Methods for treating cancers that overexpress WHSC1 by inhibiting SETD2

Abstract

The present disclosure provides methods and pharmaceutical compositions for treating or delaying the progression of cancers that overexpress the histone methyltransferase WHSC1, such as t(4;14) multiple myeloma, by administering to a subject in need thereof a therapeutically effective amount of an inhibitor of the histone methyltransferase SETD2.

Description

[Technical field]

[0001] Reference to Electronically Submitted Sequence Listing The contents of the electronically submitted Sequence Listing in the ASCII text file submitted with this application (Name: 3562_018PC04_Seqlisting_ST25.txt; Size: 1,882 bytes; Creation Date: November 26, 2019) are hereby incorporated by reference in their entirety.

[0002] The present disclosure generally relates to the field of epigenetic-based cancer therapy. More particularly, the present disclosure relates to methods and pharmaceutical compositions for treating cancers that overexpress histone methyltransferase WHSC1 by inhibiting histone methyltransferase SETD2. [Background technology]

[0003] Histone lysine methylation is a major chromatin regulatory mechanism that influences fundamental nuclear processes. The selective addition of methyl groups to specific amino acid sites on histones is controlled by the action of a family of enzymes known as histone methyltransferases (HMTs). The level of expression of a particular gene is influenced by the presence or absence of one or more methyl groups at the relevant histone site. The specific effect of a methyl group at a particular histone site persists until the methyl group is removed by histone demethylases or the modified histone is replaced by nucleosome turnover. In a similar manner, other enzyme classes can decorate DNA and histones with other chemical species, and still other enzymes can remove these species to achieve control of gene expression.

[0004] WHSC1 (Wolf-Hirschhorn syndrome candidate gene 1, also known as MMSET, NSD2, REIIBP, TRX5 and WHS) is an HMT located at cytogenetic band p16.3 of chromosome 4 (4p16.3). The major chromatin regulatory effect of WHSC1 is the dimethylation of histone H3 at lysine 36 (H3K36me2), which activates transcription. Kuo, AJ et al., Mol. Cell. 44:609-620 (2011). WHSC1 is overexpressed in numerous cancers compared to their normal counterparts and is associated with tumor invasiveness. Kassambara, A. et. al., Biochem. Biophys. Res. Comm. 379:840-845 (2009). In particular, WHSC1 has been shown to be highly overexpressed in t(4;14) multiple myeloma (MM), which has been associated with poor prognosis. Id.

[0005] SETD2 is another HMT located on chromosome 3 at cytogenetic band p21.31 (3p21.31). The acronym "SETD2" stands for Suppressor of variegation, Enhancer of zeste, and Trithorax domain containing 2. The SETD2 protein contains three conserved functional domains: (1) a triad AWS-SET-PostSET domain; (2) a WW domain; and (3) a Set2-Rbp1 interaction ("SRI") domain. These three functional domains define the biological function of SETD2. See Li, J. et al., Oncotarget 7:50719-50734 (2016). SETD2 is believed to be a single human gene involved in the trimethylation of lysine 36 (Lys-36) of histone H3 (H3K36me3) using dimethylated Lys-36 (H3K36me2) as a substrate. Edmunds, JWet al., The EMBO Journal 27:406-420 (2008). Human SETD2 is also a putative tumor suppressor. Li, J. et al., Oncotarget 7:50719-50734 (2016). For example, inactivation of human SETD2 has been reported in renal cell carcinoma (RCC). Larkin, J., et al., Nature Reviews 9:147-155 (2012). It has also been reported that the expression level of SETD2 in breast cancer samples is significantly lower than in adjacent non-cancerous tissue (ANCT) samples. Newbold, RF and Mokbel, K., Anticancer Research 30:3309-3311 (2010). Furthermore, biallelic and loss-of-function point mutations in SETD2 have been reported in patients with acute leukemia. Zhu, X. et al., Nature Genetics 46:287-293 (2014). Mutations in SETD2 have also been reported in pediatric high-grade gliomas. Fontebasso, AM et al., Acta Neuropathol. 125:659-669 (2013). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Kuo,AJet al.,Mol.Cell.44:609-620(2011) [Non-Patent Document 2] Kassambara,A.et.al.,Biochem.Biophys.Res.Comm.379:840-845(2009) [Non-Patent Document 3] Li, J. et al., Oncotarget 7:50719-50734(2016) [Non-Patent Document 4] Edmunds, JWet al., The EMBO Journal 27:406-420 (2008). [Non-Patent Document 5] Larkin, J., et al., Nature Reviews 9:147-155(2012) [Non-Patent Document 6] Newbold,RFand Mokbel,K.,Anticancer Research 30:3309-3311(2010) [Non-Patent Document 7] Zhu, X. et al., Nature Genetics 46:287-293(2014) [Non-Patent Document 8] Fontebasso,AMet al.,Acta Neuropathol.125:659-669(2013) Summary of the Invention [Problem to be solved by the invention]

[0007] Despite more than a century of intense scientific and clinical research, curing cancer remains one of the greatest medical challenges to date. Cancer treatment has mainly relied on a combination of surgery, radiation therapy and / or cytotoxic chemotherapy. While effective cancer therapies exist, suboptimal response, relapsed-refractory disease and / or resistance to one or more therapeutic agents remain challenges, especially for certain subtypes of multiple myeloma (i.e., t(4;14) multiple myeloma). Thus, there is a medical need for more effective, safe and long-lasting therapies for the treatment of all types of cancer. [Means for solving the problem]

[0008] The present disclosure relates to epigenetic-based cancer therapy and the unexpected discovery that inhibiting SETD2 can be used to treat cancer, despite its functionality as a tumor suppressor.Furthermore, the present disclosure relates to the unexpected discovery that inhibiting SETD2 can be used to treat cancer that overexpresses WHSC1.

[0009] In one aspect, the present disclosure is directed to a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a SETD2 inhibitor, wherein the cancer overexpresses WHSC1.

[0010] In certain embodiments, overexpression of WHSC1 by said cancer is determined prior to administering said SETD2 inhibitor.

[0011] In certain embodiments, the SETD2 inhibitor is a "substituted indole compound," as defined in the "Definitions" section of the detailed description.

[0012] In certain embodiments, the SETD2 inhibitor is a compound in Table 1, or a pharma- ceutically acceptable salt thereof.

[0013] In certain embodiments, the SETD2 inhibitor is not a substituted indole compound.

[0014] In certain embodiments, the WHSC1-overexpressing cancer is a hematological cancer.

[0015] In certain embodiments, the hematological cancer is acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MCL), pulmonary lymphoma (PLL), pulmonary ... ZL), hairy cell leukemia (HCL), Burkitt's lymphoma (BL), Richter's transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia and angioimmunoblastic T-cell lymphoma.

[0016] In certain embodiments, the hematological cancer is multiple myeloma.

[0017] In certain embodiments, the multiple myeloma contains a chromosomal translocation or a chromosomal deletion.

[0018] In certain embodiments, the chromosomal translocation involves chromosome 14. In certain embodiments, the chromosomal translocation is a t(4;14) translocation. In certain embodiments, the chromosomal translocation is a non-t(4;14) translocation. In certain embodiments, the non-t(4;14) translocation is selected from the group consisting of a t(14;16), a t(11;14), a t(14;20), a t(8;14), and a t(6;14) translocation.

[0019] In certain embodiments, the multiple myeloma contains a deletion, hi certain embodiments, the deletion is selected from the group consisting of del(17p) and del(13).

[0020] In certain embodiments, the WHSC1-overexpressing cancer is a solid tumor.

[0021] In certain embodiments, the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer.

[0022] In certain embodiments, the subject is a mammal, hi certain embodiments, the subject is a human.

[0023] In certain embodiments, the SETD2 inhibitor is formulated for systemic or local administration.In certain embodiments, the SETD2 inhibitor is formulated for oral, nasal, intraperitoneal or intratumoral administration.In certain embodiments, the SETD2 inhibitor is formulated for intravenous, intramuscular or subcutaneous administration.

[0024] In one aspect, the present disclosure is directed to a method of inhibiting trimethylation of lysine 36 on histone H3 (H3K36me3) in a cell, comprising contacting the cell with a SETD2 inhibitor, wherein the cell overexpresses WHSC1.

[0025] In certain embodiments, the SETD2 inhibitor is a "substituted indole compound," as defined in the "Definitions" section of the detailed description.

[0026] In certain embodiments, the SETD2 inhibitor is a compound in Table 1, or a pharma- ceutically acceptable salt thereof.

[0027] In certain embodiments, the SETD2 inhibitor is not a substituted indole compound.

[0028] In certain embodiments, inhibiting trimethylation of lysine 36 on histone H3 in a cell occurs in vitro. In certain embodiments, inhibiting trimethylation of lysine 36 on histone H3 in a cell occurs in vivo.

[0029] In certain embodiments, the cells are derived from a hematological cancer. In certain embodiments, the hematological cancer is selected from the group consisting of acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MCL), and / or idiopathic leukemia (IDL). ZL), hairy cell leukemia (HCL), Burkitt's lymphoma (BL), Richter's transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia and angioimmunoblastic T-cell lymphoma.

[0030] In certain embodiments, the hematological cancer is multiple myeloma.

[0031] In certain embodiments, the multiple myeloma contains a chromosomal translocation or a chromosomal deletion.

[0032] In certain embodiments, the chromosomal translocation involves chromosome 14. In certain embodiments, the chromosomal translocation is a t(4;14) translocation. In certain embodiments, the chromosomal translocation is a non-t(4;14) translocation. In certain embodiments, the non-t(4;14) translocation is selected from the group consisting of a t(14;16), a t(11;14), a t(14;20), a t(8;14), and a t(6;14) translocation.

[0033] In certain embodiments, the multiple myeloma contains a deletion, hi certain embodiments, the deletion is selected from the group consisting of del(17p) and del(13).

[0034] In certain embodiments, the cells are derived from a solid tumor.

[0035] In certain embodiments, the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer.

[0036] In certain embodiments, the in vivo cell is in a mammal, hi certain embodiments, the in vivo cell is in a human. In an embodiment of the present invention, for example, the following items are provided: (Item 1) A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a SETD2 inhibitor, wherein the cancer overexpresses WHSC1. (Item 2) The method of item 1, wherein overexpression of WHSC1 by the cancer is determined prior to administering the SETD2 inhibitor. (Item 3) 3. The method of claim 1 or 2, wherein the SETD2 inhibitor is a substituted indole compound. (Item 4) 4. The method of item 3, wherein the SETD2 inhibitor is a compound of Table 1 or a pharma- ceutically acceptable salt thereof. (Item 5) 3. The method of claim 1 or 2, wherein the SETD2 inhibitor is not a substituted indole compound. (Item 6) 6. The method according to any one of items 1 to 5, wherein the cancer that overexpresses WHSC1 is a blood cancer. (Item 7) The blood cancers include acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), and leukemia. 7. The method according to item 6, wherein the leukemia is selected from the group consisting of acute eosinophilic leukemia (HCL), Burkitt's lymphoma (BL), Richter's transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia and angioimmunoblastic T-cell lymphoma. (Item 8) 8. The method of claim 7, wherein the hematological cancer is multiple myeloma. (Item 9) 9. The method of claim 8, wherein the multiple myeloma contains a chromosomal translocation or a chromosomal deletion. (Item 10) 10. The method of claim 9, wherein the multiple myeloma contains a chromosomal translocation. (Item 11) 11. The method of claim 10, wherein the chromosomal translocation involves chromosome 14. (Item 12) 12. The method of claim 11, wherein the chromosomal translocation is a t(4;14) translocation. (Item 13) 13. The method of claim 12, wherein the chromosomal translocation is a non-t(4;14) translocation. (Item 14) 14. The method of claim 13, wherein the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14) and t(6;14) translocations. (Item 15) 10. The method of claim 9, wherein the multiple myeloma contains a chromosomal deletion. (Item 16) 16. The method of claim 15, wherein the deletion is selected from the group consisting of del(17p) and del(13). (Item 17) The method according to any one of items 1 to 5, wherein the cancer that overexpresses WHSC1 is a solid tumor. (Item 18) 18. The method of claim 17, wherein the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer. (Item 19) 19. The method according to any one of items 1 to 18, wherein the subject is a mammal. (Item 20) 19. The method according to any one of items 1 to 18, wherein the subject is a human. (Item 21) 21. The method according to any one of items 1 to 20, wherein the compound is formulated for systemic or local administration. (Item 22) 21. The method according to any one of items 1 to 20, wherein the compound is formulated for oral, nasal, intraperitoneal or intratumoral administration. (Item 23) 21. The method according to any one of items 1 to 20, wherein the compound is formulated for intravenous, intramuscular or subcutaneous administration. (Item 24) A method for inhibiting trimethylation of lysine 36 on histone H3 (H3K36me3) in a cell, the method comprising contacting the cell with a SETD2 inhibitor, wherein the cell overexpresses WHSC1. (Item 25) 25. The method of claim 24, wherein the SETD2 inhibitor is a substituted indole compound. (Item 26) 26. The method of item 25, wherein the SETD2 inhibitor is a compound of Table 1 or a pharma- ceutically acceptable salt thereof. (Item 27) 25. The method of claim 24, wherein the SETD2 inhibitor is not a substituted indole compound. (Item 28) 28. The method according to any one of items 24 to 27, wherein inhibiting trimethylation of lysine 36 on histone H3 in a cell occurs in vitro. (Item 29) 28. The method according to any one of items 24 to 27, wherein inhibiting trimethylation of lysine 36 on histone H3 in a cell occurs in vivo. (Item 30) 30. The method according to any one of items 24 to 29, wherein the cells are derived from a blood cancer. (Item 31) The blood cancers include acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HL), and leukemia-associated lymphoma (LEM). 31. The method of claim 30, wherein the leukemia is selected from the group consisting of acute eosinophilic leukemia (HCL), Burkitt's lymphoma (BL), Richter's transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia and angioimmunoblastic T-cell lymphoma. (Item 32) 32. The method of claim 31, wherein the hematological cancer is multiple myeloma. (Item 33) 33. The method of claim 32, wherein the multiple myeloma contains a chromosomal translocation or a chromosomal deletion. (Item 34) 34. The method of claim 33, wherein the multiple myeloma contains a chromosomal translocation. (Item 35) 35. The method of claim 34, wherein the chromosomal translocation involves chromosome 14. (Item 36) 35. The method of claim 34, wherein the chromosomal translocation is a t(4;14) translocation. (Item 37) 35. The method of claim 34, wherein the chromosomal translocation is a non-t(4;14) translocation. (Item 38) 38. The method of claim 37, wherein the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14) and t(6;14) translocations. (Item 39) 34. The method of claim 33, wherein the multiple myeloma contains a deletion. (Item 40) 40. The method of claim 39, wherein the deletion is selected from the group consisting of del(17p) and del(13). (Item 41) 25. The method of claim 24, wherein the cell is derived from a solid tumor. (Item 42) 42. The method of claim 41, wherein the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer. (Item 43) 43. The method according to any one of items 29 to 42, wherein the in vivo cell is in a mammal. (Item 44) 43. The method according to any one of items 29 to 42, wherein the in vivo cell is in a human. [Brief description of the drawings]

[0037] [Figure 1] FIG. 1 shows the antiproliferative effect of compound number 15 (N-((1R,3S)-3-(4-acetylpiperazin-1-yl)cyclohexyl)-4-fluoro-7-methyl-1H-indole-2-carboxamide) on a panel of multiple myeloma cell lines (see Table 1). FIG. 1A is a table of multiple myeloma (MM) cell lines tested in a long-term proliferation (LTP) 14-day assay with translocation status, isotype, and 14-day proliferation half-maximal inhibitory concentration IC50. FIG. 1B is a graph showing the 14-day proliferation IC50 for the MM cell lines tested. Each point represents a different cell line. Cell lines are grouped by t(4;14) status. The 14-day proliferation IC50 is shown on the y-axis. [Figure 2-1]Figure 2 shows that the inhibition mediated by Compound No. 15 of the t(4;14) multiple myeloma cell line KMS-34 is due to SETD2 inhibition. Figure 2A is a graph showing that KMS-34 has a cytotoxic response to Compound No. 15 in a 14-day LTP assay with a proliferation IC50 of 80 nM. Each point represents the average for each concentration (n=3). Figure 2B is a developed Western blot showing that KMS-34 shows a dose-dependent decrease in H3K36me3 by Compound No. 15, while H3K36me2 is unaffected after 14 days. Figure 2C is a table showing that the activity of Compound No. 15 as the most biochemically active enantiomer is stereospecific. Figure 2D is a graph showing the structure-activity relationship (SAR) observed with SETD2 inhibitors when comparing H3K36me3 inhibition potency and antiproliferative activity. Each point represents the performance of a SETD2 inhibitor in the A549 H3K36me3 assay and the KMS-34 long-term proliferation assay. [Figure 2-2] Figure 2 shows that the inhibition mediated by Compound No. 15 of the t(4;14) multiple myeloma cell line KMS-34 is due to SETD2 inhibition. Figure 2A is a graph showing that KMS-34 has a cytotoxic response to Compound No. 15 in a 14-day LTP assay with a proliferation IC50 of 80 nM. Each point represents the average for each concentration (n=3). Figure 2B is a developed Western blot showing that KMS-34 shows a dose-dependent decrease in H3K36me3 by Compound No. 15, while H3K36me2 is unaffected after 14 days. Figure 2C is a table showing that the activity of Compound No. 15 as the most biochemically active enantiomer is stereospecific. Figure 2D is a graph showing the structure-activity relationship (SAR) observed with SETD2 inhibitors when comparing H3K36me3 inhibition potency and antiproliferative activity. Each point represents the performance of a SETD2 inhibitor in the A549 H3K36me3 assay and the KMS-34 long-term proliferation assay. [Figure 3-1]It shows that sensitivity to compound No. 15 is associated with WHSC1 overexpression status in some embodiments. Two isogenic variants of KMS11 cells, TKO and NTKO, have been previously characterized (Kuo AJ et al., Mol. Cell. 44:609-620 (2011)). Non-translocation knockout (NTKO) cells express only translocated WHSC1. Translocation knockout (TKO) cells express only non-translocated alleles of WHSC1. Figure 3A is a graph showing the results of a 14-day proliferation assay with compound No. 15. Figures 3B and 3C show Western blots (Figure 3B) of H3K36me2 and H3K36me3 from KMS11 parental cells, TKO and NTKO cell lines treated with compound No. 15. Figure 3C is a bar graph showing the proliferation IC50 and H3K36me3 levels for each cell line found in Figures 3A and 3B, respectively. [Figure 3-2] It shows that sensitivity to compound No. 15 is associated with WHSC1 overexpression status in some embodiments. Two isogenic variants of KMS11 cells, TKO and NTKO, have been previously characterized (Kuo AJ et al., Mol. Cell. 44:609-620 (2011)). Non-translocation knockout (NTKO) cells express only translocated WHSC1. Translocation knockout (TKO) cells express only non-translocated alleles of WHSC1. Figure 3A is a graph showing the results of a 14-day proliferation assay with compound No. 15. Figures 3B and 3C show Western blots (Figure 3B) of H3K36me2 and H3K36me3 from KMS11 parental cells, TKO and NTKO cell lines treated with compound No. 15. Figure 3C is a bar graph showing the proliferation IC50 and H3K36me3 levels for each cell line found in Figures 3A and 3B, respectively. [Figure 4-1] In some embodiments, KMS34 cells require WHSC1 for proliferation, whereas KMS-28-BM cells do not. Figure 4A is a graph showing the results of long-term proliferation (LTP) assay in WHSC1-CRISPR target cell line. Figure 4B is a bar graph showing the WHSC1 genotype over time after CRISPR targeting. [Figure 4-2] In some embodiments, KMS34 cells require WHSC1 for proliferation, whereas KMS-28-BM cells do not. Figure 4A is a graph showing the results of long-term proliferation (LTP) assay in WHSC1-CRISPR target cell line. Figure 4B is a bar graph showing the WHSC1 genotype over time after CRISPR targeting. [Figure 5-1] Figure 5 shows drug exposure and body weight for a 7-day dose range finding study in mice, demonstrating that Compound No. 15 can be tolerated and maintained at effective concentrations in vitro. Figure 5A is a graph showing that Compound No. 15 levels are maintained at more than 10-fold the KMS11 proliferation IC50 with twice-daily (BID) or once-daily (QD) dosing in mice. Figure 5B is a graph showing that no weight loss is observed at 62.5 and 125 mg / kg BID dosing when compared to vehicle control. Figure 5C shows a Western blot and graphical representation of histone H3 probed with H3K36me3 or total H3 antibodies. [Figure 5-2] Figure 5 shows drug exposure and body weight for a 7-day dose range finding study in mice, demonstrating that Compound No. 15 can be tolerated and maintained at effective concentrations in vitro. Figure 5A is a graph showing that Compound No. 15 levels are maintained at more than 10-fold the KMS11 proliferation IC50 with twice-daily (BID) or once-daily (QD) dosing in mice. Figure 5B is a graph showing that no weight loss is observed at 62.5 and 125 mg / kg BID dosing when compared to vehicle control. Figure 5C shows a Western blot and graphical representation of histone H3 probed with H3K36me3 or total H3 antibodies. [Figure 5-3]Figure 5 shows drug exposure and body weight for a 7-day dose range finding study in mice, demonstrating that Compound No. 15 can be tolerated and maintained at effective concentrations in vitro. Figure 5A is a graph showing that Compound No. 15 levels are maintained at more than 10-fold the KMS11 proliferation IC50 with twice-daily (BID) or once-daily (QD) dosing in mice. Figure 5B is a graph showing that no weight loss is observed at 62.5 and 125 mg / kg BID dosing when compared to vehicle control. Figure 5C shows a Western blot and graphical representation of histone H3 probed with H3K36me3 or total H3 antibodies. [Figure 6-1] Figure 6 shows that Compound No. 15 demonstrates strong anti-tumor activity in KMS11, t(4;14) multiple myeloma xenograft model. Figure 6A is a graph showing KMS11 xenograft tumor growth regression with BID dosing of Compound No. 15 for 28 days. Figure 6B is a graph showing minimal weight loss at 31.25 and 62.5 mg / kg (BID for 28 days) when compared to vehicle control. Figure 6C shows fluorescence-based ELISA of KMS11 tumor samples. [Figure 6-2] Figure 6 shows that Compound No. 15 demonstrates strong anti-tumor activity in KMS11, t(4;14) multiple myeloma xenograft model. Figure 6A is a graph showing KMS11 xenograft tumor growth regression with BID dosing of Compound No. 15 for 28 days. Figure 6B is a graph showing minimal weight loss at 31.25 and 62.5 mg / kg (BID for 28 days) when compared to vehicle control. Figure 6C shows fluorescence-based ELISA of KMS11 tumor samples. [Figure 6-3] Figure 6 shows that Compound No. 15 demonstrates strong anti-tumor activity in KMS11, t(4;14) multiple myeloma xenograft model. Figure 6A is a graph showing KMS11 xenograft tumor growth regression with BID dosing of Compound No. 15 for 28 days. Figure 6B is a graph showing minimal weight loss at 31.25 and 62.5 mg / kg (BID for 28 days) when compared to vehicle control. Figure 6C shows fluorescence-based ELISA of KMS11 tumor samples. [Figure 7-1]Figure 7 shows that Compound No. 15 demonstrates anti-tumor activity in MM.1S, non-t(4;14) multiple myeloma xenograft model. Figure 7A is a graph showing MM.1S xenograft tumor growth inhibition by BID dosing of Compound No. 15 for 23 days. Figure 7B is a graph showing minimal weight loss at all doses compared to vehicle control. Figure 7C shows fluorescence-based ELISA data showing reduction of H3K36me3 by Compound No. 15 treatment in MM.1S tumor samples. [Figure 7-2] Figure 7 shows that Compound No. 15 demonstrates anti-tumor activity in MM.1S, non-t(4;14) multiple myeloma xenograft model. Figure 7A is a graph showing MM.1S xenograft tumor growth inhibition by BID dosing of Compound No. 15 for 23 days. Figure 7B is a graph showing minimal weight loss at all doses compared to vehicle control. Figure 7C shows fluorescence-based ELISA data showing reduction of H3K36me3 by Compound No. 15 treatment in MM.1S tumor samples. [Figure 7-3] Figure 7 shows that Compound No. 15 demonstrates anti-tumor activity in MM.1S, non-t(4;14) multiple myeloma xenograft model. Figure 7A is a graph showing MM.1S xenograft tumor growth inhibition by BID dosing of Compound No. 15 for 23 days. Figure 7B is a graph showing minimal weight loss at all doses compared to vehicle control. Figure 7C shows fluorescence-based ELISA data showing reduction of H3K36me3 by Compound No. 15 treatment in MM.1S tumor samples. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0038] definition To facilitate the understanding of this invention, several terms and phrases are defined below.

[0039] Open terms such as "comprise," "including," "containing," "containing," etc. mean "including." These open-ended transitional phrases are used to introduce open-ended lists of elements, method steps, etc. that do not exclude further unrecited elements or method steps. Whenever an embodiment is described herein with the phrase "comprising," other similar embodiments described in terms of "consisting of" and / or "consisting essentially of" are also provided.

[0040] As used in this disclosure and claims, the singular forms "a," "an," and "the" include the plural forms unless the context clearly dictates otherwise. For example, "a cell" includes a plurality of cells, including a single cell and mixtures thereof.

[0041] The term "substituted indole compound" as used herein refers to the compounds disclosed in International Application PCT / US2019 / 046569, filed August 14, 2019, and pharma- ceutically acceptable salts and solvates thereof. Thus, in one embodiment, the substituted indole compound has Formula I: [ka] (In the formula, R 1a is selected from the group consisting of halogen, alkyl, alkoxy, cycloalkyl, (hydroxy)alkyl, and (cycloalkyl)alkyl; Q 1 is -C(R 1b )= and -N=; Q 2 is -C(R 1c )= and -N=; Q 3 is -C(R 1d )= and -N=; However, Q 1 , Q 2 Or Q 3 At least one of each is -C(R1b )=, -C(R 1c )= or -C(R 1d )=; R 1b , R 1c and R 1d are each independently selected from the group consisting of hydrogen, halogen, alkyl, alkenyl, (hydroxy)alkyl, and alkoxy; R 1e is selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, (hydroxy)alkyl, and (cycloalkyl)alkyl; [ka] is a single bond or a double bond; G 1 is optionally substituted aryl, optionally substituted heteroaryl, optionally substituted heterocyclo, optionally substituted cycloalkyl, (aryl)alkyl, (heteroaryl)alkyl, (heterocyclo)alkyl, (amino)(aryl)alkyl, (heteroaryl)(aryl)alkyl, (heteroaryl)(heterocyclo)alkyl, (heteroaryl)(carboxamido)alkyl, (heteroaryl)(cycloalkyl)alkyl, (aryl)(alkoxycarbonyl)alkyl, (cycloalkyl)alkyl, (heteroaryl)(amino) is selected from the group consisting of (heteroaryl)(alkoxycarbonyl)alkyl, (heterocyclo)(cycloalkyl)alkyl, (aryl)(cycloalkyl)alkyl, (aryl)(hydroxy)alkyl, (cycloalkyl)(hydroxy)alkyl, (hydroxy)alkyl, optionally substituted alkyl, (aryl)(haloalkyl)alkyl, (cycloalkyl)(haloalkyl)alkyl, (hydroxy)(haloalkyl)alkyl and (alkoxycarbonyl)(haloalkyl)alkyl; and G 2 is selected from the group consisting of hydrogen and alkyl; or G 1 and G2 together with the nitrogen atom to which they are attached form an optionally substituted heterocyclo. or a pharma- ceutically acceptable salt or solvate thereof.

