Induction of myelin-forming oligodendrocytes in human cortical spheroids
A method using growth factors and hormones in neurocortical spheroids from pluripotent stem cells addresses the lack of myelinating oligodendrocytes, enabling their reproducible generation and differentiation, enhancing neural development and disease modeling.
Patent Information
- Application Number
- JP2024065390
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-07-19
- Filing Date
- 2024-04-15
- Publication Date
- 2026-04-06
- Estimated Expiration
- 2039-04-16
AI Technical Summary
Existing protocols for generating human cortical spheroids from pluripotent stem cells fail to reproducibly produce myelinating oligodendrocytes, a crucial cell type in the central nervous system, despite the generation of other neural cell types.
A method involving the generation of neurocortical spheroids from pluripotent stem cells followed by exposure to specific growth factors and hormones, such as PDGF-AA, IGF-1, and thyroid hormone, promotes the proliferation and differentiation of oligodendrocyte progenitor cells into myelinating oligodendrocytes within the spheroids.
This method enables the reproducible generation of oligodendrocytes capable of axonal myelin formation, enhancing the model's relevance for studying human neural development and disease, particularly in conditions like Pelizaeus-Merzbacher disease, and facilitating drug screening.
Smart Images

Figure 0007841017000001 
Figure 0007841017000002 
Figure 0007841017000003
Abstract
Description
Technical Field
[0001] Reference to Related Applications This international patent application claims the benefit of the filing date of U.S. Provisional Patent Application No. 62 / 658,901, filed on April 17, 2018, and U.S. Provisional Patent Application No. 62 / 700,472, filed on July 19, 2018, and the entire content of each of the above applications (including all drawings and sequence listings) is incorporated herein by reference.
[0002] Government Support This invention was made with government support under grants NS093357, NS095280, GM007250, HD084167, and CA043703 awarded by the National Institutes of Health. The government has certain rights in this invention.
Background Art
[0003] Human corticogenesis is a complex process that requires the coordinated generation, migration, and maturation of distinct cell populations. While many groups have generated oligodendrocytes by forced aggregation of neural cells during 2D culture and differentiation in vitro, hPSC-derived cortical spheroids utilize an endogenous differentiation program to recapitulate the local organization and cortical lamination present in the developing human brain.
[0004] Advances in the generation of three-dimensional (3D) tissues in vitro have improved the ability to study human neural development and disease. 3D cultures derived from human pluripotent stem cells (hPSCs) are referred to as "organoids" or "spheroids" and recapitulate complex developmental processes, cell-cell interactions, microenvironments, tissue architectures, and extended temporal dynamics that are inaccessible in conventional in vitro cultures.
Summary of the Invention
Problems to be Solved by the Invention
[0005] Several groups are developing protocols to model the coordinated rounds of cell proliferation, migration, organization, and maturation necessary for patterning the human cerebral cortex. These pluripotent stem cell-derived "cortical spheroids" have been shown to generate multiple cortical cell types (e.g., neural progenitor cells, mature neuron subtypes, and astrocytes) that establish self-organizing and functional neural networks in separate cortical layers. However, while single-cell analysis of cortical spheroids has identified transcriptional profiles suggestive of oligodendrocyte progenitor cells (OPCs) and isolated oligodendrocytes, no protocol has yet demonstrated the reproducible generation and maturation of myelinating glia and oligodendrocytes, the third major cell type of neural origin in the central nervous system (CNS). [Means for solving the problem]
[0006] In one embodiment, the present invention provides a method for generating oligocortical spheroids (OCS) from pluripotent stem cells (PSCs), comprising: a) generating neurocortical spheroids (NCS) by neurocortical pattern formation of the pluripotent stem cells; and b) exposing the neurocortical spheroids to growth factors and / or hormones of a defined oligodendrocyte lineage at a predetermined time to promote the proliferation, survival, and / or expansion of a population of native oligodendrocyte progenitor cells (OPCs) within the neurocortical spheroids, thereby generating oligocortical spheroids, wherein the oligocortical spheroids are myelin-forming oligodendrocytes capable of axonal myelin formation. The present invention provides a method comprising oligodendrocyte progenitor cells (OPCs) that can differentiate into oligodendrocytes (ODCs).
[0007] In certain embodiments, the growth factors and hormones of this defined oligodendrocyte lineage include platelet-derived growth factor (PDGF) (e.g., PDGF-AA (PDGF-AA)) and insulin-like growth factor-1 (IGF-1).
[0008] In certain embodiments, the growth factors and hormones of this defined oligodendrocyte lineage include PDGF-AA, PDGF-AB, FGF-2, VEGF, or a combination thereof, and insulin or IGF-1, or a combination thereof.
[0009] In a particular embodiment, the method further includes exposure to additional growth factors and / or hormones at predetermined timings to induce oligodendrocyte differentiation. In certain embodiments, this additional growth factor and / or hormone includes thyroid hormone (T3), clemastine, and / or ketoconazole.
[0010] In a particular embodiment, step b) is performed at a time equivalent to approximately 10 weeks after conception, or approximately 50 to 60 days after the start of step a). In certain embodiments, exposure to additional growth factors and / or hormones to induce oligodendrocyte differentiation at predetermined time points is performed at a point equivalent to approximately 14 weeks after conception, or approximately 60–70 days after the start of step a).
[0011] In certain embodiments, these pluripotent stem cells are derived from either a human embryonic stem cell lineage or an induced pluripotent stem cell (iPSC) lineage. In a particular embodiment, step b) is performed over a period of approximately 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days.
[0012] In certain embodiments, the neurocortical spheroids at the end of step a) are substantially free of oligodendrocyte lineage cells. The absence of oligodendrocyte lineage cells can be verified by any marker of oligodendrocyte lineage cells (e.g., one or more standard OPC markers such as the transcription factors OLIG2 and SOX10).
[0013] In certain embodiments, the oligocortical spheroids at the end of step b) contain substantially increased OPCs compared to neurocortical spheroids of the same age that have not been treated by step b). The increase in OPCs may be detected and / or quantified, for example, by increased immunostaining of one or more standard OPC markers. Suitable OPC markers may include OPC-specific transcription factors (e.g., OLIG2 and SOX10), oligodendrocyte membrane protein markers (e.g., proteolipidoprotein 1 (PLP1)), and transcription factors specifically expressed in oligodendrocytes in the CNS (e.g., MYRF).
[0014] In a particular embodiment, these pluripotent stem cells are iPSCs isolated from a diseased subject. According to this embodiment, OCS produced from iPSCs isolated from an affected individual may be a useful model for treating the disease.
[0015] In certain embodiments, the disease is characterized by a deficiency in myelin production or by a deficiency resulting from / related to the loss of myelin or loss of myelin function. In certain embodiments, this disease is Pelizaeus-Merzbacher disease (PMD). For example, PMD may be characterized by a deletion of the entire PLP1 locus, a duplication of the entire PLP1 locus, or a point mutation in PLP1 (e.g., c.254T>G). It may be characterized by the following.
[0016] Another aspect of the present invention provides oligocortical spheroids produced using any of the methods of the present invention. Another aspect of the present invention provides an oligocortical spheroid derived from pluripotent stem cells, comprising oligodendrocyte progenitor cells (OPCs) capable of differentiating into myelinating oligodendrocytes that can undergo axonal myelin formation.
[0017] In certain embodiments, the oligocortical spheroid further comprises myelinating oligodendrocytes capable of axonal myelin formation. Another aspect of the present invention provides a method for screening drugs effective in treating diseases characterized by defects resulting from or related to myelin production deficiency, myelin loss, or loss of myelin function, comprising the steps of: contacting each of several candidate drugs from a library of candidate drugs individually with oligocortical spheroids derived from pluripotent stem cells from an individual having the disease; and identifying one or more candidate drugs that are effective in treating the disease, by mitigating myelin production deficiency, restoring the amount and / or function of myelin, or preventing myelin loss.
[0018] In certain embodiments, the method further includes the step of administering a candidate drug identified as effective to an animal having the disease. For example, the individual having the disease may be a human, and the animal may be a mouse as a model of the disease.
