (Figure 10C). Nevertheless, the cerulean fluorescence remained unchanged, indicating that it originates solely from transspliced ​​cerulean mRNA. This experiment provides a demonstration of the principle of the usefulness of mRNA transsplicing for the rearrangement of genes expressed from AAV in vivo.

[0272] Example 5: Identification of potent binding domains suitable for human gene therapy To date, all binding domain (BD) sequences have been obtained from human intron regions. Therefore, when used in human gene therapy, they may bind to endogenous mRNA and induce trans-splicing with these transcripts. Thus, to apply mRNA trans-splicing to human gene therapy, it is necessary to identify BDs that do not contain sequences homologous to the human genome. For this purpose, a random 100 bp sequence was obtained from the bacterial lacZ gene and modified through random insertions, deletions, and substitutions to obtain four sequences homologous to the human genome (Figure 11A).

[0273] When HEK293 cells were cotransfected with 5' and 3' vector constructs containing their respective binding domains, a very high cerulean rearrangement efficiency of 78.3% ± 2.1% was observed with one of the BDs (BD_k, Figure 11B-D). Therefore, BD_k was more efficient than the human BD, which exhibited the best performance shown in Figure 4, and was used in preliminary experiments to evaluate large gene rearrangements by mRNA transsplicing.

[0274] Example 6: Effect of polyadenylation signal on reconstitution efficiency and involvement of DNA-based reconstitution in in vitro assays Since the rearrangement of the two pre-mRNA molecules derived from the 5' and 3' vectors should occur in the nucleus, the polyadenylation signal (pA), which is necessary for the stabilization and translation of mature mRNA, can theoretically be removed from the 5' vector. The advantage of this deletion is that the remaining unspliced ​​5' pre-mRNA does not trigger translation of the truncated protein. Therefore, we studied the effect of pA deletion in the 5' vector on cerulean rearrangement efficiency. For this purpose, a 5' vector lacking pA was co-transfected with a normal 3' vector. Compared to vectors in which both co-transfected contained pA, rearrangement appeared to be slightly reduced (Figure 12A and B). However, this experiment demonstrates that the pA signal can be removed when necessary. Furthermore, the successful rearrangements observed so far could theoretically be mediated by homologous recombination at the DNA level, as in conventional hybrid dual-vector approaches, since all the necessary components—namely, the recombinant sequence and splicing element for removing this sequence via cis-splicing—are present in the mRNA trans-splicing vector (Carvalho et al., 2017). To rule out this possibility, the promoter of the 3' vector was deleted to prevent transcription to premRNA, thus making it similar to the 3' vector used in known hybrid dual-vector approaches. After co-transfecting this construct with a conventional 5' vector, no rearrangements were observed. This result confirms that all observed rearrangements in ceruleans are mediated solely via mRNA trans-splicing.

[0275] Example 7: Proof of the principle of large gene rearrangement via mRNA transsplicing In addition to the AAV cerulean split reporter assay, assays have been tested to evaluate mRNAs for transsplicing therapeutically promising proteins. The transcription activator SpCas9-VPR, a catalytically inactive nuclease fused to the transcription activator domain VP64-p65-Rta (VPR), is a novel tool recently developed for gene therapy. Due to its large size (5.8kb), it needs to be delivered via a dual vector for in vivo applications. Therefore, SpCas9-VPR is a favorable candidate for reconstitution via mRNA transsplicing. The coding sequence of SpCas9-VPR was split into two halves at c.2185, with each half of the coding sequence containing BD_k or its complementary sequence, and a suitable splicing element, i.e., DSS or vgASS_620. Full-length (FL) SpCas9-VPR constructs were used as positive controls. RT-PCR from HEK293 cells co-transfected with the split construct revealed successful reconstitution of SpCas9-VPR mRNA without the generation of unwanted byproducts (Figure 13B). Sequencing of the PCR product confirmed the accurate recovery of the reading frame (Figure 13C). Furthermore, the FL SpCas9-VPR protein was detectable by Western blotting (Figure 13D). The reconstitution efficiency of SpCas9-VPR was 13.2% ± 0.9%. This provides a demonstration of the principle of applicability of the mRNA trans-splicing approach for large gene reconstitution.

