Buckwheat plants with increased urea disintegration ability
A buckwheat plant with a mutated SSIIa gene addresses the retrogradation issue by increasing urea disintegration and lowering gelatinization temperature, ensuring softness and versatility in food applications without auxiliary ingredients.
Patent Information
- Application Number
- JP2022037785
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-03-12
- Filing Date
- 2022-03-11
- Publication Date
- 2026-07-16
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Buckwheat starch tends to retrograde over time after cooking, leading to a hard and brittle texture, and the addition of auxiliary ingredients like trehalose and modified starch reduces the proportion of buckwheat flour in food, compromising its unique aroma.
Developing a buckwheat plant with a mutation in the SSIIa gene to reduce amylopectin chain length, enhancing urea disintegration and lowering gelatinization temperature, thereby maintaining food softness without additional ingredients.
The modified buckwheat plants maintain softness after cooking, expand food applications beyond noodles, and reduce cooking energy consumption by gelatinizing with less heat.
Smart Images

Figure 0007891239000004 
Figure 0007891239000005 
Figure 0007891239000006
Abstract
Description
Technical Field
[0001] The present invention relates to buckwheat plants having modified starch properties (urea-disruptibility and / or gelatinization temperature of starch).
Background Art
[0002] Cultivars of buckwheat plants classified in the Polygonaceae family include buckwheat (Fagopyrum esculentum), tartary buckwheat (F. tataricum), and perennial buckwheat (F. cymosum). In Japan, buckwheat and tartary buckwheat are mainly used as foods. Although the use of perennial buckwheat is less, it has strong waterlogging resistance and is expected to be used in the future. In addition, the use of a self-compatible buckwheat wild species (F. homotropicum) has also started. Furthermore, the use of hybrids of any of these varieties, for example, a hybrid of tartary buckwheat and perennial buckwheat (F. giganteum), a hybrid of common buckwheat and a wild species, etc. is also starting to be used.
[0003] Generally, when using grains as foods, ensuring softness after food production is one of the important factors, and starch has a great influence on them. Starch is roughly classified into amylose in which glucose is polymerized linearly and amylopectin with branched chains. In grains, when the chain length of amylopectin becomes shorter, the food remains soft even when cooled, the gelatinization temperature decreases, and the bleeding during freezing and thawing decreases.
[0004] Amylopectin chain length is elongated by starch synthase IIa (SSIIa). In rice and sweet potatoes, it is known that suppressing SSIIa expression shortens the amylopectin chain length, keeping food soft after cooking. For example, indica rice basically has active SSIIa, resulting in a long amylopectin chain length, which makes it prone to becoming dry and crumbly when cooled. Japonica rice lacks SSIIa, resulting in a short amylopectin chain length, making it less likely to harden when cooled. Methods for controlling the activity of SSIIa in rice are known (Patent Document 1). In sweet potatoes, the Konamizuki variety, which lacks SSIIa, has many short amylopectin side chains (Non-Patent Document 1), making it suitable for warabi mochi and other dishes because the food used does not harden easily when cooled (Non-Patent Document 2).
[0005] Many of the cereals in which SSIIa mutations have been reported are grasses, which are monocots. Specifically, these include rice, wheat, barley, maize, sorghum, millet, foxtail millet, and adlay. In wheat, wheat flour prepared from wheat lacking the enzymatic activity of two GBSSIs and two SSIIa genes, and foods using this flour (Patent Documents 2-6), are known, and DNA markers for SSIIa mutant selection and analysis of the starch properties of SSIIa mutants have also been conducted (Non-Patent Document 3). In dicotyledonous plants, there is a report on sweet potato of the Convolvulaceae family (Non-Patent Document 4). [Prior art documents] [Patent Documents]
[0006] [Patent Document 1] Japanese Patent Publication No. 2005-269928 [Patent Document 2] Japanese Patent Publication No. 2013-188206 (Patent No. 6226165) [Patent Document 3] Japanese Patent Publication No. 2015-033357 [Patent Document 4] Japanese Patent Publication No. 2015-033358 [Patent Document 5] Japanese Patent Publication No. 2015-033361 [Patent Document 6] Japanese Patent Publication No. 2015-0333562 [Non-patent literature]
[0007] [Non-Patent Document 1] Kenji Katayama, Tetsufumi Sakai, Yumi Kai, Yoshinori Nakazawa, and Yu Yoshinaga. Development of a new sweet potato variety, "Konamizuki". Report of the Kyushu Okinawa Agricultural Research Center, 58, 15-36 (2012). [Non-Patent Document 2] https: / / www.naro.affrc.go.jp / project / results / research_digest / digest_kind / digest_poteto / 027255.html [Non-Patent Document 3] Niihata, Tomoya. Research on the creation and characteristics of wheat starch mutants. 2014 (https: / / dl.ndl.go.jp / info:ndljp / pid / 8953018) [Non-Patent Document 4] Kenji Katayama, Seiji Tamiya1, Tetsufumi Sakai, Yumi Kai, Akiko Ohara-Takada, Toshikazu Kuranouchi and Masaru Yoshinaga; Inheritance of low pasting temperature in sweetpotato starch and the dosage effect of wild-type alleles. Breeding Science 65: 352-356 (2015) doi:10.1270 / jsbbs.65.352 [Non-Patent Document 5] Hirokazu Sato, Shinichi Saito, and Tomohiko Yoshida. Selection method for glutinous rice varieties based on glutinous rice hardening properties, gelatinization characteristics, and urea disintegration properties. Journal of the Crop Science Society of Japan, 74(3), 310-315 (2005) doi:10.1626 / jcs.74.310 [Overview of the Initiative] [Problems that the invention aims to solve]
[0008] In Japan, buckwheat is commonly used as noodles, but the starch tends to retrograde over time after cooking, resulting in a poor texture (hard and brittle). Buckwheat is thought to have a longer amylopectin chain length compared to Japonica rice and the sweet potato variety Konamizuki, which lack SSIIa, due to the action of SSIIa. While there are techniques to keep the food soft after cooking by adding trehalose and modified starch as auxiliary ingredients in buckwheat noodles, the degree of improvement is not sufficient. Furthermore, the unique aroma of buckwheat is an important quality characteristic, but the addition of auxiliary ingredients relatively reduces the proportion of buckwheat flour in the food.
[0009] To date, there have been no efforts to shorten the amylopectin chain length in buckwheat, and there is no knowledge as to whether suppressing or knocking out SSIIa expression actually alters the properties of starch in buckwheat. [Means for solving the problem]
[0010] Shorter amylopectin chain lengths in starch can be detected as differences in urea disintegration, that is, differences in the degree to which amylopectin is solubilized in the presence of urea. In other words, for example, when starch is disintegrated (solubilized) in the presence of 2M urea, short-chain amylopectin is more easily solubilized than long-chain amylopectin. Therefore, the amylopectin chain length can be measured by comparing the soluble fractions after they exhibit color changes using the iodine-starch reaction (Non-Patent Literature 5).
[0011] If the urea-disintegrating properties of buckwheat can be increased, it is possible to keep cooked foods soft, and by modifying its physical properties, its use can be expanded to food applications other than noodles.