[0019] Unless explicitly denied or inappropriate, any embodiment described herein may be combined with one or more other embodiments, including embodiments described only in the examples or claims. [Brief explanation of the drawing]
[0020] [Figure 1-1]Figures 1A-1F show the generation of oligodendrocytes in human cortical spheroids. Figure 1A is a schematic of spheroid generation. The protocols for generating neurocortical spheroids (NCS) and oligocortical spheroids (OCS) were identical until week 8. After that, neurocortical spheroids were grown in basic medium, while oligocortical spheroids were treated with PDGF-AA / IGF-1 from days 50-60 and with T3 from days 60-70. Oligodendrocyte differentiation was evaluated at week 14. Colors indicate neurons (reddish-purple), astrocytes (red), and OPC / oligodendrocytes (green). Figures 1B and 1C are representative fluorescence images of H7 spheroids at week 14, generated by (a) the neurocortical protocol or (b) the oligocortical protocol. Similar results were obtained from three independent batches of spheroids generated from four different strains for each protocol. Scale bar, 50 μm. Figure 1B shows that the neurocortical protocol spheroid generates neurons (neurofilaments: reddish-purple) and astrocytes (GFAP: red), but not oligodendrocytes (PLP1: green). Figure 1C shows that the oligocortical protocol spheroid generates neurons (neurofilaments: reddish-purple), astrocytes (GFAP: red), and oligodendrocytes (PLP1: green). Inset, morphology of oligodendrocytes at higher magnification. Figure 1D shows the quantification of MYRF, a nuclear marker for the oligodendrocyte lineage, in spheroids at week 14 generated with the neurocortical protocol or the oligocortical protocol and PDGF-AA and IGF-1, or T3 alone. MYRF-positive cells were counted and averaged from four planes (n=4, PDGF / IGF or T3 treatment; n=5, NCS and OCS) for each treatment condition from cell lines H7, H9, and CWRU191 (white box). Error bars, standard deviation. n=3 spheroids from the same batch were used for the externally validated strain RUES1. Figure 1E shows gene expression in neurons, astrocytes, and oligodendrocytes in neurocortical and oligocortical spheroids.The heatmap consists of 100 of the most cell-specific transcripts for each cell type. Oligodendrocyte-specific and astrocyte-specific genes are upregulated in oligocortex compared to neurocortical spheroids. Figure 1F shows neuron-specific, astrocyte-specific, and oligodendrocyte-specific gene expression from the data in Figure 1E. The boxes span the first and third quartiles and are divided at the mean, with whiskers extending to the maximum and minimum values. Figures 1E and 1F show RNA-seq from five spheroids for each condition. Significance was determined using the paired non-parametric Wilcoxon matched pairs signed-rank test. [Figure 1-2] Figures 1A–1F show oligodendrocyte generation in human cortical spheroids. Figures 1B and 1C are representative fluorescence images of 14-week-old H7 spheroids generated using (a) the neurocortical protocol or (b) the oligocortical protocol. Similar results were obtained for each from three independent batches of spheroids generated from four different strains. Scale bar, 50 μm. Figure 1B shows that neurocortical protocol spheroids generate neurons (neurofilaments: reddish-purple) and astrocytes (GFAP: red), but not oligodendrocytes (PLP1: green). Figure 1C shows that oligocortical protocol spheroids generate neurons (neurofilaments: reddish-purple), astrocytes (GFAP: red), and oligodendrocytes (PLP1: green). Inset, morphology of oligodendrocytes at higher magnification. [Figure 1-3]Figures 1A–1F show oligodendrocyte generation in human cortical spheroids. Figure 1D shows the quantification of MYRF, a nuclear marker for oligodendrocyte lineages, in spheroids at week 14 generated with a neurocortical protocol or an oligocortical protocol, and with PDGF-AA and IGF-1, or T3 alone. MYRF-positive cells were counted from four planes (n=4, PDGF / IGF or T3 treatment; n=5, NCS and OCS) for each treatment condition from cell lines H7, H9, and CWRU191, and averaged (white box). Error bars, standard deviation. n=3 spheroids from the same batch were used for the externally validated strain RUES1. Figure 1E shows gene expression of neurons, astrocytes, and oligodendrocytes in neurocortical and oligocortical spheroids. The heatmap consists of 100 of the most cell-specific transcripts for each cell type. Oligodendrocyte-specific and astrocyte-specific genes are upregulated in oligocortex compared to cortical spheroids. Figure 1F shows neuron-specific, astrocyte-specific, and oligodendrocyte-specific gene expression from the data in Figure 1E. The boxes span the first and third quartiles and are divided at the mean, with whiskers extending to the maximum and minimum values. Figures 1E and 1F show RNA-seq from five spheroids for each condition. Significance was determined using the paired non-parametric Wilcoxon matched pairs signed-rank test. [Figure 2-1]Figures 2A-2L show the maturation of oligodendrocytes in oligocortical spheroids. Figure 2A is a schematic of oligocortical spheroid generation. Same colors as in Figure 1A. Figures 2B-2D are representative fluorescence images of 20-week-old H7 oligocortical spheroids. Similar results were obtained from two independent batches of spheroids. Scale bar, 50 μm. Figure 2B shows robust generation of oligodendrocyte lineage (MYRF: magenta), early-born CTIP2-positive (yellow) neurons, and late-born SATB2-positive (cyan) neurons. Figure 2C shows linear process formation in maturing oligodendrocytes (PLP1: green). Figure 2D is an immunostaining for MBP (red), a marker for mature myelin, showing punctate MBP expression indicative of an early stage of maturation. Figures 2E-2G are representative EM of 20-week-old H7 oligocortical spheroids. EM results were obtained from a single batch of three spheroids. Scale bar, 1 μm. Figure 2E shows a cluster of neurons undergoing myelination by oligodendrocytes. Figure 2F shows an axon surrounded by multiple layers of loosely compacted myelin. Figure 2G shows a more extensive wrapping of loosely compacted myelin around the axon. Figures 2H-2J are representative fluorescence images of 30-week-old H9 oligocortical spheroids. Similar results were obtained from four spheroids from a single batch of oligocortical spheroids. Scale bar, 50 μm. Figure 2H shows the lamination and segregation of deep-layer CTIP2-positive (yellow) cortex from the superficial SATB2-positive (cyan) cortex. MYRF-positive (magenta) oligodendrocytes are scattered within the cortical layers. Figure 2I shows oligodendrocyte process (PLP1: magenta) tracks (arrows) and neuron axons (neurofilament: yellow). Figure 2J shows a higher magnification of the region boxed in Figure 2I. Figure 2K is an electron micrograph of a 30-week-old H9 oligocortical spheroid showing compact myelin around an axon. EM results were obtained from three spheroids from a single batch of spheroids. Scale bar, 1 μm. Figure 2L is a 3D reconstruction from block-face EM sections taken along the length of the axon. [Figure 2-2]Figures 2A-2L show the maturation of oligodendrocytes in oligocortical spheroids. Figure 2B shows the robust generation of early-developing neurons in the oligodendrocyte lineage (MYRF: reddish-purple), CTIP2-positive (yellow), and late-developing neurons in the SATB2-positive (blue-green) lineage. Figure 2C shows linear process formation in maturing oligodendrocytes (PLP1: green). Figure 2D is immunostaining for MBP (red), a marker of mature myelin, showing punctate MBP expression indicating the early stages of maturation. Figures 2E-2G are representative EMs of H7 oligocortical spheroids at 20 weeks. EM results were obtained from single batches of the three spheroid types. Scale bar, 1 μm. Figure 2E shows a cluster of neurons undergoing myelin formation by oligodendrocytes. Figure 2F shows an axon surrounded by multiple layers of loosely compressed myelin. Figure 2G shows a more extensive wrapping of loosely compressed myelin around the axon. [Figure 2-3] Figures 2A–2L show the maturation of oligodendrocytes in oligocortical spheroids. Figures 2H–2J are representative fluorescence images of H9 oligocortical spheroids at 30 weeks. Similar results were obtained from four spheroids from a single batch of oligocortical spheroids. Scale bar, 50 μm. Figure 2H shows the layering and separation of the cortex from the SATB2-positive (blue-green) superficial layer to the CTIP2-positive (yellow) deep layer. MYRF-positive (red-purple) oligodendrocytes are scattered within the cortical layer. Figure 2I shows the oligodendrocyte processes (PLP1: red-purple), tracks (arrows), and neuronal axons (neuronal filaments: yellow). Figure 2J shows a higher magnification of the area enclosed in the frame in Figure 2I. Figure 2K is an electron micrograph of a 30-week-old H9 oligocortical spheroid showing compact myelin around the axon. EM results were obtained from three spheroids from a single batch of spheroids. Scale bar, 1 μm. Figure 2L is a 3D reconstruction from a block plane EM section acquired along the length of the axon. [Figure 3]Figures 3A-3E show cortical patterning and organization in oligocortical spheroids. Figures 3A and 3B are representative fluorescence images of 8-week-old H7 spheroids. Figure 3A shows that at the end of early neocortical patterning, the spheroid generates a distinct population of neural progenitor cells (SOX2: yellow, and Nestin: blue) that organize into a ventricular-like zone. These cells are also the only cells that are actively dividing when labeled with Ki67 (magenta). Figure 3B shows that the TBR2-positive (blue) outer SV2-like zone appears adjacent to the Sox2-positive (yellow) ventricular-like zone. Figure 3C is a representative fluorescence image of an H7 spheroid generated by the oligocortical protocol up to PDGF-AA / IGF-1 treatment and then administered two doses of BrdU (magenta) during week 9 (days 58 and 60) to label dividing cells. BrdU-positive cells are localized in the SOX2-positive ventricular zone, which is identified as the early embryonic center. Figures 3D and 3E are representative fluorescence images of H7 spheroids generated by the neocortical protocol (Figure 3D) or the oligocortical protocol (Figure 3E), treated with BrdU during week 9 (days 58 and 60), and then maintained until week 14. Only oligocortical spheroids generate oligodendrocytes (MYRF: cyan), and many of these oligodendrocytes are double-positive for BrdU (arrow in the enlarged view of the boxed region in Figure 3E, shown on the right). Scale bar, 50 μm. [Figure 4]Figures 4A-4G show that myelinating agents promote oligodendrocyte generation in oligocortical spheroids. Figures 4A-4D are representative fluorescence images of H7 spheroids at 14 weeks treated with PDGF / IGF-1 (from days 50-60) and also with (Figure 4A) DMSO, (Figure 4B) T3, (Figure 4C) clemastine, or (Figure 4D) ketoconazole (from days 60-70). DMSO yielded fewer MYRF-positive cells, while T3, clemastine, and ketoconazole produced robust MYRF signals. Four spheroids from the same batch were used for analysis. Scale bar, 50 μm. Figure 4E shows the quantification of MYRF from Figures 4A-4D. MYRF-positive cells were counted (colored dots) in individual spheroids of n=4 for each cell lineage and averaged (white bars). Error bars, standard deviation. Significance was determined using a two-sided unpaired t-test corrected for Welch. Figures 4F-4G are representative EM images of H7 spheroids at 14 weeks. Scale bar, 500 nm. Figure 4F shows that spheroids produced with the standard oligocortical protocol (T3) show the absence of myelin. Figure 4G shows that spheroids produced with ketoconazole instead of T3 show robust production of uncompressible myelin surrounding multiple nerve axons. [Figure 5-1]Figures 5A–5N show that oligocortical spheroids reproduce the phenotype of human myelin disease. Figures 5A–5L are representative fluorescence images of oligocortical spheroids at 14 weeks. For analysis, five (Figures 5A and 5B) or four (Figures 5C–5L) spheroids were used from the same batch. Scale bar, 50 μm. Figures 5A and 5B show CWRU198 spheroids immunostained for (Figure 5A) PLP1: green or (Figure 5B) MYRF: red, revealing abundant oligodendrocytes and robust PLP1 expression. Figures 5C–5D show PLP1-deficient spheroids immunostained for (Figure 5C) PLP1: green or (Figure 5D) MYRF: red, showing the expected absence of PLP1 despite abundant MYRF-positive