[0276] Example 8: Reconstruction of ABCA4 (Figure 14) Finally, to study the rearrangement of a large human-derived gene, we selected the ABCA4 gene (6.8kb), which encodes a retinal ATP-binding cassette transporter. This gene is a favorable candidate for gene therapy because mutations in it cause Stargard's macular dystrophy, a hereditary retinal dystrophy. ABCA4 was split into two at c.3243, and was equipped with BD_k, DSS, and vgASS_620 (Figure 14A). Both halves contained a long intron-less ABCA4 coding sequence (CDS) that is not similar to the native premRNA, which consists of exons and introns. Therefore, this may hinder the recruitment of splice factors to the premRNA, and consequently, may also reduce mRNA trans-splicing efficiency. To make the split gene more similar to endogenous human premRNA, we designed an additional construct containing three short (80bp) intercalating introns in the CDS of both halves. HEK293 cells were transiently cotransfected with intron-free or intron-containing constructs to investigate their reconstitution ability in vitro. RT-PCR revealed that ABCA4 was successfully reconstructed at the mRNA level in both the presence and absence of introns in the split constructs (Figure 14B). Interestingly, the split construct containing introns appeared to be trans-spliced ​​more efficiently. In this case as well, no unspecified splice products were detected, and the reading frame was correctly reconstructed (Figure 14C).

[0277] Example 9: rAAV dual-vector mRNA transsplicing of ABCA4 in vivo (Figure 15) In the final experiment, ABCA4 reconstitution was further tested in vivo. For this purpose, the CMV promoter was replaced with the human rhodopsin (hRHO) promoter to ensure photoreceptor-specific expression (Figure 15A). AAV was generated using in-house optimized NN and GL capsid variants derived from the wild-type AAV2 capsid, as described in International Publication 2019 / 076856. Titer-matched viruses containing 5' or 3' CDS of ABCA4 were co-injected subretinally into 1-month-old C57Bl6 / J wild-type mice. After 4 weeks, the retinas were collected and the success of reconstitution was evaluated at the mRNA and protein levels. RT-PCR performed using junction spanning primer pairs revealed that both capsid variants, namely NN and GL, successfully reconstituted with the NN capsid, resulting in higher levels of reconstituted mRNA, possibly due to higher (co)transduction efficiency (Figure 15B). Seamless ligation of two separate premRNA molecules was confirmed by sequencing (Figure 15C). For more precise quantification, qRT-PCR was performed. These preliminary results (n=1) showed relative ABCA4 expression ranging from 10- to 42-fold compared to uninjected C57Bl6 / J wild-type retina, again confirming that the reconstitution at the mRNA level was successful and efficient (Figure 15D). Finally, to study ABCA4 reconstitution at the protein level, protein lysates from the injected retina were used for Western blotting. An anti-myc antibody was used to ensure specific detection of the transgene-derived protein. The results indicate that in both cases, the reconstituted mRNA resulted in successful in vivo protein expression (Figure 15E).

Claims

1. (i) an acceptor splice region comprising: (ia) a pyrimidine tract comprising: (iaa) 5 to 25 nucleotides; (iab) wherein at least 60% of said nucleotides within these 5-25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (ib) an acceptor splice site; (iba) wherein the acceptor splice site is located 3' to the pyrimidine tract; and (ibb) wherein the acceptor splice site comprises the sequence 5' to 3' of NAGG, where N is A, C, T / U, or G; (ii) a nucleotide sequence of interest or a portion thereof; wherein the acceptor splice region is located 3' or 5' to the nucleotide sequence of interest or a portion thereof; (iii) a pre-mRNA-targeting binding domain located 3' or 5' to the nucleic acid sequence of interest or a portion thereof; and (iv) optionally a spacer sequence, wherein the spacer sequence is located between the binding domain and the acceptor splice region; Pre-mRNA trans-splicing molecules.

2. (ii) the nucleotide sequence of interest or a portion thereof, wherein the acceptor splice region is located 3' or 5' to the nucleotide sequence of interest or a portion thereof; (iii) a donor splice site, wherein the donor splice site is located 3' to the nucleotide sequence of interest or a portion thereof; (iv) a first binding domain that targets the pre-mRNA located 5′ to the nucleotide sequence of interest or a portion thereof; (v) a second binding domain that targets the pre-mRNA located 3′ to the nucleotide sequence of interest or a portion thereof; (vi) optionally, a first spacer sequence, wherein the first spacer is located between the first binding domain and the acceptor splice region; and (vii) optionally, a second spacer sequence, wherein the second spacer is located between the second binding domain and the donor splice site; The pre-mRNA trans-splicing molecule of claim 1, comprising:

3. The pre-mRNA trans-splicing molecule of claim 1 or 2, wherein the acceptor splice region is located 5' to the target nucleotide sequence or a portion thereof, and the binding domain is located 5' to the acceptor splice region.