[0042] In another embodiment, the substituted indole compound is a compound having formula I (In the formula, R 1a is halogen, C1-C6 alkyl, C1-C6 alkoxy, C3-C8 cycloalkyl, (hydroxy)C 1~6 Alkyl and (C3-C6 cycloalkyl)C 1~6 selected from the group consisting of alkyl; R 1b , R 1c and R 1d are each independently selected from the group consisting of hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, (hydroxy)C1-C6 alkyl, and C1-C6 alkoxy; R 1e is selected from the group consisting of hydrogen and C1-C6 alkyl; G 1 is an optionally substituted C6-C 10 Aryl, optionally substituted 5-10 membered heteroaryl, optionally substituted 3-10 membered heterocyclo, optionally substituted C3-C8 cycloalkyl, (C6-C 10 Aryl)C1-C6 alkyl, (5-10 membered heteroaryl)C1-C6 alkyl, (3-10 membered heterocyclo)C1-C6 alkyl, (amino)(C6-C 10 Aryl)C1-C6 alkyl, (5-14 membered heteroaryl)(C6-C 10 aryl)C1-C6 alkyl, (5-10 membered heteroaryl)(3-10 membered heterocyclo)C1-C6 alkyl, (5-10 membered heteroaryl)(carboxamido)C1-C6 alkyl, (5-10 membered heteroaryl)(C3-C6 cycloalkyl)C1-C6 alkyl, (C6-C 10aryl)(alkoxycarbonyl)C1-C6 alkyl, (C3-C6 cycloalkyl)C1-C6 alkyl, (5-10 membered heteroaryl)(amino)C1-C6 alkyl, (C3-C6 cycloalkyl)(alkoxycarbonyl)C1-C6 alkyl, (5-14 membered heteroaryl)(alkoxycarbonyl)C1-C6 alkyl, (3-14 membered heterocyclo)(C3-C8 cycloalkyl)C1-C6 alkyl, (C 6~10 Aryl)(C3-C8 cycloalkyl)C1-C6 alkyl, (C6-C 10 Aryl)(hydroxy)C1-C6 alkyl, (C3-C6 cycloalkyl)(hydroxy)C1-C6 alkyl, (hydroxy)C1-C6 alkyl, optionally substituted C1-C6 alkyl, (C6-C 10 aryl)(C1-C6 haloalkyl)C1-C6 alkyl, (C3-C6 cycloalkyl)(C1-C6 haloalkyl)C1-C6 alkyl, (hydroxy)(C1-C6 haloalkyl)C1-C6 alkyl; and (alkoxycarbonyl)(C1-C6 haloalkyl)C1-C6 alkyl; and G 2 is selected from the group consisting of hydrogen and C1-C6 alkyl; or G 1 and G 2 together with the nitrogen atom to which they are attached form an optionally substituted 5- to 10-membered heterocycle. or a pharma- ceutically acceptable salt or solvate thereof.

[0043] In another embodiment, the substituted indole compound is a compound having formula I (In the formula, R 1a is halogen, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, (hydroxy)C 1~4 Alkyl and (C3-C6 cycloalkyl)C 1~4 selected from the group consisting of alkyl; R 1b , R 1c and R 1dare each independently selected from the group consisting of hydrogen, halogen, C1-C3 alkyl, C2-C4 alkenyl, (hydroxy)C1-C4 alkyl, and C1-C3 alkoxy; R 1e is selected from the group consisting of hydrogen and C1-C3 alkyl; G 1 is an optionally substituted C6-C 10 Aryl, optionally substituted 5-10 membered heteroaryl, optionally substituted 3-10 membered heterocyclo, optionally substituted C3-C8 cycloalkyl, (C6-C 10 Aryl)C1-C4 alkyl, (5-10 membered heteroaryl)C1-C6 alkyl, (3-10 membered heterocyclo)C1-C4 alkyl, (amino)(C6-C 10 Aryl)C1-C6 alkyl, (5-14 membered heteroaryl)(C6-C 10 aryl)C1-C4 alkyl, (5-10 membered heteroaryl)(3-10 membered heterocyclo)C1-C4 alkyl, (5-10 membered heteroaryl)(carboxamido)C1-C4 alkyl, (5-10 membered heteroaryl)(C3-C6 cycloalkyl)C1-C4 alkyl, (C6-C 10 aryl)(alkoxycarbonyl)C1-C4 alkyl, (C3-C6 cycloalkyl)C1-C4 alkyl, (5-10 membered heteroaryl)(amino)C1-C4 alkyl, (C3-C6 cycloalkyl)(alkoxycarbonyl)C1-C4 alkyl, (5-14 membered heteroaryl)(alkoxycarbonyl)C1-C4 alkyl, (3-14 membered heterocyclo)(C3-C6 cycloalkyl)C1-C4 alkyl, (C 6~10 Aryl)(C3-C6 cycloalkyl)C1-C4 alkyl, (C6-C 10 Aryl)(hydroxy)C1-C4 alkyl, (C3-C6 cycloalkyl)(hydroxy)C1-C4 alkyl, (hydroxy)C1-C4 alkyl, optionally substituted C1-C4 alkyl, (C6-C 10aryl)(C1-C4 haloalkyl)C1-C4 alkyl, (C3-C6 cycloalkyl)(C1-C4 haloalkyl)C1-C4 alkyl, (hydroxy)(C1-C4 haloalkyl)C1-C4 alkyl and (alkoxycarbonyl)(C1-C4 haloalkyl)C1-C4 alkyl; and G 2 is selected from the group consisting of hydrogen and C1-C4 alkyl; or G 1 and G 2 together with the nitrogen atom to which they are attached form an optionally substituted 5- to 10-membered heterocycle. or a pharma- ceutically acceptable salt or solvate thereof.

[0044] In another embodiment, the substituted indole compound is a compound having formula I, [ka] is a double bond) or a pharma- ceutically acceptable salt or solvate thereof.

[0045] In another embodiment, the substituted indole compound is a compound having formula I, 1 and Q 2 is -C(H)=) or a pharma- ceutically acceptable salt or solvate thereof.

[0046] In another embodiment, the substituted indole compound is a compound having formula I, 3 is -C(R 1d ) =; and R 1d is selected from the group consisting of hydrogen and halo) or a pharma- ceutically acceptable salt or solvate thereof.

[0047] In another embodiment, the substituted indole compound is a compound having formula I, 1e is hydrogen) or a pharma- ceutically acceptable salt or solvate thereof.

[0048] In another embodiment, the substituted indole compound is a compound having formula I, 1a is C1-C3 alkyl) or a pharma- ceutically acceptable salt or solvate thereof.

[0049] In another embodiment, the substituted indole compound is a compound having formula I, 2 is hydrogen) or a pharma- ceutically acceptable salt or solvate thereof.

[0050] In another embodiment, the substituted indole compound has formula II: [ka] (In the formula, R 1d and G 1 is as defined in relation to formula I) or a pharma- ceutically acceptable salt or solvate thereof.

[0051] In another embodiment, the substituted indole compound is a compound having formula I or II, 1d is selected from the group consisting of hydrogen and fluoro) or a pharma- ceutically acceptable salt or solvate thereof.

[0052] In another embodiment, the substituted indole compound has formula II-A: [ka] (In the formula, G 1 is as defined in relation to formula II) or a pharma- ceutically acceptable salt or solvate thereof.

[0053] In another embodiment, the substituted indole compound is a compound having formula I, II or II-A, 1 is an optionally substituted C6-C 10Aryl, optionally substituted 5-9 membered heteroaryl, optionally substituted 3-10 membered heterocyclo, optionally substituted C6-C8 cycloalkyl, (5-9 membered heteroaryl)C1-C6 alkyl, (5-9 membered heteroaryl)(C 6~10 aryl)C1-C4 alkyl, (5-9 membered heteroarylheteroaryl)(C3-C6 cycloalkyl)C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl), or a pharma- ceutically acceptable salt or solvate thereof.

[0054] In another embodiment, the substituted indole compound has formula III: [ka] (In the formula, A 1 -N= and -C(R 2a )= selected from the group consisting of; R 2a is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 2b is optionally substituted alkyl, optionally substituted heterocyclo, optionally substituted cycloalkyl, optionally substituted heteroaryl, optionally substituted aryl, (carboxamido)alkyl, -OR 10c , amino, (heterocyclo)alkyl, (amino)alkyl, (hydroxy)alkyl, carboxamide, (heteroaryl)alkyl, -S(=O)R 9b , -S(=O)2R 9b and -C(=O)R 9c selected from the group consisting of; A 2 -N= and -C(R 2c )= selected from the group consisting of; R 2c is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 2d is selected from the group consisting of hydrogen, alkyl, halogen, cyano, and haloalkyl; R 2e is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 9b is selected from the group consisting of amino, alkyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclo, and optionally substituted heteroaryl; R 9c is selected from the group consisting of amino, alkyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclo, and optionally substituted heteroaryl; and R 10c is selected from the group consisting of alkyl, (hydroxy)alkyl and (amino)alkyl; and R 1d is as defined in relation to formula I) or a pharma- ceutically acceptable salt or solvate thereof.

[0055] In another embodiment, the substituted indole compound has formula III-A: [ka] (In the formula, R 1d , R 2a , R 2b , R 2c , R 2d and R 2e is as defined in relation to formula III) or a pharma- ceutically acceptable salt or solvate thereof.

[0056] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A. (In the formula, R 2a is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 2b teeth, (A) Unsubstituted 4- to 10-membered heterocyclo; (B)(i)-N(R 3a )C(=O)R 4a (ii) -NR 5a R 5b (iii) unsubstituted 4- to 10-membered heterocyclo; (iv) hydroxy, -NR 5c R 5d , C1-C4 alkyl, C1-C6 alkoxy, -C(R 6a )(R 6b )C(=O)NR 5e R 5f , -C(=O)R 4b (v) a substituted 4-10 membered heterocyclo having one, two or three substituents independently selected from the group consisting of (hydroxy)C1-C4 alkyl and halo; (v) an unsubstituted C3-C6 cycloalkyl; (vi) (hydroxy)C1-C4 alkyl; (vii) C1-C6 alkyl; (viii) -C(=O)NR 5g R 5h ;(ix)Halo;(x)-C(=O)R 4c (xi) C1-C6 haloalkyl; (xii) hydroxy; (xiii) (amino)C1-C4 alkyl; (xiv) (C1-C4 alkoxy)C1-C4 alkyl; (xv) -S(=O)2R 9a (xvi) (3-8 membered heterocyclo)C1-C4 alkyl; (xvii) C1-C6 alkoxy; (xviii) (C3-C6 cycloalkyl)C 1~4 Alkyl; (xix) (C 6~10 aryl) C1-C4 alkyl; and (xxii) -OR 10b a substituted 4-10 membered heterocyclo having 1, 2, 3 or 4 substituents independently selected from the group consisting of: (C) unsubstituted C3-C8 cycloalkyl; (D) (i) unsubstituted 4-10 membered heterocyclo; (ii) substituted 4-10 membered heterocyclo having one or two substituents independently selected from the group consisting of amino and C1-C4 alkyl; (iii) unsubstituted 5- or 6-membered heteroaryl; (iv) substituted 5- or 6-membered heteroaryl having one, two or three substituents independently selected from the group consisting of halo, C1-C4 alkyl, (3- to 8-membered heterocyclo) alkyl, hydroxy and amino; (v) -NR 5i R 5j (vi) cyano; (vii) -N(R 3d )C(=O)R 4f (viii) hydroxy; and (ix) a substituted C3-C8 cycloalkyl having 1, 2, 3, or 4 substituents independently selected from the group consisting of C1-C4 alkyl; (E) unsubstituted 5-10 membered heteroaryl; (F)(i) halo;(ii) C1-C4 alkyl;(C1-C4 alkoxy)C1-C4 alkyl;(hydroxy)C1-C4 alkyl;C3-C6 cycloalkyl;(amino)C1-C4 alkyl;unsubstituted C3-C6 cycloalkyl;-NR 5g R 5h a substituted C3-C6 cycloalkyl having one, two, three or four substituents independently selected from the group consisting of: an unsubstituted 4-14 membered heterocyclo; a substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; -NR 5q R 5r and (ix) a substituted 5-10 membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of (3-8 membered heterocyclo)C1-C4 alkyl; (G) Unsubstituted C6~C 10 Aryl; (H) (i) halo; (ii) C1-C4 alkyl; (iii) -CH2N(H)S(=O)2R 8 (iv) (5-9 membered heteroaryl) C1-C4 alkyl; (v) -OR 10a ;(vi)-N(R 3b )C(=O)R 4b(vii) (amino) C1-C4 alkyl; and (viii) (hydroxy) C1-C4 alkyl having 1, 2, 3 or 4 substituents independently selected from the group consisting of: 10 Aryl; (I) (carboxamido) C1-C4 alkyl; (J)-OR 10c ; (K)-NR 5o R 5p ; (L) (3-8 membered heterocyclo)C1-C4 alkyl; (M) (amino) C1-C4 alkyl; (N)(hydroxy)C1-C4 alkyl; (O)-C(=O)NR 5s R 5t ; (P) (5-9 membered heteroaryl)C1-C4 alkyl; and (Q)-S(=O)2R 9b selected from the group consisting of; R 2c is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 2d is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, cyano, and C1-C4 haloalkyl; R 2e is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 3a , R 3b , R 3c and R 3d are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, optionally substituted C3-C6 cycloalkyl, and optionally substituted 4-14 membered heterocyclo; R 4a , R 4b , R 4c , R 4d , R 4e and R 4fis C1-C6 alkyl; C1-C6 haloalkyl; C3-C6 cycloalkyl; C1-C6 alkoxy; (C1-C4 alkoxy)C1-C4 alkyl; (C 6~10 (aryl)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; (amino)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; (cyano)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted C6-C 10 aryl; substituted C6-C aryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo and C1-C4 alkyl; 10 aryl; unsubstituted 5- or 6-membered heteroaryl; and substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo and C1-C4 alkyl; R 5a and R 5b are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; R 5c and R 5dare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5c and R 5d together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5e and R 5f are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5e and R 5f together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5g and R 5hare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5g and R 5h together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5i and R 5j are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5i and R 5j together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5k and R 5lare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5k and R 5l together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5m and R 5n are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5m and R 5n together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5o and R 5pare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5o and R 5p together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5q and R 5r are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; R 5s and R 5tare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; R 6a , R 6b , R 6c and R 6d are each independently selected from the group consisting of hydrogen and C1-C4 alkyl; R 8 is C1-C6 alkyl; R 9a is selected from the group consisting of C1-C6 alkyl; unsubstituted C3-C8 cycloalkyl; and substituted C3-C8 cycloalkyl having 1 or 2 substituents independently selected from the group consisting of halo, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; R 9b is selected from the group consisting of C1-C6 alkyl and amino; R 10a is selected from the group consisting of alkyl, (hydroxy)C1-C4 alkyl, and (amino)C1-C4 alkyl; R 10b is (amino)C1-C4 alkyl; and R 10c is (amino)C1-C4 alkyl) or a pharma- ceutically acceptable salt or solvate thereof.

[0057] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is an optionally substituted 3- to 10-membered heterocycle linked to the remainder of the molecule through a nitrogen atom, e.g., R 2bteeth, [ka] etc.).

[0058] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A. (In the formula, R 2b teeth, [ka] selected from the group consisting of; R a1 is -N(R 3a )C(=O)R 4a ;-NR 5a R 5b ;Unsubstituted 4-10 membered heterocyclo;Hydroxy, -NR 5c R 5d , C1-C4 alkyl, C1-C6 alkoxy, -C(R 6a )(R 6b )C(=O)NR 5e R 5f , -C(=O)R 4b , (hydroxy)C1-C4 alkyl, and halo; R a2 and R a3 are each hydrogen; or R a2 and R a3 together with the carbon atom to which they are attached to form a C(=O) group; R a4 is selected from the group consisting of hydrogen, halo, and hydroxy; R a5 is selected from the group consisting of hydrogen, C1-C4 alkyl, and C3-C6 cycloalkyl; R b1 is selected from the group consisting of hydrogen, C1-C4 alkyl, and C3-C6 cycloalkyl; R c1is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c selected from the group consisting of; R c2 and R c3 are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, and C1-C4 haloalkyl; or R c2 and R c3 together with the carbon atom to which they are attached to form a C(=O) group; R c4 is selected from the group consisting of hydrogen and C1-C4 alkyl; m is 1 or 2; R d1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c is selected from the group consisting of R d2 and R d3 are each independently selected from the group consisting of hydrogen and fluoro; R e1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c selected from the group consisting of; R f1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c is selected from the group consisting of R g1 is hydrogen, C1-C4 alkyl, -C(=O)R 4c , C1-C4 haloalkyl, (C1-C4 alkoxy)C1-C4 alkyl; R h1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c selected from the group consisting of; R h2 is selected from the group consisting of hydrogen and C1-C4 alkyl; R h3 and R h4 are each independently selected from the group consisting of hydrogen and C1-C4 alkyl; or R h3 and Rh4 together with the carbon atom to which they are attached to form a C(=O) group; R i1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl, (hydroxy)C1-C4 alkyl, -N(R 3a )C(=O)R 4a and (amino)C1-C4 alkyl; Z 1 is selected from the group consisting of -CH2- and -O-; R j1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c selected from the group consisting of; R k1 is C1-C4 alkyl, unsubstituted 4-14 membered heterocyclo and -NR 5a R 5b selected from the group consisting of; R k2 is selected from the group consisting of hydrogen, hydroxy, and C1-C4 alkyl; r is 0, 1 or 2; Z 2 is -O- and -N(R m3 )- selected from the group consisting of; R m3 is selected from the group consisting of hydrogen, C1-C4 alkyl, and C1-C4 haloalkyl; R n3 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R o1 is hydroxy, (hydroxy)C1-C4 alkyl, (amino)C1-C4 alkyl, (C1-C4 alkoxy)C1-C4 alkyl, C1-C4 alkoxy, -NR 5a R 5b , unsubstituted 4-14 membered heterocyclo, and substituted 4-14 membered heterocyclo having 1, 2, or 3 substituents independently selected from the group consisting of halo, C1-C4 alkyl, and C1-C4 alkoxy; R o2is selected from the group consisting of hydrogen, C1-C4 alkyl, and (C1-C4 alkoxy)C1-C4 alkyl; R o3 is selected from the group consisting of hydrogen, fluoro, and C1-C4 alkyl; R p1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; Z 3 is -O- and -N(R q1 )- selected from the group consisting of; R q1 is selected from the group consisting of hydrogen and C1-C4 alkyl; R r1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R s1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R t1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R u1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R v1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R w1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R x1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R y1 is selected from the group consisting of hydrogen and C1-C4 alkyl; and R z1 is selected from the group consisting of hydrogen and C1-C4 alkyl or a pharma- ceutically acceptable salt or solvate thereof.

[0059] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b teeth, [ka] [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0060] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -1, R 2b -1A, R 2b -1B, R 2b -1C or R 2b -1D) or a pharma- ceutically acceptable salt or solvate thereof. a1 is -N(R 3a )C(=O)R 4a In another embodiment, R a1 -NR 5a R 5b In another embodiment, R a1 -NR 5a R 5b and R 5a and R 5b is independently selected from the group consisting of hydrogen and C1-C4 alkyl. a1 is an optionally substituted 4-10 membered heterocyclo.

[0061] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -2, R 2b -2A or R 2b -2b) or a pharma- ceutically acceptable salt or solvate thereof. b1 is C1-C4 alkyl.

[0062] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -3, R 2b -3A or R 2b -3B) or a pharma- ceutically acceptable salt or solvate thereof. c1 is C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c In another embodiment, R c2 and R c3 are each hydrogen. c2 and R c3 taken together with the carbon atom to which they are attached form a C(=O) group. In another embodiment, R c4 In another embodiment, m is 1.

[0063] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -4) or a pharma- ceutically acceptable salt or solvate thereof. d1 is C(=O)R 4c In another embodiment, R d2 and R d3 are each hydrogen or fluoro.

[0064] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -5, R 2b -5A or R 2b -5B) or a pharma- ceutically acceptable salt or solvate thereof. e1 is -C(=O)R 4c It is.

[0065] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R2b -6, R 2b -6A or R 2b -6B) or a pharma- ceutically acceptable salt or solvate thereof. f1 is C(=O)R 4c It is.

[0066] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -7) or a pharma- ceutically acceptable salt or solvate thereof. g1 is C(=O)R 4c It is.

[0067] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -8, R 2b -8A, R 2b -8B, R 2b -8C or R 2b -8D) or a pharma- ceutically acceptable salt or solvate thereof. h1 is -C(=O)R 4c In another embodiment, R h2 is selected from the group consisting of hydrogen and C1-C3 alkyl. h3 is hydrogen.

[0068] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -9) or a pharma- ceutically acceptable salt or solvate thereof.

[0069] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -10, R 2b -10A, R 2b -10B, R 2b -10C and R2b -10d) or a pharma- ceutically acceptable salt or solvate thereof.

[0070] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -11, R 2b -11A and R 2b -11B) or a pharma- ceutically acceptable salt or solvate thereof.

[0071] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -12) or a pharma- ceutically acceptable salt or solvate thereof. j1 is -C(=O)R 4c It is.

[0072] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -13, R 2b -13A, R 2b -13B, R 2b -13C, R 2b -13D, R 2b -13E and R 2b -13F) or a pharma- ceutically acceptable salt or solvate thereof.

[0073] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -14) or a pharma- ceutically acceptable salt or solvate thereof.

[0074] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b-15) or a pharma- ceutically acceptable salt or solvate thereof.

[0075] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -16, R 2b -16A and R 2b -16B) or a pharma- ceutically acceptable salt or solvate thereof. In another embodiment, R n3 is -C(=O)R 4c It is.

[0076] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -17) or a pharma- ceutically acceptable salt or solvate thereof.

[0077] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -18) or a pharma- ceutically acceptable salt or solvate thereof.

[0078] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -19) or a pharma- ceutically acceptable salt or solvate thereof.

[0079] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -20) or a pharma- ceutically acceptable salt or solvate thereof.

[0080] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -21, R 2b -21A and R2b -21B) or a pharma- ceutically acceptable salt or solvate thereof.

[0081] In another embodiment, the substituted indole compound is a compound having formula III, 2b is R 2b -22, R 2b -22A and R 2b -22B) or a pharma- ceutically acceptable salt or solvate thereof.

[0082] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -23) or a pharma- ceutically acceptable salt or solvate thereof.

[0083] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -24) or a pharma- ceutically acceptable salt or solvate thereof.

[0084] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -25) or a pharma- ceutically acceptable salt or solvate thereof.

[0085] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -26, R 2b -26A and R 2b -26B) or a pharma- ceutically acceptable salt or solvate thereof.

[0086] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -27, R 2b-27A and R 2b -27B) or a pharma- ceutically acceptable salt or solvate thereof.

[0087] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -28, R 2b -28A and R 2b -28B) or a pharma- ceutically acceptable salt or solvate thereof.

[0088] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -29) or a pharma- ceutically acceptable salt or solvate thereof.

[0089] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R 2b -30, R 2b -30A or R 2b -30B) or a pharma- ceutically acceptable salt or solvate thereof.

[0090] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2b is R provided in relation to formula IV 11a The compound is any one or more of the groups:

[0091] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 4c is C1-C4 alkyl) or a pharma- ceutically acceptable salt or solvate thereof.

[0092] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2dis selected from the group consisting of hydrogen, fluoro and chloro) or a pharma- ceutically acceptable salt or solvate thereof.

[0093] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2d is hydrogen) or a pharma- ceutically acceptable salt or solvate thereof.

[0094] In another embodiment, the substituted indole compound is a compound having formula III in any of the embodiments described above, 1 and A 2 is -C(H)=;R 2e is hydrogen; and R 2d is selected from the group consisting of hydrogen and halogen) or a pharma- ceutically acceptable salt or solvate thereof.

[0095] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, 2d is fluoro) or a pharma- ceutically acceptable salt or solvate thereof.

[0096] In another embodiment, the substituted indole compound has formula IV: [ka] (In the formula, Z 4 -O-, -C(R 28a )(R 28b )- and -N(R 23 )-; or Z 4 is non-existent; Z 5 is selected from the group consisting of -CH2- and -CH2CH2-; R 11a is an optionally substituted alkyl, an optionally substituted heterocyclo, an optionally substituted heteroaryl, and -N(R 12b )C(=O)R 13c selected from the group consisting of; R 12b is selected from the group consisting of hydrogen, alkyl, cycloalkyl, and heterocyclo; R 13c is selected from the group consisting of alkyl, haloalkyl, alkoxy, (alkoxy)alkyl, (hydroxy)alkyl, (cyano)alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl and optionally substituted heterocycle, amino, (amino)alkyl, (C3-C6 cycloalkyl)oxy and (4-8 membered heterocyclo)oxy; R 23 is selected from the group consisting of hydrogen and C1-C4 alkyl; R 28a and R 28b is independently selected from the group consisting of hydrogen, alkyl, and halo; and R 1d is as defined in relation to formula I) or a pharma- ceutically acceptable salt or solvate thereof.

[0097] In another embodiment, the substituted indole compound is a compound having formula IV, 4 is selected from the group consisting of -O- and -CH2-; or Z 4 is absent) or a pharma- ceutically acceptable salt or solvate thereof.

[0098] In another embodiment, the substituted indole compound is a compound having formula IV (In the formula, Z 4 is selected from the group consisting of -O- and -CH2-; or Z 4 is non-existent; Z 5 is selected from the group consisting of -CH2- and -CH2CH2-; R 13cis selected from the group consisting of alkyl, haloalkyl, alkoxy, (alkoxy)alkyl, (hydroxy)alkyl, (cyano)alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocycle; and R 1d is as defined in relation to formula I) or a pharma- ceutically acceptable salt or solvate thereof.