oligodendrocytes. Figures 5E and 5F show PLP1-duplexed oligocortical spheroids immunostained with (Figure 5E) PLP1: green or (Figure 5F) MYRF: red, demonstrating robust PLP1 expression despite a decrease in the abundance of MYRF-positive oligodendrocytes. Figures 5G and 5H show PLP1 c.254T>G spheroids immunostained with (Figure 5G) PLP1: green or (Figure 5H) MYRF: red, indicating perinuclear retention of PLP1 and a decrease in the abundance of MYRF-positive oligodendrocytes. Figures 5I and 5J show PLP1 c.254T>G oligocortical spheroids treated with GSK2656157 and immunostained with (Figure 5I) PLP1: green or (Figure 5J) MYRF: red, indicating recruitment of PLP1 to oligodendrocyte processes and rescue of MYRF-positive oligodendrocytes. Figures 5K and 5L show PLP1 CRISPR-corrected c.254TG>T oligocortical spheroids immunostained for (Figure 5K) PLP1: green or (Figure 5L) MYRF: red, demonstrating both perinuclear retention of PLP1 and salvage of oligodendrocytes. Figure 5M shows the percentage of MYRF-positive oligodendrocytes per organoid in Figures 5A–5L. MYRF-positive cells were counted (colored dots) from n=5 individual spheroids in the control line CWRU198 and n=4 individual spheroids per cell line, and averaged (white box). Error bars, standard deviation.Significance was determined using a two-sided unpaired t-test corrected for Welch. Figure 5N shows a representative EM of a PLP1 CRISPR-corrected c.254G>T oligocortical spheroid at week 30, showing compact myelin surrounding the axon. Three spheroids from a single batch were used for EM analysis. Scale bar, 1 μm. [Figure 5-2] Figures 5A–5N show that oligocortical spheroids reproduce the phenotype of human myelin disease. Figure 5M shows the proportion of MYRF-positive oligodendrocytes per organoid in Figures 5A–5L. MYRF-positive cells were counted (colored dots) from n=5 individual spheroids in the control line CWRU198 and n=4 individual spheroids per cell line and averaged (white box). Error bars, standard deviation. Significance was determined using a two-sided unpaired t-test corrected by Welch. Figure 5N is a representative EM of a PLP1 CRISPR-corrected c.254G>T oligocortical spheroid at week 30, showing compact myelin surrounding the axon. Three spheroids from a single batch were used for EM analysis. Scale bar, 1 μm. [Figure 6-1]Figures 6A-6E show the generation of oligodendrocyte precursor cells in human cortical spheroids. Figure 6A is a schematic of spheroid generation. The protocols for generating neurocortical spheroids (NCS) and oligocortical spheroids (OCS) were the same until week 8. Neurocortical spheroids were grown in basic medium, while oligocortical spheroids were treated with PDGF-AA / IGF-1 from days 50-60 to generate OPCs. The increase in OPC numbers was evaluated at the end of week 9. The colors in this schematic mimic neurons (reddish-purple), astrocytes (red), and OPCs / oligodendrocytes (green). Figures 6B-6C are representative fluorescence images of H7 spheroids at week 8 (Figure 6B) and week 9 (Figure 6C) generated using the neurocortical protocol. These spheroids do not produce OPCs (OLIG2: yellow and SOX10: reddish-purple). The scale bar is 50 μm in Figures 6B-6D. Figure 6D is a representative fluorescence image of 9-week H7 spheroids generated by the oligocortical protocol before treatment with PDGA-AA / IGF-1. These spheroids produce OPCs (OLIG2: yellow and SOX10: reddish-purple). Arrows indicate OLIG2 / SOX10 double-positive cells. Figure 6E shows the quantification of OLIG2-positive OPCs and SOX10 / OLIG2 double-positive OPCs in 9-week spheroids generated by the neurocortical protocol or the oligocortical protocol. Cells were counted from each of the three planes from five individual spheroids (colored dots) of strains H7, H9, and CWRU191 and averaged (white box). Error bars are the standard deviation, n=5 spheroids from the same batch per strain. [Figure 6-2] Figures 6A–6E show the generation of oligodendrocyte precursor cells in human cortical spheroids. Figure 6E shows the quantification of OLIG2-positive OPCs and SOX10 / OLIG2 double-positive OPCs in 9-week spheroids generated by the neurocortical protocol or the oligocortical protocol. Cells were counted from each of the three planes from five individual spheroids (colored dots) of strains H7, H9, and CWRU191 and averaged (white box). Error bars represent the standard deviation, with n=5 spheroids from the same batch per strain. [Figure 7] Figures 7A–7C show the validation of the oligocortical protocol in three additional human pluripotent strains. Figure 7A is a representative fluorescence image of PLP1 in 14-week oligocortical spheroids generated from H9, CWRU191, and RUES1. Similar results were obtained from three independent batches of spheroids from H9, CWRU191, and CWRU198, as well as from one batch from RUES1. Scale bar, 50 μm. Figure 7B is a representative fluorescence image of MYRF in 14-week oligocortical spheroids generated from H9, CWRU191, and RUES1. Similar results were obtained from three independent batches of spheroids from H9, CWRU191, and CWRU198, as well as from one batch from RUES1. Scale bar, 50 μm. Figure 7C is a schematic of MYRF quantification in Figure 1D, with a representative fluorescence image of MYRF in a single 14-week oligocortical spheroid generated from H7. Four panels (1-4) show four equally magnified, uniformly sized, and consistently distributed regions that were imaged and counted per spheroid. The reported %MYRF-positive cells per spheroid are the average of these four images. Scale bar, 50 μm. [Figure 8]Figures 8A–8C show the maturation of oligodendrocytes from additional pluripotent lineages. Figure 8A shows representative fluorescence images of MYRF and PLP1 expression in H9, CWRU191, and RUES1 oligocortical spheroids at 20 weeks. The results are representative of spheroids produced from two independent batches of lineages H9 and CWRU191, as well as from one batch of lineage RUES1. Scale bar, 50 μm. Figure 8B shows representative EM images of multiple loosely compressed myelin wraps around axons in H9 and CWRU191 oligocortical spheroids at 20 weeks. EM analysis was performed on three spheroids from the same batch for each lineage. EM analysis was not performed on RUES1. Scale bar, 1 μm. Figure 8C shows representative fluorescence images of Sox10 and MYRF expression in H7 oligocortical spheroids at 14 and 20 weeks. The results are representative of spheroids generated from two independent batches. Scale bar, 50 μm. [Figure 9] Figure 9 shows BrdU-based fate mapping of oligodendrocytes in oligocortical spheroids. Representative fluorescence images are shown of two additional H7 spheroids, two H9 spheroids, and two CWRU191 spheroids, generated with the oligocortical protocol up to PDGF-AA / IGF-1 treatment and then administered two doses of BrdU at week 9 (days 58 and 60) to label dividing cells. After the second BrdU pulse, the majority of BrdU-positive (red-purple) cells are localized together with SOX2-positive (yellow) and vimentin-positive (blue) cells. By week 14, some BrdU-labeled cells are double-positive for the oligodendrocyte marker MYRF (blue-green) (arrows in the high-magnification inset). Pulse-chase experiments were performed on single batches of spheroids from each lineage, and four spheroids per lineage were analyzed. Scale bar, 50 μm. [Figure 10]Figure 10 shows a single-cell analysis of cell populations in 12-week-old oligocortical spheroids. Shown is clustering of single-cell RNA-seq data from 12-week-old H7 oligocortical spheroids compared to single-cell human fetal brain cells generated by Nowakowski et al., 2017. A series of progenitor cell populations are evident in both datasets through visualization of progenitor cell markers vimentin, SOX2, nestin, and Sox6, but only oligocortical spheroids show evidence of the oligodendrocyte clusters (PLP1 / DM20 and OMG) that appear. Single-cell RNA-seq was performed on 10 spheroids from a single batch. [Figure 11-1] Figures 11A–11C show CRISPR correction for a single-point PLP mutation. Figure 11A is a schematic of the correction of a single-point PLP mutation (PLP1c.254T>G) in patient-derived hiPSCs using guide RNA that duplicates the mutation and a single-stranded antisense oligonucleotide donor. Figure 11B shows the Sanger sequencing trace and karyotype of the mutated parent (PLP1c.254G) lineage. Figure 11C shows the Sanger sequencing trace and karyotype of the corrected (PLP1c.254T) lineage. [Figure 11-2] Figures 11A-11C show CRISPR correction for a single PLP mutation. Figure 11B shows the Sanger sequencing trace and karyotype of the mutant parent (PLP1c.254G) line. Figure 11C shows the Sanger sequencing trace and karyotype of the corrected (PLP1c.254T) line. [Modes for carrying out the invention]
[0021] While cerebral organoids offer a system usable for studying cellular composition, interactions, and organization, they lack oligodendrocytes, the myelin-forming glial cells of the central nervous system. Described herein is a method for reproducibly generating oligodendrocytes and myelin in the ancestral "oligocortical spheroid" of human pluripotent stem cells. Molecular features consistent with maturing oligodendrocytes appear by 20 weeks of culture, with further maturation and myelin compression occurring by 30 weeks.
[0022] Myelin formation enhances the rate and extent of oligodendrocyte generation and myelin formation, and spheroids produced from patients with genetic myelin disorders reproduce human disease phenotypes.
[0023] Therefore, the method described in this subject and the oligocortical spheroids produced thereby provide a versatile platform for studying myelin formation in the developing central nervous system and offer new opportunities for disease modeling and therapeutic development.
[0024] The applicant has developed a method for reproducibly inducing oligodendrocyte progenitor cells and myelin-forming oligodendrocytes in cortical spheroids by exposure to growth factors such as PDGF, IGF-1, and T3, while preserving the overall organization and localization demonstrated in prior neuronal models. The induction of all major CNS lineages in these oligocortical spheroids provides a new opportunity to observe and disrupt human cortical development and disease.
[0025] Therefore, in one embodiment, the present invention provides a method for generating oligocortical spheroids (OCS) from pluripotent stem cells (PSCs), comprising: a) generating neurocortical spheroids (NCS) by neurocortical pattern formation of the pluripotent stem cells; and b) exposing the neurocortical spheroids to growth factors and / or hormones of a defined oligodendrocyte lineage at a predetermined timing to promote the proliferation, survival, and / or expansion of a population of native oligodendrocyte progenitor cells (OPCs) within the neurocortical spheroids, thereby generating oligocortical spheroids, wherein the oligocortical spheroids include oligodendrocyte progenitor cells (OPCs) that can differentiate into myelinating oligodendrocytes (ODCs) capable of axonal myelin formation.
[0026] In certain embodiments, the oligocortical spheroid preferably contains at least about 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30% oligodendrocyte progenitor cells (OPCs) and / or differentiated oligodendrocytes at the end of week 9, 14, or 20, preferably after the start of step a). The proportion of OPCs and / or ODCs can be measured based on the counting of cells expressing an OPC / ODC marker (e.g., MYRF or PLP1). These cells can be counted according to the method used in Figure 1D or Figure 7C (e.g., counting from four planes from four or five individual spheroids).
[0027] In certain embodiments, the growth factors and hormones of this defined oligodendrocyte lineage include platelet-derived growth factor (PDGF) (e.g., PDGF-AA (PDGF-AA)) and insulin-like growth factor-1 (IGF-1).
[0028] In certain embodiments, the growth factors and hormones of this defined oligodendrocyte lineage include PDGF-AA, PDGF-AB, FGF-2, VEGF, or a combination thereof, and insulin or IGF-1, or a combination thereof.
[0029] In a particular embodiment, the method further includes exposure to additional growth factors and / or hormones at predetermined timings to induce oligodendrocyte differentiation. Any factor known to induce oligodendrocyte differentiation from OPCs may be used in this step of the present invention. In certain embodiments, this additional growth factor and / or hormone includes thyroid hormone (T3), clemastine, and / or ketoconazole.