4. The pre-mRNA trans-splicing molecule according to any one of claims 1 to 3, further comprising a termination sequence, preferably a polyA sequence.

5. (a) the 5 to 25 nucleotides of the pyrimidine tract comprise a sequence encoded by the sequence TTTTTT or TCTTTT; (b) the sequence between the last pyrimidine of the pyrimidine tract and the acceptor splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases; and / or (c) the acceptor splice site has the sequence CAGG; A pre-mRNA trans-splicing molecule according to any one of claims 1 to 4.

6. The acceptor splice region comprises: (a) the 7 nucleotides 5' to the pyrimidine tract having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is a C; (b) the 7 nucleotides 5' to the pyrimidine tract having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is a C; (c) the 7 nucleotides 5' to the pyrimidine tract having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAA; or (d) the 7 nucleotides 5' to the pyrimidine tract having at least 5 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is CAAC; The pre-mRNA trans-splicing molecule of any one of claims 1 to 5, further comprising:

7. A DNA molecule comprising a promoter and a sequence encoding the pre-mRNA trans-splicing molecule of any one of claims 1 to 6.

8. A method for producing a nucleic acid sequence, the method comprising: (A) providing a first nucleic acid sequence comprising one or more donor splice site sequences; (B) providing a second nucleic acid sequence comprising: (i) an acceptor splice region sequence comprising: (ia) a pyrimidine tract comprising: (iaa) 5 to 25 nucleotides; (iab) wherein at least 60% of said nucleotides within these 5-25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (ib) an acceptor splice site; (iba) wherein the acceptor splice site is located 3' to the pyrimidine tract; and (ibb) wherein the acceptor splice site comprises the sequence 5' to 3' of NAGG, where N is A, C, T / U, or G; (C) cleaving the first nucleic acid sequence at the one or more donor splice site sequences and cleaving the second nucleic acid sequence at the acceptor splice site; (D) ligating the first cleaved nucleic acid sequence to the second cleaved nucleic acid sequence, thereby obtaining a nucleic acid sequence; A method comprising:

9. 9. The method of claim 8, wherein the first nucleic acid sequence further comprises a nucleotide sequence of interest or a portion thereof, wherein at least a portion of the nucleotide sequence of interest is located 5' to the donor splice site, and wherein the second nucleic acid sequence further comprises a nucleotide sequence of interest or a portion thereof, wherein at least a portion of the nucleotide sequence of interest is located 3' to the splice acceptor splice region.

10. 10. The method of claim 8 or 9, wherein the first and second nucleic acid sequences are introduced into a host cell, preferably the first and second nucleic acid sequences are recombinant nucleic acid sequences.

11. (A) introducing into a host cell a first nucleic acid sequence comprising a pre-mRNA trans-splicing molecule sequence or a nucleic acid sequence encoding said pre-mRNA trans-splicing molecule, wherein said first pre-mRNA trans-splicing molecule comprises, 5' to 3': (a) the 5' portion of the nucleotide acid sequence of interest; (b) donor splice site; (c) optionally a spacer sequence; (d) a first binding domain; and (e) optionally a termination sequence, preferably a polyA sequence, and (B) introducing into a host cell a second nucleic acid sequence comprising a pre-mRNA trans-splicing molecule sequence or a nucleic acid sequence encoding said pre-mRNA trans-splicing molecule, wherein said second pre-mRNA trans-splicing molecule comprises, 5' to 3': (i) a second binding domain complementary to the first target domain of the first nucleic acid sequence; (ii) an acceptor splice region sequence comprising: (iia) a pyrimidine tract comprising: (ii aa) 5 to 25 nucleotides; (iiab) wherein at least 60% of said nucleotides within these 5-25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (iib) an acceptor splice site; (iiba) wherein the acceptor splice site is located 3' to the pyrimidine tract; and (iibb) wherein the acceptor splice site comprises the sequence 5' to 3' of NAGG, where N is A, C, T / U, or G; (iii) the 3' portion of the nucleotide sequence of interest, and (iv) a termination sequence, preferably a polyA sequence; (C) cleaving the first nucleic acid sequence at the donor splice site sequence and cleaving the second nucleic acid sequence at the acceptor splice site; (D) ligating the first cleaved nucleic acid sequence comprising the 5' portion of the nucleotide sequence of interest to the second cleaved nucleic acid sequence comprising the 3' portion of the nucleotide sequence of interest, thereby obtaining the nucleic acid sequence of interest; The method according to any one of claims 8 to 10, comprising:

12. An adeno-associated virus (AAV) vector comprising at least two inverted terminal repeats and a nucleic acid sequence between the two inverted terminal repeats, wherein the nucleic acid sequence is 5' to 3' (i) a promoter; (ii) a binding domain; (iii) optionally a spacer sequence; (iv) an acceptor splice region sequence comprising: (a) a pyrimidine tract comprising: (aa) 5 to 25 nucleotides; (ab) wherein at least 60% of the nucleotides within these 5-25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (b) an acceptor splice site; ba) wherein the acceptor splice site is located 3' to the pyrimidine tract; and bb) wherein said acceptor splice site comprises the sequence 5' to 3' of NAGG, where N is A, C, T / U, or G; (v) a nucleotide sequence of interest or a portion thereof; and (vi) optionally a polyA sequence An adeno-associated virus (AAV) vector comprising:

13. (I) a first AAV vector comprising at least two inverted terminal repeats, the first AAV vector comprising a nucleic acid sequence between the two inverted terminal repeats, wherein the nucleic acid sequence between the two inverted terminal repeats is from 5' to 3' (a) a promoter; (b) a nucleotide sequence encoding the N-terminal portion of the polypeptide of interest; (c) donor splice site; (d) optionally a spacer sequence; (e) a first binding domain; and (f) optionally a termination sequence, preferably a polyA sequence; a first AAV vector comprising: (II) a second AAV vector comprising a nucleic acid sequence comprising at least two inverted terminal repeats, the nucleic acid sequence between the two inverted terminal repeats being from 5' to 3' (i) a promoter; (ii) a second binding domain complementary to the first binding domain of the first AAV vector; (ii) optionally a spacer sequence; (iii) an acceptor splice region sequence comprising: (a) a pyrimidine tract comprising: (aa) 5 to 25 nucleotides; (ab) wherein at least 60% of said nucleotides within these 5-25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (b) an acceptor splice site; (ba) wherein the acceptor splice site is located 3' to the pyrimidine tract; and (bb) wherein said acceptor splice site comprises the sequence 5' to 3' of NAGG, where N is A, C, T / U, or G; (iv) a nucleotide sequence encoding the C-terminal portion of the polypeptide of interest; (iv) wherein the C-terminal portion of the polypeptide of interest and the N-terminal portion of the polypeptide of interest reconstitute the polypeptide of interest; and (v) a termination sequence, preferably a polyA sequence An adeno-associated virus (AAV) vector system comprising:

14. 14. The AAV vector system of claim 13, wherein the polypeptide is a full-length polypeptide, the first AAV vector comprises an N-terminal portion of the full-length polypeptide of interest, and the second AAV vector comprises a C-terminal portion of the polypeptide of interest.

15. (i) an acceptor splice region sequence comprising: (ia) a pyrimidine tract comprising: (iaa) 5 to 25 nucleotides; (iab) wherein at least 60% of said nucleotides within these 5-25 nucleotides are pyrimidine bases, e.g., cytosine (C), thymine (T), and / or uracil (U); (ib) an acceptor splice site; ba) wherein said acceptor splice site is located 3' to said pyrimidine tract; and bb) wherein said acceptor splice site comprises the sequence 5' to 3' of NAGG, where N is A, C, T / U, or G; (ii) a nucleotide sequence of interest, wherein the nucleotide sequence of interest (iia) is located on the 3' or 5' side of the acceptor splice region; A nucleic acid sequence comprising:

16. (a) the 5 to 25 nucleotides of the pyrimidine tract comprise a sequence encoded by the sequence TTTTTT or TCTTTT; (b) the sequence between the last pyrimidine of the pyrimidine tract and the acceptor splice site is less than 10 bases, preferably less than 5 bases, more preferably less than 3 bases; (c) the acceptor splice site has the sequence CAGG; (d) the acceptor splice region further comprises 7 nucleotides 5' to the pyrimidine tract having at least 4 nucleotides of the sequence CAACGAG, where the first 5' nucleotide is C; and / or (e) wherein the splice acceptor region comprises the sequence of SEQ ID NO: 3, or 4. The method of any one of claims 8 to 11, the AAV vector of claim 12, the AAV vector system of claim 13 or 14, and the nucleic acid of claim 15.

17. A pre-mRNA trans-splicing molecule according to any one of claims 1 to 6, an adeno-associated viral vector according to claim 12, or an adeno-associated viral vector system according to claim 13 or 14 for use in therapy.

Images