[0099] In another embodiment, the substituted indole compound has formula IV-A: [ka] (In the formula, R 1d , R 11a and Z 4 is as defined in relation to formula IV) or a pharma- ceutically acceptable salt or solvate thereof.

[0100] In another embodiment, the substituted indole compound has formula IV-B: [ka] (In the formula, R 1d , R 11a and Z 4 is as defined in relation to formula IV) or a pharma- ceutically acceptable salt or solvate thereof.

[0101] In another embodiment, the substituted indole compound has formula IV-C: [ka] (In the formula, R 1d , R 11a and Z 4 is as defined in relation to formula IV) or a pharma- ceutically acceptable salt or solvate thereof.

[0102] In another embodiment, the substituted indole compound has formula IV-D: [ka] (In the formula, R 1d , R 11a and Z 4 is as defined in relation to formula IV) or a pharma- ceutically acceptable salt or solvate thereof.

[0103] In another embodiment, the substituted indole compound has any one of formulas IV, IV-A, IV-B, IV-C, or IV-D. (In the formula, R 11a (A) unsubstituted 4- to 14-membered heterocyclo; (B) -N(R 12a )C(=O)R 13a ;-C(=O)R 13b ;C1-C4 alkyl;(C1-C4 alkoxy)C1-C4 alkyl;(hydroxy)C1-C4 alkyl;C1-C4 haloalkyl;Amino;Hydroxy;-N(R 12a )S(=O)2R 24 ;-S(=O)2R 24 unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one, two or three substituents independently selected from the group consisting of substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (C) unsubstituted 5-10 membered heteroaryl; (D) substituted 5- or 6-membered heteroaryl having one, two, three or four substituents independently selected from the group consisting of halo, C1-C4 alkyl and (amino) alkyl; (E) C1-C6 alkyl; and (F) -N(R 12b )C(=O)R 13c selected from the group consisting of; R12a and R 12b are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, (C1-C4 alkoxy)C1-C4 alkyl, and (hydroxy)C1-C4 alkyl; R 13a , R 13b and R 13c is C1-C6 alkyl; C1-C6 haloalkyl; unsubstituted C3-C6 cycloalkyl; C1-C6 alkoxy; (C1-C4 alkoxy)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; (cyano)alkyl; unsubstituted C6-C 10 aryl; substituted C6-C aryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; 10 aryl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; unsubstituted 4-14-membered heterocyclo; substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; amino; (amino)alkyl; (C3-C6 cycloalkyl)oxy; and (4-8-membered heterocyclo)oxy; and R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl It is.

[0104] In another embodiment, the substituted indole compound is a compound having formula IV, IV-A, IV-B, IV-C or IV-D, 4 is -C(R 28a )(R 28b )-; and R 28a and R 28b are independently selected from the group consisting of hydrogen, C1-C4 alkyl, and fluoro), or a pharma- ceutically acceptable salt or solvate thereof.

[0105] In another embodiment, the substituted indole compound is a compound having formula IV, IV-A, IV-B, IV-C or IV-D, 4 is -C(R 28a )(R 28b )-and;R 28a is hydrogen; and R 28b is selected from the group consisting of C1-C4 alkyl and fluoro) or a pharma- ceutically acceptable salt or solvate thereof.

[0106] In another embodiment, the substituted indole compound is a compound having formula IV, IV-A, IV-B, IV-C or IV-D, 4 is -C(R 28a )(R 28b )-; and R 28a and R 28b are independently C1-C4 alkyl) or a pharma- ceutically acceptable salt or solvate thereof.

[0107] In another embodiment, the substituted indole compound is a compound having formula IV, IV-A, IV-B, IV-C or IV-D, 4 is -O-, -CH2- and -N(R 23 ) or Z 4 is absent) or a pharma- ceutically acceptable salt or solvate thereof.

[0108] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, 4 is -CH2-) or a pharma- ceutically acceptable salt or solvate thereof.

[0109] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is an optionally substituted 3- to 10-membered heterocycle linked to the remainder of the molecule through a nitrogen atom, e.g., R 11a teeth, [ka] etc.).

[0110] In another embodiment, the substituted indole compound has any one of formulas IV, IV-A, IV-B, IV-C, or IV-D. (In the formula, R 11a teeth, [ka] is a substituted 4-14 membered heterocyclo selected from the group consisting of: R 12a is selected from the group consisting of hydrogen, C1-C3 alkyl, (C1-C4 alkoxy)C1-C4 alkyl; and (hydroxy)C1-C4 alkyl; R 13a is selected from the group consisting of C1-C4 alkyl; amino; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; R 13b is selected from the group consisting of C1-C4 alkyl; amino; C1-C4 haloalkyl; C1-C4 alkoxy; (hydroxy)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (amino)alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (C3-C6 cycloalkyl)oxy; and (4-8 membered heterocyclo)oxy; R 21 is hydrogen, -C(=O)R 13b , C1-C4 alkyl, C1-C4 haloalkyl, unsubstituted 4-14 membered heterocyclo and -S(=O)R 24 selected from the group consisting of; R 22 is C1-C4 alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl; R 25 is selected from the group consisting of hydrogen, C1-C4 alkyl, and C1-C4 haloalkyl; R 25b and R 25c is independently selected from the group consisting of C1-C4 alkyl and C1-C4 haloalkyl; R 26 is selected from the group consisting of unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; and R 21a and R 25a together with the atom to which they are attached form an optionally substituted 4-8 membered heterocycle. or a pharma- ceutically acceptable salt or solvate thereof.

[0111] In another embodiment, the substituted indole compound has any one of formulas IV, IV-A, IV-B, IV-C, or IV-D. (In the formula, R 11a teeth, [ka] [ka] is selected from the group consisting of R 27a and R 27b are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, C1-C4 haloalkyl, (C1-C4 alkoxy)C1-C4 alkyl, and (hydroxy)C1-C4 alkyl; R 27c is hydrogen; -C(=O)R 13b C1-C4 alkyl; C1-C4 haloalkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; and -S(=O)2R 24 selected from the group consisting of; R 27d is selected from the group consisting of hydrogen; C1-C4 alkyl; and C1-C4 haloalkyl; R 13b is selected from the group consisting of C1-C4 alkyl; amino C1-C4 haloalkyl; C1-C4 alkoxy; (hydroxy)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (amino)alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (C3-C6 cycloalkyl)oxy; and (4-8 membered heterocyclo)oxy; and R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl or a pharma- ceutically acceptable salt or solvate thereof.

[0112] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a teeth, [ka] [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0113] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is an unsubstituted 4- to 14-membered heterocyclo; -N(R 12a )C(=O)R 13a , -C(=O)R 13b and C1-C4 alkyl; unsubstituted 5-10 membered heteroaryl; and substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl), or a pharma- ceutically acceptable salt or solvate thereof.

[0114] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a teeth, [ka] or a phenyl group or a phenyl group, or a phenyl group ...

[0115] In another embodiment, R 12a is selected from the group consisting of hydrogen and C1-C3 alkyl; R 13a is C1-C4 alkyl; and R 13bis C1-C4 alkyl, or a pharma- ceutically acceptable salt or solvate thereof. 12a is selected from the group consisting of hydrogen and methyl; R 13a is methyl; and R 13b is methyl, or a pharma- ceutically acceptable salt or solvate thereof.

[0116] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R provided in relation to formula III 2b The compound may be any one or more of the groups:

[0117] In another embodiment, the substituted indole compound has any one of formulas IV, IV-A, IV-B, IV-C, or IV-D. (In the formula, R 11a teeth, [ka] and R a1 , R a2 , R a3 , R a4 、 R a5 , R b1 , R c1 , R c2 , R c3 , R c4 , m, R d1 , R d2 , R d3 , R e1 , R f1 , R g1 , R h1 , R h2 , R h3 , R h4 , R i1 , Z 1 , R j1 , R k1 , R k2 , r, Z 2 , Rn3 , R o1 , R o2 , R o3 , R p1 、 Z 3 、 R r1 、 R s1 , R t1 , R u1 , R v1 , R w1 , R x1 , R y1 and R z1 is as defined in relation to formula III) or a pharma- ceutically acceptable salt or solvate thereof.

[0118] In another embodiment, the substituted indole compound has any one of formulas IV, IV-A, IV-B, IV-C, or IV-D. (In the formula, R 11a teeth, [ka] [ka] and R a1 , R a5 , R b1 , R e1 , R f1 , R h1 , R h2 , R h3 , R k1 , R n3 , R s1 , R t1 , R w1 , R x1 and R y1 is as defined in relation to formula III) or a pharma- ceutically acceptable salt or solvate thereof.

[0119] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -1, R 11a -1A, R 11a -1B, R 11a -1C or R 11a -1D) or a pharma- ceutically acceptable salt or solvate thereof. a1 is -N(R 3a )C(=O)R 4a In another embodiment, R a1 -NR 5a R 5b In another embodiment, R a1 -NR 5a R 5b and R 5a and R 5b is independently selected from the group consisting of hydrogen and C1-C4 alkyl. a1 is an optionally substituted 4-10 membered heterocyclo.

[0120] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -2, R 11a -2A or R 11a -2b) or a pharma- ceutically acceptable salt or solvate thereof. b1 is C1-C4 alkyl.

[0121] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -3, R 11a -3A or R 11a -3B) or a pharma- ceutically acceptable salt or solvate thereof. c1 is C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R4c In another embodiment, R c2 and R c3 are each hydrogen. c2 and R c3 taken together with the carbon atom to which they are attached form a C(=O) group. In another embodiment, R c4 In another embodiment, m is 1.

[0122] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -4) or a pharma- ceutically acceptable salt or solvate thereof. d1 is C(=O)R 4c In another embodiment, R d2 and R d3 are each hydrogen or fluoro.

[0123] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D (R 11a is R 11a -5, R 11a -5A or R 11a -5B) or a pharma- ceutically acceptable salt or solvate thereof. e1 is -C(=O)R 4c It is.

[0124] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -6, R 11a -6A or R 11a -6B) or a pharma- ceutically acceptable salt or solvate thereof. f1 is C(=O)R 4c It is.

[0125] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -7) or a pharma- ceutically acceptable salt or solvate thereof. g1 is C(=O)R 4c It is.

[0126] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -8, R 11a -8A, R 11a -8B, R 11a -8C or R 11a -8D) or a pharma- ceutically acceptable salt or solvate thereof. h1 is -C(=O)R 4c In another embodiment, R h2 is selected from the group consisting of hydrogen and C1-C3 alkyl. h3 is hydrogen.

[0127] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -9) or a pharma- ceutically acceptable salt or solvate thereof.

[0128] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -10, R 11a -10A, R 11a -10B, R 11a -10C and R 11a -10d) or a pharma- ceutically acceptable salt or solvate thereof.

[0129] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -11, R 11a -11A and R 11a -11B) or a pharma- ceutically acceptable salt or solvate thereof.

[0130] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -12) or a pharma- ceutically acceptable salt or solvate thereof. j1 is -C(=O)R 4c It is.

[0131] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -13, R 11a -13A, R 11a -13B, R 11a -13C, R 11a -13D, R 11a -13E and R 11a -13F) or a pharma- ceutically acceptable salt or solvate thereof.

[0132] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -14) or a pharma- ceutically acceptable salt or solvate thereof.

[0133] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a-15) or a pharma- ceutically acceptable salt or solvate thereof.

[0134] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -16, R 11a -16A and R 11a -16B) or a pharma- ceutically acceptable salt or solvate thereof. In another embodiment, R n3 is -C(=O)R 4c It is.

[0135] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -17) or a pharma- ceutically acceptable salt or solvate thereof.

[0136] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -18) or a pharma- ceutically acceptable salt or solvate thereof.

[0137] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -19) or a pharma- ceutically acceptable salt or solvate thereof.

[0138] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -20) or a pharma- ceutically acceptable salt or solvate thereof.

[0139] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -21, R 11a -21A and R 11a -21B) or a pharma- ceutically acceptable salt or solvate thereof.

[0140] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D (R 11a is R 11a -22, R 11a -22A and R 11a -22B) or a pharma- ceutically acceptable salt or solvate thereof.

[0141] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -23) or a pharma- ceutically acceptable salt or solvate thereof.

[0142] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -24) or a pharma- ceutically acceptable salt or solvate thereof.

[0143] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -25) or a pharma- ceutically acceptable salt or solvate thereof.

[0144] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R11a -26, R 11a -26A and R 11a -26B) or a pharma- ceutically acceptable salt or solvate thereof.

[0145] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -27, R 11a -27A and R 11a -27B) or a pharma- ceutically acceptable salt or solvate thereof.

[0146] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -28, R 11a -28A and R 11a -28B) or a pharma- ceutically acceptable salt or solvate thereof.

[0147] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -29) or a pharma- ceutically acceptable salt or solvate thereof.

[0148] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C, or IV-D, where R 11a is R 11a -30, R 11a -30A or R 11a -30B) or a pharma- ceutically acceptable salt or solvate thereof.

[0149] In another embodiment, the substituted indole compound has any one of formulas IV-A, IV-B, IV-C, or IV-D. (In the formula, Z 4 is -CH2-; R 11a teeth, [ka] is selected from the group consisting of R 12a is selected from the group consisting of hydrogen and C1-C3 alkyl; R 21 is -C(=O)R 13b and; R 27c is -C(=O)R 13b and; R 13b is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl; R 24 is C1-C4 alkyl; R 25 is selected from the group consisting of hydrogen, C1-C4 alkyl, and C1-C4 haloalkyl; and R 25b and R 25c are independently selected from the group consisting of C1-C4 alkyl and C1-C4 haloalkyl. or a pharma- ceutically acceptable salt or solvate thereof.

[0150] In another embodiment, the substituted indole compound has any one of formulas IV-A, IV-B, IV-C, or IV-D. (In the formula, Z 4 is -CH2-; R 11a teeth, [ka] (selected from the group consisting of or a pharma- ceutically acceptable salt or solvate thereof.

[0151] In another embodiment, the substituted indole compound has formula V: [ka] (In the formula, R 14a is selected from the group consisting of optionally substituted alkyl and optionally substituted heteroaryl; R 14b is selected from the group consisting of optionally substituted alkyl, optionally substituted heteroaryl, optionally substituted aryl, optionally substituted heterocyclo, optionally substituted cycloalkyl, and carboxamido; and p is 0, 1, 2 or 3. or a pharma- ceutically acceptable salt or solvate thereof.

[0152] In another embodiment, the substituted indole compound has the formula VA: [ka] (In the formula, R 1d , R 14a , R 14d and p is as defined in relation to formula V. or a pharma- ceutically acceptable salt or solvate thereof.

[0153] In another embodiment, the substituted indole compound has formula VB: [ka] (In the formula, R 1d , R 14a , R 14d and p is as defined in relation to formula V. or a pharma- ceutically acceptable salt or solvate thereof.

[0154] In another embodiment, the substituted indole compound has any one of the formulas V, VA, or VB. (In the formula, R 14ais (A) unsubstituted 5-10 membered heteroaryl; (B) (i) halo; (ii) C1-C4 alkyl; (iii) C1-C4 alkoxy; (iv) (3-8 membered heterocyclo)C1-C4 alkyl; (v) (5-9 membered heteroaryl)C1-C4 alkyl; (vi) -C(=O)NR 15a R 15b (vii) unsubstituted 5-10 membered heteroaryl; (viii) halo, C1-C4 alkyl, (3-8 membered heterocyclo)C1-C4 alkyl, 5-9 membered heteroaryl and -NR 15e R 15f (ix) -OR 16 (x) unsubstituted C3-C6 cycloalkyl; (xi) C1-C4 alkyl and -N(R 17a )C(=O)R 18a (xii) cyano; (xiii) unsubstituted 4-14 membered heterocyclo; (xiv) substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of C1-C4 alkyl, (5-9 membered heteroaryl)C1-C4 alkyl; (xv) (carboxy)C1-C4 alkyl; (xvi) (carboxamido)C1-C4 alkyl; and (xvii) substituted 5- or 10-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of carboxy; and (C) selected from the group consisting of C1-C6 alkyl; R 14b (A) unsubstituted 5-10 membered heteroaryl; (B) substituted 5- or 10-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; (C) unsubstituted C6-C 10 (D) a substituted C6-C alkyl group having one, two, three or four substituents independently selected from the group consisting of halo, C1-C4 alkyl and (3-8 membered heterocyclo)C1-C4 alkyl. 10Aryl; (E) unsubstituted 4-14 membered heterocyclo; (F) substituted 4-14 membered heterocyclo having 1, 2, 3 or 4 substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; (G) -C(=O)NR 15c R 15d (H) unsubstituted C3-C6 cycloalkyl; and (I) C1-C6 alkyl; p is 0, 1, 2 or 3; R 15a and R 15b (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 Aryl; (H) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10 Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (K) unsubstituted 4-14-membered heterocyclo; (L) substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15h or R 15a and R 15b together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 15c and R 15d(A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 Aryl; (H) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10 Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (K) unsubstituted 4-14-membered heterocyclo; (L) substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15h or R 15c and R 15d together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 15e and R 15f (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 Aryl; (H) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (K) unsubstituted 4-14-membered heterocyclo; (L) substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15h or R 15e and R 15f together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 15g and R 15h (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) C1-C6 alkoxy; (E) (C1-C4 alkoxy)C1-C4 alkyl; (F) (hydroxy)C1-C4 alkyl; (G) (cyano)alkyl; (H) unsubstituted C6-C 10 Aryl; (I) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10 Aryl; (J) unsubstituted 5- or 6-membered heteroaryl; (K) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (L) unsubstituted 4-14-membered heterocyclo; (M) substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (N) unsubstituted C3-C8 cycloalkyl; and (O) C1-C6 alkyl and -NR 15g R 15h or R 15g and R 15g together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 16 is (amino)(hydroxy)C1-C4 alkyl; R 17a is selected from the group consisting of hydrogen and C1-C4 alkyl; R 18a (A) C1-C6 alkyl; (B) C1-C6 haloalkyl; (C) C1-C6 alkoxy; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 Aryl; (H) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10 (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (K) unsubstituted 4-14-membered heterocyclo; (L) substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) substituted C3-C8 cycloalkyl having 1, 2, 3, or 4 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl. or a pharma- ceutically acceptable salt or solvate thereof.

[0155] In another embodiment, the substituted indole compound is a compound having any one of formulas V, VA, or VB, 14a is unsubstituted 5-10 membered heteroaryl; and C1-C4 alkyl; C1-C4 alkoxy; (3-8 membered heterocyclo)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; -C(=O)NR 15a R 15ba substituted 5- or 10-membered heteroaryl having one, two or three substituents independently selected from the group consisting of: unsubstituted 5- to 10-membered heteroaryl; halo, C1-C4 alkyl, (3- to 8-membered heterocyclo)C1-C4 alkyl, 5- to 9-membered heteroaryl and -NR 15e R 15f Substituted 5- or 10-membered heteroaryl having one, two, or three substituents independently selected from the group consisting of: unsubstituted C3-C6 cycloalkyl; and C1-C4 alkyl and -N(R 17a )C(=O)R 18a or a pharma- ceutically acceptable salt or solvate thereof.

[0156] In another embodiment, the substituted indole compound is a compound having any one of formulas V, VA, or VB, 14a is C1-C4 alkyl; C1-C4 alkoxy; (3-8 membered heterocyclo)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; -C(=O)NR 15a R 15b substituted pyridyl having one, two or three substituents independently selected from the group consisting of: unsubstituted 5-10 membered heteroaryl; halo, C1-C4 alkyl, (3-8 membered heterocyclo)C1-C4 alkyl, 5-9 membered heteroaryl and -NR 15e R 15f Substituted 5-10 membered heteroaryl having one, two or three substituents independently selected from the group consisting of: unsubstituted C3-C6 cycloalkyl; and C1-C4 alkyl and -N(R 17a )C(=O)R 18a or a pharma- ceutically acceptable salt or solvate thereof.

[0157] In another embodiment, the substituted indole compound is a compound having any one of formulas V, VA, or VB, 14bis an unsubstituted 5-10 membered heteroaryl; a substituted 5-10 membered heteroaryl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; an unsubstituted C6-C 10 Aryl; Substituted C6-C having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (3-8 membered heterocyclo)C1-C4 alkyl. 10 aryl; unsubstituted 4-14 membered heterocyclo; substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; and unsubstituted C3-C6 cycloalkyl) or a pharma- ceutically acceptable salt or solvate thereof.

[0158] In another embodiment, the substituted indole compound is a compound having any one of formulas V, VA, or VB, 14b is selected from the group consisting of unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; unsubstituted phenyl; substituted phenyl having 1 or 2 substituents independently selected from the group consisting of C1-C4 alkyl and (3-8 membered heterocyclo)C1-C4 alkyl; and unsubstituted C3-C6 cycloalkyl), or a pharma- ceutically acceptable salt or solvate thereof.

[0159] In another embodiment, the substituted indole compound is a compound having any one of formulas V, VA or VB, wherein p is 0, or a pharma- ceutically acceptable salt or solvate thereof.

[0160] In another embodiment, the substituted indole compound is a compound having any one of formulas V, VA or VB, wherein p is 1, or a pharma- ceutically acceptable salt or solvate thereof.

[0161] In another embodiment, the substituted indole compound has formula VI: [ka] (In the formula, R 19 is selected from the group consisting of unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; R 20 is selected from the group consisting of hydrogen, halo, and C1-C4 alkyl; and q is 1, 2 or 3. or a pharma- ceutically acceptable salt or solvate thereof.

[0162] In another embodiment, the substituted indole compound is a compound having formula VI, wherein q is 1.

[0163] In another embodiment, the substituted indole compound has formula VII: [ka] (In the formula, R 11b is selected from the group consisting of C1-C4 alkyl, halo, and C1-C4 haloalkyl; and R 1d and R 11a is as defined in relation to formula IV) or a pharma- ceutically acceptable salt or solvate thereof.

[0164] In another embodiment, the substituted indole compound has formula VII-A: [ka] (In the formula, R 1d , R 11a and R 11b is as defined in relation to formula VII. or a pharma- ceutically acceptable salt or solvate thereof.

[0165] In another embodiment, the substituted indole compound has formula VII-B: [ka] (In the formula, R 1d , R 11a and R 11b is as defined in relation to formula VII. or a pharma- ceutically acceptable salt or solvate thereof.

[0166] In another embodiment, the substituted indole compound has formula VII-C: [ka] (In the formula, R 1d , R 11a and R 11b is as defined in relation to formula VII. or a pharma- ceutically acceptable salt or solvate thereof.

[0167] In another embodiment, the substituted indole compound has formula VII-D: [ka] (In the formula, R 1d , R 11a and R 11b is as defined in relation to formula VII. or a pharma- ceutically acceptable salt or solvate thereof.

[0168] In another embodiment, the substituted indole compound has formula VII-E: [ka] (In the formula, R 1d , R 11a and R 11b is as defined in relation to formula VII. or a pharma- ceutically acceptable salt or solvate thereof.

[0169] In another embodiment, the substituted indole compound has formula VII-F: [ka] (In the formula, R 1d , R 11a and R 11b is as defined in relation to formula VII. or a pharma- ceutically acceptable salt or solvate thereof.

[0170] In another embodiment, the substituted indole compound has formula VII-G: [ka] (In the formula, R 1d , R 11a and R 11b is as defined in relation to formula VII. or a pharma- ceutically acceptable salt or solvate thereof.

[0171] In another embodiment, the substituted indole compound has formula VII-H: [ka] (In the formula, R 1d , R 11a and R 11b is as defined in relation to formula VII. or a pharma- ceutically acceptable salt or solvate thereof.

[0172] In another embodiment, the substituted indole compound has formula VIII: [ka] (In the formula, R 30is hydrogen; C1-C6 alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; -C(=O)R 13b and -S(=O)2R 24 selected from the group consisting of; R 13b is selected from the group consisting of C1-C4 alkyl; amino; C1-C4 haloalkyl; C1-C4 alkoxy; (hydroxy)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (amino)alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (C3-C6 cycloalkyl)oxy; and (4-8 membered heterocyclo)oxy; R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl; u is 0, 1, 2 or 3; and R 1d is as defined in relation to formula I) or a pharma- ceutically acceptable salt or solvate thereof.

[0173] In another embodiment, the substituted indole compound has formula VIII-A: [ka] (In the formula, R 1d , R 30 and u is as defined in relation to formula VIII. or a pharma- ceutically acceptable salt or solvate thereof.

[0174] In another embodiment, the substituted indole compound has formula VIII-B: [ka] (In the formula, R 1d , R 30 and u is as defined in relation to formula VIII. or a pharma- ceutically acceptable salt or solvate thereof.

[0175] In another embodiment, the substituted indole compound is a compound according to embodiments 1-73 as described below.

[0176] Embodiment 1. Formula I: [ka] (In the formula, R 1a is selected from the group consisting of halogen, alkyl, alkoxy, cycloalkyl, (hydroxy)alkyl, and (cycloalkyl)alkyl; Q 1 is -C(R 1b )= and -N=; Q 2 is -C(R 1c )= and -N=; Q 3 is -C(R 1d )= and -N=; However, Q 1 , Q 2 Or Q 3 At least one of each is -C(R 1b )=, -C(R 1c )= or -C(R 1d )=; R 1b , R 1c and R 1dare each independently selected from the group consisting of hydrogen, halogen, alkyl, alkenyl, (hydroxy)alkyl, and alkoxy; R 1e is selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, (hydroxy)alkyl, and (cycloalkyl)alkyl; [ka] is a single bond or a double bond; G 1 is an optionally substituted aryl; optionally substituted heteroaryl; optionally substituted heterocyclo; optionally substituted cycloalkyl; (aryl)alkyl; (heteroaryl)alkyl; (heterocyclo)alkyl; (amino)(aryl)alkyl; (heteroaryl)(aryl)alkyl; (heteroaryl)(heterocyclo)alkyl; (heteroaryl)(carboxamido)alkyl; (heteroaryl)(cycloalkyl)alkyl; (aryl)(alkoxycarbonyl)alkyl; (cycloalkyl)alkyl; (heteroaryl)(amino) is selected from the group consisting of: (cycloalkyl)(alkoxycarbonyl)alkyl; (heteroaryl)(alkoxycarbonyl)alkyl; (heterocyclo)(cycloalkyl)alkyl; (aryl)(cycloalkyl)alkyl; (aryl)(hydroxy)alkyl; (cycloalkyl)(hydroxy)alkyl; (hydroxy)alkyl; optionally substituted alkyl; (aryl)(haloalkyl)alkyl; (cycloalkyl)(haloalkyl)alkyl; (hydroxy)(haloalkyl)alkyl; and (alkoxycarbonyl)(haloalkyl)alkyl; and G 2 is selected from the group consisting of hydrogen and alkyl; or G 1 and G 2 together with the nitrogen atom to which they are attached form an optionally substituted heterocyclo. Compound.