[0030] In a particular embodiment, step b) is performed at a time equivalent to approximately 10 weeks after conception, or approximately 50 to 60 days after the start of step a). In certain embodiments, exposure to additional growth factors and / or hormones to induce oligodendrocyte differentiation at predetermined time points is performed at a point equivalent to approximately 14 weeks after conception, or approximately 60–70 days after the start of step a).
[0031] In certain embodiments, these pluripotent stem cells are derived from either a human embryonic stem cell lineage or an induced pluripotent stem cell (iPSC) lineage. In a particular embodiment, step b) is performed over a period of approximately 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days.
[0032] In certain embodiments, the neurocortical spheroids at the end of step a) are substantially free of oligodendrocyte-derived cells. The absence of oligodendrocyte-derived cells can be verified by any marker of oligodendrocyte-derived cells. For example, the absence of oligodendrocyte-derived cells can be verified by the absence of one or more standard OPC markers such as the transcription factors OLIG2 and SOX10, or by minimal immunostaining.
[0033] In certain embodiments, the oligocortical spheroids at the end of step b) contain substantially increased OPCs compared to neurocortical spheroids of the same age that have not been treated by step b). The increase in OPCs may be detected and / or quantified, for example, by increased immunostaining of one or more standard OPC markers. Suitable OPC markers may include OPC-specific transcription factors (e.g., OLIG2 and SOX10), oligodendrocyte membrane protein markers (e.g., proteolipidoprotein 1 (PLP1)), and transcription factors specifically expressed in oligodendrocytes in the CNS (e.g., MYRF).
[0034] In a particular embodiment, these pluripotent stem cells are iPSCs isolated from a diseased subject. According to this embodiment, OCS produced from iPSCs isolated from an affected individual may be a useful model for treating the disease.
[0035] In certain embodiments, the disease is characterized by a deficiency in myelin production or by a deficiency resulting from / related to the loss of myelin or loss of myelin function. In certain embodiments, the disease is Pelizaeus-Merzbacher disease (PMD). For example, PMD may be characterized by a deletion of the entire PLP1 locus, a duplication of the entire PLP1 locus, or a point mutation in PLP1 (e.g., c.254T>G).
[0036] Another aspect of the present invention provides oligocortical spheroids produced using any of the methods of the present invention. Another aspect of the present invention provides an oligocortical spheroid derived from pluripotent stem cells, comprising oligodendrocyte progenitor cells (OPCs) capable of differentiating into myelinating oligodendrocytes that can undergo axonal myelin formation.
[0037] In certain embodiments, the oligocortical spheroid further comprises myelinating oligodendrocytes capable of axonal myelin formation. Another aspect of the present invention provides a method for screening drugs effective in treating diseases characterized by defects resulting from or related to myelin production deficiency, myelin loss, or loss of myelin function, comprising the steps of: contacting each of several candidate drugs from a library of candidate drugs individually with oligocortical spheroids derived from pluripotent stem cells from an individual having the disease; and identifying one or more candidate drugs that are effective in treating the disease, by mitigating myelin production deficiency, restoring the amount and / or function of myelin, or preventing myelin loss.
[0038] In certain embodiments, this method further includes the step of administering a candidate drug identified as effective to an animal having the disease. For example, the individual having the disease is a human. Therefore, this animal could be a mouse model for this disease.
[0039] The present invention has been generally described above, and certain features of the present invention will be described in more detail in the following sections. Generation of neurocortical spheroids (NCS) According to the method of the present invention, neurocortical spheroids can be generated from (human) pluripotent stem cells (hPSCs) by exposing a defined oligodendrocyte strain to growth factors and hormones at predetermined timings.
[0040] An exemplary 50-day protocol is incorporated herein by reference by Pasca et al., Functional cortical neurons and astrocytes from human pluripotent stem cells in This is described in 3D culture. Nat Methods 12, 671-678 (2015). Therefore, in one embodiment, neurocortical spheroids are generated from (human) pluripotent stem cells (hPSCs) according to this 50-day protocol described by Pasca et al.
[0041] In another embodiment, neurocortical spheroids are generated from (human) pluripotent stem cells (hPSCs) according to a modified version of this 50-day protocol as described by Pasca et al., as briefly described herein.
[0042] Specifically, pluripotent stem cell colonies are cultured on vitronectin (e.g., Gibco #A14700). These cell colonies are harvested at 37°C for 10 minutes using an enzyme (e.g., dispase (e.g., Gibco #17105-041)). The intact colonies are then transferred to individual hypoadherent tissue culture surfaces (e.g., S-Bio Prime #MS-9096VZ V-bottom 96-well plates) in an appropriate amount (e.g., 200 μL) of Spheroid Starter medium containing a lock inhibitor (e.g., 10 μM Y-27632 of Calbiomechem #688001), an AMP-kinase inhibitor (e.g., 10 μM Dorsopmorphin of Sigma #P5499), and a TGF-β inhibitor (e.g., 10 μM SB-431542 of Sigma #S4317).
[0043] Spheroid Starter medium can be prepared using DMEM / F12 (Invitrogen #11320-033) containing 20% knockout serum (Invitrogen #12587-010), non-essential amino acids (Invitrogen #11140050), Glutamax (Invitrogen #35050061), β-mercaptoethanol, and 100 U / mL penicillin / streptomycin.
[0044] Next, the same medium without a lock inhibitor is used for the following 5 days, after which it is replaced with Neurobasal-A based spheroid medium. Neurobasal-A spheroid medium is supplemented with B-27 serum substitute and vitamin A (Invitrogen #12587) and Glutamax (Invitrogen The medium used is Neurobasal-A medium (Invitrogen #10888022) without the addition of 100 U / mL penicillin / streptomycin (#35050061).
[0045] From day 7 to 25, 20 ng / ml FGF-2 (R&D systems #233-FB-25 / CF) and 10 ng / ml EGF (R&D systems #236-EG-200) are added to this culture medium.
[0046] The spheroids were kept in a 96-well plate for 25 days, with half of the culture medium being changed daily. Culturing: On day 25, transfer the spheroids to a very low-adhesion culture surface (e.g., a Corning #CLS3471 6-well plate) at a density of 8-10 spheroids per well and culture in this manner for the remainder of the protocol.
[0047] Furthermore, from this point onward, 1% Geltrex (Invitrogen #A15696-01) was added to the Neurobasal-A spheroid medium. Neuronal differentiation can be induced between days 27 and 41 by supplementing Neurobasal-A spheroid medium with 20 ng / ml BDNF (R&D systems #248-BD) and 20 ng / ml NT-3 (R&D systems #267-N). Half of the medium may be replaced every other day between days 17 and 41.
[0048] Formation of oligocortical spheroids (OCS) To generate oligocortical spheroids, NCS are exposed to growth factors and / or hormones of a defined oligodendrocyte lineage at specified timings to promote the proliferation, survival, and / or expansion of the native oligodendrocyte progenitor cell (OPC) population within the neurocortical spheroids.
[0049] In one embodiment, starting on day 50, 10 ng / mL of platelet-derived growth factor-AA (PDGF-AA, e.g., R&D Systems #221-AA-050) and 10 ng / mL of insulin-like growth factor-1 (IGF-1, e.g., R&D Systems #291-G1-200) are added to the culture medium, which is changed every other day for 10 days, to generate oligocortical spheroids.
[0050] The OCS thus produced contains oligodendrocyte progenitor cells (OPCs) that can differentiate into myelinating oligodendrocytes (ODCs) capable of axonal myelin formation. The OCS thus generated can be further exposed to additional growth factors and / or hormones to induce oligodendrite splitting.
[0051] In one embodiment, on day 60, 40 ng / mL 3,3',5-triiodothyronine (T3, Sigma #ST2877) is added to the culture medium, which is changed every other day for 10 days. Optionally, low molecular weight molecules may also be supplemented during this period. For example, 4 μM may be added instead of T3. Ketoconazole and 2 μM clemastine may be added. Furthermore, GSK2656157 may be added in addition to T3.
[0052] Exemplary use In validating the system described in this subject, the applicant has demonstrated its use in modeling genetic diseases and screening preclinical drugs. Using the oligocortical spheroid described in this subject, many unresolved questions have been studied, from understanding demyelination in leukodystrophy to developing remyelination strategies for treating multiple sclerosis. This system can also be used to explore fundamental questions of myelin development, myelin compression, regulation of nodule and internodal size in various neuronal classes, as well as the electrophysiology of single neurons and whole spheroids.
[0053] Localized populations of oligodendrocytes arise, migrate, and mature at separate stages during embryogenesis. In mammals, ventral-derived oligodendrocytes are one of the first populations to arise, but they are not required for proper cortical myelin formation and are largely replaced by later cortical-derived oligodendrocytes. Compared to non-human primates, the timing and duration of myelin formation differ locally in humans. Human oligocortical spheroids provide a system available for exploring these and other unique human aspects of myelin development. [Examples]
[0054] Example 1: Generation of oligocortical spheroids Described here is an exemplary protocol for generating cortical spheroids derived from (human) pluripotent stem cells (hPSCs), including oligodendrocyte progenitor cells (OPCs) and myelin-forming oligodendrocytes, through timely exposure of a defined oligodendrocyte lineage to growth factors and hormones.
[0055] First, the applicant has developed a 50-day protocol (Pasca et al., incorporated herein by reference, Functional cortical neurons and astrocytes from human pluripotent stem cells) An optimized version of the method described in 3D culture (Nat Methods 12, 671-678 (2015)) was used to generate and pattern "neurocortical spheroids." See the variation in Example 7.
[0056] Following the initial pattern formation of the neurocortex, the applicant generated "oligocortical spheroids" by treatment with platelet-derived growth factor-AA (PDGF-AA) and insulin-like growth factor-1 (IGF-1) to drive the expansion of the natural OPC population (days 50-60 = "week 9"), followed by treatment with thyroid hormone (T3) to induce oligodendrocyte differentiation, and finally myelin formation (days 60-70 = "week 10") (Figure 1A).
[0057] PDGF-AA and IGF-1 are essential developmental mitogens that promote the proliferation and survival of OPCs, and T3 modulates and induces oligodendrocyte generation from OPCs in vivo. The treatment duration was determined empirically, reflecting the early identification of OPCs and oligodendrocytes in human fetal brains at 10 and 14 weeks post-conception, respectively.
[0058] To assess inter-line variability and demonstrate the robustness of this protocol, the applicant initially developed the protocol using the human embryonic stem cell line H7 (female). Subsequently, the applicant replicated key experiments using two additional independent hPSC lines: the embryonic stem cell line H9 (female) and the in-house derived induced pluripotent stem cell (iPSC) line CWRU191 (male).