[0012] The inventors have now obtained a buckwheat plant from among buckwheat plants that have undergone mutation treatment, in which a mutation in the SSIIa gene has occurred, resulting in lower urea disintegration properties and gelatinization temperature compared to the wild type, and have completed the present invention.
[0013] The present invention provides the following: [1] A buckwheat plant lacking starch synthase (SSIIa) activity. [2] The buckwheat plant described in 1, wherein the deficiency of SSIIa activity is selected from the group consisting of splicing mutations, stop codon insertion mutations, amino acid deletion mutations, and amino acid substitution mutations in the SSIIa gene. [3] A buckwheat plant described in 1 or 2, wherein SSIIa is SSIIa2. [4] A plant of the genus Buckwheat having any of the following polynucleotides: (a) A polynucleotide consisting of the sequence of sequence number 2. (b) A polynucleotide having 80% or more sequence identity with the polynucleotide consisting of the sequence of SEQ ID NO: 2, and having a deletion in any of the nucleotides corresponding to positions 577-585 of SEQ ID NO: 3. [5] A plant of the genus Fagopyrum described in any one of items 1 to 5, wherein the plant is buckwheat (Fagopyrum esculentum), Tartary buckwheat (F. tataricum), perennial buckwheat (F. cymosum), or wild buckwheat (F. homotropicum), or a hybrid of any of these. [6] The plant body of a buckwheat plant as described in any one of items 1 to 6. [7] A method for breeding buckwheat plants, including using the plant described in 6 or its progeny. [8] The harvested products, propagating materials, or processed products of the plant described in 7. [9] A method to increase the urea disintegration of buckwheat plants by inhibiting the activity of any of the following proteins: (A) A protein consisting of one of the amino acid sequences from Sequence ID No. 9 to 15; (B) A protein consisting of an amino acid sequence having 90% or more identity with any one of the amino acid sequences of SEQ ID NOs: 9 to 15 and having a function of controlling the urea degradability of buckwheat plants; (C) A polynucleotide encoding an amino acid sequence in which 1 to 60 amino acids are deleted, substituted or added in any one of the amino acid sequences of SEQ ID NOs: 9 to 15 and having a function of controlling the urea degradability and gelatinization temperature of starch in buckwheat plants.
[10] The method according to 9, wherein suppressing the activity of the protein is suppressing the activity of any of the following proteins: (A’) A protein consisting of any one of the amino acid sequences of SEQ ID NOs: 9, 11, and 13; (B’) A protein consisting of an amino acid sequence having 90% or more identity with any one of the amino acid sequences of SEQ ID NOs: 9, 11, and 13 and having a function of controlling the urea degradability of buckwheat plants; (C’) A polynucleotide encoding an amino acid sequence in which 1 to 60 amino acids are deleted, substituted or added in any one of the amino acid sequences of SEQ ID NOs: 9, 11, and 13 and having a function of controlling the urea degradability of buckwheat plants.
[11] A buckwheat plant, or its seeds or powder, satisfying at least one of the following: · The urea degradability is 1.5 times or more compared to the wild type. · The peak gelatinization temperature is 95% or less compared to the wild type.
[0014]
[12] A kit for determining a buckwheat plant lacking SSIIa activity, comprising any of the following primer pairs: (a) A pair of an oligonucleotide primer consisting of the sequence of SEQ ID NO: 20 and an oligonucleotide primer consisting of the sequence of SEQ ID NO: 21; (b) A pair of oligonucleotide primers, each having a length of 15-30 nucleotides and at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 20, and each having a length of 15-30 nucleotides and at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 21, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template; (c) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 22 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 23; (d) A pair of oligonucleotide primers, each having a length of 15 to 30 nucleotides and having at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 22, and an oligonucleotide primer having a length of 15 to 30 nucleotides and having at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 23, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template.
[13] A plant of the genus Buckwheat, or its seeds or flour, having a polynucleotide whose mutant amplified fragment can be detected by a PCR reaction using one of the following primer pairs: (a) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 20 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 21; (b) A pair of oligonucleotide primers, each having a length of 15-30 nucleotides and at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 20, and each having a length of 15-30 nucleotides and at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 21, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template; (c) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 22 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 23; (d) A pair of oligonucleotide primers, each having a length of 15 to 30 nucleotides and having at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 22, and an oligonucleotide primer having a length of 15 to 30 nucleotides and having at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 23, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template. [Effects of the Invention]
[0015] The buckwheat plants of the present invention can be used to obtain improved buckwheat grains and flour. The buckwheat grains and flour obtained from the buckwheat plant of the present invention can be widely used in various foods, taking advantage of their improved properties.
[0016] The buckwheat grains and flour obtained by this invention allow foods to retain their softness even when cooled, without the need to add auxiliary ingredients such as trehalose or modified starch, and the softness of the food during storage can be improved. The improved starch obtained by this invention can gelatinize with less heat, thus saving energy during cooking and shortening cooking time. [Brief explanation of the drawing]
[0017] [Figure 1] Differences between the SSIIa2 sequence (SEQ ID NO: 17) of the mutant buckwheat plant "18AS29" and the wild-type sequence (SEQ ID NO: 16). In mutant 18AS29, there is a deletion in the SSIIa2 gene, resulting in a deletion in the putative amino acid as well. [Figure 2] Urea disintegration in the SSIIa2 amino acid mutant line "18AS29". A statistically significant difference in the mean was observed at the 0.1% level in the t-test. [Figure 3] Comparison of urea disintegration per unit of buckwheat flour in spring-sown buckwheat cultivation (Kyushu Okinawa Agricultural Research Center) in 2021 (wild type = 1.0). 36 wild-type plants, 53 mutant plants, **: Significantly significant difference in mean values at the 1% level. [Figure 4]Comparison of urea disintegration per unit of buckwheat flour in summer-sown buckwheat cultivation (Kyushu Okinawa Agricultural Research Center) in 2021 (wild type = 1.0). 10 wild-type plants, 10 mutant plants. * * *: Significantly significant difference in mean values at the 0.1% level. [Figure 5] Determination of each genotype using primers for detecting wild-type and mutant types. [Figure 6] Determination of each genotype using primers designed to contain the mutation site in the amplified fragment. [Modes for carrying out the invention]
[0018] [New Buckwheat species] This invention provides a buckwheat plant lacking starch synthase (SSIIa) activity. Furthermore, the present invention provides a plant of the genus Buckwheat that satisfies at least one of the following conditions. • The urea-disintegrating properties of the starch are more than 1.5 times greater than those of the wild type. • The starch gelatinization peak temperature is 95% or less compared to the wild type.
[0019] (Deficiency of starch synthase (SSIIa) activity) In relation to the present invention, a deficiency in starch synthase (SSIIa) activity in plants (a state of SSIIa deficiency) means that the SSIIa protein, which has normal SSIIa activity, is not functioning within the plant body. In relation to the present invention, when referring to SSIIa in buckwheat plants, it refers to SSIIa1 and SSIIa2 unless otherwise specified.