[0177] Embodiment 2.R 1a is halogen, C1-C6 alkyl, C1-C6 alkoxy, C3-C8 cycloalkyl, (hydroxy)C 1~6 Alkyl and (C3-C6 cycloalkyl)C 1~6 selected from the group consisting of alkyl; R 1b , R 1c and R 1d are each independently selected from the group consisting of hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, (hydroxy)C1-C6 alkyl, and C1-C6 alkoxy; R 1e is selected from the group consisting of hydrogen and C1-C6 alkyl; G 1 is an optionally substituted C6-C 10 Aryl; optionally substituted 5-10 membered heteroaryl; optionally substituted 3-10 membered heterocyclo; optionally substituted C3-C8 cycloalkyl; (C6-C 10 Aryl)C1-C6 alkyl;(5-10 membered heteroaryl)C1-C6 alkyl;(3-10 membered heterocyclo)C1-C6 alkyl;(amino)(C6-C 10 Aryl)C1-C6 alkyl;(5-14 membered heteroaryl)(C6-C 10 Aryl)C1-C6 alkyl;(5-10 membered heteroaryl)(3-10 membered heterocyclo)C1-C6 alkyl;(5-10 membered heteroaryl)(carboxamido)C1-C6 alkyl;(5-10 membered heteroaryl)(C3-C6 cycloalkyl)C1-C6 alkyl;(C6-C 10 Aryl)(alkoxycarbonyl)C1-C6 alkyl;(C3-C6 cycloalkyl)C1-C6 alkyl;(5-10 membered heteroaryl)(amino)C1-C6 alkyl;(C3-C6 cycloalkyl)(alkoxycarbonyl)C1-C6 alkyl;(5-14 membered heteroaryl)(alkoxycarbonyl)C1-C6 alkyl;(3-14 membered heterocyclo)(C3-C8 cycloalkyl)C1-C6 alkyl;(C 6~10 Aryl)(C3-C8 cycloalkyl)C1-C6 alkyl;(C6-C 10Aryl)(hydroxy)C1-C6 alkyl;(C3-C6 cycloalkyl)(hydroxy)C1-C6 alkyl;(hydroxy)C1-C6 alkyl;Optionally substituted C1-C6 alkyl;(C6-C 10 aryl)(C1-C6 haloalkyl)C1-C6 alkyl; (C3-C6 cycloalkyl)(C1-C6 haloalkyl)C1-C6 alkyl; (hydroxy)(C1-C6 haloalkyl)C1-C6 alkyl; and (alkoxycarbonyl)(C1-C6 haloalkyl)C1-C6 alkyl; and G 2 is selected from the group consisting of hydrogen and C1-C6 alkyl; or G 1 and G 2 or a pharma- ceutically acceptable salt or solvate thereof. The compound of embodiment 1, wherein: taken together with the nitrogen atom to which they are attached, form an optionally substituted 5-10 membered heterocycle; or a pharma- ceutically acceptable salt or solvate thereof.

[0178] Embodiment 3.R 1a is halogen, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, (hydroxy)C 1~4 Alkyl and (C3-C6 cycloalkyl)C 1~4 selected from the group consisting of alkyl; R 1b , R 1c and R 1d are each independently selected from the group consisting of hydrogen, halogen, C1-C3 alkyl, C2-C4 alkenyl, (hydroxy)C1-C4 alkyl, and C1-C3 alkoxy; R 1e is selected from the group consisting of hydrogen and C1-C3 alkyl; G 1 is an optionally substituted C6-C 10 Aryl; optionally substituted 5-10 membered heteroaryl; optionally substituted 3-10 membered heterocyclo; optionally substituted C3-C8 cycloalkyl; (C6-C 10Aryl)C1-C4 alkyl;(5-10 membered heteroaryl)C1-C6 alkyl;(3-10 membered heterocyclo)C1-C4 alkyl;(amino)(C6-C 10 Aryl)C1-C6 alkyl;(5-14 membered heteroaryl)(C6-C 10 Aryl)C1-C4 alkyl;(5-10 membered heteroaryl)(3-10 membered heterocyclo)C1-C4 alkyl;(5-10 membered heteroaryl)(carboxamido)C1-C4 alkyl;(5-10 membered heteroaryl)(C3-C6 cycloalkyl)C1-C4 alkyl;(C6-C 10 Aryl)(alkoxycarbonyl)C1-C4 alkyl;(C3-C6 cycloalkyl)C1-C4 alkyl;(5-10 membered heteroaryl)(amino)C1-C4 alkyl;(C3-C6 cycloalkyl)(alkoxycarbonyl)C1-C4 alkyl;(5-14 membered heteroaryl)(alkoxycarbonyl)C1-C4 alkyl;(3-14 membered heterocyclo)(C3-C6 cycloalkyl)C1-C4 alkyl;(C 6~10 Aryl)(C3-C6 cycloalkyl)C1-C4 alkyl;(C6-C 10 Aryl)(hydroxy)C1-C4 alkyl;(C3-C6 cycloalkyl)(hydroxy)C1-C4 alkyl;(hydroxy)C1-C4 alkyl;Optionally substituted C1-C4 alkyl;(C6-C 10 aryl)(C1-C4 haloalkyl)C1-C4 alkyl; (C3-C6 cycloalkyl)(C1-C4 haloalkyl)C1-C4 alkyl; (hydroxy)(C1-C4 haloalkyl)C1-C4 alkyl; and (alkoxycarbonyl)(C1-C4 haloalkyl)C1-C4 alkyl; and G 2 is selected from the group consisting of hydrogen and C1-C4 alkyl; or G 1 and G 2 or a pharma- ceutically acceptable salt or solvate thereof. The compound of embodiment 2, wherein: taken together with the nitrogen atom to which they are attached, form an optionally substituted 5-10 membered heterocycle; or a pharma- ceutically acceptable salt or solvate thereof.

[0179] Embodiment 4. [ka] The compound of any one of embodiments 1-3, or a pharma- ceutically acceptable salt or solvate thereof, wherein is a double bond.

[0180] Embodiment 5.Q 1 and Q 2 The compound of any one of embodiments 1-4, or a pharma- ceutically acceptable salt or solvate thereof, wherein:

[0181] Embodiment 6.Q 3 is -C(R 1d ) =; and R 1d The compound of any one of embodiments 1-4, or a pharma- ceutically acceptable salt or solvate thereof, wherein is selected from the group consisting of hydrogen and halo.

[0182] Embodiment 7.R 1e The compound of any one of embodiments 1-6, or a pharma- ceutically acceptable salt or solvate thereof, wherein: is hydrogen.

[0183] Embodiment 8.R 1a The compound of any one of embodiments 1-7, or a pharma- ceutically acceptable salt or solvate thereof, wherein is C1-C3 alkyl.

[0184] Embodiment 9.G 2 The compound of any one of embodiments 1-8, or a pharma- ceutically acceptable salt or solvate thereof, wherein: is hydrogen.

[0185] Embodiment 10. Formula II: [ka] 10. The compound of any one of embodiments 1 to 9, or a pharma- ceutically acceptable salt or solvate thereof.

[0186] Embodiment 11.R 1dis selected from the group consisting of hydrogen and fluoro, or a pharma- ceutically acceptable salt or solvate thereof.

[0187] Embodiment 12. Formula II-A: [ka] 12. The compound of embodiment 11, or a pharma- ceutically acceptable salt or solvate thereof.

[0188] Embodiment 13.G 1 is an optionally substituted C6-C 10 Aryl; optionally substituted 5-9 membered heteroaryl; optionally substituted 3-10 membered heterocyclo; optionally substituted C6-C8 cycloalkyl; (5-9 membered heteroaryl)C1-C6 alkyl; (5-9 membered heteroaryl)(C 6~10 The compound of any one of embodiments 10-12, wherein the compound is selected from the group consisting of: (aryl)C1-C4 alkyl; (5-9 membered heteroarylheteroaryl)(C3-C6 cycloalkyl)C1-C4 alkyl; and (C3-C6 cycloalkyl)C1-C4 alkyl, or a pharma- ceutically acceptable salt or solvate thereof.

[0189] Embodiment 14. Formula III: [ka] (In the formula, A 1 -N= and -C(R 2a )= selected from the group consisting of; R 2a is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 2b is optionally substituted alkyl, optionally substituted heterocyclo, optionally substituted cycloalkyl, optionally substituted heteroaryl, optionally substituted aryl, (carboxamido)alkyl, -OR 10c, amino, (heterocyclo)alkyl, (amino)alkyl, (hydroxy)alkyl, carboxamide, (heteroaryl)alkyl, -S(=O)R 9b , -S(=O)2R 9b and -C(=O)R 9c selected from the group consisting of; A 2 -N= and -C(R 2c )= selected from the group consisting of; R 2c is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 2d is selected from the group consisting of hydrogen, alkyl, halogen, cyano, and haloalkyl; R 2e is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 9b is selected from the group consisting of amino, alkyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclo, and optionally substituted heteroaryl; R 9c is selected from the group consisting of amino, alkyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclo, and optionally substituted heteroaryl; and R 10c is selected from the group consisting of alkyl, (hydroxy)alkyl and (amino)alkyl. 14. The compound of embodiment 13, or a pharma- ceutically acceptable salt or solvate thereof.

[0190] Embodiment 15. Formula III-A: [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0191] Embodiment 16.R 2ais selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 2b teeth, (A) Unsubstituted 4- to 10-membered heterocyclo; (B)(i)-N(R 3a )C(=O)R 4a (ii) -NR 5a R 5b (iii) unsubstituted 4- to 10-membered heterocyclo; (iv) hydroxy, -NR 5c R 5d , C1-C4 alkyl, C1-C6 alkoxy, -C(R 6a )(R 6b )C(=O)NR 5e R 5f , -C(=O)R 4b (v) a substituted 4-10 membered heterocyclo having one, two or three substituents independently selected from the group consisting of (hydroxy)C1-C4 alkyl and halo; (v) an unsubstituted C3-C6 cycloalkyl; (vi) (hydroxy)C1-C4 alkyl; (vii) C1-C6 alkyl; (viii) -C(=O)NR 5g R 5h ;(ix)Halo;(x)-C(=O)R 4c (xi) C1-C6 haloalkyl; (xii) hydroxy; (xiii) (amino)C1-C4 alkyl; (xiv) (C1-C4 alkoxy)C1-C4 alkyl; (xv) -S(=O)2R 9a (xvi) (3-8 membered heterocyclo)C1-C4 alkyl; (xvii) C1-C6 alkoxy; (xviii) (C3-C6 cycloalkyl)C 1~4 Alkyl; (xix) (C 6~10 aryl) C1-C4 alkyl; and (xxii) -OR 10b a substituted 4-10 membered heterocyclo having 1, 2, 3 or 4 substituents independently selected from the group consisting of: (C) unsubstituted C3-C8 cycloalkyl; (D) (i) unsubstituted 4-10 membered heterocyclo; (ii) substituted 4-10 membered heterocyclo having one or two substituents independently selected from the group consisting of amino and C1-C4 alkyl; (iii) unsubstituted 5- or 6-membered heteroaryl; (iv) substituted 5- or 6-membered heteroaryl having one, two or three substituents independently selected from the group consisting of halo, C1-C4 alkyl, (3- to 8-membered heterocyclo) alkyl, hydroxy and amino; (v) -NR 5i R 5j (vi) cyano; (vii) -N(R 3d )C(=O)R 4f (viii) hydroxy; and (ix) a substituted C3-C8 cycloalkyl having 1, 2, 3, or 4 substituents independently selected from the group consisting of C1-C4 alkyl; (E) unsubstituted 5-10 membered heteroaryl; (F) (i) halo; (ii) C1-C4 alkyl; (iii) (C1-C4 alkoxy) C1-C4 alkyl; (iv) (hydroxy) C1-C4 alkyl; (v) C3-C6 cycloalkyl; (vi) (amino) C1-C4 alkyl; (vii) unsubstituted C3-C6 cycloalkyl; (viii) -NR 5g R 5h (xi) a substituted C3-C6 cycloalkyl having one, two, three or four substituents independently selected from the group consisting of: (xii) a substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; (xiii) -NR 5q R 5r and (ix) a substituted 5-10 membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of (3-8 membered heterocyclo)C1-C4 alkyl; (G) Unsubstituted C6~C 10 Aryl; (H) (i) halo; (ii) C1-C4 alkyl; (iii) -CH2N(H)S(=O)2R 8 (iv) (5-9 membered heteroaryl) C1-C4 alkyl; (v) -OR 10a ;(vi)-N(R 3b)C(=O)R 4b (vii) (amino) C1-C4 alkyl; and (viii) (hydroxy) C1-C4 alkyl having 1, 2, 3 or 4 substituents independently selected from the group consisting of: 10 Aryl; (I) (carboxamido) C1-C4 alkyl; (J)-OR 10c ; (K)-NR 5o R 5p ; (L) (3-8 membered heterocyclo)C1-C4 alkyl; (M) (amino) C1-C4 alkyl; (N)(hydroxy)C1-C4 alkyl; (O)-C(=O)NR 5s R 5t ; (P) (5-9 membered heteroaryl)C1-C4 alkyl; and (Q)-S(=O)2R 9b selected from the group consisting of; R 2c is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 2d is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, cyano, and C1-C4 haloalkyl; R 2e is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 3a , R 3b , R 3c and R 3d are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, optionally substituted C3-C6 cycloalkyl, and optionally substituted 4-14 membered heterocyclo; R 4a , R 4b , R 4c , R 4d , R 4e and R 4fis C1-C6 alkyl; C1-C6 haloalkyl; C3-C6 cycloalkyl; C1-C6 alkoxy; (C1-C4 alkoxy)C1-C4 alkyl; (C 6~10 (aryl)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; (amino)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; (cyano)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted C6-C 10 aryl; substituted C6-C aryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo and C1-C4 alkyl; 10 aryl; unsubstituted 5- or 6-membered heteroaryl; and substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo and C1-C4 alkyl; R 5a and R 5b are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; R 5c and R 5dare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5c and R 5d together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5e and R 5f are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5e and R 5f together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5g and R 5hare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5g and R 5h together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5i and R 5j are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5i and R 5j together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5k and R 5lare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5k and R 5l together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5m and R 5n are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5m and R 5n together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5o and R 5pare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; or R 5o and R 5p together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 5q and R 5r are independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; R 5s and R 5tare independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; R 6a , R 6b , R 6c and R 6d are each independently selected from the group consisting of hydrogen and C1-C4 alkyl; R 8 is C1-C6 alkyl; R 9a is selected from the group consisting of C1-C6 alkyl; unsubstituted C3-C8 cycloalkyl; and substituted C3-C8 cycloalkyl having 1 or 2 substituents independently selected from the group consisting of halo, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; R 9b is selected from the group consisting of C1-C6 alkyl and amino; R 10a is selected from the group consisting of alkyl, (hydroxy)C1-C4 alkyl, and (amino)C1-C4 alkyl; R 10b is (amino)C1-C4 alkyl; and R 10c or a pharma- ceutically acceptable salt or solvate thereof.

[0192] Embodiment 17.A 1 and A 2 is -C(H)=;R 2e is hydrogen; and R 2dThe compound of any one of embodiments 14-16, or a pharma- ceutically acceptable salt or solvate thereof, wherein is selected from the group consisting of hydrogen and halogen.

[0193] Embodiment 18.R 2b teeth, [ka] selected from the group consisting of; R a1 is -N(R 3a )C(=O)R 4a ;-NR 5a R 5b ;Unsubstituted 4-10 membered heterocyclo;Hydroxy, -NR 5c R 5d , C1-C4 alkyl, C1-C6 alkoxy, -C(R 6a )(R 6b )C(=O)NR 5e R 5f , -C(=O)R 4b , (hydroxy)C1-C4 alkyl, and halo; R a2 and R a3 are each hydrogen; or R a2 and R a3 together with the carbon atom to which they are attached to form a C(=O) group; R a4 is selected from the group consisting of hydrogen, halo, and hydroxy; R a5 is selected from the group consisting of hydrogen, C1-C4 alkyl, and C3-C6 cycloalkyl; R b1 is selected from the group consisting of hydrogen, C1-C4 alkyl, and C3-C6 cycloalkyl; R c1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c selected from the group consisting of; R c2 and R c3are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, and C1-C4 haloalkyl; or R c2 and R c3 together with the carbon atom to which they are attached to form a C(=O) group; R c4 is selected from the group consisting of hydrogen and C1-C4 alkyl; m is 1 or 2; R d1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c is selected from the group consisting of R d2 and R d3 are each independently selected from the group consisting of hydrogen and fluoro; R e1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c selected from the group consisting of; R f1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c is selected from the group consisting of R g1 is hydrogen, C1-C4 alkyl, -C(=O)R 4c , C1-C4 haloalkyl, (C1-C4 alkoxy)C1-C4 alkyl; R h1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c selected from the group consisting of; R h2 is selected from the group consisting of hydrogen and C1-C4 alkyl; R h3 and R h4 are each independently selected from the group consisting of hydrogen and C1-C4 alkyl; or R h3 and R h4 together with the carbon atom to which they are attached to form a C(=O) group; R i1is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl, (hydroxy)C1-C4 alkyl, -N(R 3a )C(=O)R 4a and (amino)C1-C4 alkyl; Z 1 is selected from the group consisting of -CH2- and -O-; R j1 is hydrogen, C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c selected from the group consisting of; R k1 is C1-C4 alkyl, unsubstituted 4-14 membered heterocyclo and -NR 5a R 5b selected from the group consisting of; R k2 is selected from the group consisting of hydrogen, hydroxy, and C1-C4 alkyl; r is 0, 1 or 2; Z 2 is -O- and -N(R m3 )- selected from the group consisting of; R m3 is selected from the group consisting of hydrogen, C1-C4 alkyl, and C1-C4 haloalkyl; R n1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R o1 is hydroxy, (hydroxy)C1-C4 alkyl, (amino)C1-C4 alkyl, (C1-C4 alkoxy)C1-C4 alkyl, C1-C4 alkoxy, -NR 5a R 5b , unsubstituted 4-14 membered heterocyclo, and substituted 4-14 membered heterocyclo having 1, 2, or 3 substituents independently selected from the group consisting of halo, C1-C4 alkyl, and C1-C4 alkoxy; R o2 is selected from the group consisting of hydrogen, C1-C4 alkyl, and (C1-C4 alkoxy)C1-C4 alkyl; R o3 is selected from the group consisting of hydrogen, fluoro, and C1-C4 alkyl; R p1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; Z 3 is -O- and -N(R q1 )- selected from the group consisting of; R q1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R r1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R s1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R t1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R u1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R v1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R w1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R x1 is hydrogen, C1-C4 alkyl and -C(=O)R 4c selected from the group consisting of; R y1 is selected from the group consisting of hydrogen and C1-C4 alkyl; and R z1 or a pharma- ceutically acceptable salt or solvate thereof.

[0194] Embodiment 19.R 2b teeth, [ka] [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0195] Embodiment 20.R 2b is R 2b -1A, R 2b -1B, R 2b -1C and R 2b -1D, or a pharma- ceutically acceptable salt or solvate thereof.

[0196] Embodiment 21.R 2b is R 2b -2A and R 2b -2B; and R b1 is C1-C4 alkyl, or a pharma- ceutically acceptable salt or solvate thereof.

[0197] Embodiment 22.R 2b is R 2b -5A and R 2b -5B; and R e1 is -C(=O)R 4c or a pharma- ceutically acceptable salt or solvate thereof.

[0198] Embodiment 23.R 2b is R 2b -6A and R 2b -6B; and R f1 is -C(=O)R 4c or a pharma- ceutically acceptable salt or solvate thereof.

[0199] Embodiment 24.R 2b is R 2b -10A, R 2b -10B, R 2b -10C and R 2b-10d, or a pharma- ceutically acceptable salt or solvate thereof.

[0200] Embodiment 25.R 2b is R 2b -11A and R 2b -11B, or a pharma- ceutically acceptable salt or solvate thereof.

[0201] Embodiment 26.R 2b is R 2b -4;R d1 is -C(=O)R 4c and R d2 and R d3 or a pharma- ceutically acceptable salt or solvate thereof.

[0202] Embodiment 27.R 2b is R 2b -3; R c1 is C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c selected from the group consisting of; R c2 and R c3 are each hydrogen; or R c2 and R c3 together with the carbon atom to which they are attached to form a C(=O) group; R c4 is hydrogen; and The compound of embodiment 18, or a pharma- ceutically acceptable salt or solvate thereof, wherein m is 1.

[0203] Embodiment 28.R 2b is R 2b -8;R h1 is -C(=O)R 4c and R h2 is selected from the group consisting of hydrogen and C1-C3 alkyl, or a pharma- ceutically acceptable salt or solvate thereof.

[0204] Embodiment 29.R 2b is R 2b -12; and R j1 is -C(=O)R 4c or a pharma- ceutically acceptable salt or solvate thereof.

[0205] Embodiment 30.R 4c or a pharma- ceutically acceptable salt or solvate thereof.

[0206] Embodiment 31.R 2d The compound of any one of embodiments 14-30, or a pharma- ceutically acceptable salt or solvate thereof, wherein is selected from the group consisting of hydrogen, fluoro, and chloro.

[0207] Embodiment 32. Formula IV: [ka] (In the formula, Z 4 -O-, -C(R 28a )(R 28b )- and -N(R 23 )-; or Z 4 is non-existent; Z 5 is selected from the group consisting of -CH2- and -CH2CH2-; R 11a is an optionally substituted alkyl, an optionally substituted heterocyclo, an optionally substituted heteroaryl, and -N(R 12b )C(=O)R 13c selected from the group consisting of; R 12b is selected from the group consisting of hydrogen, alkyl, cycloalkyl and heterocyclo, (C1-C4 alkoxy)C1-C4 alkyl and (hydroxy)C1-C4 alkyl; and R 13cis selected from the group consisting of alkyl, haloalkyl, alkoxy, (alkoxy)alkyl, (hydroxy)alkyl, (cyano)alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl and optionally substituted heterocycle, amino, (amino)alkyl, (C3-C6 cycloalkyl)oxy and (4-8 membered heterocyclo)oxy; R 23 is selected from the group consisting of hydrogen and C1-C4 alkyl; and R 28a and R 28b are independently selected from the group consisting of hydrogen, alkyl, and halo. 14. The compound of embodiment 13, or a pharma- ceutically acceptable salt or solvate thereof.

[0208] Embodiment 33. Formula IV-A: [ka] 33. The compound of embodiment 32, or a pharma- ceutically acceptable salt or solvate thereof.

[0209] Embodiment 34. Formula IV-B: [ka] 33. The compound of embodiment 32, or a pharma- ceutically acceptable salt or solvate thereof.

[0210] Embodiment 35. Formula IV-C: [ka] 33. The compound of embodiment 32, or a pharma- ceutically acceptable salt or solvate thereof.

[0211] Embodiment 36. Formula IV-D: [ka] 33. The compound of embodiment 32, or a pharma- ceutically acceptable salt or solvate thereof.

[0212] Embodiment 37.R 11a teeth, (A) Unsubstituted 4- to 14-membered heterocyclo; (B)(i)-N(R 12a )C(=O)R 13a (ii) -C(=O)R 13b (iii) C1-C4 alkyl; (iv) (C1-C4 alkoxy) C1-C4 alkyl; (v) (hydroxy) C1-C4 alkyl; (vi) C1-C4 haloalkyl; (vii) amino; (vii) hydroxy; (viii) -N(R 12a )S(=O)2R 24 ;(ix)-S(=O)2R 24 (x) unsubstituted C3-C6 cycloalkyl; (xi) substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino and (amino)C1-C4 alkyl; (xii) unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (xiii) -C(=NR 60 )R 61 ; and (xiv) -C(=C-NO2)R 64 a substituted 4-14 membered heterocyclo having 1, 2 or 3 substituents independently selected from the group consisting of: (C) unsubstituted 5-10 membered heteroaryl; (D) a substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo and C1-C4 alkyl; (E) C1-C6 alkyl; and (F)-N(R 12b )C(=O)R 13c selected from the group consisting of; R 12a and R 12b are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, (C1-C4 alkoxy)C1-C4 alkyl, and (hydroxy)C1-C4 alkyl; R 13a, R 13b and R 13c (A) C1-C6 alkyl; (B) C1-C6 haloalkyl; (C) unsubstituted C3-C6 cycloalkyl; (D) C1-C6 alkoxy; (E) (C1-C4 alkoxy)C1-C4 alkyl; (F) (hydroxy)C1-C4 alkyl; (G) (cyano)alkyl; (H) unsubstituted C6-C 10 Aryl; (I) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10 (J) unsubstituted 5- or 6-membered heteroaryl; (K) substituted 5- or 6-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (L) unsubstituted 4-14 membered heterocyclo; (M) substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (N) amino; (O) (amino) alkyl; (P) (C3-C6 cycloalkyl) oxy; and (Q) (4-8 membered heterocyclo) oxy; and R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl; R 60 is cyano, nitro, hydroxy, C1-C6 alkoxy, -C(=O)R 62 and -S(=O)2R 62 selected from the group consisting of; R 61 is C1-C6 alkyl, C3-C6 cycloalkyl and -NR 63a R 63b selected from the group consisting of; R 62 is C1-C6 alkyl, C3-C6 cycloalkyl and -NR 63a R 63b selected from the group consisting of; R 63a is selected from the group consisting of hydrogen, C1-C6 alkyl, and C3-C6 cycloalkyl; R 63bis selected from the group consisting of hydrogen, C1-C6 alkyl, and C3-C6 cycloalkyl; or R 63a and R 63b together with the nitrogen atom to which they are attached form an optionally substituted 4- to 6-membered heterocycle; R 64 is C1-C6 alkyl, C3-C6 cycloalkyl and -NR 63c R 63d selected from the group consisting of; R 63c is selected from the group consisting of hydrogen, C1-C6 alkyl, and C3-C6 cycloalkyl; R 63d is selected from the group consisting of hydrogen, C1-C6 alkyl, and C3-C6 cycloalkyl; or R 63c and R 63d or a pharma- ceutically acceptable salt or solvate thereof. The compound of any one of embodiments 32-36, wherein: taken together with the nitrogen atom to which they are attached, form an optionally substituted 4-6 membered heterocyclo; or a pharma- ceutically acceptable salt or solvate thereof.