[0059] Example 2: Derivation of OPC and oligodendrocytes By the completion of cortical patterning at 8 weeks, the cortical spheroids contained very few cells within the oligodendrocyte lineage, as evidenced by minimal immunostaining for two standard OPC transcription factors, OLIG2 and SOX10 (Figure 6B-6C). However, subsequent treatment of the patterned spheroids with PDGF-AA and IGF-1 over 10 days substantially increased the number of OPCs within the oligodendrocytes compared to untreated cortical spheroids of the same age (Figure 6C-6E).
[0060] By week 14, neurocortical spheroids had generated robust populations of neurons and astrocytes, but not oligodendrocytes (Figure 1B). Oligocortical spheroids (treated with PDGF-AA / IGF-1 from days 50-60 and with T3 from days 60-70) reliably generated robust populations of oligodendrocytes across all three hPSC lines, as demonstrated by immunofluorescence for proteolipidoprotein 1 (PLP1), the most abundant oligodendrocyte membrane protein, and MYRF, a transcription factor specifically expressed in oligodendrocytes in the CNS (Figure 1C, Figures 7A-7C).
[0061] Importantly, oligocortical spheroids showed low variability between strains and spheroids in the production of MYRF-positive oligodendrocytes, as follows: 21.59%±4.9%, 20.53%±3.9%, and 18.4%±2.2% of total cells for oligocortical spheroids derived from H7, H9, and CWRU191, respectively (see Figure 7C for a summary of quantification), with n=5 spheroids per strain (Figure 1D).
[0062] In addition, robust induction of oligodendrocyte lines depended on sequential treatment with both PDGF-AA / IGF-1 and T3, because MYRF-positive oligodendrocytes were hardly produced by either treatment alone (Figure 1D).
[0063] Therefore, while the structural and cellular frameworks for oligodendrocyte generation are established through the pattern formation of the neurocortex, this experiment showed that PDGF-AA, IGF-1, and T3 are necessary for the reproducible induction of OPCs and oligodendrocytes.
[0064] To further validate the reproducibility of this approach, the protocol was replicated in an independent laboratory using an independent cell lineage, the human embryonic stem cell lineage RUES1 (male), and separate personnel and reagents. MYRF-positive cells constituted 18.36% ± 3.37% of the cells in the RUES-derived oligocortical spheroids (Figure 1D, Figures 7A-7B).
[0065] Finally, using RNA sequencing of bulk spheroids, we comprehensively evaluated the extent to which PDGF-AA / IGF-1 treatment and T3 treatment affect the transcription of neuronal, astrocyte, and oligodendrocyte genes in oligocortical spheroids compared to neurocortical spheroids of the same age. Analysis of 14-week-old spheroids regarding the expression of the most specific mRNA transcripts of 100 cell types (defined using mouse transcription data from brainrnaseq.org) showed no significant changes in the neuronal gene set, but significant upregulation of the glial heritability set (particularly that of oligodendrocyte lines) was demonstrated (Figures 1E and 1F). These data demonstrate that methods for generating oligocortical spheroids activate the comprehensive oligodendrocyte transcription program but do not explicitly alter the expression programs of other cell types (e.g., neurons) in the spheroids.
[0066] Example 3: Maturation and myelin formation of oligodendrocytes Following initial oligocortical patterning, spheroids can be maintained in basal medium for several weeks to several months. The applicant analyzed neuronal diversity and oligodendrocyte maturation at weeks 20 and 30 (Figure 2A). Spheroids at week 20 appeared relatively immature. In addition to MYRF-positive oligodendrocytes, these spheroids contained a large population of early-developing deep neurons labeled with CTIP2, and another smaller population of later-developing superficial neurons labeled with SATB2, with MYRF-positive oligodendrocytes distributed throughout (Figure 2B, Figure 8A). However, the neuronal populations showed substantial overlap, consistent with the continued migration of relatively young SATB2 cells through the deep lamina.
[0067] As oligodendrocytes mature, they extend cellular processes that track adjacent axons and give rise to myelin formation. PLP1 expression was robust as early as 14 weeks of culture, and PLP1 immunofluorescence did not resolve as distinct processes until 20 weeks (Figure 2C, Figure 8A). Furthermore, a subset of these processes began expressing myelin basic protein (MBP, Figure 2D), a marker of early myelin formation, suggesting that the oligodendrocyte processes were associating with neuronal axons. Electron microscopy observation (E From M), at 20 weeks, concentric (often unorganized) wrapping of human axons with multiple layers of uncompressed myelin was observed (Figures 2E-2G, 8B). The unorganized nature of this early oligocortical spheroid myelin may be partly attributable to the in vitro culture environment, but it shows a remarkable similarity to the earliest stages of fetal myelin formation in vivo in both humans and chickens. Importantly, despite T3 treatment and extensive oligodendrocyte maturation, the 20-week-old oligocortical spheroids also maintained a pool of SOX10-positive, MRYF-negative OPCs (Figure 8C).
[0068] At 30 weeks, the spheroids contained CTIP2-labeled and SATB2-labeled neuronal populations organized into separate cortical layers, with the SATB2 population being larger and the CTIP2 layer smaller. MYRF-positive oligodendrocytes were present both throughout these layers and as a separate layer adjacent to CTIP2 (Figure 2H). In addition, oligodendrocyte processes were further resolved as separate PLP1-positive tracts co-localizing with neuronal axons expressing neuronal filaments (Figures 2I-2J). From EM at 30 weeks, neuronal axons surrounded by compact myelin were identified (Figure 2K), and longitudinal myelin wrapping around axons was demonstrated from a series of block plane images obtained by 3D reconstruction (Figure 2L). However, at 30 weeks, the applicant was unable to identify conclusive evidence of further structural organization, such as Ranvier's nodes, likely due in part to the continued immaturity of the spheroid neurons and minimal coherent electrical activity (a problem noted in all current spheroid and organoid technologies).
[0069] In summary, these results demonstrate that early myelin formation in human neurons by human oligodendrocytes can occur in oligocortical spheroids in as little as 20 weeks, with myelin maturation, purification, and compression occurring by 30 weeks. This in vitro timing is similar to the appearance of myelin in the latter half of the third stage of human fetal development in utero, as well as the timing of maturation and myelin formation of human OPCs after transplantation into rodent CNS, suggesting the possibility of a cell-specific developmental clock for human oligodendrocyte maturation, as proposed in rodents.
[0070] Example 4: Relationship with cortical development in vivo The applicant then evaluated the development and cellular organization of the subject within oligocortical spheroids to demonstrate their relevance to in vivo human cortical development. By week 8, the spheroids contained robust populations of dividing nestin-positive and SOX2-positive neural progenitor cells, organized into SOX2-positive ventricular zones and TBR2-positive lateral subventricular zones (Figures 3A and 3B). Not all SOX2 populations surrounded ventricular spaces, and many were localized on the outer surface of the spheroids; however, the arrangement of SOX2-positive germinal centers was reminiscent of ventricular zones in the cortex. At week 9, the applicant labeled the proliferating Sox2-positive cells in these germinal centers with the thymidine analog 5-bromo-2'-deoxyuridine (BrdU) (Figures 3C and 9A) and tracked their developmental trajectories. By week 14, BrdU-labeled cells had migrated away from the germinal center and formed a distinct population from the SOX2-positive germinal zone (Figures 3D-3E, 9A). At this point, only oligocortical spheroids contained MYRF-positive OPCs, some of which were MYRF / BrdU double-positive (Figures 3E and 9A). The co-localization of MYRF with BrdU provides strong evidence that these cells originated from BrdU-labeled SOX2-positive progenitor cells found in the precursor cell zone of oligocortical spheroids.
[0071] The migration of BrdU-pulsed progenitor cells away from the germinal center suggests that oligocortical spheroids contain a series of oligodendrocytes that proliferate and differentiate. This indicates comprehensive diversity in the cellular composition and spectrum of glial maturation. To evaluate this, the applicant performed single-cell RNA-seq on oligocortical spheroids at 12 weeks, an early point immediately following PDGF-AA / IGF-1 and T3 treatment, where all populations would be represented. Cell clustering broadly distinguished glial and neuronal populations. The glial clusters included early progenitor cells (labeled with vimentin, SOX2, and nestin), OPCs (labeled with SOX6), and maturing oligodendrocytes (labeled with PLP1 and oligodendrocyte myelin glycoprotein). Growth markers were expressed throughout this cluster, and maturation markers defined distinct subpopulations at progressively different stages of development (Figure 10A). This single-cell analysis demonstrates the coexistence of distinct populations of oligodendrocytes within oligocortical spheroids at multiple developmental stages, similar to single-cell transcriptome data from human fetal cortex (Figure 10A). This suggests that oligocortical spheroids may offer a means to investigate these largely inaccessible stages of human glial development.
[0072] Example 5: Testing of myelin formation promoters in spheroids The ability to generate human oligodendrocytes capable of inducing myelin formation in human axons in vitro offers new opportunities to explore the development, diseases, and therapies of human myelin. The applicant first tested whether the human oligocortical spheroid of the subject matter reproduces the known effects of already identified myelin formation promoters.
[0073] Clemastine and ketoconazole, two FDA-approved drugs, are known to be potent stimulants of rodent oligodendrocyte generation and myelin formation in vitro and in vivo. Furthermore, clemastine was recently reported to enhance remyelin formation in a phase 2 reuse clinical trial in patients with multiple sclerosis. To evaluate the effects of these myelin-promoting agents on human oligodendrocyte generation, oligocortical spheroids were treated with PDGF-AA / IGF-1 from day 50–60, then with either DMSO, T3, clemastine, or ketoconazole from day 60–70, and subsequently returned to basal medium for 4 weeks. Quantitative analysis of MYRF-positive oligodendrocytes at week 14 revealed that clemastine (18.7% ± 2.94%) and ketoconazole (27.61% ± 5.941%), respectively, enhanced oligodendrocyte production to a level comparable to T3 (21.59% ± 4.9%) compared to the vehicle (DMSO) control (6.345% ± 1.46%) (Figures 4A-4E). Notably, when examined by EM, ketoconazole-treated spheroids also showed myelin formation by week 14 of culture, two months earlier than spheroids treated with T3 (Figures 4F-4G). These results demonstrate that clemastine and ketoconazole enhance and promote human oligodendrocyte formation and maturation, and that oligocortical spheroids provide a physiologically and species-valid preclinical model for evaluating candidate myelin therapeutics before human clinical trials.
[0074] Example 6: Spheroids reproduce the pathology of myelin damage. Oligocortical spheroids provide an unprecedented, minimally manipulated, tissue-like system for studying previously inaccessible stages of human myelin formation and the pathological processes leading to myelin disease. To test whether the system of subject matter can reproduce known cellular pathologies and dysfunctions, the applicant investigated Pelizaeus-Merzbacher disease (PMD [MIM 312080]), a monogenic leukodystrophy.