[0020] In relation to the present invention, the statement that an SSIIa protein having normal SSIIa activity is non-functional is not limited to cases where SSIIa activity is suppressed by a specific mechanism. Activity suppression includes not only the suppression of SSIIa enzymatic activity but also the suppression of SSIIa gene expression. More specifically, activity suppression includes not only the inhibition of SSIIa activity but also mutations in the SSIIa gene that prevent the production of active SSIIa, decreased SSIIa activity, and mutations in the SSIIa gene's expression regulatory region (promoter region, transcription factor binding region, etc.) that suppress SSIIa production.
[0021] SSIIa is generally thought to be involved in the synthesis of amylopectin branched chains (glucose polymers branched by α-1,6 links), particularly chains with a moderate degree of polymerization (chains with a degree of polymerization of approximately 11 to 25). Therefore, whether or not SSIIa activity is deficient can be evaluated by the shortening of the amylopectin chain length of the starch contained in the plant compared to a plant in which SSIIa protein with normal SSIIa activity is functioning (which can be called the wild type). Furthermore, the shortening of the amylopectin chain length of the contained starch can be evaluated by the increased disintegration of urea or the lower gelatinization peak temperature, as will be described later.
[0022] In relation to the present invention, when we say that SSIIa activity is deficient (SSIIa is absent), the degree of mutation, the degree to which the amylopectin chain length is shortened, or the degree to which urea disintegration is increased are not particularly limited. For example, with respect to the urea disintegration of starch, if it is 1.5 times or more that of the wild type, the plant can be said to be deficient in SSIIa, and with respect to the gelatinization peak temperature of starch, if it is 95% or less that of the wild type, the plant can be said to be deficient in SSIIa. The measurement and calculation of urea disintegration and gelatinization peak temperature will be described later.
[0023] In a preferred embodiment, the buckwheat plant has a mutation in at least one of the SSIIa1 gene and the SSIIa2 gene. Preferably, the mutation is in the SSIIa2 gene. The sequence listing shows, as Sequence ID No. 1, the sequence of the buckwheat SSIIa2 (wild type) gene; as Sequence ID No. 2, the sequence of the buckwheat SSIIa2 (mutant type) gene obtained by the present inventors; as Sequence ID No. 3, the sequence of the buckwheat SSIIa1 (wild type) cDNA; as Sequence ID No. 4, the sequence of the buckwheat SSIIa2 (mutant type) cDNA obtained by the present inventors; as Sequence ID No. 5, the sequence of the Tartary buckwheat SSIIa2 cDNA; as Sequence ID No. 6, the sequence of the Tartary buckwheat SSIIa1 cDNA; as Sequence ID No. 7, the sequence of the perennial buckwheat SSIIa2 cDNA; and as Sequence ID No. 8, the sequence of the perennial buckwheat SSIIa1 cDNA.
[0024] Mutations that can occur in plants of the genus Buckwheat include mutations involving amino acid mutations (amino acid substitutions, amino acid insertions, amino acid deletions, stop codon insertions), splicing mutations (splicing signal mutations, genomic mutations involving splicing mutations due to intron mutations), and mutations in untranslated regions (including nucleic acid methylation) that cause changes in the expression level of gene transcripts. A specific example is a gene mutation in which a mutation occurs in the splicing signal site of SSIIa, resulting in the insertion of a stop codon into the gene transcript, which reduces the accumulation of SSIIa protein and consequently causes changes in urea disintegration.
[0025] In one preferred embodiment, buckwheat plants have a mutation in SSIIa as shown in SEQ ID NO: 2, specifically a mutation in the region corresponding to positions 565 to 597 of the putative cDNA sequence, SEQ ID NO: 3. More specifically, part or all of the region corresponding to positions 577-585 of SEQ ID NO: 3 is deleted. However, similar effects may be obtained with mutations at different positions. For example, mutations that delete or substitute cysteine residues related to the three-dimensional structure of the protein, which greatly affects activity, mutations that delete or substitute amino acids in the active site with amino acids of different polarity, or mutations that delete or substitute one or several amino acids with other amino acids of different polarity in an amino acid region that is highly conserved among plants are thought to suppress the activity of SSIIa, and similar effects can be expected with such mutations. On the other hand, in mutations where the C-terminus of SSIIa is only slightly shortened, SSIIa can still exhibit its original activity, resulting in no or minimal effect. However, a similar effect can be expected in buckwheat plants that have a polynucleotide with high identity (e.g., 80% or more) with the polynucleotide consisting of the sequence of SEQ ID NO: 2, or a polynucleotide consisting of a complementary sequence of the sequence of SEQ ID NO: 2, and that hybridizes under stringent conditions with such a polynucleotide, and which has a deletion of the nucleotide corresponding to positions 577-585 of SEQ ID NO: 3.
[0026] The presence of a gene mutation can be confirmed, for example, by the following methods. Methods for detecting the mutation include decoding the mutated base sequence itself using base sequence analysis methods such as the Sanger method or next-generation DNA analysis technology, detecting differences in the cleavage status of genomic DNA or PCR amplification fragments using restriction enzymes that recognize the base sequence, detecting differences in the base sequence using techniques such as LGC Genomics' KASP (Kompetitive Allele Specific PCR) genotyping assay or high-resolution melting curve (HRM) analysis, or PCR-SSCP (Single Nucleotide Conformation Polymorphism). Detection may also be performed using a DNA marker linked to the mutated base portion. In addition to the methods for investigating the SSIIa protein described in the examples above, methods for measuring activity and immunochemical methods (immunoblotting, immunochromatography, etc.) can be used to determine the deletion of the SSIIa protein.
[0027] Mutations in the SSIIa gene or its regulatory region may be carried out by various means. Examples of methods for obtaining buckwheat plants with mutations in the SSIIa gene or its regulatory region include selection from mutant strains, genetic engineering, RNA interference, genome editing, artificial genome synthesis, and genome methylation.
[0028] In a preferred embodiment, a method of selection from mutant strains is used because it allows for more reliable production of plant bodies.
[0029] Buckwheat plants may be bred from existing varieties or strains. Buckwheat plants obtained in this way can be distinguished from existing varieties or strains by at least one of the following characteristics: a short amylopectin chain length in the starch they contain, high urea disintegration, or a low gelatinization peak temperature.
[0030] There are no particular limitations on the varieties and lines used as starting materials when acquiring mutant strains, or the varieties and lines used in breeding. Examples of buckwheat varieties include Kitawase Soba, Botan Soba, Kitayuki, Hashikami Wase, Iwate Wase, Mogami Wase, Hashikami Wase, Hitachi Aki Soba, Shinano No. 1, Shinshu Oosoba, Shinano Natsu Soba, Fukui Zairaishu, Kochi Zairaishu, Miyazaki Ootsubu, AOI, KOMA, NARO-FE-1, Akiakane, Gamma no Irodori, Kitano Mashu, Kitamitsuki, Great Ruby, Cobalt no Chikara, Sachiizumi, Sanrutin, and Soba. Examples of varieties of buckwheat include Nakanaka Motono No. 1, Tachiakane, Dewakaori, Toyomusume, Natsumi, Nijiyutaka, Horominori, Miyazaki Ootsubu, Ruchiking, Reranokaori, Natsuyoshi, Aizu no Kaori, Kaida Wase, Miyazaki Wase Kaori, Takamine Ruby, Takamine Ruby 2011, Yamagata BW No. 5, Izumo no Mai, Haru no Ibuki, Hitachi Akisoba, Shin'ei Red, Shinshu Oosoba, Nagano S11, Nagano S8, Shimada Scarlet, Hida No. 1, and Hokkai No. 3. Examples of varieties of buckwheat include Shin'ei Yellow, Hokkai T8, Hokkai T9, Hokkai T10, Hokuriku No. 4, Ki no Chikara, Ki no Takara, Ki no Yutaka, Daizen, Shinano Kurotsubu, Daruma Dattan, Aeon no Kisai, Manten Kirari, Nishi no Haruka, and Aeon no Kisai. Many of these can be obtained from seed companies or related organizations.