[0213] Embodiment 38.R 11a teeth, [ka] is a substituted 4-14 membered heterocyclo selected from the group consisting of: R 12a is selected from the group consisting of hydrogen, C1-C3 alkyl, (C1-C4 alkoxy)C1-C4 alkyl; and (hydroxy)C1-C4 alkyl; R 13ais selected from the group consisting of C1-C4 alkyl; amino; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; R 13b is selected from the group consisting of C1-C4 alkyl; amino; C1-C4 haloalkyl; C1-C4 alkoxy; (hydroxy)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (amino)alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (C3-C6 cycloalkyl)oxy; and (4-8 membered heterocyclo)oxy; R 21 is hydrogen, -C(=O)R 13b , C1-C4 alkyl, C1-C4 haloalkyl, unsubstituted 4-14 membered heterocyclo and -S(=O)R 24 selected from the group consisting of; R 22 is C1-C4 alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl; R 25 is selected from the group consisting of hydrogen, C1-C4 alkyl, and C1-C4 haloalkyl; R 25b and R 25c is independently selected from the group consisting of C1-C4 alkyl and C1-C4 haloalkyl; R 26 is selected from the group consisting of unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; and R 21a and R 25a The compound of embodiment 37, wherein: is taken together with the atom to which they are attached to form an optionally substituted 4-8 membered heterocycle, or a pharma- ceutically acceptable salt or solvate thereof.

[0214] Embodiment 39.R 11a teeth, [ka] [ka] is a substituted 4-14 membered heterocyclo selected from the group consisting of: R 27a and R 27b are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, C1-C4 haloalkyl, (C1-C4 alkoxy)C1-C4 alkyl, and (hydroxy)C1-C4 alkyl; R 27c is hydrogen; -C(=O)R 13b C1-C4 alkyl; C1-C4 haloalkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; and -S(=O)2R 24 selected from the group consisting of; R 27d is selected from the group consisting of hydrogen; C1-C4 alkyl; and C1-C4 haloalkyl; R 13b is selected from the group consisting of C1-C4 alkyl; amino C1-C4 haloalkyl; C1-C4 alkoxy; (hydroxy)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (amino)alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (C3-C6 cycloalkyl)oxy; and (4-8 membered heterocyclo)oxy; and R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl, or a pharma- ceutically acceptable salt or solvate thereof.

[0215] Embodiment 40.R 11a teeth, [ka] [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0216] Embodiment 41.R 11a teeth, [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0217] Embodiment 42.Z 4 or a pharma- ceutically acceptable salt or solvate thereof.

[0218] Embodiment 43.R 11a is an unsubstituted 4- to 14-membered heterocyclo; -N(R 12a )C(=O)R 13a , -C(=O)R 13b and C1-C4 alkyl; unsubstituted 5-10 membered heteroaryl; and substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of halo and C1-C4 alkyl. The compound of any one of embodiments 32-38 or 42, or a pharma- ceutically acceptable salt or solvate thereof.

[0219] Embodiment 44.R 11a teeth, [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0220] Embodiment 45.R 12a is selected from the group consisting of hydrogen and C1-C3 alkyl; R 13a is C1-C4 alkyl; and R 13b is C1-C4 alkyl, or a pharma- ceutically acceptable salt or solvate thereof.

[0221] Embodiment 46.R 12a is selected from the group consisting of hydrogen and methyl; R 13a is methyl; and R 13b is methyl; or a pharma- ceutically acceptable salt or solvate thereof.

[0222] Embodiment 47. Formula V: [ka] (In the formula, R 14a is selected from the group consisting of optionally substituted alkyl and optionally substituted heteroaryl; R 14b is selected from the group consisting of optionally substituted alkyl, optionally substituted heteroaryl, optionally substituted aryl, optionally substituted heterocyclo, optionally substituted cycloalkyl, and carboxamido; and p is 0, 1, 2 or 3. 14. The compound of embodiment 13, or a pharma- ceutically acceptable salt or solvate thereof.

[0223] Embodiment 48. Formula VA: [ka] 48. The compound of embodiment 47, or a pharma- ceutically acceptable salt or solvate thereof.

[0224] Embodiment 49. Formula VB: [ka] 48. The compound of embodiment 47, or a pharma- ceutically acceptable salt or solvate thereof.

[0225] Embodiment 50.R 14a teeth, (A) unsubstituted 5-10 membered heteroaryl; (B) (i) halo; (ii) C1-C4 alkyl; (iii) C1-C4 alkoxy; (iv) (3-8 membered heterocyclo)C1-C4 alkyl; (v) (5-9 membered heteroaryl)C1-C4 alkyl; (vi) -C(=O)NR 15a R 15b (vii) unsubstituted 5-10 membered heteroaryl; (viii) halo, C1-C4 alkyl, (3-8 membered heterocyclo)C1-C4 alkyl, 5-9 membered heteroaryl and -NR 15e R 15f (ix) -OR16 (x) unsubstituted C3-C6 cycloalkyl; (xi) C1-C4 alkyl and -N(R 17a )C(=O)R 18a (xii) cyano; (xiii) unsubstituted 4-14 membered heterocyclo; (xiv) substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of C1-C4 alkyl, (5-9 membered heteroaryl)C1-C4 alkyl; (xv) (carboxy)C1-C4 alkyl; (xvi) (carboxamido)C1-C4 alkyl; and (xvii) substituted 5-10 membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of carboxy; and (C) C1-C6 alkyl selected from the group consisting of; R 14b teeth, (A) unsubstituted 5-10 membered heteroaryl; (B) a substituted 5- or 10-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, C1-C4 alkyl, and (C3-C6 cycloalkyl)C1-C4 alkyl; (C) Unsubstituted C6~C 10 Aryl; (D) a substituted C6-C alkyl group having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, C1-C4 alkyl, and (3-8 membered heterocyclo)C1-C4 alkyl. 10 Aryl; (E) Unsubstituted 4- to 14-membered heterocyclo; (F) a substituted 4-14 membered heterocyclo having 1, 2, 3 or 4 substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; (G)-C(=O)NR 15c R 15d ; (H) unsubstituted C3-C6 cycloalkyl; and (I) C1-C6 alkyl selected from the group consisting of; p is 0, 1, 2 or 3; R 15a and R 15b (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 Aryl; (H) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10 Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (K) unsubstituted 4-14-membered heterocyclo; (L) substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15h or R 15a and R 15b together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 15c and R 15d (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 Aryl; (H) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (K) unsubstituted 4-14-membered heterocyclo; (L) substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15h or R 15c and R 15d together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 15e and R 15f is (A) hydrogen, (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 (G') a substituted C6-C aryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10 Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (K) unsubstituted 4-14-membered heterocyclo; (L) substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15h or R15e and R 15f together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 15g and R 15h (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) C1-C6 alkoxy; (E) (C1-C4 alkoxy)C1-C4 alkyl; (F) (hydroxy)C1-C4 alkyl; (G) (cyano)alkyl; (H) unsubstituted C6-C 10 Aryl; (I) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10 Aryl; (J) unsubstituted 5- or 6-membered heteroaryl; (K) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (L) unsubstituted 4-14-membered heterocyclo; (M) substituted 4-14-membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (N) unsubstituted C3-C8 cycloalkyl; and (O) C1-C6 alkyl and -NR 15g R 15h or R 15g and R 15g together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocyclo; R 16 is (amino)(hydroxy)C1-C4 alkyl; R 17a is selected from the group consisting of hydrogen and C1-C4 alkyl; R 18a(A) C1-C6 alkyl; (B) C1-C6 haloalkyl; (C) C1-C6 alkoxy; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 Aryl; (H) a substituted C6-C aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl. 10 (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (K) unsubstituted 4-14 membered heterocyclo; (L) substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) substituted C3-C8 cycloalkyl having 1, 2, 3, or 4 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl, or a pharma- ceutically acceptable salt or solvate thereof.

[0226] Embodiment 51.R 14a is unsubstituted 5-10 membered heteroaryl; and C1-C4 alkyl; C1-C4 alkoxy; (3-8 membered heterocyclo)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; -C(=O)NR 15a R 15b a substituted 5-10 membered heteroaryl having one, two or three substituents independently selected from the group consisting of: unsubstituted 5-10 membered heteroaryl; halo, C1-C4 alkyl, (3-8 membered heterocyclo)C1-C4 alkyl, 5-9 membered heteroaryl and -NR 15e R 15f Substituted 5-10 membered heteroaryl having one, two or three substituents independently selected from the group consisting of: unsubstituted C3-C6 cycloalkyl; and C1-C4 alkyl and -N(R 17a )C(=O)R 18aor a pharma- ceutically acceptable salt or solvate thereof.

[0227] Embodiment 52.R 14a is C1-C4 alkyl; C1-C4 alkoxy; (3-8 membered heterocyclo)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; -C(=O)NR 15a R 15b substituted pyridyl having one, two or three substituents independently selected from the group consisting of: unsubstituted 5-10 membered heteroaryl; halo, C1-C4 alkyl, (3-8 membered heterocyclo)C1-C4 alkyl, 5-9 membered heteroaryl and -NR 15e R 15f Substituted 5-10 membered heteroaryl having one, two or three substituents independently selected from the group consisting of: unsubstituted C3-C6 cycloalkyl; and C1-C4 alkyl and -N(R 17a )C(=O)R 18a or a pharma- ceutically acceptable salt or solvate thereof.

[0228] Embodiment 53.R 14b is an unsubstituted 5-10 membered heteroaryl; a substituted 5-10 membered heteroaryl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; an unsubstituted C6-C 10 Aryl; Substituted C6-C having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (3-8 membered heterocyclo)C1-C4 alkyl. 10The compound of any one of embodiments 47-52, or a pharma- ceutically acceptable salt or solvate thereof, wherein the compound is selected from the group consisting of: aryl; unsubstituted 4-14 membered heterocyclo; substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of hydroxy, amino, and C1-C4 alkyl; and unsubstituted C3-C6 cycloalkyl.

[0229] Embodiment 54.R 14b is selected from the group consisting of unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1 or 2 substituents independently selected from the group consisting of C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; unsubstituted phenyl; substituted phenyl having 1 or 2 substituents independently selected from the group consisting of C1-C4 alkyl and (3-8 membered heterocyclo)C1-C4 alkyl; and unsubstituted C3-C6 cycloalkyl, or a pharma- ceutically acceptable salt or solvate thereof.

[0230] Embodiment 55. The compound of any one of embodiments 47-54, or a pharma- ceutically acceptable salt or solvate thereof, wherein p is 0.

[0231] Embodiment 56.p is the compound of any one of embodiments 47-54, or a pharma- ceutically acceptable salt or solvate thereof, wherein p is 1.

[0232] Embodiment 57. Formula VI: [ka] (In the formula, R 19 is selected from the group consisting of unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; R 20 is selected from the group consisting of hydrogen, halo, and C1-C4 alkyl; and q is 1, 2 or 3. 14. The compound of embodiment 13, or a pharma- ceutically acceptable salt or solvate thereof.

[0233] Embodiment 58. Formula VII: [ka] (In the formula, R 11a is an optionally substituted alkyl, an optionally substituted heterocyclo, an optionally substituted heteroaryl, and -N(R 12b )C(=O)R 13c selected from the group consisting of; R 12b is selected from the group consisting of hydrogen, alkyl, cycloalkyl and heterocyclo, (C1-C4 alkoxy)C1-C4 alkyl and (hydroxy)C1-C4 alkyl; R 13c is selected from the group consisting of alkyl, haloalkyl, alkoxy, (alkoxy)alkyl, (hydroxy)alkyl, (cyano)alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl and optionally substituted heterocycle, amino, (amino)alkyl, (C3-C6 cycloalkyl)oxy and (4-8 membered heterocyclo)oxy; and R 11b is selected from the group consisting of C1-C4 alkyl, halo, and C1-C4 haloalkyl 14. The compound of embodiment 13, or a pharma- ceutically acceptable salt or solvate thereof.

[0234] Embodiment 59. Formula VII-A: [ka] 59. The compound of embodiment 58, or a pharma- ceutically acceptable salt or solvate thereof.

[0235] Embodiment 60. Formula VII-B: [ka] 59. The compound of embodiment 58, or a pharma- ceutically acceptable salt or solvate thereof.

[0236] Embodiment 61. Formula VII-C: [ka] 59. The compound of embodiment 58, or a pharma- ceutically acceptable salt or solvate thereof.

[0237] Embodiment 62. Formula VII-D: [ka] 59. The compound of embodiment 58, or a pharma- ceutically acceptable salt or solvate thereof.

[0238] Embodiment 63. Formula VII-E: [ka] 59. The compound of embodiment 58, or a pharma- ceutically acceptable salt or solvate thereof.

[0239] Embodiment 64. Formula VII-F: [ka] 59. The compound of embodiment 58, or a pharma- ceutically acceptable salt or solvate thereof.

[0240] Embodiment 65. Formula VII-G: [ka] 59. The compound of embodiment 58, or a pharma- ceutically acceptable salt or solvate thereof.

[0241] Embodiment 66. Formula VII-H: [ka] 59. The compound of embodiment 58, or a pharma- ceutically acceptable salt or solvate thereof.

[0242] Embodiment 67. Formula VIII: [ka] (In the formula, R 30 is hydrogen; C1-C6 alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; and substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; -C(=O)R 13b and -S(=O)2R 24 selected from the group consisting of; R 13b is selected from the group consisting of C1-C4 alkyl; amino; C1-C4 haloalkyl; C1-C4 alkoxy; (hydroxy)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (amino)alkyl; unsubstituted C3-C6 cycloalkyl; substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (C3-C6 cycloalkyl)oxy; and (4-8 membered heterocyclo)oxy; R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl; and u is 0, 1, 2 or 3) 14. The compound of embodiment 13, or a pharma- ceutically acceptable salt or solvate thereof.

[0243] Embodiment 68. Formula VIII-A: [ka] 68. The compound of embodiment 67, or a pharma- ceutically acceptable salt or solvate thereof.

[0244] Embodiment 69. Formula VIII-B: [ka] 68. The compound of embodiment 67, or a pharma- ceutically acceptable salt or solvate thereof.

[0245] Embodiment 70.R 1d or a pharma- ceutically acceptable salt or solvate thereof.

[0246] Embodiment 71. A compound of embodiment 1 selected from any one or more of the compounds in Table 1, or a pharma- ceutically acceptable salt or solvate thereof.

[0247] [Table 1-1]

[0248] [Table 1-2]

[0249] [Table 1-3]

[0250] [Table 1-4]

[0251] [Table 1-5]

[0252] [Table 1-6]

[0253]

Table 1-7

[0254]

Table 1-8

[0255]

Table 1-9

[0256]

Table 1-10

[0257]

Table 1-11

[0258]

Table 1-12

[0259]

Table 1-13

[0260]

Table 1-14

[0261]

Table 1-15

[0262]

Table 1-16

[0263]

Table 1-17

[0264]

Table 1-18

[0265]

Table 1-19

[0266]

Table 1-20

[0267]

Table 1-21

[0268]

Table 1-22

[0269]

Table 1-23

[0270]

Table 1-24

[0271]

Table 1-25

[0272]

Table 1-26

[0273]

Table 1-27

[0274]

Table 1-28

[0275]

Table 1-29

[0276]

Table 1-30

[0277]

Table 1-31

[0278]

Table 1-32

[0279]

Table 1-33

[0280]

Table 1-34

[0281]

Table 1-35

[0282]

Table 1-36

[0283]

Table 1-37

[0284]

Table 1-38

[0285]

Table 1-39

[0286]

Table 1-40

[0287]

Table 1-41

[0288]

Table 1-42

[0289]

Table 1-43

[0290]

Table 1-44

[0291]

Table 1-45

[0292]

Table 1-46

[0293]

Table 1-47

[0294]

Table 1-48

[0295]

Table 1-49

[0296]

Table 1-50

[0297]

Table 1-51

[0298]

Table 1-52

[0299]

Table 1-53

[0300]

Table 1-54

[0301]

Table 1-55

[0302]

Table 1-56

[0303]

Table 1-57

[0304]

Table 1-58

[0305]

Table 1-59

[0306]

Table 1-60

[0307]

Table 1-61

[0308]

Table 1-62

[0309]

Table 1-63

[0310]

Table 1-64

[0311]

Table 1-65

[0312]

Table 1-66

[0313]

Table 1-67

[0314]

Table 1-68

[0315]

Table 1-69

[0316]

Table 1-70

[0317]

Table 1-71

[0318]

Table 1-72

[0319]

Table 1-73

[0320]

Table 1-74

[0321]

Table 1-75

[0322]

Table 1-76

[0323]

Table 1-77

[0324]

Table 1-78

[0325]

Table 1-79

[0326]

Table 1-80

[0327]

Table 1-81

[0328]

Table 1-82

[0329]

Table 1-83

[0330]

Table 1-84

[0331]

Table 1-85

[0332]

Table 1-86

[0333]

Table 1-87

[0334]

Table 1-88

[0335]

Table 1-89

[0336]

Table 1-90

[0337]

Table 1-91

[0338]

Table 1-92

[0339]

Table 1-93

[0340]

Table 1-94

[0341]

Table 1-95

[0342]

Table 1-96

[0343]

Table 1-97

[0344] [Table 1-98]

[0345] [Table 1-99]

[0346] [Table 1-100]

[0347] [Table 1-101]

[0348] [Table 1-102]

[0349] [Table 1-103]

[0350] Embodiment 72. A compound of embodiment 71, or a pharma- ceutically acceptable salt or solvate thereof, selected from the group consisting of compound numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 824, 828, 839, 870, 922, 930, 942, 995, 1007, 1025, 1043, 1044, 1045, 1048, 1051, 1055, 1070, 1078, 1083, 1097, 1117, 1138, 1180, 1184 and 1192.

[0351] Embodiment 73. A compound of embodiment 73 selected from the group consisting of compound numbers 15, 922, 930, 942, 1055, 1070, 1117, 1180, 1184 and 1192, or a pharma- ceutically acceptable salt or solvate thereof.

[0352] The term "SETD2" (also known as SET domain-containing 2, huntingtin interacting protein B, lysine N-methyltransferase 3A, huntingtin yeast partner B, EC 2.1.1.43, P231HBP, HIP-1, HIF-1, KMT3A, HYPB, SET2, histone-lysine N-methyltransferase SETD2, huntingtin interacting protein 1, huntingtin interacting protein 1, SET domain-containing protein 2, KIAA1732, HSPC069, HBP231, HSET2, HIF1, and LLS) refers to native histone methyltransferase SETD2, unless otherwise indicated. "Human SETD2" refers to native human histone methyltransferase SETD2. "SETD2" encompasses full-length unprocessed SETD2 and any form of SETD2 resulting from intracellular processing. The term also encompasses naturally occurring variants of SETD2, such as splice variants, allelic variants, and isoforms. SETD2 can be isolated from various sources, such as human or other animal tissue types, or can be prepared by recombinant or synthetic methods. Examples of human gene sequences encoding SETD2 or SETD2 polypeptide sequences include, but are not limited to, NCBI gene ID 29072, HGNC:18420, and SETD2 transcript variant 1, mRNA-NCBI reference sequence:NM_014159.6. The human gene encoding SETD2 is located on the short arm of chromosome 3. The term "SETD2" as used herein generally refers to the gene encoding human SETD2, while other mammalian forms of SETD2 are also intended.

[0353] As used herein, "functional domain of SETD2" refers to one of three conserved functional domains of SETD2 that are believed to define the biological function of SETD2. These functional domains are (1) the AWS-SET-post-SET triad; (2) the WW domain; and (3) the Set2-Rbp1 interaction ("SRI") domain (Li, J. et al., Oncotarget 7:50719-50734 (2016)), which can be described as follows:

[0354] AWS-SET-Post-SET domain. Without wishing to be bound by theory, the human SET domain is believed to be a 130 amino acid motif that is evolutionarily conserved from yeast to mammals and is also found in some bacteria and viruses. SET domains are usually present as part of multiple domains that are flanked by AWS (associated with SET) and post-SET domains. In general, SET domain-containing proteins transfer one or more methyl groups from S-adenosyl-L-methionine to the amino groups of lysine or arginine residues of histones or other proteins. This transfer is thought to depend on the adjacent AWS and post-SET regions, which contain several conserved cysteine ​​residues. In contrast to other methyltransferases, SET domain-containing methyltransferases have an alpha-sheet structure that facilitates multiple rounds of methylation without dissociation of the substrate.

[0355] WW domain. "WW domain" refers to the presence of two conserved tryptophan (W) residues separated by 20-22 amino acids. Binding assays show that the WW domain preferentially binds to proline-rich segments, mediates protein-protein interactions, and participates in various molecular processes. Without being bound by theory, it is believed that the WW domain recognizes motifs such as proline-proline-x-tyrosine (PPxY), phospho-serine-proline (p-SP), or phospho-threonine-proline (p-ST), and mediates protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. Without being bound by theory, it is believed that the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment, regardless of the length of the HD-associated polyglutamine track, and may also interact with TP53. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can block the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and possibly other proteins as well.

[0356] SRI Domain. Without wishing to be bound by theory, the Set2Rpb1 interaction ("SRI") domain is believed to interact with the highly phosphorylated C-terminal domain (CTD) of Rpb1, the largest subunit of RNA Pol II. Also, without wishing to be bound by theory, it is believed that in humans, the major C-terminal domain docking site for RNA Pol II is located in the first and second helices of SETD2. This domain is believed to target the activity of SETD2 to actively transcribed genes.

[0357] As used herein, the term "WHSC1" (also known as Wolf-Hirschhorn syndrome candidate gene 1, MMSET, NSD2, REIIBP, TRX5 and WHS) refers to a histone methyltransferase enzyme located at the chromosome 4p16.3 locus. WHSC1 is significantly overexpressed in multiple cancer types compared to their normal counterparts. Furthermore, WHSC1 is associated with tumor aggressiveness or prognosis in many types of these cancers. Kassambara, A. et al., Biochem. Biophys. Res. Commun. 379:840-845 (2009). See also Hudlebusch HR et al., Clin Cancer Res. 17:2919-2933 (2011). A chromosomal translocation occurs in a subset of multiple myelomas in which the 4p16.3 locus of WHSC1 is fused to the 14q32 locus, resulting in substantial overexpression of WHSC1, commonly known as t(4;14), and described in more detail below.

[0358] As used herein, the term "overexpression" refers to expression (e.g., of WHSC1 polynucleotide or polypeptide) at a level that exceeds that present in normal cells or cells of a different phenotypic context.In one embodiment, WHSC1 expression is differentially present (e.g., overexpressed) in subjects of one phenotypic context, e.g., subjects with hematological cancer, compared with another phenotypic context, e.g., normal non-diseased subjects or patients with cancer without overexpression of WHSC1.Comparison can be performed by statistical analysis of numerical measurements of expression or by visual inspection of experimental results.

[0359] As used herein, the term "subject" refers to any animal (e.g., mammal), including but not limited to humans, non-human primates, rodents, etc., that will be the recipient of a particular treatment. Typically, the terms "subject" and "patient" are used interchangeably herein in reference to a human subject.

[0360] "Tumor" and "neoplasm" refer to any mass of tissue resulting from excessive cell growth or proliferation, whether benign (non-cancerous) or malignant (cancerous), including pre-cancerous and in situ lesions.

[0361] The terms "cancer," "cancerous," or "malignant tumor" are used interchangeably and refer to a physiological condition in mammals (i.e., humans) in which a population of cells is characterized by uncontrolled or regulated cell growth or proliferation. Examples of cancer include, for example, carcinoma, lymphoma, blastoma, sarcoma, myeloma, and leukemia. Non-limiting examples of cancer types that may be treated with the methods and pharmaceutical compositions of the present disclosure include esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, prostate cancer, testicular cancer, melanoma, blood cancer, multiple myeloma, pancreatic cancer, colorectal cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer.

[0362] The term "recurrent" cancer in a patient refers to a patient who previously achieved complete or partial remission but who shows evidence of disease progression after a period of six months or more. The term "refractory" cancer in a patient refers to a patient who has experienced treatment failure or disease progression within six months of the last anti-cancer therapy.

[0363] Tumors that are "unresponsive" or "poorly responsive" to treatment (e.g., with a particular chemotherapy regimen) either fail to show a statistically significant improvement in response to the treatment in recognized animal models or human clinical trials when compared with no treatment or treatment with a placebo, or respond to initial treatment but grow as treatment continues.

[0364] The term "multiple myeloma" or "MM" refers to a heterogeneous plasma cell disorder / blood cancer characterized by multiple molecularly defined subtypes, each with variable clinicopathological features and disease outcomes. MM is also known as "plasma cell myeloma" or "PCM." The American Cancer Society estimates that approximately 32,000 new cases are expected to be diagnosed in the United States in 2019, with approximately 13,000 deaths. Genetic abnormalities in MM include, for example, chromosomal translocations, deletions, duplications, copy number variations from DNA gains or losses (e.g., hyperdiploidy, gain of 1q, loss of 1p, loss of chromosome 13 / 13q, loss of 17p) and gene mutations. Prideaux, SM et al., Advances in Hematology Volume 2014:1-16 (2014).

[0365] Chromosomal translocations are early events in the pathogenesis of MM, followed later by secondary changes. The term "chromosomal translocation" refers to a genetic abnormality whereby genetic material from one chromosome is transferred to a different location on a (most often) non-homologous chromosome. Translocations can be classified into two main categories: reciprocal (or balanced) and non-reciprocal. In the more typical "reciprocal translocations," genetic material is exchanged between two non-homologous chromosomes. In non-reciprocal translocations, there is a unidirectional transfer of genetic material from one chromosome to another.

[0366] In approximately 40-50% of patients with multiple myeloma, translocations occur between the immunoglobulin heavy chain allele at chromosome 14q32 and various partner chromosomes. Pawlyn, C. et al., Nat. Rev. Cancer 17:543-556 (2017). Translocation of oncogenes to this region can result in increased expression, contributing to disease initiation, disease progression, and resistance to therapy. Several chromosomal translocations have been identified in patients with multiple myeloma, including t(4;14), t(14;16), t(14;20), t(8;14), t(11;14), and t(6;14), although t(11;14) and t(6;14) have been reported as neutral translocations. See Kalff and Spencer, Blood Cancer Journal 2:e89 (2012).