[0075] PMD is a rare X-linked disease characterized by a deficiency in myelin production. Hundreds of mutations have been identified in the causative gene PLP1 in patients exhibiting a spectrum of severity ranging from mild motor retardation and spasticity to severe hypotonia with infantile death.
[0076] The applicant has previously generated oligodendrocytes derived from PMD iPSCs from a panel of affected male patients using two-dimensional (2D) culture, demonstrating both distinct and convergent cellular phenotypes in individuals with a variety of mutations. Here, the applicant generated oligocortical spheroids from three iPSC lines with different PMD mutations (deletion of the entire PLP1 locus, duplication of the entire PLP1 locus, and a point mutation in PLP1 (c.254T>G)). Phenotypically, these patients were affected to mild (deletion), moderate (duplication), and severe (point mutation) levels. To control both the sex of origin and cell type, the applicant simultaneously generated spheroids of MYRF (18.4% ± 2.20%) and PLP1 (Figures 5A-5B) from in-house CWRU198 derived from healthy control male iPSC lines expressing them to levels comparable to the previously described control lines H7, H9, and CWRU191.
[0077] In oligocortical spheroids, the abundance of MYRF-positive oligodendrocytes was correlated with disease severity, while the degree of PLP1 expression correlated with genetic status (Figures 5C-5H). PLP1-deficient lines produced abundant MYRF-positive oligodendrocytes (15.14% ± 1.96%) despite the expected absence of PLP1 (Figures 5C-5D, 5M). Conversely, duplication lines produced abundant PLP1 signaling despite a significant decrease in MYRF-positive oligodendrocytes (11.84% ± 2.27%) compared to CWRU198 (Figures 5F, 5M) (Figure 5E).
[0078] In previous 2D cultures, oligodendrocytes with the c.254T>G point mutation showed clear perinuclear retention of PLP1, which is quenched by chemical regulation of the endoplasmic reticulum stress pathway. Oligocortical spheroids reproduced this phenotype, demonstrating frank perinuclear retention of PLP1 (Figure 5G) and the most severe reduction in MYRF-positive oligodendrocytes (9.69% ± 1.82%) (Figures 5H, 5M). Subsequent treatment of point-mutant oligocortical spheroids with GSK2656157, an inhibitor of protein kinase R-like endoplasmic reticulum kinase (PERK), improved the recruitment of PLP1 from the endoplasmic reticulum to oligodendrocyte processes (Figure 5I) and significantly increased the percentage of MYRF-positive cells (15.04% ± 1.96%) (Figures 5J, 5M). Finally, CRISPR correction of point mutations to the wild-type sequence in iPSCs before oligocortical spheroid formation (Figures 11A-11C) not only restored PLP1 recruitment to oligodendrocyte protrusions (Figure 5K), but also increased the proportion of MYRF-positive oligodendrocytes to healthy control levels (17.25±3.22%) (Figures 5L-5M) and enabled myelin production up to 20 weeks of culture (Figure 5N).
[0079] The mechanistic relationship between genotype and phenotype in PMD is not fully characterized. Current data suggest that the accumulation of excessive (e.g., duplicated) PLP1 or abnormal / misfolded (e.g., missense mutations) PLP1 leads to ER stress, cell death, and a severe patient phenotype, while PLP1 deletion exhibits better resistance, and the dichotomy between cellular abundance and PLP1 expression in oligocortical spheroids of this subject is consistent with this hypothesis. Mutation-specific pathological processes involved in neurological disorders have been analyzed in detail using brain organoids and cortical spheroids derived from hPSCs. Validating the systems of this subject could extend these efforts to a wide range of myelin diseases and initiate the exploration of patient-specific pathogenesis across the processes of oligodendrocyte birth, maturation, myelin formation, and death.
[0080] Example 7: Various Methods Pluripotent stem cell lines Healthy iPSCs (CWRU191; CWRU198) and PMD iPSCs are administered with informed consent and in the case of Western Reserve University and University Hospital Institutional. The cells were already generated after approval by the Review Board. This study also used two human embryonic stem cell (hESC) lines from the approved NIH hESC Registry: "H7" NIHhESC-10-0061 and "H9" NIHhESC-10-0062.
[0081] Oligocortical spheroid differentiation Neurocortical spheroids, as already described by the variations mentioned below (Pasca et al., Functional cortical neurons and astrocytes from human, incorporated herein by reference), are described by the variations mentioned below. Pluripotent stem cells in 3D culture. Nat Methods 12, 671-678 (2015), generated from human pluripotent stem cells.
[0082] To pattern the neurocortical spheroids, pluripotent stem cell colonies cultured on vitronectin (Gibco #A14700) were elevated for 10 minutes at 37°C using dispase (Gibco #17105-041). Intact colonies were treated with 10 μM lock inhibitor Y-27632 (Calbiochem #688001), 10 μM dorsopmorphin (Sigma #P5499), and 10 μM Spheroids were transferred to individual low-adhesion V-bottom 96-well plates (S-Bio Prime #MS-9096VZ) in 200 μL of spheroid starter medium containing SB-431542 (Sigma #S4317). The spheroid starter medium was DMEM / F12 (Invitrogen #11320-033) containing 20% knockout serum (Invitrogen #12587-010), non-essential amino acids (Invitrogen #11140050), Glutamax (Invitrogen #35050061), β-mercaptoethanol, and 100 U / mL penicillin / streptomycin. The same medium without a lock inhibitor was used for the next 5 days, after which it was replaced with Neurobasal-A based spheroid medium. The Neurobasal-A spheroid medium was Neurobasal-A medium (Invitrogen #10888022) supplemented with B-27 serum substitute and without vitamin A (Invitrogen #12587), glutamax (Invitrogen #35050061), or 100 U / mL penicillin / streptomycin. From days 7 to 25, 20 ng / ml FGF-2 (R&D systems #233-FB-25 / CF) and 10 ng / ml EGF (R&D systems #236-EG-200) were added to this medium. Spheroids were cultured in 96-well plates until day 25, with half of the medium being replaced daily. On day 25, the spheroids were transferred to ultra-low adhesion 6-well plates (Corning #CLS3471) at a density of 8-10 spheroids per well and cultured in this manner for the remainder of the protocol. From this point onward, 1% Geltrex (Invitrogen #A15696-01) was added to the Neurobasal-A spheroid medium. Neuronal differentiation was induced between days 27 and 41 by supplementing the Neurobasal-A spheroid medium with 20 ng / ml BDNF (R&D systems #248-BD) and 20 ng / ml NT-3 (R&D systems #267-N). Half of the medium was replaced every other day between days 17 and 41.
[0083] To generate oligocortical spheroids, 10 ng / mL platelet-derived growth factor-AA (PDGF-AA, R&D Systems #221-AA-050) and 10 ng / mL insulin-like growth factor-1 (IGF-1, R&D Systems #291-G1-200) were added to the medium, which was changed every other day for 10 days, starting on day 50. Then, on day 60, 40 ng / mL 3,3',5-triiodothyronine (T3, Sigma #ST2877) was added to the medium, which was changed every other day for 10 days. If used, low molecular weight drugs were supplemented during this period. 4 μM ketoconazole and 2 μM clemastine were added instead of T3. GSK2656157 was added in addition to T3.
[0084] From day 70 onward, the culture medium was changed every other day until the experiment was completed, and the spheroids were matured and maintained in Neurobasal-A spheroid medium. Independent verification We used one hESC strain, "RUES1" (NIHhESC-09-0012), from the approved NIH hESC Registry. RUES1 was cultured on Matrigel in mTeSR1 medium (Stemcell Technologies #85850) and lifted using StemPro Accutase (Thermofisher #A1110501). Oligocortical spheroid differentiation was carried out as described above, except that an N2 supplement (Thermofisher #17502048) and 25 mg / mL human insulin solution (Sigma #I9278) were used instead of KSR on days 1–7 of the differentiation protocol.
[0085] low molecule A 4 mM stock solution of ketoconazole (Sigma #K1003), a 2 mM stock solution of clemastine fumarate (Sigma #SML0445), and a 10 mM stock solution of GSK2656157 (EMD Millipore #5046510001) were prepared, aliquoted, and stored at -20°C. The low molecular weight compounds were warmed to 37°C for 20 minutes and then added to pre-warmed culture medium. Frozen aliquots were thawed no more than twice before discarding.
[0086] BrdU label To label dividing cells in spheroids, BrdU was added to the culture medium at a final concentration of 3 μg / mL on days 58 and 60. Samples were collected at week 9, 4 hours after BrdU administration on day 60. For lineage tracking experiments, BrdU-labeled spheroids were collected at week 14 and processed for immunohistochemistry.
[0087] PLP1 gene editing CRISPR-Cas9 editing of a single PLP point mutation (c.254T>G) in iPSCs was performed at the Genome Engineering and iPSC Center at Washington University in St. Louis, using a guide RNA (sequence: CCAGCAGGCGGGCCCCATAAAGG) that duplicates this mutation and a single-stranded oligonucleotide with a 25-nucleotide homology arm surrounding the mutation. Upon receipt, the mutated and corrected loci were rearranged, and both lines were karyotyped to ensure that no major genotypic abnormalities occurred during the editing process (cytophylogenetics).
[0088] immunocytochemistry Spheroids for immunohistochemistry were initially fixed with 4% ice-cold paraformaldehyde for 45 minutes, washed three times with PBS, and equilibrated overnight with 30% sucrose. These spheroids were embedded in an OCT scanner and thinned to 10 μm.
[0089] Immunohistochemistry was performed as previously described (Najm et al., Nat Methods 8, 957-962 (2011)). Briefly, sections were washed three times with PBS and then blocked for 30 minutes with PBS containing 0.1% Triton X-100 and 0.25% normal donkey serum. These sections were then incubated overnight at 4°C with the primary antibody in the blocking solution. The following primary antibodies were used: rat anti-PLP1 (1:500, AA3, donated by Wendy Macklin); rabbit anti-PLP1 (1:500, AA3, donated by Wendy Macklin); rabbit anti-PLP1 (1:500, AA3, donated by Wendy Macklin). MYRF (1:1000, provided by Dr. Michael Wegner); goat anti-SOX10 (1:250 R&D Systems AF 2864); rabbit anti-OLIG2 (1:250 Millipore AB9610); mouse anti-pan-axonal filament (1:1000, Covance #SMI311); mouse anti-MBP (1:200, Covance #Smi99); mouse anti-pan-neuronal filament (NF, 1:1000, Covance #SMI312); rabbit anti-GFAP (1:1000, Dako #Z0334); mouse anti-SATB2 (1:250 Abcam, #ab51520); rat anti-CTIP2 (1:400 Abcam #ab18465); goat anti-SOX2 (1:250 R&D Systems, #AF2018); Rabbit anti-TBR2 (1:250, Abcam, ab23345); Mouse anti-Ki67 (1:250, Millipore MAB4190); Mouse anti-nestin (1:1000 Millipore, MAB5326); Mouse anti-BrdU (1:1000, Millipore, MAB3510); Chicken anti-vimentin (1:1000 Abcam, ab24525); DAPI (1 μg / ml, Sigma #D8417).