[0031] This application is the first to disclose that in buckwheat plants, a deficiency in SSIIa activity alters the properties of the starch they contain.
[0032] Wheat has three SSIIa genes, but each isozyme contributes differently to the gelatinization temperature. According to Table 2-4 of Non-Patent Literature 2, when a certain SSIIa gene was deleted, the effect differed depending on the type of SSIIa isozyme that remained (To, Tp, and ΔH differed significantly in the comparison between types 4, 5, and 6). Therefore, it was impossible to predict how much effect the remaining isozymes would exert without actually inducing mutations in the isozymes.
[0033] Furthermore, some SSIIa proteins function in the leaves. If SSIIa proteins that function in the leaves are deficient, photosynthetic products cannot be accumulated, which can lead to death or severe growth disorders. Therefore, prior to this application, there was a concern that buckwheat plants with mutated SSIIa proteins might not be able to be produced as plants because SSIIa might be common to both the leaves and seeds.
[0034] Furthermore, many of the cereals in which plants with SSIIa mutations have been reported are grasses, which are monocots. Specifically, these include rice, wheat, barley, maize, sorghum, millet, foxtail millet, and adlay. In dicotyledonous plants, there is a report on sweet potato, which belongs to the Convolvulaceae family (Non-Patent Literature 4). However, since sweet potatoes reproduce vegetatively, their mode of reproduction is fundamentally different from that of dicotyledonous plants such as buckwheat, which reproduce by seeds. Also, the report on sweet potatoes concerns tubers, while buckwheat is consumed for its seeds. Therefore, prior to this application, the results of SIIa mutations in the seeds of buckwheat, which belongs to the Polygonaceae family and is also a dicotyledonous plant, could not be predicted, and there were concerns that it would be lethal.
[0035] (Urea disintegration / gelatinization temperature) The buckwheat plants of the present invention have improved starch properties. Specifically, compared to conventional buckwheat plants, they have a shorter amylopectin chain length, resulting in increased urea disintegration and a lower gelatinization temperature. Measuring amylopectin chain length requires special equipment and is relatively complicated. However, evaluating urea disintegration does not require special equipment, and if the difference is large, it can be observed with the naked eye, and the procedure is simple.
[0036] In relation to the present invention, when referring to urea disintegration properties of buckwheat plants, unless otherwise specified, it refers to the urea disintegration properties of buckwheat flour (endosperm) obtained by milling buckwheat seeds obtained from the target buckwheat plant using a conventional milling machine. Urea disintegration properties may sometimes be expressed as the degree of urea disintegration in the starch of whole grain flour, but those skilled in the art can perform appropriate calculations for buckwheat flour milled using a milling machine and determine the difference in the degree of urea disintegration properties by comparing it with buckwheat flour distributed on the market. Generally, buckwheat flour is produced by rolling buckwheat (grains) and separating the crushed material with a sieve.
[0037] The urea-disintegrating properties of starch can be quantified by colorimetrically comparing the iodine-starch reaction with starch solubilized in 1-4 M urea from buckwheat flour.
[0038] More specifically, for example, after removing the hulls from buckwheat seeds, approximately 20 mg of buckwheat flour prepared by grinding in a mortar is weighed into a 0.5 ml tube, 1 ml of 2 M urea is added, and the mixture is stirred at 25°C for 16 hours (200 rpm). 180 μL of iodine solution (0.002% iodine - 0.02% potassium iodide solution) is added to 20 μL of the supernatant, and the absorbance at 690 nm is measured using a microplate reader (Thermo Scientific: Multiskan FC). At this time, the absolute value of the measurement obtained (absorbance divided by the weight of the buckwheat flour) may be used for evaluation, but it may also be evaluated using a relative value compared to a control buckwheat flour (buckwheat flour obtained from wild-type buckwheat, or commercially available buckwheat flour).
[0039] The degree of increase in urea disintegration in buckwheat plants according to the present invention is preferably such that it affects the retention of softness after cooking in foods containing buckwheat plants as raw materials.
[0040] Specifically, the urea disintegration properties of the buckwheat plants of the present invention are preferably 1.2 times or more, preferably 1.3 times or more, more preferably 1.4 times or more, and even more preferably 1.5 times or more, compared to the wild type. According to the inventors' studies, the buckwheat lineage "18AS29" obtained by the inventors is 1.61 times more urea disintegration properties than wild-type buckwheat (see Examples section), and 1.82 times more urea disintegration properties than commercially available buckwheat flour.
[0041] Furthermore, the urea disintegration properties of the present invention are greater than those of the wild type from which the buckwheat plant originates. In relation to the present invention, when the degree of urea disintegration compared to the wild type is expressed numerically, unless otherwise specified, it is the value of the increase ratio of the degree of disintegration compared to the wild type.
[0042] The urea disintegration properties of the buckwheat plants of the present invention are preferably at least 1.2 times, preferably 1.3 times or more, more preferably 1.4 times or more, and even more preferably 1.5 times or more, compared to commercially available buckwheat.
[0043] In rice, it is known that a deficiency in SSIIa increases urea disintegration (https: / / agriknowledge.affrc.go.jp / RN / 2030928508.pdf). Therefore, it is thought that the desired effect can be expected in the buckwheat plants of the present invention if there is a similar increase in urea disintegration.
[0044] In relation to the present invention, when referring to gelatinization temperature, unless otherwise specified, it refers to the value (°C) measured for buckwheat flour (endosperm) obtained by milling buckwheat seeds obtained from the target buckwheat plant using a conventional milling machine. The gelatinization temperature can be measured by differential scanning calorimetry (DSC).
[0045] More specifically, for example, buckwheat flour prepared by grinding buckwheat seeds in a mortar after removing the hulls. Approximately 10 mg was weighed and placed in a silver pan. Distilled water was added to achieve a starch concentration of 30% (based on dry weight, weight / weight). Using this sealed pan with the added distilled water as a reference, the scan was performed from 25°C to 130°C at a heating rate of 2°C / min. For a more detailed method, refer to the method of Noda et al. 2004, cited below.
[0046] The degree to which the gelatinization peak temperature of the buckwheat plant of the present invention is reduced is preferably such that it affects the retention of softness after cooking in a food product containing the buckwheat plant as a raw material.