[0367] As used herein, the term "t(4;14) multiple myeloma" or "t(4;14)MM" refers to a subset of MM in which a translocation between chromosomes 4 and 14 exists. The t(4;14) translocation is associated with upregulation of fibroblast growth factor receptor 3 (FGFR3) and WHSC1. More specifically, in t(4:14)MM, a chromosomal translocation occurs in which the 4p16.3 locus of WHSC1 is fused to the 14q32 locus. The consequence of t(4;14) in multiple myeloma is that the WHSC1 gene is placed under the transcriptional control of the immunoglobulin heavy chain (IgH) promoter / enhancer region. This results in a large upregulation and overexpression of WHSC1 (Chesi et al., Blood 92:3025-3034 (1998)). Overexpression of WHSC1 results in a global increase in histone H3 dimethylation at lysine 36 (H3K36me2). (Kuo et al., Mol. Cell 44:609-620(2011)). WHSC1 is now recognized as a driving mechanism in t(4;14) pathogenesis. Similar to WHSC1, SETD2 also methylates H3K36 by adding a third methyl group (H3K36me3, trimethylation), utilizing H3K36me2 catalyzed by WHSC1 as its substrate. SETD2 is the only known HMT that can catalyze H3K36 trimethylation.

[0368] Based on the sensitivity of t(4;14) multiple myeloma cell lines to SETD2 inhibition (as shown in the following examples), the oncogenic function resulting from the increase in H3K36me2 driven by WHSC1 overexpression in t(4;14)MM may also require the ability of SETD2 to add additional methyl groups.In other words, SETD2 inhibition in t(4;14) multiple myeloma cells depends on the overexpression of WHSC1.Therefore, without being bound by theory, it is believed that the abnormal H3K36me2 driven by WHSC1 overexpression in t(4;14)MM presents additional substrates for trimethylation, which leads to oncogenic dependency on SETD2.

[0369] The term "non-t(4;14) multiple myeloma" or "non-t(4;14) MM" refers to a subset of MM in which there is a chromosomal translocation present other than t(4;14). For example, translocations in "non-t(4;14) multiple myeloma" include, for example, t(14;16), t(14;20), t(8;14), t(11;14), and t(6;14).

[0370] The term "pharmaceutical formulation" refers to a preparation that is in a form that allows the biological activity of the active ingredient to be effective and does not contain additional components that are not acceptable or toxic to the subject to which the formulation is administered. Such a formulation may be sterile.

[0371] The term "therapeutically effective amount" refers to an amount of a therapeutic agent (e.g., a small molecule inhibitor of SETD2) effective to "treat" a disease or disorder in a subject or mammal. In the case of cancer, a therapeutically effective amount of an agent can reduce the number of cancer cells, reduce the proliferation of cancer cells, reduce tumor size, inhibit (i.e., slow to some extent, and in some embodiments stop) cancer cell invasion into peripheral organs, inhibit (i.e., slow to some extent, and in some embodiments stop) tumor metastasis, inhibit tumor growth to some extent, and / or alleviate to some extent one or more symptoms associated with cancer. See the definition of "treating" herein. To the extent the agent can prevent growth and / or kill existing cancer cells, it can be cytostatic and / or cytotoxic.

[0372] The terms "treating," "treatment," "treat," "therapeutic," "palliating," "ameliorating," or "delaying progression" and the like refer to both 1) therapeutic measures that cure, eradicate, delay, reduce symptoms, and / or halt the progression of a diagnosed pathological disorder, such as cancer; and 2) preventative or prophylactic measures that prevent and / or delay the onset of cancer. Thus, those in need of treatment include those already with the disorder; those prone to having the disorder; and those in whom the disorder is to be prevented. In certain embodiments, a subject is successfully "treated" for cancer by the methods of the present disclosure if the patient exhibits one or more of the following: reduced cachexia, increased survival time, prolonged time to tumor progression, reduced tumor mass, reduced tumor burden and / or prolonged time to tumor metastasis, time to tumor recurrence or progressive disease, tumor response, complete response (CR), partial response (PR), stable disease, progression-free survival (PFS), overall survival (OS) (each measured by standards set by the National Cancer Institute and the U.S. Food and Drug Administration (FDA) for the approval of new drugs). See Johnson et al, J. Clin. Oncol. 21:1404-1411 (2003). In some embodiments, "therapeutic benefit" also encompasses reduced toxicity or adverse side effects and / or improved tolerability, as defined above.

[0373] "Administering" refers to the physical introduction of a SETD2 inhibitor as described herein into a subject using any of a variety of methods and delivery systems known to those skilled in the art. Routes of administration include oral, mucosal, topical, intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, such as by injection or infusion. As used herein, the phrase "parenteral administration" refers to methods of administration including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, and in vivo electroporation. Administering can be performed, for example, once, multiple times and / or over one or more chronic periods.

[0374] All numbers expressing amounts, ratios, physical properties of materials and / or uses in this disclosure are understood to be modified by the word "about," unless otherwise indicated. The term "about," when referring to a number or numerical range, means that the referenced number or range is an approximation, e.g., within experimental variability (or within statistical experimental error), and thus the number or numerical range may vary, e.g., by 1% to 15% of the stated number or numerical range.

[0375] SETD2 inhibitors The present disclosure provides a method for treating cancer that overexpresses WHSC1 by inhibiting SETD2, which is histone methyltransferase.The present disclosure relates to the unexpected discovery that inhibiting SETD2 can be used to treat cancer that overexpresses another histone methyltransferase, WHSC1, despite its known functionality as a tumor suppressor.In certain embodiments, the present disclosure relates to using SETD2 inhibitors to treat t(4;14) multiple myeloma (MM).The treatment includes, inter alia, administering a therapeutically effective amount of an inhibitor of SETD2 to a subject in need thereof and treating cancer.

[0376] As used herein, "inhibitor of SETD2" or "SETD2 inhibitor" refers to any molecule or compound that modulates, e.g., downregulates, the activity of human SETD2. For example, a SETD2 inhibitor may inhibit the histone methyltransferase activity of SETD2. For example, a SETD2 inhibitor may have a biochemical 50% inhibitory concentration (IC) of about 1 nM to about 10,000 nM, about 1 nM to about 1,000 nM, about 1 nM to about 500 nM, about 1 nM to about 100 nM, about 1 nM to about 50 nM, or about 1 nM to about 10 nM for SETD2 in a purified enzyme assay. 50 ) may be a compound exhibiting the formula:

[0377] In some embodiments, "downregulating (or inhibiting) the activity of human SETD2" refers to inhibiting trimethylation of lysine 36 of histone 3.

[0378] In some embodiments, the SETD2 inhibitors used in the methods of the disclosure are small molecule (i.e., molecules with a molecular weight of less than about 1,500 g / mol, e.g., between about 100 g / mol and about 1,500 g / mol) compounds that selectively target and downregulate one or more activities of SETD2.

[0379] In some embodiments, the small molecule inhibitors of SETD2 are "substituted indole compounds" as defined in the "Definitions" section of the detailed description.

[0380] In some embodiments, the SETD2 inhibitor is a compound in Table 1, or a pharma- ceutically acceptable salt thereof.

[0381] In some embodiments, the SETD2 inhibitor is not a substituted indole compound. In some embodiments, the SETD2 inhibitor is a sinefungin derivative. Sinefungin is an analog of S-adenosylmethionine (SAM). In some embodiments, the sinefungin analog is N-alkyl (methyl, ethyl, propyl, benzyl) sinefungin. In some embodiments, the N-alkyl sinefungin is N-propyl sinefungin (Pr-SNF) or N-benzyl sinefungin (Bn-SNF). The synthesis of sinefungin derivatives and their inhibitory profile against human methyltransferase SETD2 are described in Zheng, W. et al., J. Am. Chem. Soc. 134:18004-18014 (2012), which is incorporated by reference in its entirety.

[0382] In some embodiments, the SETD2 inhibitor is a compound from traditional Chinese medicine (TCM), such as conicelin, coniferyl ferulate, and 1-O-cis feruloyl-3-O-trans-p-coumaroylglycerol (FOC). See Chang, Y Let al., SAR and QSAR in Environmental Research 27:589-608 (2016), which is incorporated by reference in its entirety. Conicelin is isolated from the alcohol extract of Comiselinum vaginatum Thell. Coniferyl ferulate can be isolated from Angelica sinensis, Poria cocos (Schw.) Wolf, and Notopterygium forbesii. FOC is isolated from the rhizome of Sparganium stoloniferum. Id.

[0383] In some embodiments, the SETD2 inhibitor can be, for example, a polypeptide, DNA, or RNA. The SETD2 inhibitor can be, for example, a molecule that specifically binds to a SETD2 polypeptide, a molecule that specifically binds to a ligand of a SETD2 polypeptide, an antiserum raised against a SETD2 polypeptide, a soluble SETD2 polypeptide, or a soluble SETD2 polypeptide that also comprises, consists essentially of, or consists of the extracellular domain of a SETD2 polypeptide.

[0384] In some embodiments, the SETD2 inhibitor can be, for example, an antibody that specifically binds to a SETD2 polypeptide or an antigen-binding fragment of an antibody that specifically binds to a SETD2 polypeptide. In some embodiments, the antibody is a polyclonal antibody, a monoclonal antibody, a mouse antibody, a human antibody, a humanized antibody, or a chimeric antibody. Monoclonal and polyclonal anti-SETD2 antibodies are commercially available and can be purchased, for example, from Thermo Fisher Scientific and Millipore Sigma. In some embodiments, the antigen-binding fragment is a Fab, Fab', F(ab')2, Fv, scFv, sdFv fragment, a VH domain, or a VL domain.

[0385] In some embodiments, the SETD2 inhibitor can be, for example, RNAi, miRNA, siRNA, shRNA, antisense RNA, antisense DNA, decoy molecule, decoy DNA, double-stranded DNA, single-stranded DNA, complexed DNA, encapsulated DNA, viral DNA, plasmid DNA, naked RNA, encapsulated RNA, viral RNA, double-stranded RNA, a molecule capable of producing RNA interference, or a combination thereof, that hybridizes to a nucleotide sequence encoding a SETD2 polypeptide.

[0386] Downregulation of SETD2 can also be achieved by gene editing technology. In some embodiments, the SETD2 inhibitor can be, for example, a clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 system. The CRISPR-Cas9 system has been described in the literature with applications in cancer biology, and can include, for example, Cas9 nuclease and single guide RNA (sgRNA). See Sanchez-Rivera, FJ and Jacks, T., "Applications of the CRISPR-Cas9 System in Cancer Biology," Nat Rev Cancer 15:387-395 (2015); Chen, S. et al., "CRISPR-Cas9: from Genome Editing to Cancer Research," Int. J. Biol. Sci. 12:1427-1436 (2016). For example, sgRNA targeting the SETD2 gene together with Cas9 nuclease can be administered to a subject, resulting in the removal of a specific sequence in the SETD2 gene, resulting in downregulated SETD2 activity (i.e., inhibition of trimethylation of lysine 36 of histone H3). In particular, the SET, AWS, PS, SRI or WW domains can be targeted with CRISPR-Cas9 for removal. A non-limiting example of a CRISPR-Cas9 system includes sgRNA target SEQ ID NO:1 with sequence AGCACCAGTAACAGAGCCAG (SEQ ID NO:7), sgRNA target SEQ ID NO:2 with sequence GACTGTGAACGGACAACTGA (SEQ ID NO:8) and Cas9 mRNA. In some embodiments, the sgRNA and Cas9 mRNA can each be contained in a separate vector. In some embodiments, the sgRNA can both be contained in a first vector and the Cas9 mRNA can be contained in a second vector. In some embodiments, the sgRNA and Cas9 mRNA can all be contained in a single vector. Those of skill in the art are aware of reagents and methods for formulating the CRISPR-Cas9 system for administration to a subject in need thereof.

[0387] In addition to the CRISPR-Cas9-based system, other alternative CRISPR-based systems, such as the CRISPR / Cpf1 system of the bacterium Francisella novicida, can be used to inhibit SETD2. See Zetsche, B. et al., Cell 163:759-771 (2015); Fonfara, I et al., Nature 532:517-521 (2016).

[0388] In addition to CRISPR-based systems, other gene editing technologies, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and engineered homing meganucleases, can also be used to inhibit SETD2. See, for example, Maeder, ML and Gersbach, CA, "Genome-editing Technologies for Gene and Cell Therapy," Mol. Ther. 24:430-446 (2016); Gaj, T. et al., "ZFNs, TALENs, and CRISPR / Cas-based methods for genome engineering," Trends Biotechnol 31:397-405 (2013); Perez-Pinera, P. et al., "Advances in targeted genome editing," Curr Opin Chem Biol 16:268-277 (2012).

[0389] In one embodiment, the SETD2 inhibitor is an antisense nucleic acid or oligonucleotide that is fully or partially complementary to the target nucleic acid (DNA or RNA) encoding the SETD2 polypeptide and can hybridize with the target nucleic acid (DNA or RNA) encoding the SETD2 polypeptide. For example, the antisense nucleic acid or oligonucleotide can be complementary to the 5' or 3' untranslated region or can overlap the translation initiation codon (5' untranslated and translated region) of at least one nucleic acid molecule encoding SETD2. As a non-limiting example, the antisense oligonucleotide can target to hybridize to the following regions: mRNA cap region, translation initiation site; translation termination site; transcription initiation site; transcription termination site; polyadenylation signal; 3' untranslated region; 5' untranslated region; 5' coding region, central coding region; 3' coding region: DNA replication initiation and elongation site.

[0390] In some embodiments, oligonucleotides can be constructed that bind to double-stranded nucleic acids (i.e., DNA:DNA or DNA:RNA) and form stable triple helices or triplex nucleic acids. Such triplex oligonucleotides can inhibit transcription and / or expression of nucleic acids encoding SETD2. Triplex oligonucleotides are constructed using the base-pairing rules of triplex formation.

[0391] In further embodiments, oligonucleotides containing moieties with non-naturally occurring portions can be used in the method. Thus, oligonucleotides can have altered sugar moieties or inter-sugar linkages. Exemplary among these are phosphorothioates and other sulfur-containing species known in the art. In preferred embodiments, at least one of the phosphodiester bonds of the oligonucleotide is replaced with a structure that functions to enhance the ability of the composition to penetrate into the region of the cell in which the RNA whose activity is to be modulated is located. Such replacements preferably include phosphorothioate bonds, methylphosphonate bonds, or short chain alkyl or cycloalkyl structures.

[0392] In other embodiments, the phosphodiester linkages are replaced with structures that are simultaneously substantially non-ionic and non-chiral or chiral and enantiomerically specific. One of skill in the art can select other linkages for use in the disclosed methods, including inverted terminal nucleotides.

[0393] Oligonucleotides may also include species that contain at least some modified base forms. Thus, purines and pyrimidines other than those normally found in nature may be used. Similarly, modifications on the furanosyl portion of the nucleotide subunits may also be effected. Examples of such modifications are 2'-O-alkyl- and 2'-halogen substituted nucleotides. Some non-limiting examples of modifications at the 2' position of the sugar moiety include OH, SH, SCH3, F, OCH3, OCN, O(CH2), NH2, and O(CH2)nCH3, where n is 1 to about 10. Such oligonucleotides are functionally interchangeable with natural or synthetic oligonucleotides (having one or more differences from the natural structure). All such analogs are thus encompassed as long as they function effectively to hybridize and inhibit the function of at least one nucleic acid molecule encoding SETD2.

[0394] An "isolated" polypeptide, antibody, polynucleotide, vector, cell or composition is a polypeptide, antibody, polynucleotide, vector, cell or composition that is in a form not found in nature. Isolated polypeptides, antibodies, polynucleotides, vectors, cells or compositions include those that have been purified to the extent that they are no longer in the form in which they are found in nature. In some embodiments, an isolated antibody, polynucleotide, vector, cell or composition is substantially pure. As used herein, "substantially pure" refers to a material that is at least 50% pure (i.e., free from contaminants), at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.

[0395] "Polynucleotide" or "nucleic acid", as used interchangeably herein, refers to a polymer of nucleotides of any length, and includes both DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. A polynucleotide can contain modified nucleotides, such as methylated nucleotides and their analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polymer. The sequence of nucleotides can be interrupted by non-nucleotide components.

[0396] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymers can be linear or branched, can include modified amino acids, and can be interrupted by non-amino acids. These terms also encompass amino acid polymers that are modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within this definition are, for example, polypeptides that contain one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art. Because the polypeptides of the present disclosure are based on antibodies, it is understood that in certain embodiments, the polypeptides can occur as single chains or associated chains.

[0397] The term "identical" or percent "identity," in the context of two or more nucleic acids or polypeptides, refers to two or more sequences or subsequences that are the same or have a specified percentage of the same nucleotides or amino acid residues when compared and aligned (introducing gaps, if necessary) for maximum correspondence, without considering any conservative amino acid substitutions as part of the sequence identity. Percent identity can be measured using sequence comparison software or algorithms or by visual inspection.

[0398] Various algorithms and software that can be used to obtain alignment of amino acid or nucleotide sequences are known in the art. One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al., Proc. Natl. Acad. Sci. 87: 2264-2268 (1990), modified in Karlin et al., Proc. Natl. Acad. Sci. 90: 5873-5877 (1993), and incorporated into the NBLAST and XBLAST programs (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1991)). In certain embodiments, gapped BLAST can be used as described in Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997). BLAST-2, WU-BLAST-2 (Altschul et al., Methods in Enzymology 266:460-480 (1996)), ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or Megalign (DNASTAR) are further publicly available software programs that can be used to align sequences. In certain embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software (e.g., using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70 or 90 and a length weight of 1, 2, 3, 4, 5 or 6). In certain alternative embodiments, the GAP program in the GCG software package incorporating the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using a Blossum62 matrix or a PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5).

[0399] Alternatively, in certain embodiments, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4:11-17 (1989)). For example, the percent identity can be determined using the ALIGN program (version 2.0) and using PAM120 with a residue table, a gap length penalty of 12, and a gap penalty of 4. Appropriate parameters for maximum alignment with a particular alignment software can be determined by one of skill in the art. In certain embodiments, the default parameters of the alignment software are used. In certain embodiments, the percent identity "X" between a first amino acid sequence and a second amino acid sequence is calculated as 100 x (Y / Z), where Y is the number of amino acid residues scored as a perfect match in the alignment of the first and second sequences (aligned by visual inspection or by a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of the first sequence is longer than the length of the second sequence, the percent identity between the first sequence and the second sequence is greater than the percent identity between the second sequence and the first sequence.

[0400] As a non-limiting example, whether any particular polynucleotide has a particular percentage of sequence identity (e.g., at least 80% identical, at least 85% identical, at least 90% identical, and in some embodiments at least 95%, 96%, 97%, 98% or 99% identical) to a reference sequence can, in certain embodiments, be determined using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981), to find the best segment of homology between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present disclosure, parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and allows gaps in homology of up to 5% of the total number of nucleotides in the reference sequence.

[0401] In some embodiments, two nucleic acids or polypeptides described herein are substantially identical, meaning that they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity when compared and aligned for maximum correspondence as measured using a sequence comparison algorithm or by visual inspection. In certain embodiments, the identity exists over a region of the sequences at least about 10, about 20, about 40-60 residues, or any integer value therebetween, or a region longer than 60-80 residues, at least about 90-100 residues, or the sequences are substantially identical over the full length of the sequences being compared, e.g., the coding regions of the nucleotide sequences.

[0402] Alternatively, expression vectors derived from retroviruses, adenoviruses, herpes or vaccinia viruses or various bacterial plasmids can be used for delivery of nucleotide sequences to target organs, tissues or cell populations. Methods well known to those skilled in the art can be used to construct recombinant vectors that express nucleic acid sequences complementary to those encoding human SETD2 polypeptides.

[0403] RNA interference (RNAi) is a post-transcriptional gene silencing process induced by miRNA or dsRNA (small interfering RNA; siRNA) and has been used to modulate gene expression. RNAi can be used in the therapeutic methods described herein to inhibit SETD2. Generally, RNAi is performed by contacting cells with double-stranded siRNA or short hairpin RNA (shRNA). However, the manipulation of RNA outside the cell is time-consuming due to the susceptibility of RNA to degradation. Thus, it is also encompassed herein that a deoxyribonucleic acid (DNA) composition is used that encodes a short interfering RNA (siRNA) molecule or an intermediate siRNA molecule (e.g., shRNA) that includes one strand of siRNA. Thus, the present application provides an isolated DNA molecule, which includes an expressible template nucleotide sequence of at least about 16 nucleotides that encodes an intermediate siRNA that, when a component of the siRNA, mediates RNA interference (RNAi) of a target RNA. The present application further relates to the use of RNA interference (RNAi) to modulate the expression of a nucleic acid molecule encoding SETD2 in a target cell. While therapeutic applications are not limited to a specific mechanism of action, RNAi may involve the degradation of messenger RNA (e.g., the mRNA of the gene of SETD2) by RNA-induced silencing complex (RISC), preventing the translation of transcribed target mRNA. Alternatively, it may involve the methylation of genomic DNA, which interrupts the transcription of target genes. The suppression of gene expression brought about by RNAi may be transient, or may be more stable and even persistent.

[0404] "Short interfering RNA" (siRNA) can also be used in the present methods as SETD2 inhibitors. siRNA refers to any nucleic acid molecule capable of mediating RNA interference (RNAi) or gene silencing. For example, siRNAs can be double-stranded RNA molecules of about 10 to about 30 nucleotides in length, the name derived from their ability to specifically interfere with protein expression (e.g., SETD2 protein expression). In one embodiment, siRNAs of the present disclosure are 12 to 28 nucleotides in length, more preferably 15 to 25 nucleotides in length, even more preferably 19 to 23 nucleotides in length, and most preferably 21 to 23 nucleotides in length. Thus, preferred siRNAs are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 nucleotides in length. As used herein, siRNA molecules need not be limited to those molecules that contain only RNA, but further encompass chemically modified nucleotides and non-nucleotides. siRNA can be designed to reduce the expression of SETD2 in target cells by RNA interference. siRNA can include a sense region and an antisense region, the antisense region includes a sequence that is complementary to the mRNA sequence for the nucleic acid molecule encoding SETD2, and the sense region includes a sequence that is complementary to the antisense sequence of the mRNA of the gene. siRNA molecule can be assembled from two nucleic acid fragments, one fragment includes the sense region of the siRNA molecule, and the second fragment includes the antisense region. The sense region and the antisense region can also be covalently connected via a linker molecule. The linker molecule can be a polynucleotide linker or a non-polynucleotide linker.

[0405] In one embodiment, the SETD2 inhibitor is a human SETD2 siRNA selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4. UAAAGGAGGUAUAUCGAAU (SEQ ID NO: 1) GAGAGGUACUCGAUCAUAA (SEQ ID NO: 2) GCUCAGAGUUAACGUUUGA (SEQ ID NO: 3) CCAAAGAUUCAGACAUAUA (SEQ ID NO: 4)

[0406] Ribozymes (from ribonucleic acid enzymes, also called RNA enzymes or catalytic RNAs) are RNA molecules that catalyze chemical reactions. Some ribozymes can play important roles as therapeutic agents, as enzymes that target defined RNA sequences, as biosensors, and for applications in functional genomics and gene discovery. Ribozymes can be engineered to specifically cleave the transcripts of genes from the nucleic acid molecule encoding SETD2, whose expression is desired to be downregulated.

[0407] Delivery of genes or genetic material into cells (partially or entirely encoding sequences that reduce the expression of SETD2) is the first step in gene therapy treatment of any disorder. Numerous delivery methods are well known to those skilled in the art. Preferably, nucleic acids are administered for in vivo or ex vivo gene therapy use. Non-viral vector delivery systems include DNA plasmids, naked nucleic acids and nucleic acids complexed with delivery vehicles such as liposomes. Viral vector delivery systems include DNA and RNA viruses that have episomal or integrated genomes after delivery to cells.

[0408] The use of RNA or DNA-based viral systems for the delivery of nucleic acids takes advantage of the highly evolved process for targeting viruses to specific cells in the body and transporting the viral payload to the cell nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells and modified cells in vitro and then administered to patients (ex vivo). Conventional viral-based systems for the delivery of nucleic acids can include retroviral, lentiviral, adenoviral, adeno-associated viral and herpes simplex viral vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration in the host genome is possible with retroviral, lentiviral and adeno-associated viral gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiency has been observed in many different cell types and target tissues.

[0409] In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are typically used. Adenovirus-based vectors can enable very high transduction efficiency in many cell types and do not require cell division. High titers and expression levels have been obtained with such vectors. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus ("AAV") vectors are also used to transduce cells with target nucleic acid, for example, in the in vitro production of nucleic acids and peptides and for in vivo and ex vivo gene therapy procedures.

[0410] Recombinant adeno-associated virus vectors (rAAV) are a promising alternative gene delivery system based on the defective and non-pathogenic parvovirus adeno-associated type 2 virus. All vectors are derived from plasmids that carry only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery by integration into the genome of transduced cells are key features for this vector system.

[0411] Replication-defective recombinant adenoviral vectors (Ad) are primarily used in transient expression gene therapy because they can be produced at high titers and easily infect several different cell types. Most adenoviral vectors are engineered so that a transgene replaces the Ad E1a, E1b, and E3 genes. The replication-defective vectors are then propagated in human 293 cells, which supply the missing gene functions in trans. Ad vectors can transduce multiple types of tissues in vivo, including non-dividing differentiated cells, such as those found in liver, kidney, and muscle tissue. Conventional Ad vectors have a large carrying capacity.

[0412] In many gene therapy applications, it is desirable for gene therapy vectors to be delivered with a high degree of specificity to a particular tissue type, such as glial cells.Viral vectors are typically modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus.The ligand is selected to have affinity for a receptor known to be present on the cell type of interest.

[0413] Gene therapy vectors can be delivered in vivo by administration to an individual subject, typically by systemic administration (e.g., intravenous, intratumoral, intraperitoneal, intramuscular, subcutaneous or intracranial injection) or local application. Alternatively, vectors can be delivered ex vivo to cells, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates and tissue biopsies) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into the subject, usually after selection for cells that have incorporated the vector.

[0414] In one embodiment, stem cells are used in ex vivo procedures for cell transfection and gene therapy. The advantage of using stem cells is that they can be differentiated in vitro into other cell types or can be introduced into a mammal (e.g., the cell donor) where they engraft in the appropriate place (e.g., in the bone marrow). Methods are known for differentiating CD34+ cells in vitro into clinically important immune cell types using cytokines such as GM-CSF, IFN-γ, and TNF-α.

[0415] Stem cells are isolated for transduction and differentiation using known methods. For example, stem cells can be isolated from bone marrow cells by panning the bone marrow cells with antibodies that bind unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (pan B cells), GR-1 (granulocytes), and lad (differentiated antigen presenting cells).