[0090] Next, the sections were washed with PBS and incubated with secondary antibody for 2 hours. All secondary antibodies used were LifeTechnologies AlexaFluor-conjugated secondary antibody, used at a 1:500 dilution.
[0091] For immunohistochemistry of PLP1, 10% Triton solution is used before the blocking step. The initial step involved washing with PBS containing X-100 for 20 minutes. For MBP immunohistochemistry, ice-cold acetone was used for 20 minutes after the fixation step. After antigen recovery, BrdU immunohistochemistry was performed, which involved placing the slides in a sealed Coplin jar with boiling 100 mM sodium citrate buffer and allowing it to come to room temperature for 1 hour.
[0092] Spheroid sections were imaged at the Case Western Reserve School of Medicine Imaging Core using either a Leica DMi8 fluorescence microscope or a Leica Sp8 confocal microscope. Four 20× fields were imaged for each spheroid to count MYRF-positive nuclei. Two fields from the top and bottom of the spheroid, and two fields from the edge of the central region of the spheroid were quantified (see Figure 6C for an overview). The total number of DAPI-positive and MYRF-positive cells was manually counted using Adobe Photoshop or NIH ImageJ. Three to five spheroids were analyzed for each strain and each treatment condition, and t-tests were performed using Graphpad Prism to assess statistical significance between strains and between treatments.
[0093] Electron microscope observation Spheroids were fixed and processed as previously described (Najm et al., Nat Methods 8, 957-962 (2011)). Samples were fixed at room temperature for 1 hour in a fixation solution containing 4% paraformaldehyde (EMS), 2% glutaraldehyde (EMS), and 0.1 M sodium cacodylate (EMS). Subsequently, samples were osmicated, stained with uranyl acetate, and embedded in EMbed 812 (EMS). Ultrathin sections (120 nm) from each spheroid sample were observed using an ultra-high resolution (XHR) field emission scanning electron microscope with a concentric (insertable) high-energy electron detector on an FEI Helios NANOLAB™ 660 FIBSEM, and all images were acquired at high magnification (15000-35000 ×) using 4 KV and a 0.2 current landing voltage.
[0094] A series of block surface imaging and 3D reconstructions. The epoxy-embedded spheroid is prepared and mounted on a silicon wafer, and the conductive The sample was covered with silver paint. An additional iridium layer of approximately 1 nm was deposited using sputter coating (Cressington Scientific Instruments), and the sample was imaged using a Helios Nanolab 660i dual-beam microscope (FEI). Loaded into the Company. After setting the ion column and beam coincidence at eucentric height (52° tilt), a current landing of 2kV and 40pA was used for the electron beam, and then a low current of 0.23nA was used for milling after the cross-section, with the ion beam (Ga + Supported platinum was deposited as a protective layer, and excess block material was removed using a high ion beam current (30 kV, 6.5 nA).
[0095] For final surface polishing / milling, a reduced ion current (30kV, 2.8nA) was used. For imaging, Auto Slice and View G3 software (FEI Company) was used with an electron beam current of 400pA, HFW of 11.84μm, and a TLD detector with a resolution of 6144×4096, residence time of 6μs, and working distance of 4.04mm to obtain an image stock of 154 sections (pixel size: 1.97, and z=50nm). The raw images were aligned using the Fuji imaging processing package, and Imaris 9.1 software (Bitplane AG) was used for image visualization and 3D reconstruction of myelin bundles.
[0096] Sequencing and analysis of bulk RNA Four spheroids per line were collected in TriReagent (Zymo Research #R2050-1-200), and RNA was extracted according to the manufacturer's instructions. Further RNA purification was performed using the Qiagen RNeasy Plus Mini kit (Qiagen, #73404). Illumina Library A library was prepared and sequenced in 50bp paired-end mode using a HiSeq 2500 instrument at the CWRU Genomics Core facility. Reads were aligned to the hg19 genome using TopHat v2.0.6 without obtaining a reference transcriptome. Transcriptor richness from the iGenomes hg19 RefSeq reference was measured using Cufflinks v2.0.2. FPKM was quantile-normalized. Neuron-specific, astrocyte-specific, and oligodendrocyte-specific genes were defined by their expression in their respective cells (FPKM > 1) and absence in the other two lineages. Each list was reduced to the 100 genes most specific to this cell type by multiplicity changes detected in at least one spheroid sample. Differences in gene list expression were evaluated using the Wilcoxon test with Graphpad Prism.
[0097] Sequencing and analysis of single-cell RNA Ten independently generated 12-week spheroids were pooled and dissociated as previously described (Marques et al., Science 352, 1326-1329 (2016)). Briefly, the spheroids were dissociated using a Worthington Papain dissociation system (Worthington Biochemical Corp., Lakewood NJ, catalog #: LK003150) according to the manufacturer's instructions. The papain solution was oxygenated with 95% O2 and 5% CO2 before dissociation. Cell counting of the single-cell suspension was performed using a Countess Automated Cell Counter (Invitrogen), and cells were loaded for single-cell capture at a final concentration of 1,000 cells / μL.
[0098] Single cell capture, cDNA synthesis, cDNA pre-amplification, and library preparation were performed using the 10×Genomics Chromium Single Cell 3' Library and Bead Kit v2 (10×Genomics Inc, Pleasanton CA, Catalog #: 120237). 3,850 cells were used. Cells were collected and sequenced at a depth of 38,611 readouts per cell, with a median of 1,870 genes per cell. Cell Ranger Single-Cell Software Suite v2.1.0 was used for barcoding and single-cell 3' gene counting, and readouts were mapped to hg19. PCA dimensionality reduction and tSNE analysis were performed using Cell Ranger Single-Cell Software Suite v2.1.0, and data were visualized using 10×Genomics Loupe Cell Browser v2.0.0. The data in Figures 2A-2L were clustered using 10×Genomics Loupe Cell Browser v2.0.0 with K-Means clustering based on the present number of two clusters to isolate broad clusters of neurons and glial / progenitor cells. Spheroid clustering was compared to publicly available single-cell data from developing human cortex and available on UCSC Cluster Browser (bit.ly / cortexSingleCell). Figure 2 shows an oligocortical spheroid gene expression cluster heatmap, created using 10×Genomics Loupe Cell Browser v2.0.0. This heatmap represents the Log2Fold change in gene expression in each cell compared to the mean gene expression in the overall population. A comparative gene expression cluster heatmap of developing human cortex was created using UCSC Cluster Browser.
[0099] Summary of Life Science Reports Further information on the experimental design is available in the summary of the life science report. Data availability All RNA-seq data are deposited in the Gene Expression Omnibus (GEO) database under accession number GSE110006 (incorporated herein by reference).
[0100] statistics To quantify the proportion of MYRF-positive oligodendrocytes in a single spheroid, four regions (shown in Figure 7) were imaged, and the proportion of MYRF cells was averaged for each spheroid. In the case of the data shown in Figure 1, five spheroids (n=5) were analyzed similarly for each treatment group. In the case of the data shown in Figure 4, four spheroids were analyzed for each group (n=4). The data shown in Figure 5M was obtained from five spheroids (n=5) of strain CWRU198, and four spheroids were obtained from each PMD strain (n=4). A two-sided unpaired t-test corrected for Welch was performed to compare two groups at once.
[0101] Bulk RNA-seq was performed using five spheroids from each condition. Statistical significance was determined using the paired, nonparametric Wilcoxon matched-pair signed-rank test.