[0047] Specifically, the degree of reduction in the gelatinization peak temperature of the buckwheat plant of the present invention (gelatinization peak temperature for the target buckwheat plant (°C) / gelatinization peak temperature for the wild type (°C) × 100) is preferably 98% or less, preferably 97% or less, more preferably 96% or less, and even more preferably 95% or less. According to the inventors' studies, the gelatinization peak temperature of the buckwheat line "18AS29" obtained by the inventors is approximately 95% when compared to wild-type buckwheat.
[0048] Alternatively, the gelatinization peak temperature of the buckwheat plant of the present invention is preferably 71°C or lower, preferably 70°C or lower, more preferably 69°C or lower, and even more preferably 68°C or lower. According to the inventors' studies, the gelatinization peak temperature of the buckwheat line "18AS29" obtained by the inventors is approximately 67.7°C.
[0049] (New buckwheat variety) An example of a buckwheat plant provided by the present invention that lacks starch synthase (SSIIa) activity, or a buckwheat plant that satisfies at least one of the following conditions: urea disintegration is 1.5 times or more compared to the wild type, and the starch gelatinization peak temperature is 95% or less compared to the wild type, is "18AS29".
[0050] "18AS29" is a strain obtained by the method described in the examples of this specification and has the following characteristics. • Scientific properties (morphological, cultivation characteristics, physiological characteristics, etc.) Taxonomic position: It belongs to the same lineage as common buckwheat (Fagopyrum esculentum). This is an annual, upright, branching plant. After sowing, the cotyledons unfold, followed by the development of true leaves. Flower clusters then appear on the main stem and branches, and finally, fruit is produced. • Origin: Developed through spontaneous mutation breeding at the Hokkaido Agricultural Research Center. • Cultivation conditions: For the survival confirmation test (germination test conditions), the seeds are immersed in 70% ethanol for 1 minute for sterilization, stirred with a stirrer for 30 minutes in a 1% (effective chlorine concentration) sodium hypochlorite solution, washed 5 times with sterile water, and sown on filter paper soaked in sterile water in a petri dish at 25°C (tolerance range 22-28°C) in the dark. Seedlings that have developed crown roots are judged to have germinated. The germination test will last 12 days. Outdoor weather conditions for the plants are an average daily temperature of 13°C-18°C, a maximum daily temperature of 18°C-25°C, a minimum daily temperature of 10°C-18°C, good drainage, monthly rainfall of 200-400 mm, and more than 100 hours of sunshine per month. • Seed storage method: 5℃
[0051] [Method for modifying starch in buckwheat plants] The present invention provides a method for modifying starch contained in buckwheat plants by suppressing the activity of an enzyme consisting of any of the following proteins (specifically, a method for shortening the amylopectin chain length, a method for increasing urea disintegration, or a method for lowering the gelatinization peak temperature). (A) A protein consisting of one of the amino acid sequences from Sequence ID No. 9 to 15; (B) A protein consisting of an amino acid sequence having 90% or more identity with any one of the amino acid sequences of Sequence ID Nos. 9-15, and having the function of controlling the urea disintegration of buckwheat plants; (C) A protein that codes for an amino acid sequence in which 1 to 60 amino acids are deleted, substituted, or added in any one of the amino acid sequences of Sequence ID No. 9 to 15, and has the function of controlling the urea disintegration of buckwheat plants.
[0052] In this preferred embodiment, the activity of an enzyme comprising any of the following is suppressed. (A') A protein consisting of one of the amino acid sequences of sequence numbers 9, 12, and 14; (B') A protein consisting of an amino acid sequence having 90% or more identity with one of the amino acid sequences of sequence numbers 9, 12, and 14, and having the function of controlling the urea disintegration of buckwheat plants; (C') A protein that encodes an amino acid sequence in which 1 to 60 amino acids are deleted, substituted, or added in any one of the amino acid sequences of sequence numbers 9, 12, and 14, and has the function of controlling the urea disintegration of buckwheat plants.
[0053] The sequence listing includes the amino acid sequence of buckwheat SSIIa2 (wild type) as sequence number 9, the amino acid sequence of buckwheat SSIIa2 (mutant type) as sequence number 10, the amino acid sequence of buckwheat SSIIa1 as sequence number 11, the amino acid sequence of Tartary buckwheat SSIIa2 as sequence number 12, the amino acid sequence of Tartary buckwheat SSIIa1 as sequence number 13, the amino acid sequence of perennial buckwheat SSIIa2 as sequence number 14, and the amino acid sequence of perennial buckwheat SSIIa1 as sequence number 15.
[0054] In relation to the present invention, when referring to "hybridizing polynucleotides under stringent conditions," unless otherwise specified, the hybridization conditions for any polynucleotide can be appropriately selected according to the polynucleotide to be obtained, in accordance with the descriptions in Molecular Cloning. A Laboratory Manual. 2nd ed. (Sambrook et al., Cold Spring Harbor Laboratory Press) and Hybridization of Nucleic Acid Immobilization on Solid Supports (ANALYTICAL BIOCHEMISTRY 138, 267-284 (1984)). For example, to obtain DNA with 85% or more identity, hybridization can be performed at 40°C in the presence of a 2x concentration SSC solution and 50% formamide, followed by washing the filter at 55°C using a 0.1x concentration SSC solution (the composition of the 1x concentration SSC solution is 150 mM sodium chloride and 15 mM sodium citrate). Furthermore, to obtain DNA with more than 90% identity, hybridization should be performed at 55°C in the presence of a 2x concentration SSC solution and 50% formamide, followed by washing the filter at 60°C with a 0.1x concentration SSC solution.
[0055] Furthermore, with respect to the present invention, when referring to an amino acid sequence in which "one or more amino acids are substituted, deleted, inserted, and / or added," the number of amino acids substituted, deleted, inserted, and / or added is not particularly limited in any protein as long as the protein consisting of that amino acid sequence has the desired function, unless otherwise specified. However, it is generally around 1 to 120, 1 to 60, 1 to 30, 1 to 9, or 1 to 4 amino acids, or even more substitutions are possible if the substitutions are with amino acids of similar properties. Means for preparing polynucleotides or proteins relating to such amino acid sequences are well known to those skilled in the art.
[0056] In this invention, when referring to a base sequence (sometimes called a nucleotide sequence) or an amino acid sequence, unless otherwise specified, it means the percentage of matching nucleotides or amino acids shared between two sequences when the two sequences are aligned in the most optimal manner. That is, identity can be calculated as (number of matching positions / total number of positions) × 100, and can be calculated using commercially available algorithms. Such algorithms are incorporated into the NBLAST and XBLAST programs described in Altschul et al., J.Mol.Biol.215(1990)403-410. More specifically, the search and analysis of the identity of base sequences or amino acid sequences can be performed using algorithms or programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW). When using a program, the parameters can be appropriately set by those skilled in the art, or the default parameters of each program may be used. The specific methods of these analysis methods are also well known to those skilled in the art.
[0057] In this specification, when referring to a high degree of identity with respect to a base sequence or amino acid sequence, unless otherwise specified, it means a sequence identity of at least 70%, preferably 80% or more, more preferably 85% or more, even more preferably 90% or more, even more preferably 95% or more, even more preferably 97.5% or more, and even more preferably 99% or more.