[0416] Administration of SETD2 inhibitors The appropriate method of administering the SETD2 inhibitors described herein is based on the properties of the inhibitor (i.e., small molecule, DNA, RNA, protein, antibody) and is well known to those skilled in the art. The SETD2 inhibitors described herein can be administered orally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, transdermally, intrathecally, intranasally, transmucosally, intratumorally, rectally, intravaginally or buccally, or by inhalation. For example, intravenous injection, such as drip infusion, intramuscular injection, intraperitoneal injection, subcutaneous injection, suppository, irrigation, oral enteric coated tablet, etc. can be selected, and the administration method can be selected as necessary according to the age and condition of the patient. The SETD2 inhibitors described herein can be administered systemically (e.g., by intravenous injection) or locally (e.g., intrathecally, intratumorally or to lymph nodes).

[0417] The appropriate dosage of the SETD2 inhibitor of the present disclosure depends on several factors, such as the type of cancer being treated, the severity, course and stage of the cancer, the responsiveness of the cancer, previous treatments, and the patient's medical history, all at the discretion of the treating physician. In some embodiments, the dosage of the SETD2 inhibitor is about 0.01 mg / kg to about 1000 mg / kg of body weight. In some embodiments, the dosage of the SETD2 inhibitor is about 1 mg / kg to about 500 mg / kg of body weight. In some embodiments, the dosage of the SETD2 inhibitor is about 0.1 mg / day to about 50 g / day; about 0.1 mg / day to about 25 g / day; about 0.1 mg / day to about 10 g / day; about 0.1 mg / day to about 3 g / day; or about 0.1 mg / day to about 1 g / day. Alternatively, the dosage of the SETD2 inhibitor ranges from 1 to 2000 mg, preferably 100 to 1000 mg, per patient.

[0418] In some embodiments, a SETD2 inhibitor can be administered once or over a series of treatments lasting several days to several months, or until a cure is effected or a diminution of the pathology is achieved (e.g., a reduction in tumor size).

[0419] In some embodiments, the SETD2 inhibitors described herein can be administered daily, weekly, monthly, or one or more times per year. In certain embodiments, the SETD2 inhibitors are administered once a day, once every two days, once every three days, or once every four days. In certain embodiments, the SETD2 inhibitors are administered twice a day, three times a day, or four times a day. In certain embodiments, the SETD2 inhibitors are administered once a week. In certain embodiments, the SETD2 inhibitors are administered once every two weeks. In certain embodiments, the SETD2 inhibitors are administered once every three weeks. In some embodiments, the SETD2 inhibitors are administered once every four weeks. In some embodiments, the SETD2 inhibitors are administered once a month.

[0420] In some embodiments, the SETD2 inhibitors described herein may be administered at an initial higher "loading" dose, followed by one or more lower doses. In some embodiments, the frequency of administration may also vary. In some embodiments, the dosing regimen may include administering an initial dose, followed by a further dose (or "maintenance" dose) twice a day, once a day, once every other day, once every third day, or once a week. For example, the dosing regimen may include administering an initial loading dose, followed by a daily maintenance dose, e.g., half the initial dose. Or the dosing regimen may include administering an initial loading dose, followed by a maintenance dose, e.g., half the initial dose, every other day. Or the dosing regimen may include administering three initial doses for three days, followed by a maintenance dose, e.g., of the same amount, every other day.

[0421] Those skilled in the art will recognize that the dosage administered, the route of administration and frequency of administration will vary according to the circumstances of the particular subject being treated, and will take into account such factors as the age, sex, health and weight of the recipient, the condition or disorder being treated, the severity of the disorder, the type of concurrent treatment (if any) and the nature of the effect desired.

[0422] One of skill in the art will also recognize that the dosage and / or frequency of administration of a SETD2 inhibitor may vary (decreased or increased) during the course of treatment or between different phases of treatment (i.e., treatment or maintenance) depending on the patient's clinical response, side effects, etc.

[0423] Pharmaceutical Compositions The SETD2 inhibitor used in the methods described herein can be formulated into a pharmaceutical composition suitable for administration to a subject in need thereof (i.e., a subject suffering from a cancer that overexpresses WHSC1). As used herein, "pharmaceutical composition" refers to a preparation of one or more agents (e.g., SETD2 inhibitors) as described herein or physiologically acceptable salts or prodrugs thereof, together with other chemical components, including, but not limited to, pharmaceutical acceptable carriers, additives, lubricants, buffers, antibacterial agents, fillers (e.g., mannitol), antioxidants (e.g., ascorbic acid or sodium bisulfite), and the like. The purpose of a pharmaceutical composition is to facilitate administration of an agent to a subject.

[0424] The terms "pharmacologically acceptable carrier", "additive" and "adjuvant" and "physiologically acceptable vehicle" and the like are understood to refer to acceptable carriers or adjuvants that can be administered to a patient together with the SETD2 inhibitors described herein and do not destroy or abrogate its pharmacological activity. Pharmaceutically acceptable additives, as used herein, include, but are not limited to, any solvent, dispersion medium or other liquid vehicle, dispersing or suspending aid, excipient, granulating and / or dispersing agent, surface active agent, isotonicity agent, thickening or emulsifying agent, preservative, binder, lubricant or oil, coloring agent, sweetener or flavoring agent, stabilizer, antioxidant, antimicrobial or antifungal agent, osmolality adjusting agent, pH adjusting agent, buffer, chelating agent, cryoprotectant and / or bulking agent, as appropriate for the particular dosage form desired. Various additives for formulating pharmaceutical compositions and techniques for preparing compositions are well known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, incorporated herein by reference in its entirety). st Edition, A. R. Gennaro (see Lippincott, Williams & Wilkins, Baltimore, MD, 2006).

[0425] Exemplary excipients include, but are not limited to, calcium or sodium carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, and the like, and / or combinations thereof.

[0426] Exemplary granulating and / or dispersing agents include, but are not limited to, starch, pregelatinized or microcrystalline starch, alginic acid, guar gum, agar, poly(vinyl-pyrrolidone), (Providone), cross-linked poly(vinyl-pyrrolidone) (Crospovidone), cellulose, methylcellulose, carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), magnesium aluminum silicate (VEEGUM®), sodium lauryl sulfate, and the like, and / or combinations thereof.

[0427] Exemplary surfactants and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monooleate [TWEEN® 80], sorbitan monopalmitate [SPAN® 40], glyceryl monooleate, polyoxyethylene esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [BRIJ® 30]), PLUORINC® F68, Poloxamer® 188, etc.), and / or combinations thereof.

[0428] Exemplary binders include, but are not limited to, starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., acacia, sodium alginate), ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose, and the like, as well as combinations thereof.

[0429] Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, and the like, and combinations thereof.

[0430] Exemplary chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, edetate disodium, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, edetate trisodium, and the like, and combinations thereof.

[0431] Exemplary antimicrobial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, and the like, and combinations thereof.

[0432] Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, ascorbic acid, butylated hydroxyanisole, ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), and the like, and combinations thereof.

[0433] Exemplary buffers for controlling pH can include, but are not limited to, sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, and the like, and / or combinations thereof.

[0434] Exemplary lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium or magnesium lauryl sulfate, and the like, and combinations thereof.

[0435] The pharmaceutical compositions or formulations described herein may contain a cryoprotectant that stabilizes the polynucleotides described herein during freezing. Exemplary cryoprotectants include, but are not limited to, mannitol, sucrose, trehalose, lactose, glycerol, dextrose, and the like, and combinations thereof.

[0436] The administration of the SETD2 inhibitor of the present disclosure is by any of the routes that are usually used to introduce molecules into ultimate contact with tumor cells.The pharmaceutical composition containing the SETD2 inhibitor can be administered by any suitable method, for example, parenterally, intracerebroventricularly, orally, topically, rectally, vaginally, nasally, intrabuccally or via an implanted reservoir.As used herein, the term "parenteral" includes subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques.

[0437] Parenteral formulations can be a single bolus dose, an infusion or a loading bolus dose followed by a maintenance dose.These compositions can be administered at specific fixed intervals or at variable intervals, for example, twice a week or once a week.In some embodiments, the SETD2 inhibitor is administered intravenously.

[0438] In certain embodiments, the pharmaceutical compositions can be administered orally in any acceptable dosage form, including, for example, capsules, tablets, aqueous suspensions or solutions. In certain embodiments, the pharmaceutical compositions can also be administered by nasal aerosol or inhalation. Such compositions can be prepared as solutions in saline using benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, and / or other conventional solubilizing or dispersing agents.

[0439] Those skilled in the art will understand that the specific dosage and treatment regimen for any particular patient will depend on a variety of factors, including the particular therapeutic agent used, the patient's age, weight, general health, sex, and diet, as well as the time of administration, excretion rate, drug combination, and the severity of the particular disease being treated. Judgment of such factors by the therapist is within the ordinary skill of the art. The amount will also depend on the individual patient being treated, the route of administration, the type of formulation, the characteristics of the compound used, the severity of the disease, and the effect desired. The amount used can be determined by pharmacological and pharmacokinetic principles well known in the art.

[0440] Methods of Treating Cancers That Overexpress WHSC1 In one aspect, the disclosure provides a method of treating a cancer that overexpresses WHSC1 in a subject by administering to a subject in need thereof a therapeutically effective amount of a SETD2 inhibitor, such as any of those described herein.

[0441] In some embodiments, the SETD2 inhibitor is a substituted indole compound as defined in the "Definitions" section of the detailed description.

[0442] In some embodiments, the SETD2 inhibitor is a compound in Table 1, or a pharma- ceutically acceptable salt thereof.

[0443] In some embodiments, the SETD2 inhibitor is not a substituted indole compound. For example, the SETD2 inhibitor may be a sinefungin derivative selected from the group consisting of N-propyl sinefungin and N-benzyl sinefungin or any other SETD2 inhibitor described herein.

[0444] In some embodiments, the overexpression of WHSC1 by the cancer is determined before administering the SETD2 inhibitor. A person skilled in the art can determine the expression and overexpression of WHSC1 using any of the many methods known and commonly used in the art. Examples include, but are not limited to, PCR (polymerase chain reaction) or RT-PCR, flow cytometry, Northern blot, Western blot, ELISA (enzyme-linked immunosorbent assay), RIA (radioimmunoassay), gene chip analysis of RNA expression, immunohistochemistry or immunofluorescence. See, for example, Slagle et al., Cancer 83:1401 (1998). Certain embodiments include methods in which WHSC1 RNA expression (transcription) is determined. Other embodiments of the present disclosure include methods in which WHSC1 protein expression is determined in biological samples (i.e., tumor tissue). See, e.g., Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, (1988); Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York 3rd Edition, (1995); Kamel and Al-Amodi, Genomics Proteomics Bioinformatics 15:220-235 (2017). For Northern blot or RT-PCR analysis, RNA is isolated from tumor tissue samples using RNase-free techniques. WHSC1 protein expression in tumor samples can be measured using standard immunohistochemistry and immunostaining techniques. See, e.g., Hudlebusch, HR et al., Clinical Cancer Research 17:2919-2933 (2011).

[0445] For example, if the mean or median expression level of WHSC1 is calculated to be statistically significant, the expression levels measured between different phenotypic situations can be considered to be different. Common tests for statistical significance include, among others, t-test, ANOVA, Kruskal-Wallis, Wilcoxon, Mann-Whitney, significance analysis of microarray, odds ratio, etc. Biomarkers (e.g., WHSC1), alone or in combination, provide a measure of the relative likelihood that a subject belongs to one or another phenotypic situation. Thus, they are useful, among others, as markers for disease and as indicators of the likelihood that a particular therapeutic treatment regimen will bring about beneficial patient outcomes.

[0446] In one embodiment of the present disclosure, a biological sample is obtained from a patient and the biological sample is assayed for determination of WHSC1 expression or mutation status.

[0447] In another embodiment of the present disclosure, a Northern blot analysis of WHSC1 transcripts in tumor cell samples is performed. Northern analysis is a standard method for detecting and / or quantifying mRNA levels in a sample. First, RNA is isolated from the sample to be assayed using Northern blot analysis. In the analysis, the RNA sample is first separated by size by electrophoresis in an agarose gel under denaturing conditions. The RNA is then transferred to a membrane, crosslinked, and hybridized with a probe that is labeled. Typically, Northern hybridization involves the in vitro polymerization of radiolabeled or nonisotopically labeled DNA or the production of oligonucleotides as hybridization probes. Typically, the membrane that holds the RNA sample is prehybridized or blocked before probe hybridization to prevent the probe from coating the membrane and reduce nonspecific background signals. After hybridization, unhybridized probes are typically removed by washing with several changes of buffer. The stringency of washing and hybridization conditions can be designed, selected and implemented by those skilled in the art. Detection is achieved using a detectably labeled probe and appropriate detection method. Radioactive and non-radioactive labeled probes and their use are well known in the art. The presence and / or relative level of WHSC1 expression can be quantified, for example, using densitometry.

[0448] In another embodiment, WHSC1 expression and / or mutation status is determined using RT-PCR. RT-PCR allows detection of the progress of PCR amplification of target genes in real time. The design of primers and probes required to detect WHSC1 expression and / or mutation status is within the skill of a person skilled in the art. RT-PCR can be used to determine the level of RNA encoding WHSC1 in tumor tissue samples. In one embodiment of the present disclosure, RNA from biological samples is isolated under ribonuclease-free conditions and then converted to DNA by treatment with reverse transcriptase. Methods for reverse transcriptase conversion of RNA to DNA are well known in the art. Descriptions of PCR are provided in the following references: Mullis et al., Cold Spring Harbor Symp. Quant. Biol. 51:263 (1986); EP 50,424; EP 84,796; EP 258,017; EP 237,362; EP 201,184; U.S. Pat. Nos. 4,683,202; 4,582,788; and 4,683,194.

[0449] RT-PCR probes depend on the 5'-3' nuclease activity of the DNA polymerase used for PCR, which hydrolyzes oligonucleotides hybridized to the target amplicon (WHSC1 gene). RT-PCR probes are oligonucleotides with a fluorescent reporter dye attached to the 5' end and a quencher moiety coupled to the 3' end (or vice versa). These probes are designed to hybridize to an internal region of the PCR product. In the unhybridized state, the proximity of the fluorescent and quencher molecules prevents detection of the fluorescent signal from the probe. During PCR amplification, when the polymerase replicates the template to which the RT-PCR probe is bound, the 5'-3' nuclease activity of the polymerase cleaves the probe. This decouples the fluorescent and quenching dyes and FRET no longer occurs. Thus, fluorescence increases in each cycle in a manner commensurate with the amount of probe cleavage. The fluorescent signal emitted from the reaction can be measured or tracked over time using conventional and conventional techniques using commercially available equipment.

[0450] In another embodiment of the present disclosure, the expression of the protein encoded by WHSC1 is detected by Western blot analysis. Western blot (also known as immunoblot) is a method for protein detection in a given sample of tissue homogenate or extract. It uses gel electrophoresis to separate denatured proteins by mass. Proteins are then transferred from the gel onto a membrane (e.g., nitrocellulose or polyvinylidene difluoride (PVDF)) and are detected using a primary antibody that specifically binds to the protein. The bound antibody can then be detected by a secondary antibody conjugated with a detectable label (e.g., biotin, horseradish peroxidase or alkaline phosphatase). Detection of the secondary label signal indicates the presence of the protein.

[0451] In another embodiment of the present disclosure, the expression of the protein encoded by WHSC1 is detected by enzyme-linked immunosorbent assay (ELISA). In one embodiment of the present disclosure, the "sandwich ELISA" includes: coating a plate with a capture antibody; adding a sample (wherein any antigen present binds to the capture antibody); adding a detection antibody that also binds the antigen; adding an enzyme-linked secondary antibody that binds to the detection antibody; and adding a substrate that is converted to a detectable form by the enzyme on the secondary antibody. Detection of the signal from the secondary antibody indicates the presence of WHSC1 antigen protein.

[0452] Many types of cancers that overexpress WHSC1 can be treated by the disclosed methods and pharmaceutical compositions. In some embodiments, the cancer is adrenal gland carcinoma, acinic cell carcinoma, acoustic neuroma, acral lentigo melanoma, acral sweat adenoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, adenoid odontogenic tumor, adenosquamous carcinoma, adipose tissue neoplasm, adrenal cortical carcinoma, AIDS-related lymphoma, alveolar rhabdomyosarcoma, alveolar soft part sarcoma (honeycomb soft part sarcoma), ameloblastoma, anaplastic large cell lymphoma, anaplastic thyroid carcinoma, angiomyolipoma, angiosarcoma, astrocytoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, biliary tract cancer, bladder cancer, blastoma, bone cancer, breast cancer, brain cancer, carcinoma, intraepithelial carcinoma, carcinosarcoma, carcinoma of cartilage tissue, cementum tumor, myeloid sarcoma, chondroma, chordoma, choriocarcinoma, choroid plexus papilloma, clear cell sarcoma of the kidney, craniopharyngioma, cutaneous T-cell lymphoma, cervical cancer, colorectal cancer, Degos disease, desmoplastic small round cell tumor, dysgerminoma, embryonal carcinoma, endocrine neoplasm, endodermal sinus tumor, esophageal cancer, fibrosarcoma, follicular lymphoma, follicular thyroid carcinoma, ganglioneuroma, gastrointestinal cancer, germ cell tumor, gestational choriocarcinoma, giant cell fibroblastoma, giant cell tumor of bone, glial tumor, glioblastoma, glioma, gliomatosis cerebri, glucagonoma, gonadoblastoma, granulosa cell tumor , male germ cell tumor, gallbladder cancer, gastric cancer, hemangioblastoma, head and neck cancer, hemangiopericytoma, hepatoblastoma, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, invasive lobular carcinoma, intestinal cancer, kidney cancer, laryngeal cancer, lentigo maligna, lethal midline carcinoma, leukemia, Leydig cell tumor, liposarcoma, lung cancer, lymphangioma, lymphangiosarcoma, lymphoepithelioma, hepatocellular carcinoma, small cell lung cancer, non-small cell lung cancer, malignant fibrous histiocytoma, malignant peripheral nerve sheath tumor, malignant Triton tumor, mediastinal germ cell tumor, medullary carcinoma of the breast, medullary thyroid carcinoma, medulloblastoma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, metastatic urothelial carcinoma, Müllerian duct Mixed tumor, Myxoid tumor, Muscle tissue neoplasm, Myxoid fungoides, Myxoid liposarcoma, Myxoma, Myxosarcoma, Nasopharyngeal carcinoma, Schwannoma, Neuroblastoma, Neurofibroma, Neuroma, Nodular melanoma, Eye cancer, Oligodendroglioma, Oxysinophilic granular cell tumor, Optic nerve sheath meningioma, Optic nerve tumor, Oral cancer, Osteosarcoma, Ovarian cancer, Papillary thyroid carcinoma, Paraganglioma, Pineoblastoma, Pineocytoma, Pituitary cell tumor, Pituitary adenoma, Pituitary tumor, Plasmacytoma, Polyembryoma, Primary central nervous system lymphoma, Primary effusion lymphoma, Primary peritoneal cancer, Prostate cancer, Pancreatic cancer, Pharyngeal cancer, Peritoneal pseudomyxoma,Renal cell carcinoma, medullary renal carcinoma, retinoblastoma, rhabdomyoma, rhabdomyosarcoma, rectal cancer, sarcoma, schwannomatosis, seminoma, Sertoli cell tumor, sex cord-gonadal stromal tumor, skin cancer, small cell carcinoma, soft tissue sarcoma, somatostatinoma, spinal cord tumor, squamous cell carcinoma, synovial sarcoma, small intestine cancer, squamous cell carcinoma, gastric cancer, testicular cancer, thyroid cancer, transitional cell carcinoma, throat cancer, urachal cancer, genitourinary cancer, urothelial carcinoma, uveal melanoma, uterine cancer, verrucous carcinoma, visual pathway glioma, vulvar cancer , vaginal carcinoma, Warthin's tumor, Wilms' tumor, squamous cell carcinoma of the head and neck, adenocarcinoma, squamous cell carcinoma of the esophagus, adenocarcinoma of the stomach, adenocarcinoma of the colon, hepatocellular carcinoma, cholangiocarcinoma of the bile duct system, adenocarcinoma of the gallbladder, adenocarcinoma of the pancreas, ductal carcinoma in situ of the breast, adenocarcinoma of the breast, adenocarcinoma of the lung, squamous cell carcinoma of the lung, transitional cell carcinoma of the bladder, squamous cell carcinoma of the bladder, squamous cell carcinoma of the cervix, adenocarcinoma of the cervix, endometrial carcinoma, penile squamous cell carcinoma, and squamous cell carcinoma of the skin.

[0453] In some embodiments, the cancer is esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, blood cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, or colorectal cancer.

[0454] In some embodiments, the cancer is acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia. The hematological cancers overexpressing WHSC1 are selected from the group consisting of acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma.

[0455] In some embodiments, the hematological cancer that overexpresses WHSC1 is selected from the group consisting of acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), including extranodal and nodal MZL, hairy cell leukemia (HCL), Burkitt's lymphoma (BL), and Richter's transformation.

[0456] In some embodiments, the WHSC1-overexpressing hematological cancer is multiple myeloma.

[0457] In some embodiments, the WHSC1-overexpressing hematological cancer is t(4;14) multiple myeloma as described herein.

[0458] In some embodiments, the hematological cancer that overexpresses WHSC1 is a non-t(4;14) multiple myeloma, such as t(14;16), t(11;14), t(14;20), t(8;14) and t(6;14) as described herein. In some embodiments, non-t(4;14) multiple myeloma cells do not overexpress WHSC1 but still respond to SETD2 inhibition. This is shown in the examples below.

[0459] In some embodiments, the cancer is refractory to traditional chemotherapy.

[0460] In some embodiments, the cancer has recurred.

[0461] In some embodiments, treatment with the methods described herein can be continued indefinitely (i.e., as a maintenance treatment). In some embodiments, treatment with the methods described herein can be continued for up to about 18 weeks, up to about 17 weeks, up to about 16 weeks, up to about 15 weeks, up to about 14 weeks, up to about 13 weeks, or up to about 12 weeks. In some embodiments, treatment continues for about 12 weeks. In some embodiments, treatment with the methods described herein can be continued for about 1 week to about 52 weeks, about 1 week to about 26 weeks, about 1 week to about 12 weeks, about 1 week to about 6 weeks, about 6 weeks to about 52 weeks, about 6 weeks to about 26 weeks, or about 12 weeks to about 52 weeks. In some embodiments, treatment with the methods described herein can be continued for more than 52 weeks.

[0462] Methods for inhibiting trimethylation of lysine 36 on histone H3 (H3K36me3) in cells In one aspect, the disclosure provides a method of inhibiting trimethylation of lysine 36 on histone H3 (H3K36me3) in a cell overexpressing WHSC1, comprising contacting the cell with a SETD2 inhibitor as described herein.

[0463] In some embodiments, overexpression of WHSC1 by the cancer is determined prior to administering the SETD2 inhibitor.

[0464] In some embodiments, the SETD2 inhibitor is a substituted indole compound as defined in the "Definitions" section of the detailed description.

[0465] In some embodiments, the SETD2 inhibitor is a compound in Table 1, or a pharma- ceutically acceptable salt thereof.

[0466] In some embodiments, the SETD2 inhibitor is not a substituted indole compound. For example, the SETD2 inhibitor may be a sinefungin derivative selected from the group consisting of N-propyl sinefungin and N-benzyl sinefungin, or any other SETD2 inhibitor described herein.

[0467] In some embodiments, inhibiting trimethylation of lysine 36 on histone H3 in a cell occurs in vitro. In some embodiments, inhibiting trimethylation of lysine 36 on histone H3 in a cell occurs in vivo. In some embodiments, the in vivo cell is in a mammal. In some embodiments, the in vivo cell is in a human.

[0468] In some embodiments, the cells are from a hematological cancer. In some embodiments, the hematological cancer is acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MCL), or idiopathic ... ZL), hairy cell leukemia (HCL), Burkitt's lymphoma (BL), Richter's transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia and angioimmunoblastic T-cell lymphoma.

[0469] In some embodiments, the hematological cancer is multiple myeloma.

[0470] In some embodiments, the multiple myeloma contains a chromosomal translocation or a chromosomal deletion.

[0471] In some embodiments, the multiple myeloma contains a chromosomal translocation.

[0472] In some embodiments, the chromosomal translocation involves chromosome 14.

[0473] In some embodiments, the chromosomal translocation is a t(4;14) translocation. In the t(4;14) translocation, the MM cells overexpress WHSC1.

[0474] In some embodiments, the chromosomal translocation is a non-t(4;14) translocation. In some embodiments, the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14) and t(6;14) translocations. In some embodiments, the non-t(4;14) MM cells do not overexpress WHSC1, but a SETD2 inhibitor can inhibit trimethylation of lysine 36 on histone H3 (H3K36me3) in the cells.

[0475] In some embodiments, the multiple myeloma contains a deletion, hi some embodiments, the deletion is selected from the group consisting of del(17p) and del(13).

[0476] In some embodiments, the cells are derived from a solid tumor, hi some embodiments, the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer.

[0477] The present invention is further illustrated by the following examples, which should not be construed as further limiting. The contents of all patent and non-patent references cited throughout this application are expressly incorporated herein by reference in their entireties. EXAMPLES

[0478] Example 1: Small molecule SETD2 inhibitors exhibit potent antiproliferative activity in t(4;14) multiple myeloma The t(4;14) chromosomal translocation is found in 15% of newly diagnosed multiple myeloma (MM) patients and is associated with high risk and poor prognosis. t(4;14) MM cells are known to overexpress WHSC1, a histone methyltransferase (HMT), which leads to deregulation of gene expression by increased dimethylation of histone H3 at lysine 36 (H3K36me2). Another HMT, SETD2, is the only enzyme capable of trimethylation of H3K36 (H3K36me3). Because t(4;14) MM overexpresses WHSC1, resulting in ubiquitous 3K36me2 (dimethylation), this example evaluates whether t(4;14) MM is dependent on H3K36me3 catalyzed by SETD2. Also in this example, a panel of MM cell lines, with and without the t(4;14) translocation, was tested against small molecule inhibitors of SETD2. t(4;14) multiple myeloma cell lines showed substantial loss of proliferation / viability in response to the SETD2 inhibitor Compound No. 15 compared to non-t(4;14). Finally, this example shows robust tumor growth regression by Compound No. 15 in a KMS11 t(4;14) xenograft model, indicating that SETD2 is a viable therapeutic target in t(4;14) MM.