[0102] References 1.Kadoshima, T. et al. Self-organization of axial polarity, inside-out layer pattern, and species-specific progenitor dynamics in human ES cell-derived neocortex. Proc Natl Acad Sci USA 110, 20284-20289 (2013). 2.Lancaster, MA et al. Cerebral organoids model human brain development and microcephaly. Nature501, 373-379 (2013). 3.Pasca, AM et al. Functional cortical neurons and astrocytes from human pluripotent stem cells in 3D culture. Nat Methods 12, 671-678 (2015). 4.Camp, J.G. et al. Human cerebral organoids recapitulate gene expression programs of fetal neocortex development. Proc Natl Acad Sci U S A 112, 15672-15677 (2015). 5.Jo, J. et al. Midbrain-like Organoids from Human Pluripotent Stem Cells Contain Functional Dopaminergic and Neuromelanin-Producing Neurons. Cell Stem Cell 19, 248-257 (2016). 6.Bagley, J.A., Reumann, D., Bian, S., Levi-Strauss, J. & Knoblich, J.A. Fused cerebral organoids model interactions between brain regions. Nat Methods 14, 743-751 (2017). 7.Birey, F. et al. Assembly of functionally integrated human forebrain spheroids. Nature545, 54-59 (2017). 8.Lancaster, M.A. et al. Guided self-organization and cortical plate formation in human brain organoids. Nat Biotechnol (2017). 9.Li, Y. et al. Induction of Expansion and Folding in Human Cerebral Organoids. Cell Stem Cell 20, 385-396 e383 (2017). 10. Quadrato, G. et al. Cell diversity and network dynamics in photosensitive human brain organoids. Nature 545, 48-53 (2017). 11. Renner, M. et al. Self-organized developmental patterning and differentiation in cerebral organoids. EMBO J (2017). 12. Sloan, S.A. et al. Human Astrocyte Maturation Captured in 3D Cerebral Cortical Spheroids Derived from Pluripotent Stem Cells. Neuron 95, 779-790 e776 (2017). 13. Xiang, Y. et al. Fusion of Regionally Specified hPSC-Derived Organoids Models Human Brain Development and Interneuron Migration. Cell Stem Cell 21, 383-398 e387 (2017). 14. Nakano, T. et al. Self-formation of optic cups and storable stratified neural retina from human ESCs. Cell Stem Cell10, 771-785 (2012). 15. Pasca, S.P. The rise of three-dimensional human brain cultures. Nature553, 437-445 (2018). 16. Arlotta, P. Organoids required! A new path to understanding human brain development and disease. Nat Methods 15, 27-29 (2018). 17. Lancaster, M.A. & Knoblich, J.A. Generation of cerebral organoids from human pluripotent stem cells. Nat Protoc 9, 2329-2340 (2014). 18. Luo, C. et al. Cerebral Organoids Recapitulate Epigenomic Signatures of the Human Fetal Brain. Cell Rep 17, 3369-3384 (2016). 19. Monzel, A.S. et al. Derivation of Human Midbrain-Specific Organoids from Neuroepithelial Stem Cells. Stem Cell Reports 8, 1144-1154 (2017). 20. McMorris, F.A., Smith, T.M., DeSalvo, S. & Furlanetto, R.W. Insulin-like growth factor I / somatomedin C: a potent inducer of oligodendrocyte development. Proc Natl Acad Sci U S A 83, 822-826 (1986). 21. Noble, M., Murray, K., Stroobant, P., Waterfield, M.D. & Riddle, P. Platelet-derived growth factor promotes division and motility and inhibits premature differentiation of the oligodendrocyte / type-2 astrocyte progenitor cell. Nature 333, 560-562 (1988). 22. Barres, B.A., Lazar, M.A. & Raff, M.C. A novel role for thyroid hormone, glucocorticoids and retinoic acid in timing oligodendrocyte development. Development120, 1097-1108 (1994). 23. Jakovcevski, I., Filipovic, R., Mo, Z., Rakic, S. & Zecevic, N. Oligodendrocyte development and the onset of myelination in the human fetal brain. Front Neuroanat 3, 5 (2009). 24. Silbereis, J.C., Pochareddy, S., Zhu, Y., Li, M. & Sestan, N. The Cellular and Molecular Landscapes of the Developing Human Central Nervous System. Neuron89, 248-268 (2016). 25. Bujalka, H. et al. MYRF is a membrane-associated transcription factor that autoproteolytically cleaves to directly activate myelin genes. PLoS Biol 11, e1001625 (2013). 26. James, D., Noggle, S.A., Swigut, T. & Brivanlou, A.H. Contribution of human embryonic stem cells to mouse blastocysts. Dev Biol 295, 90-102 (2006). 27. Zhang, Y. et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci 34, 11929-11947 (2014). 28. Nevin, Z.S. et al. Modeling the Mutational and Phenotypic Landscapes of Pelizaeus-Merzbacher Disease with Human iPSC-Derived Oligodendrocytes. Am J Hum Genet 100, 617-634 (2017). 29. Weidenheim, K.M., Kress, Y., Epshteyn, I., Rashbaum, W.K. & Lyman, W.D. Early myelination in the human fetal lumbosacral spinal cord: characterization by light and electron microscopy. J Neuropathol Exp Neurol51, 142-149 (1992). 30. Szuchet, S., Nielsen, L.L., Domowicz, M.S., Austin, J.R., 2nd & Arvanitis, D.L. CNS myelin sheath is stochastically built by homotypic fusion of myelin membranes within the bounds of an oligodendrocyte process. J Struct Biol 190, 56-72 (2015). 31. Wang, S. et al. Human iPSC-derived oligodendrocyte progenitor cells can myelinate and rescue a mouse model of congenital hypomyelination. Cell Stem Cell 12, 252-264 (2013). 32. Windrem, M.S. et al. Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia. Cell Stem Cell 21, 195-208 e196 (2017). 33. Gao, F.B., Durand, B. & Raff, M. Oligodendrocyte precursor cells count time but not cell divisions before differentiation. Curr Biol 7, 152-155 (1997). 34. Raff, M.C., Lillien, L.E., Richardson, W.D., Burne, J.F. & Noble, M.D. Platelet-derived growth factor from astrocytes drives the clock that times oligodendrocyte development in culture. Nature 333, 562-565 (1988). 35. Temple, S. & Raff, M.C. Clonal analysis of oligodendrocyte development in culture: evidence for a developmental clock that counts cell divisions. Cell 44, 773-779 (1986). 36. Nowakowski, T.J. et al. Spatiotemporal gene expression trajectories reveal developmental hierarchies of the human cortex. Science 358, 1318-1323 (2017). 37. Najm, F.J. et al. Drug-based modulation of endogenous stem cells promotes functional remyelination in vivo. Nature 522, 216-220 (2015). 38. Mei, F. et al. Micropillar arrays as a high-throughput screening platform for therapeutics in multiple sclerosis. Nat Med 20, 954-960 (2014). 39. Cohen, J.A. & Tesar, P.J. Clemastine fumarate for promotion of optic nerve remyelination. Lancet 390, 2421-2422 (2017). 40. Green, A.J. et al. Clemastine fumarate as a remyelinating therapy for multiple sclerosis (ReBUILD): a randomised, controlled, double-blind, crossover trial. Lancet 390, 2481-2489 (2017). 41. Hobson, G.M. & Garbern, J.Y. Pelizaeus-Merzbacher disease, Pelizaeus-Merzbacher-like disease 1, and related hypomyelinating disorders. Semin Neurol32, 62-67 (2012). 42. Douvaras, P. et al. Efficient generation of myelinating oligoden drocytes from primary progressive multiple sclerosis patients by induced pluripotent stem cells. Stem Cell Reports 3, 250-259 (2014). 43. Axten, J.M. et al. Discovery of GSK2656157: An Optimized PERK Inhibitor Selected for Preclinical Development. ACS Med Chem Lett 4, 964-968 (2013). 44. Garbern, J.Y. Pelizaeus-Merzbacher disease: Genetic and cellular pathogenesis. Cell Mol Life Sci 64, 50-65 (2007). 45. Bershteyn, M. et al. Human iPSC-Derived Cerebral Organoids Model Cellular Features of Lissencephaly and Reveal Prolonged Mitosis of Outer Radial Glia. Cell Stem Cell20, 435-449 e434 (2017). 46. Mariani, J. et al. FOXG1-Dependent Dysregulation of GABA / Glutamate Neuron Differentiation in Autism Spectrum Disorders. Cell 162, 375-390 (2015). 47. Qian, X. et al. Brain-Region-Specific Organoids Using Mini-bioreactors for Modeling ZIKV Exposure. Cell 165, 1238-1254 (2016). 48. Pamies, D. et al. A human brain microphysiological system derived from induced pluripotent stem cells to study neurological diseases and toxicity. ALTEX 34, 362-376 (2017). 49. Kessaris, N. et al. Competing waves of oligodendrocytes in the forebrain and postnatal elimination of an embryonic lineage. Nat Neurosci 9, 173-179 (2006). 50. Miller, D.J. et al. Prolonged myelination in human neocortical evolution. Proc Natl Acad Sci U S A 109, 16480-16485 (2012). 51. Sheng, Y. et al. Using iPSC-derived human DA neurons from opioid-dependent subjects to study dopamine dynamics. Brain Behav 6, e00491 (2016). 52. Najm, FJ et al. Rapid and robust generation of functional oligodendrocyte progenitor cells from epiblast stem cells. Nat Methods 8, 957-962 (2011). 53. Trapnell, C., Pachter, L. & Salzberg, SL TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105-1111 (2009). 54. Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28, 511-515 (2010). 55. Marques, S. et al. Oligodendrocyte heterogeneity in the mouse juvenile and adult central nervous system. Science 352, 1326-1329 (2016). All references cited herein are incorporated herein by reference.
Claims
1. A method for generating oligocortical spheroids (OCS) from pluripotent stem cells (PSCs), a) A step of generating neurocortical spheroids (NCS) by forming a neurocortical pattern of the pluripotent stem cells, wherein the neurocortical spheroids (NCS) do not contain oligodendrocyte-derived cells. b) Exposing the cortical spheroids (NCS) to specified oligodendrocyte lineage growth factors and / or hormones at specified timings to promote the proliferation, survival, and / or expansion of the native oligodendrocyte progenitor cell (OPC) population within the cortical spheroids (NCS), wherein the specified oligodendrocyte lineage growth factors and hormones include platelet-derived growth factor-AA (PDGF-AA) and insulin-like growth factor-1 (IGF-1), thereby generating the oligocortical spheroids (OCS). The oligocortical spheroid (OCS) comprises oligodendrocyte progenitor cells (OPCs) that can differentiate into myelinating oligodendrocytes (ODCs) capable of axonal myelin formation, and the oligocortical spheroid (OCS) at the end of step b) contains increased OPCs compared to neurocortical spheroids (NCS) of the same age that have not been treated by step b), c) A step of inducing oligodendrocyte (ODC) differentiation by exposing the oligocortical spheroids (OCS) from step b) to additional growth factors and / or hormones at predetermined timings, The method, including the method described above.
2. The method according to claim 1, wherein the additional growth factor and / or hormone in step c) comprises thyroid hormone (T3), clemastine, and / or ketoconazole.
3. The method according to claim 1 or 2, wherein step b) is performed at a time equivalent to approximately 10 weeks after conception, or approximately 50 to 60 days after the start of step a).
4. The method according to any one of claims 1 to 3, wherein step c) is performed at a time equivalent to approximately 14 weeks after conception, or approximately 60 to 70 days after the start of step a).
5. The method according to any one of claims 1 to 4, wherein the pluripotent stem cells are derived from a human embryonic stem cell lineage or from an induced pluripotent stem cell (iPSC) lineage.
6. The method according to any one of claims 1 to 5, wherein step b) is performed over a period of approximately 10 days.
7. The method according to any one of claims 1 to 6, wherein the pluripotent stem cells are iPSCs isolated from a subject having a disease.
8. The method according to claim 7, wherein the disease is characterized by a deficiency in myelin production or by a deficiency resulting from / related to the loss of myelin or its function.
9. The method according to claim 8, wherein the disease is Pelizaeus-Merzbacher disease (PMD).
10. The method according to claim 8, wherein the PMD is characterized by deletion of the entire PLP1 locus, duplication of the entire PLP1 locus, or a point mutation in PLP1 (c.254T>G).
11. Oligocorticosteroids produced using the method according to any one of claims 1 to 10.
12. A method for screening drugs effective in treating a disease characterized by a deficiency in myelin production, comprising the steps of: contacting each of several candidate drugs derived from a library of candidate drugs individually with oligocortical spheroids (OCS) generated from pluripotent stem cells derived from an individual having the disease; and identifying one or more candidate drugs that are effective in treating the disease, thereby reducing the deficiency in myelin production, restoring the amount or function of myelin, or preventing myelin loss, wherein the OCS are generated using the method according to any one of claims 1 to 10. The aforementioned method.
13. The method according to claim 12, further comprising the step of administering a candidate drug identified as effective to an animal (excluding humans) having the aforementioned disease.
14. The method according to claim 13, wherein the animal is a mouse as a model of the disease.
Citation Information
Patent Citations
Culture methods for obtaining and maintaining pure or enriched populations of mammalian neural stem cells and / or neural progenitor cells that readily differentiate into oligodendrocyte-derived cells in vitro.
JP2014503219A
Compounds and methods of promoting myelination
WO2018022904A2
Personalized 3D neural culture system for generating human oligodendrocytes and studying myelination in vitro
WO2018191656A1