[0058] [Breeding methods, methods for producing buckwheat plants] The present invention also provides a method for breeding novel buckwheat plants using the buckwheat plants of the present invention. The breeding method of the present invention is characterized by using the buckwheat plants of the present invention, their plant bodies, or their offspring as breeding material. The breeding method is not particularly limited and examples include crossbreeding, selection of mutants, backcrossing, genetic modification, cell fusion, genome editing, etc.
[0059] The breeding objectives are not particularly limited and include, for example, increased yield, improved ecological characteristics, lodging resistance, limited growth, moisture tolerance, and improved quality (improvement of functional components such as rutin, improvement of proteins, improvement of aroma components, and resistance to pre-harvest sprouting).
[0060] The present invention also provides a method for producing buckwheat plants with a relatively short amylopectin chain length, buckwheat plants with relatively high urea disintegration ability, and buckwheat plants with a relatively low gelatinization peak temperature. The method for producing buckwheat plants according to the present invention is characterized by comprising the steps of mutating the SSIIa gene of a buckwheat plant, or propagating a buckwheat plant with a mutated SSIIa gene. Various buckwheat varieties and lines can be used as starting materials, but for example, the self-pollinating buckwheat variety, Buckwheat Intermediate Parent Line No. 1, can be publicly used.
[0061] [Harvested produce, breeding material, or processed products] In relation to the present invention, the term "plant" is used to mean a plant body or a part thereof, unless otherwise specified, and "a part thereof" includes, unless otherwise specified, seeds (including germinated seeds and immature seeds), organs or parts thereof (including leaves, roots, stems, flowers, stamens, pistils, and their fragments), plant cultured cells, callus, and protoplasts. Plants include genetically modified plants and transgenic plants. Plants also include harvested products and reproductive materials.
[0062] Unless otherwise specified, "propagation material" refers to all or part of a plant body used for propagation (sometimes called seedlings), such as seeds, seedlings, cells, callus, and sprouts. In this invention, "harvested products" is used in the usual sense, except in special cases, and includes all or part of a plant body that is not used for propagation, such as buckwheat seeds as food ingredients, harvested buckwheat, buckwheat hulls, and bran.
[0063] In relation to the present invention, when referring to a processed product, unless otherwise specified, it means a processed product produced directly from harvested produce, specifically buckwheat grains, buckwheat flour, etc.
[0064] Buckwheat grains or buckwheat flour can be used as ingredients in food products. Examples of such foods include noodles, confectionery (cookies, biscuits, crackers, bolo, snacks, sponge cakes, manju, dango, senbei, arare, okaki, etc.), mochi, bread (e.g., sliced bread, sweet bread, bagels, steamed buns, and butter rolls, etc.), pizza, alcohol, ice cream, candy, chocolate, mixed flours (e.g., fried chicken mix, tempura mix, bread mix, pancake mix, okonomiyaki mix, and takoyaki mix, etc.), and beverages (e.g., buckwheat tea beverages, soups, green juice, smoothies).
[0065] [Primers, etc., for detecting variants] The present invention also provides a kit for determining buckwheat plants lacking SSIIa activity, comprising any of the following primer pairs, or the same. (a) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 20 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 21; (b) A pair of oligonucleotide primers, each having a length of 15-30 nucleotides and at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 20, and each having a length of 15-30 nucleotides and at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 21, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template; (c) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 22 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 23; (d) A pair of oligonucleotide primers, each having a length of 15 to 30 nucleotides and having at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 22, and an oligonucleotide primer having a length of 15 to 30 nucleotides and having at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 23, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template.
[0066] The present invention also provides a buckwheat plant, or its seeds or powder, having a polynucleotide whose mutant amplified fragment can be detected by a PCR reaction using any of the following primer pairs. (a) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 20 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 21; (b) A pair of oligonucleotide primers, each having a length of 15-30 nucleotides and at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 20, and each having a length of 15-30 nucleotides and at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 21, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template; (c) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 22 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 23; (d) A pair of oligonucleotide primers, each having a length of 15 to 30 nucleotides and having at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 22, and an oligonucleotide primer having a length of 15 to 30 nucleotides and having at least 90% sequence identity with an equal-length portion of an oligonucleotide consisting of the sequence of SEQ ID NO: 23, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template.
[0067] The sequence listing includes an example sequence for a 5' primer for wild-type detection as SEQ ID NO: 18, an example sequence for a 3' primer for wild-type detection as SEQ ID NO: 19, an example sequence for a 5' primer for mutant detection as SEQ ID NO: 20, an example sequence for a 3' primer for mutant detection as SEQ ID NO: 21, an example sequence for a 5' primer for amplifying a fragment containing the mutant as SEQ ID NO: 22, and an example sequence for a 3' primer for amplifying a fragment containing the mutant as SEQ ID NO: 23.
[0068] The size of the amplified fragment by PCR reaction is approximately 250 bp when using primer pair (a) or (b), and when using primer pair (c) or (d), the wild type is approximately 125 bp, while the mutant type is approximately 116 bp, which is about 9 bases less.
[0069] The detection of a mutant amplified fragment means that at least one band corresponding to the mutant is detected. Specifically, when using the primer pair (a) or (b) above, which is for mutant detection, it means that an amplified fragment is detected. When using the primer pair (c) or (d) above, which is for amplifying a fragment containing the mutant site, it means that an amplified fragment shorter than the wild type (e.g., about 116 bp) is detected due to a deletion (e.g., about 9 bp). When a mutant amplified fragment is detected, it can be said that the buckwheat plant, or its seeds or flour, is derived from a buckwheat plant lacking the starch synthase (SSIIa) activity of the present invention.
[0070] In relation to the present invention, high sequence identity means having a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97.5%, at least 98%, at least 99%, or at least 99.9%. The identity value is based on the number of matching bases shared between the two sequences when the two sequences are aligned in an optimal state. That is, identity can be calculated as: Identity = (Number of matching positions / Total number of positions) × 100. Search and analysis regarding identity can be performed using algorithms or programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW).
[0071] The present invention will now be described in more detail with reference to examples, but the present invention is not limited thereto. [Examples]
[0072] [Acquisition of buckwheat plants with SSIIa gene mutation] To induce mutation, 100g of buckwheat (Fagopyrum esculentum, strain name IH3) seeds were placed in 200ml of ethyl methanesulfonate (0.1%~2.5%) and stirred at 25°C or similar conditions at 150 revolutions per minute. After 2-16 hours, the seeds were removed and sown in pots or fields (NARO Kyushu Okinawa Agricultural Research Center (2421 Suya, Koshi City, Kumamoto Prefecture 861-1192) or NARO Hokkaido Agricultural Research Center (4-banchi, Shinsei Minami 9-sen, Memuro-cho, Kasai-gun, Hokkaido 082-0081)). Seeds were obtained from each plant after fruiting. The harvested seeds were sown again in pots or fields, and genomic DNA was prepared from leaves and seeds to determine the genomic DNA sequence for the SSIIa gene. Genomic DNA preparation was carried out using commercially available genome extraction kits.