[0479] Materials and Methods Tissue cultures and cell lines The cell lines used in this example were obtained from the following sources and cultured according to conditions specified by their respective cell banks: A549 (CCL-185), MM.1R (CRL-2975), MM.1S (CRL-2974), NCI-H929 (CRL-9068), U266B1 (TIB-196) and RPMI-8226 (CCL-155) were obtained from ATCC (Manassas, VA, USA). KMS-12-BM (ACC-551), LP-1 (ACC-41), OPM-2 (ACC-50), EJM (ACC-560), MOLP-2 (ACC-607), MOLP-8 (ACC-569), AMO-1 (ACC-538), L363 (ACC-49), SK-MM-2 (ACC-430), and SK-MM-1 (ACC-758) were obtained from DSMZ (Braunschweig, Germany). KMS-28-BM (JCRB1192), KMS-26 (JCRB1187), KMS-34 (JCRB1195), KMS-11 (JCRB1179), Delta-47 (JCRB1344), and KMM-1 (JCRB1180) were obtained from JCRB (Osaka, Japan), and PCM6 (RCB1460) was obtained from RIKEN (Tsukuba, Japan). All cells were maintained in a humidified incubator set at 37°C and 5% CO2.

[0480] Western blot analysis Whole cell lysates were prepared using 1x NP40 buffer (ThermoFisher Scientific, FNN0021) supplemented with 1 mM PMSF and Halt™ protease inhibitor cocktail (ThermoFisher Scientific, 78440). Cells were pelleted, washed with ice-cold 1x PBS, resuspended in ice-cold NP40 buffer, incubated on ice for 30 min, and then sonicated (Amplitude 30% / 5 sec x 1). Lysates were centrifuged at 13,200 rpm for 10 min at 4°C and normalized for protein concentration by Pierce BCA Protein Assay Kit (ThermoFisher Scientific, 23225). Twenty-five micrograms of lysates were resolved on a 4-12% Bis-Tris protein gel (ThermoFisher Scientific, WG1402BOX) and transferred using iBlot (program 3-7 min, nitrocellulose transfer stack). Blots were probed overnight (O / N) with the following primary antibodies in Odyssey Blocking Buffer (LI-COR Biosciences, 927-40000) with 0.1% Tween® 20 (v / v): rabbit anti-tri-methylhistone H3 (Lys36) (D5A7) antibody (Cell Signaling Technology, 4909S, 1:1,000 dilution), rabbit anti-di-methylhistone H3 (Lys36) (C75H12) antibody (Cell Signaling Technology, 2901S, 1:1,000 dilution), and mouse anti-histone H3 (Cell Signaling Technology, 3638S, 1:20,000 dilution). Membranes were probed with IRDye800CW donkey anti-rabbit IgG (LI-COR Biosciences, 926-32213, 1:20,000 dilution) and IRDye680RD donkey anti-mouse IgG (LI-COR Biosciences, 926-68072, 1:20,000 dilution) secondary antibodies for 1 hour. Blots were imaged using an Odyssey Imaging System (LICOR Biosciences).

[0481] Individual sgRNA CRISPR infection Lentivirus, a single expression system containing Cas9 and sgRNA for all targets, was purchased from Cellecta, Inc. The sequences for the sgRNAs are as follows: WHSC1-1 sgRNA-CCCATTCACTGTCCACTTGA (SEQ ID NO: 5) and WHSC1-2 sgRNA-CCCTCAAGTGGACAGTGAAT (SEQ ID NO: 6). On day 0, cells were plated at 17,500 cells / cm in 100 mm culture dishes containing 10 mL of complete medium. 2 The cells were plated at a density of 1000 x 1000 and incubated at 37°C with 5% CO2 for 24 hours. After 24 hours, the cells were infected with sgRNA at MOI 3 in the presence of 5ug / mL polybrene (Millipore, no. TR-1003-G). Virus media was removed 24 hours post-infection and selection with puromycin (1ug / mL) was started 48 hours post-infection. Infected cells were cultured under puromycin selection for 30 days.

[0482] Intracellular Western Assay A549 cells were maintained in growth medium (F12K supplemented with 10% v / v heat-inactivated fetal bovine serum and 100 units / mL penicillin-streptomycin) and cultured at 37° C. under 5% CO2. Compounds were added directly to poly-D-lysine coated 384-well culture plates. Cells were seeded at a density of 80,000 cells per mL (4,000 cells / well) in assay medium and added to the plates in a volume of 50 μL per well. The plates were left on the benchtop for 20 minutes to allow the cells to settle on the bottom of the wells. The plates were incubated for 3 days at 37° C., 5% CO2. After 3 days of incubation, the medium was removed from the plates and the cells were permeabilized with ice-cold 100% methanol. The plates were incubated for 30 minutes and then washed with 1×PBS-Tween® 20 (0.5%). Plates were then blocked with Odyssey blocking buffer (LI-COR Biosciences, 927-40000) for 1 hour at room temperature. Blocking buffer was removed and 20 μL of primary antibody (rabbit anti-tri-methyl histone H3 (Lys36) (D5A7) antibody, Cell Signaling Technology, 4909S, 1:1,000 dilution) was added per well in Odyssey buffer with 0.1% Tween® 20 (v / v) and plates were incubated overnight (16 hours) at 4°C. The plates were washed with 1×PBS-Tween® 20 (0.5%), then 20 μL of secondary antibody (IRDye800CW goat anti-rabbit IgG (H+L), LI-COR Biosciences, 926-32211, 1:500 dilution), (DRAQ5 antibody, Cell Signaling Technology, 4048L, 1:1000 dilution) was added per well in Odyssey buffer with 0.1% Tween® 20 (v / v) and incubated for 1 hour at room temperature. The plates were first washed with 1×PBS-Tween® 20 (0.5%) and then with water. The plates were imaged on an Odyssey Imaging System (LI-COR Biosciences) using both the 700 nm and 800 nm channels.The ratio for each well was calculated by dividing the 800 nm (H3K36me3) value by the 700 nm (DRAQ5) value. Percent inhibition values ​​were then calculated using the average of the test sample ratios and the positive and negative control ratios.

[0483] In vitro long-term proliferation (LTP) assay Long-term proliferation assay plating densities for each suspension cell line were determined based on growth curves (measured by calcein AM cell viability) and density over a 4-day time course. On day 0, cells were plated in triplicate in 96-well plates and were either untreated, DMSO treated, or treated with compound #15 starting at 10 μM and decreasing in 3-fold dilutions. Plates were read on an Acumen on days 0, 4, 7, 11, and 14 using calcein AM (Invitrogen, C3099). Cells from each treatment were counted and replated at the original seeding density on days 4, 7, and 11 in triplicate in 96-well plates. The replated cells were re-treated with compound using the same dilution scheme as above. The average of the triplicates was used to plot proliferation over time and IC 50 values ​​were calculated.

[0484] Dose range finding study All procedures related to the handling, care, and treatment of animals in this study were performed in accordance with guidelines approved by the Institutional Animal Care and Use Committee of Pharmaron, Beijing, China, and in accordance with the guidance of the Association for Assessment and Accreditation of Laboratory Animal Care.

[0485] NOD SCID mice aged 6-8 weeks were purchased from Beijing HFK Bioscience Co.,Ltd. Mice were housed in polycarbonate cages maintained at a temperature of (22+ / -3°C) and a relative humidity of 40-70%. Animals had free access to sterile drinking water and radiation-sterilized dry granular food throughout the study. Mice were randomly assigned to dose groups based on body weight so that each treatment group had the same average body weight. Compound or vehicle was administered by oral gavage twice daily (every 12 hours) or once daily at the indicated doses (n=4, 0.5% NaCMC+0.1% Tween®-80 in water vehicle; n=7 for compound no. 15 dose group). Each dose was delivered in a volume of 10 mL / kg. Body weights were measured daily over 7 days, and mice were evaluated for abnormal clinical signs. For pharmacokinetic analysis, plasma samples were collected from dose groups at specific time points throughout the 7-day study and biochemical analyses were performed.

[0486] xenograft research KMS11 xenograft KMS11 cells were harvested during exponential growth phase and mixed in a 1:1 ratio of RPMI-1640:Matrigel. NOD SCID mice were cultured at 1 × 10 7 Each mouse received 0.1 mL of cell suspension subcutaneously in the right flank area. Seven days later, the mice were 3 Mice bearing tumors of 117–119 mm 3Mice were sorted into treatment groups with mean tumor volume (n=10 mice per group) of 1000 mg / kg / day. Compound #15 or vehicle (0.5% NaCMC+0.1% Tween®-80 (v / v) in water) was administered twice daily (every 12 hours) or once daily at the indicated doses by oral gavage. Each dose was delivered in a volume of 10 mL / kg and adjusted for the last recorded weight of each individual animal. The maximum treatment length was 28 days. Tumor volumes (twice weekly) and body weights (daily) were recorded throughout the experiment. Mice were sampled in a pre-specified manner on days 7 or 28 during the study. Sampling included non-terminal retro-orbital bleeding and terminal cardiac puncture under CO2 anesthesia to obtain a full volume of blood. Blood samples were processed for plasma with K2-EDTA as anticoagulant and PBMCs were isolated. Samples were frozen at -80°C and stored prior to analysis. Tumors were harvested from designated mice under ribonuclease-free conditions and flash-frozen in liquid nitrogen. Bone marrow was flushed from femurs using 1×PBS, strained on a 40um nylon strainer, and flash-frozen. Histones were extracted from tumors, bone marrow, and PBMCs as previously described. See Daigle et al. Cancer Cell 20:53-65 (2011).

[0487] MM.1S xenograft CB17SCID mice were inoculated with MM.1S tumor cells (5 × 10 6 ) was inoculated subcutaneously into the right flank area. After 18 days, the tumor size was 100-150 mm. 3 Mice bearing tumors of 103 mm 3Mice were sorted into treatment groups with mean tumor volume of 1000 mg / kg (n=10 mice per group). Compound #15 or vehicle (0.5% NaCMC+0.1% Tween®-80 (v / v) in water) was administered twice daily (every 12 hours) at the indicated doses by oral gavage. Each dose was delivered in a volume of 10 mL / kg and adjusted for the last recorded weight of each individual animal. The maximum treatment length was 23 days. Tumor volumes and body weights were recorded twice weekly throughout the experiment. Mice were sampled in a pre-specified manner on days 18 or 41 of the study. Sampling included full volume blood collection by non-terminal retro-orbital bleeding and terminal cardiac puncture under CO2 anesthesia. Blood samples were processed for plasma with K2-EDTA as anticoagulant and PBMCs were isolated. Samples were frozen at -80°C and stored prior to analysis. Tumors were harvested from the indicated mice under ribonuclease-free conditions and flash frozen in liquid nitrogen. Bone marrow was flushed from femurs using 1×PBS, strained onto a 40um nylon strainer, and flash frozen. Histones were extracted from tumors, bone marrow, and PBMCs as previously described in Daigle et al., Cancer Cell 20:53-65 (2011).

[0488] Fluorescence-based ELISA assay (Fluorescence Immunoassay (FIA) detection of anti-histone H3 tri-methyl K36) Histone concentrations were determined with the Pierce BCA Protein Assay Kit (ThermoFisher Scientific, 23225). Histones were prepared in coating buffer and added directly to high-binding 96-well plates. Plates were left overnight at 4°C to allow the histones to adhere. The next morning, the coating buffer with histones was discarded and 100 μL of the primary antibody solution per well, (anti-histone H3 tri-methyl K36 (Epigentek, 4042-050, 1:100 dilution) and total histone H3 (Cell Signaling Technology, 14269, 1:500 dilution) in Odyssey buffer with 0.1% Tween® 20 (v / v) was added to the plate and incubated for 1 h. The plate was washed 3 times with 1×PBS-Tween® 20 (0.5%) wash buffer. Then, 100 μL of the secondary solution antibodies per well were added, IRDye800CW donkey anti-rabbit IgG (H+L) antibody (LI-COR Biosciences, 926-32213, 1:200 dilution) and donkey anti-mouse IgG (H+L) Alexa Fluor 470 antibody in Odyssey buffer with 0.1% Tween® 20 (v / v). Fluor680 conjugate (Life Technologies, A10038, 1:1000 dilution) was incubated for 1 hour at room temperature in the dark. Plates were washed 3 times with 1x PBS-Tween® 20 (0.5%) wash buffer and then filled with 100 μL of 1x PBS-Tween® 20 (0.5%) per well, avoiding direct exposure to light as much as possible. Plates were imaged on an Odyssey Imaging System (LI-COR Biosciences) using both 700 nm and 800 nm channels. The average ratio value for each test sample was calculated by dividing the 800 nm (H3K36me3) value by the 700 nm value (total H3) and used to determine the percentage of H3K36me3 from vehicle.

[0489] result Small molecule inhibition of SETD2 is enhanced in t(4;14) cell lines It was hypothesized that the dependency of t(4;14) on the catalytic activity of WHSC1 indeed reflects a subsequent dependency on SETD2 activity. To test this, we utilized compound no. 15, a small molecule inhibitor of SETD2, to investigate the effect of SETD2 inhibition in the context of multiple myeloma. A panel of 22 human myeloma cell lines was examined for the phenotypic effects of treatment with this compound. These cell lines, representing a wide range of MM translocations, were subjected to long-term proliferation assays over a 14-day period to assess the antiproliferative effects (Figure 1A). Compound no. 15 showed higher activity in the t(4;14) subset of MM.

[0490] To further explore the effect of SETD2 inhibition in the t(4;14) setting, the MM cell line, KMS34, was selected for follow-up assays. Compound #15 showed an IC of 80 nM. 50 Compound #15 inhibited the growth of KMS-34 line in vitro in a dose-dependent manner with H3K36me3 reduction by treatment, while H3K36me2 remained unchanged (Figure 2B). To confirm that the activity of compound #15 was on target, we compared it with three less active enantiomers from the same chemical series. Compound #15 showed biochemical activity against SETD2 protein as well as reduction in methyl marks and growth defects, while none of the less active enantiomers showed activity by these measures (Figure 2C). Structure-activity relationships (SAR) were further tested with a panel of 17 compounds with a range of biochemical potencies, showing a direct correlation between H3K36me3 inhibition and in vitro growth effects (Figure 2D). In summary, small molecule inhibition of SETD2 dose-dependently inhibited proliferation in t(4;14) MM lines, indicating that this effect was targeted.

[0491] In some embodiments, response to SETD2 inhibition in t(4;14)MM depends on WHSC1 overexpression Given the enhanced SETD2 inhibition in cell lines containing the t(4;14) translocation, efforts have been made to understand the relationship between WHSC1 overexpression and SETD2 inhibition. Two isogenic variants of KMS11 cells, TKO and NTKO, previously characterized by Kuo, AJ et al., Mol. Cell. 44:609-620 (2011), were subjected to long-term proliferation assays. NTKO cells express only the translocated WHSC1 allele. Meanwhile, TKO cells express only the non-translocated allele of WHSC1. As a result, NTKO cells overexpress WHSC1, while TKO cells lack WHSC1 overexpression driven by the t(4;14) translocation. After 14 days of treatment with compound no. 15, both the parental line expressing the translocated allele and the NTKO line showed IC of 360 nM and 361 nM, respectively. 50 Conversely, TKO lines expressing only the non-translocated allele showed no growth effect in response to compound no. 15 (Figure 3A). Methyl mark assessment showed that H3K36me3 had IC values ​​of 150–250 nM for all variants. 50 We found that SETD2 sensitivity in t(4;14)MM was reduced in a dose-responsive manner with increased H3K36me2 methylation. Furthermore, assessment of the H3K36me2 methyl mark confirmed that only parental and NTKO lines had elevated levels of H3K36me2 and exhibited WHSC1 overexpression (Figures 3B, 3C). These results suggest that SETD2 sensitivity in t(4;14)MM is determined by WHSC1 overexpression.

[0492] Additionally, we used CRISPR knockout of WHSC1 to further explore the dependence of WHSC1 overexpression on sensitivity to SETD2 inhibition in t(4;14) MM cell lines. Two t(4;14) MM cell lines were selected based on their sensitivity to SETD2 inhibition. KMS-34 cells showed an IC of 80 nM. 50 On the other hand, KMS-28-BM cells were sensitive to SETD2 inhibition with an IC 50KMS-28-BM cells were insensitive to SETD2 inhibition, with low cyclin D2 expression and KRAS mutations (Figure 1A). It was hypothesized that KMS-28-BM cells were insensitive to SETD2 inhibition because they were not dependent on t(4;14)-driven WHSC1 overexpression for survival, potentially due to other driving mechanisms, such as low cyclin D2 expression and KRAS mutations. If true, knockout of WHSC1 would not affect the proliferation or viability of these cells. Conversely, KMS-34 cells were expected to be sensitive to loss of WHSC1, given their sensitivity to SETD2 inhibition.

[0493] To test these theories, both cell lines were subjected to CRISPR knockout of WHSC1 and growth and genotype were monitored over a period of 4 weeks.Knockout of WHSC1 in KMS-28-BM cells has no effect on proliferation.On the other hand, in KMS-34 cell line, there was a significant decrease in proliferation in the WHSC1-targeted line (Figure 4A).

[0494] Genotyping of the knockout lines over time showed that more than 50% of KMS-28-BM carried out-of-frame mutations, suggesting that cells survived with loss of WHSC1. Conversely, KMS-34 genotyping showed the largest out-of-frame population at 12 days post-infection, after which positive selection against the wild-type population occurred (Figure 4B), indicating loss of cells with WHSC1 knockout and proliferation of cells that maintained WHSC1 overexpression. Together, these results suggest that sensitivity to SETD2 inhibition in t(4;14)MM is associated with a dependency on WHSC1 overexpression.

[0495] Compound No. 15 has an in vitro IC 50 is tolerated in vivo at a dose 10 times higher than that of To determine doses for in vivo efficacy studies, a dose-ranging (DRF) study was performed in the KMS11 xenograft model. IC of Compound No. 15 in vitro for KMS11 cells50 was used as a benchmark for selecting the dose used in the DRF. The pharmacokinetics in NOD SCID mice following oral administration of Compound #15 demonstrated an IC50 / KMS11 proliferation in mice up to 12 hours with BID or QD dosing. 50 The results show that SETD2 inhibitor Compound No. 15 can maintain drug levels over 10-fold higher than in NOD SCID mice (Figure 3A). No weight loss is observed at 62.5 and 125 mg / kg BID when compared to vehicle control (Figure 3B). Furthermore, modulation of H3K36me3 methyl marks in untreated bone marrow shows a substantial reduction in H3K36me3 levels in response to Compound No. 15 treatment (Figure 3C). Taken together, these results show that the SETD2 inhibitor Compound No. 15 is very well tolerated at effective concentrations in NOD SCID mice, demonstrating pharmacodynamic mark target binding in vivo.

[0496] SETD2 inhibition leads to robust tumor regression in t(4;14) MM xenograft models To determine whether the growth inhibitory effects of SETD2 inhibition observed in cell cultures could be translated to in vivo studies, the effects of treatment with Compound No. 15 on a KMS11 xenograft model were investigated. Studies were performed in NOD SCID mice bearing subcutaneous KMS11 tumors. Mice were orally administered Compound No. 15 or vehicle control for 28 days. Compound No. 15 demonstrated robust tumor regression in a dose-dependent manner with a maximum tumor inhibition of 99% at the top three doses (Figure 6A). Compound No. 15 was well tolerated with minimal effects on body weight (BW) at 31.25 mg / kg (BID for 28 days) and 62.5 mg / kg (BID for 28 days). On the other hand, 125 mg / kg (18 days BID, 7 days BID (3D-4D+)) and 175 mg / kg (11 days BID, 14 days BID (3D-4D+)) were less well tolerated and required a dosing holiday after 18 and 11 days of continuous dosing, respectively (Figure 6B). Fluorescence-based ELISA analysis of H3K36me3 on histones isolated from tumors harvested on day 28 showed complete reduction of the methyl mark at all doses (Figure 6C). Compound #15 was extremely well tolerated and showed strong antitumor activity in the KMS11t(4;14) multiple myeloma xenograft model with complete removal of the H3K36me3 methyl mark at all observed doses.

[0497] SETD2 inhibition leads to tumor regression in non-t(4;14) MM xenograft models While SETD2 inhibition clearly resulted in growth inhibition of t(4;14) MM cell lines, we also observed a response in non-t(4;14) cell lines. Given these results, compound No. 15 was tested in the non-t(4;14) MM xenograft model MM.1S. This cell line showed an IC of 382 nM for the KMS11 cell line in a long-term cell proliferation assay. 50 Compared to 3uM IC 50The mice were approximately 10-fold less sensitive to the compound, with a 1:1 ratio with a 1:1 ratio of 0.01 to 0.01 (Figure 1A). The study was performed in CB17 SCID mice bearing subcutaneous MM.1S tumors. Compound #15 or vehicle control was administered twice daily by oral gavage for 23 days. Compound #15 demonstrated tumor inhibition in a dose-dependent manner with maximum inhibition seen in the top dose group (62.5 mg / kg-85% TGI) (Figure 7A). The compound was well tolerated at all doses with minimal changes in body weight after 23 consecutive days of dosing (Figure 7B). A dose-dependent decrease in H3K36me3 methyl marks is seen in MM.1S tumor samples (Figure 7C). As expected based on the cellular LTP assay, the MM.1S xenograft model responded to treatment with Compound #15, but to a lesser extent than the KMS11 xenograft model. Tumor growth inhibition of up to 85% was seen following treatment, with near complete tumor regression observed in the KMS11 model, suggesting that SETD2 inhibition is likely most effective in the t(4;14) subset of MM, but that other MM subtypes may also be affected, albeit to a lesser extent.

[0498] The present invention has been described above using functional building blocks that illustrate the implementation of specific functions and relationships thereof. The boundaries of these functional building blocks have been arbitrarily defined herein for convenience of description. Alternative boundaries can be defined as long as the specific functions and relationships thereof are appropriately performed.

[0499] The above description of specific embodiments makes fully clear the overall nature of the present invention, that others may easily modify and / or adapt various applications of such specific embodiments by applying knowledge within the skill of the art without undue experimentation and without departing from the general concept of the present invention. Such adaptations and modifications are therefore intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It should be understood that the phraseology or terminology used herein is for purposes of description and not of limitation, as interpreted by those skilled in the art in light of the teaching and guidance. All patents and publications mentioned herein are indicative of the level of skill in the art to which this disclosure pertains. All patents and publications are incorporated herein by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

Claims

1. A composition for treating cancer in a subject in need thereof, said composition comprising a SETD2 inhibitor, wherein said cancer overexpresses WHSC1, and said SETD2 inhibitor is selected from the group consisting of the following compounds: 【Chemistry 116】 or a pharma- ceutically acceptable salt thereof.

2. The composition of claim 1 , wherein overexpression of WHSC1 by the cancer is determined prior to administering the composition.

3. The composition of claim 1 or 2, wherein the cancer that overexpresses WHSC1 is a blood cancer.

4. The blood cancers include acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia, and leukemia.

4. The composition of claim 3, wherein the leukemia is selected from the group consisting of acute eosinophilic leukemia (HCL), Burkitt's lymphoma (BL), Richter's transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B cell prolymphocytic leukemia, B cell lymphoma, MALT lymphoma, precursor T lymphoblastic lymphoma, T cell lymphoma, mast cell leukemia, adult T cell leukemia / lymphoma, aggressive NK cell leukemia and angioimmunoblastic T cell lymphoma.

5. The composition of claim 4 , wherein the hematological cancer is multiple myeloma.

6. The composition of claim 5 , wherein the multiple myeloma contains a chromosomal translocation or a chromosomal deletion.

7. The composition of claim 6 , wherein the multiple myeloma contains a chromosomal translocation.

8. The composition of claim 7, wherein the chromosomal translocation is a t(4;14) translocation.

9. The composition of claim 7, wherein the chromosomal translocation is a non-t(4;14) translocation.

10. 10. The composition of claim 9, wherein the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14) and t(6;14) translocations.

11. The composition of claim 6 , wherein the multiple myeloma contains a chromosomal deletion.

12. The composition of claim 11 , wherein the deletion is selected from the group consisting of del(17p) and del(13).

13. The composition of claim 1 or 2, wherein the cancer that overexpresses WHSC1 is a solid tumor.

14. 14. The composition of claim 13, wherein the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer.

15. The composition of any one of claims 1 to 14, wherein the subject is a human.

16. The composition of any one of claims 1 to 15, wherein the compound is formulated for systemic or local administration.

17. The composition of any one of claims 1 to 15, wherein the compound is formulated for oral, nasal, intraperitoneal or intratumoral administration.

18. The composition of any one of claims 1 to 15, wherein the compound is formulated for intravenous, intramuscular or subcutaneous administration.

19. A composition for inhibiting trimethylation of lysine 36 on histone H3 (H3K36me3) in a cell, the composition comprising a SETD2 inhibitor, the cell being contacted with the SETD2 inhibitor, wherein the cell overexpresses WHSC1, and the SETD2 inhibitor is selected from the group consisting of the following compounds: 【Chemistry 231】 or a pharma- ceutically acceptable salt thereof.

20. The composition of claim 19, wherein inhibiting trimethylation of lysine 36 on histone H3 in a cell occurs in vitro.

21. The composition of claim 19, wherein inhibiting trimethylation of lysine 36 on histone H3 in a cell occurs in vivo.

22. The composition of any one of claims 19 to 21, wherein the cells are derived from a blood cancer.

23. The blood cancers include acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), and hairy cell leukemia.

23. The composition of claim 22, wherein the cancer is selected from the group consisting of acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B cell prolymphocytic leukemia, B cell lymphoma, MALT lymphoma, precursor T lymphoblastic lymphoma, T cell lymphoma, mast cell leukemia, adult T cell leukemia / lymphoma, aggressive NK cell leukemia and angioimmunoblastic T cell lymphoma.

24. 24. The composition of claim 23, wherein the hematological cancer is multiple myeloma.

25. 25. The composition of claim 24, wherein the multiple myeloma contains a chromosomal translocation or a chromosomal deletion.

26. 26. The composition of claim 25, wherein the multiple myeloma contains a chromosomal translocation.

27. 27. The composition of claim 26, wherein the chromosomal translocation is a t(4;14) translocation.

28. 27. The composition of claim 26, wherein the chromosomal translocation is a non-t(4;14) translocation.

29. 29. The composition of claim 28, wherein the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14) and t(6;14) translocations.

30. 26. The composition of claim 25, wherein the multiple myeloma contains a chromosomal deletion.

31. 31. The composition of claim 30, wherein the chromosomal deletion is selected from the group consisting of del(17p) and del(13).

32. The composition of any one of claims 19 to 21, wherein the cells are derived from a solid tumor.

33. 33. The composition of claim 32, wherein the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer.

34. The composition of any one of claims 21 to 33, wherein the in vivo cell is in a human.

Images