[0073] The genomic DNA sequence for the SSIIa gene was amplified by PCR using DNA primers that specifically amplify the gene. The method was based on Katsu, K., Suzuki, T., Fujino, K., Morishita, T. and Noda, T. (2019). Development of a DNA marker for variety discrimination specific to 'Manten-Kirari' based on an NGS-RNA sequence in Tartary buckwheat (Fagopyrum tataricum). Food Chem., 295, 51-57. The resulting amplified DNA fragments were sequenced using the Sanger assay or by outsourcing to an analytical company. The determined base sequences were compared with the wild-type base sequences, specifically Fes_sc0005785.1.g000003.aua.1 (SSIIa1) and Fes_sc0000009.1.g000056.aua.1 (SSIIa2), obtained from the Buckwheat Genome Database (BGDB) (http: / / buckwheat.kazusa.or.jp / index.html). By performing genome sequencing using the Sanger method to identify the missing parts, we identified the plants with base sequence mutations. Next, to fix the mutation in a homozygous state, we sowed the seeds again and repeated the process of self-pollination and confirmation of the presence or absence of the gene mutation. Once the gene mutation was fixed in a homozygous state, the plants were designated as SSIIa gene mutant buckwheat plants. The results are shown in the table below.
[0074] [Table 1]
[0075] [Genome mutation site of acquired SSIIa gene mutant buckwheat plants] The sequences of the wild-type SSIIa2 gene and the mutant SSIIa2 gene obtained in this study ("18AS29") are shown as Sequence ID 1 and Sequence ID 2 in the sequence listing, and in Figure 1, respectively.
[0076] The mutations in the wild-type and mutant ("18AS29") SSIIa gene are shown in Figure 1. While the wild-type SSIIa is "AATTTGAATTTCTCTGAACTTGAAAATGTTTCT" (Sequence ID 16), the mutant ("18AS29") SSIIa2 has a deletion of 9 bases corresponding to the wild type, resulting in a deletion of amino acid residues.
[0077] [Degree of increase in urea disintegration of buckwheat flour derived from buckwheat plants with SSIIa gene mutation] To investigate the effect of the above mutation on urea disintegration, we examined the urea disintegration properties of strains with and without the mutation from a buckwheat population containing both mutants and wild-type strains of "18AS29" before trait fixation. Urea disintegration properties were determined by colorimetric quantification of the iodine-starch reaction with starch solubilized in 2M urea.
[0078] Specifically, after removing the hulls from buckwheat seeds, approximately 20 mg of buckwheat flour prepared by grinding in a mortar was weighed into a 0.5 ml tube, 1 ml of 2 M urea was added, and the mixture was stirred at 25°C for 16 hours (200 rpm). 180 μL of iodine solution (0.002% iodine - 0.02% potassium iodide solution) was added to 20 μL of the supernatant, and the absorbance at 690 nm was measured using a microplate reader (Thermo Scientific: Multiskan FC).
[0079] The results are shown in Figure 2. Compared to the wild type, the amino acid mutation increased urea disintegration by 1.61 times. A t-test showed a statistically significant difference at the 0.1% level from the mean (N=6).
[0080] [Gelatinization properties of buckwheat flour derived from buckwheat plants with the SSIIa gene mutation] Furthermore, gelatinization characteristics were measured and compared using differential scanning calorimeter (DSC) based on the method described by Noda et al. 2004.
[0081] [Table 2]
[0082] [Summary] From these results, it can be seen that by introducing a mutation into the SSIIa gene, it is possible to create buckwheat plants with increased urea disintegration ability, resulting in changes related to the softness of cooked food.
[0083] [Comparison of wild and mutant varieties in spring planting] "18AS29" and "IH3" were crossed, and seeds from the F2 isolated generation were cultivated at the Kyushu Okinawa Agricultural Research Center in the spring of 2021. Seeds were harvested from each plant. The harvested seeds were investigated for urea disintegration using the method described above. The genotype of the harvested plants was determined by Sanger sequencing. 36 wild-type plants and 53 mutant plants were used in the analysis.
[0084] Furthermore, buckwheat flour was prepared using the method described above for three representative wild-type strains and three mutant strains, and its gelatinization properties were investigated using DSC.
[0085] The results are shown in Figure 3 and the table below. No isolation treatment (bagging) was performed after flowering. During cultivation, the mutant lines were surrounded by plants with wild-type pollen, so it is possible that they were pollinated by those pollen plants (the degree of urea disintegration in the wild type may be underestimated). Nevertheless, a statistically significant difference in urea disintegration ability was confirmed (Figure 3).
[0086] [Table 3]
[0087] As shown in the table, the mutant showed significantly lower gelatinization onset temperature, gelatinization peak temperature, and enthalpy.
[0088] [Comparison of urea disintegration activity between wild-type and mutant varieties in summer sowing cultivation] "18AS29" and "IH3" were crossed, and the F3 generation seeds were cultivated at the Kyushu Okinawa Agricultural Research Center in the summer of 2021. Seeds were harvested from each plant. The harvested seeds were investigated for urea disintegration using the method described above. The genotype of the harvested plants was determined using DNA markers described later. Ten wild-type plants and ten mutant plants were used for the analysis. Isolation treatment (bagging) was performed before flowering.
[0089] The results are shown in Figure 4. A statistically significant difference in urea disintegration was confirmed.
[0090] [Genotype detection using primers for wild-type detection and primers for mutant detection] Using the F3 generation seeds described above, PCR was performed on wild-type, heterozygous, and mutant genomic DNA using wild-type detection primers and mutant detection primers, and the amplified fragments were investigated by agarose gel electrophoresis.
[0091] (Primer sequences and PCR conditions for wild-type detection) 5' primer: GAATTTCTCTGAACTTGAAAATG (SEQ ID NO: 18) 3' Primer: GCATTATCCCCAGCAAGTGT (SEQ ID NO: 19) PCR conditions: 98°C for 10 seconds, 60°C for 5 seconds, 68°C for 10 seconds, 35 cycles, polymerase KOD one (registered trademark) (Toyobo Co., Ltd.)
[0092] (Primer sequences and PCR conditions for mutant detection) 5' primer: TTGCAGAAAACTTGAATTTTGAA (SEQ ID NO: 20) 3' Primer: CATCTCCAAGCCCACCTAAG (SEQ ID NO: 21) PCR conditions: 98°C for 10 seconds, 60°C for 5 seconds, 68°C for 10 seconds, 33 cycles, polymerase KOD one (registered trademark) (Toyobo Co., Ltd.)
[0093] The results are shown in Figure 5. Each genotype was determined based on the presence or absence of a band of the corresponding size (specifically, 249 bp for the wild type and 530 bp for the mutant).
[0094] [Genotype detection using primers for detecting mutation sites] Using the F3 generation seeds described above, primers containing the mutation sites were designed for wild-type, heterozygous, and mutant genomic DNA. PCR was performed, and the amplified fragments were examined using a chip electrophoresis system. Each genotype was determined based on the presence or absence of bands of the corresponding size.
[0095] 5' primer: CCGGTTCCAGTGCTAATTCAGG (SEQ ID NO: 22) 3' Primer: GTCATCTGATGGCCAAGAAACA (SEQ ID NO: 23) PCR conditions: 98°C for 10 seconds, 55°C for 5 seconds, 68°C for 5 seconds, 37 cycles, polymerase KOD One® (Toyobo Co., Ltd.)
[0096] The results are shown in Figure 6. Because the mutant has a 9-base deletion, the band position differs from that of the wild type. Heterozygous individuals possess both wild-type and mutant genotypes, resulting in two bands. The size of the amplified fragments is 125 bp for the wild type and 116 bp for the mutant.
[0097] [References cited in the examples] Takahiro Noda, Shogo Tsuda, Motoyuki Mori, Shigenobu Takigawa, Chie Matsuura-Endo, Katsuichi Saito, Wickramasinghe Hetti Arachichige Mangalika, Akihiro Hanaoka, Yasuyuki Suzuki, Hiroaki Yamauchi (2004). The effect of harvest dates on the starch properties of various potato cultivars. Food Chemistry 86, 119-125. [Industrial applicability]
[0098] The buckwheat plants in which the starch synthase of the present invention has been mutated exhibit increased urea disintegration compared to the wild type. Therefore, it is believed that by using the technology of the present invention, it will be possible to cultivate buckwheat plants with altered softness in cooked food, thereby meeting consumer needs. [Sequence Listing Free Text]
[0099] Sequence ID 1: Buckwheat SSIIa2 (wild type) gene Sequence ID 2: Buckwheat SSIIa2 (mutant) gene Sequence ID 3: Buckwheat SSIIa2 (wild type) cDNA Sequence ID 4: Buckwheat SSIIa2 (mutant) cDNA Sequence ID 5: Tartary buckwheat SSIIa2 cDNA Sequence ID 6: Tartary buckwheat SSIIa1 cDNA Sequence ID 7 Perennial buckwheat SSIIa2 cDNA Sequence ID 8: Perennial buckwheat SSIIa1 cDNA Sequence ID 9: Buckwheat SSIIa2 (wild type) Sequence ID 10: Buckwheat SSIIa2 (mutant) Sequence ID 11: Buckwheat SSIIa1 Sequence ID 12: Tartary buckwheat SSIIa2 Sequence ID 13: Tartary buckwheat SSIIa1 Sequence ID 14: Perennial buckwheat SSIIa2 Sequence ID 15 Perennial buckwheat SSIIa1 Sequence ID 16: Partial sequence of the buckwheat SSIIa2 (wild type) gene and amino acids. Sequence ID No. 17: Partial sequence of the buckwheat SSIIa2 (mutant) gene and amino acids. Sequence ID No. 18: 5' primer for wild-type detection Sequence ID No. 19 3' primer for wild-type detection Sequence ID No. 20: 5' primer for mutant detection Sequence ID No. 21 3' primer for mutant detection Sequence ID 22: 5' primer for amplifying the fragment containing the mutation site. Sequence ID 23: 3' primer for amplifying the fragment containing the mutation site.
Claims
1. A buckwheat plant having a mutation in the starch synthase (SSIIa)2 gene that causes a deficiency in the activity of SSIIa2 encoded by the gene, and having a shorter amylopectin chain length in the starch it contains compared to wild-type buckwheat plants.
2. The buckwheat plant according to claim 1, wherein the deficiency of SSIIa2 activity is caused by any of the following in the SSIIa2 gene: splicing mutation, stop codon insertion mutation, amino acid deletion mutation, or amino acid substitution mutation.
3. Buckwheat plants that possess one of the following mutant polynucleotides as a homozygote and lack SSIIa2 activity. (a) A polynucleotide consisting of the sequence of Sequence ID No.
2. (b) A polynucleotide having 90% or more sequence identity with the polynucleotide consisting of the sequence of SEQ ID NO: 2, and having a deletion in any of the nucleotides corresponding to positions 577-585 of SEQ ID NO:
3.
4. A plant of the genus Fagopyrum according to any one of claims 1 to 3, wherein the plant of the genus Fagopyrum is buckwheat (Fagopyrum esculentum), Tartary buckwheat (F. tataricum), perennial buckwheat (F. cymosum), or wild buckwheat (F. homotropicum), or a hybrid of any of these.
5. A plant body of a buckwheat plant according to any one of claims 1 to 4.
6. A method for breeding buckwheat plants, comprising using a buckwheat plant lacking SSIIa2 activity as described in any one of claims 1 to 4, or its progeny having a mutation in the SSIIa2 gene.
7. A harvested product, propagating material, or processed product of a plant according to claim 5, comprising the SSIIa2 gene having the mutation defined in claim 1.
8. A method to increase the urea disintegration properties of buckwheat plants by suppressing the activity of any of the following proteins or the expression of polynucleotides: (A) A protein consisting of one of the amino acid sequences of sequence numbers 9, 12, and 14; (B) A protein having an amino acid sequence that is 90% or more identical to any one of the amino acid sequences of Sequence ID Nos. 9, 12, and 14, and that has the function of reducing the urea disintegration of buckwheat plants; (C) A polynucleotide that encodes an amino acid sequence in which 1 to 60 amino acids are deleted, substituted, or added in any one of the amino acid sequences of Sequence ID Nos. 9, 12, and 14, and has the function of reducing the urea disintegration properties of buckwheat plants.
9. A buckwheat plant according to any one of claims 1 to 4, or its seeds or flour, that satisfies at least one of the following conditions: - Urea disintegration is 1.5 times more than that of the wild type. - The gelatinization peak temperature is 95% or less compared to the wild type.
10. A kit for identifying buckwheat plants lacking SSIIa2 activity, containing any of the following primer pairs: (a) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 20 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 21; (b) A pair of oligonucleotide primers, each having a length of 15 to 23 nucleotides and having at least 90% sequence identity with a contiguous sequence of Sequence ID No. 20, and an oligonucleotide primer having a length of 15 to 20 nucleotides and having at least 90% sequence identity with a contiguous sequence of Sequence ID No. 21, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of Sequence ID No. 2 as a template; (c) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 22 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 23; (d) A pair of oligonucleotide primers, each having a length of 15–22 nucleotides and having at least 90% sequence identity with a contiguous sequence of Sequence ID No. 22, and having at least 90% sequence identity with a contiguous sequence of Sequence ID No. 23, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of Sequence ID No. 2 as a template; (e) A pair of oligonucleotide primers comprising the sequence of SEQ ID NO: 20 and the sequence of SEQ ID NO: 21, wherein the pair is capable of amplifying an amplified fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template; (f) A pair of oligonucleotide primers comprising the sequence of SEQ ID NO: 22 and the sequence of SEQ ID NO: 23, wherein the pair is capable of amplifying an amplified fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template.
11. A buckwheat plant according to claim 3, or its seeds or flour, having a polynucleotide whose mutant amplified fragment can be detected by a PCR reaction using any of the following primer pairs: (a) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 20 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 21; (b) A pair of oligonucleotide primers, each having a length of 15 to 23 nucleotides and having at least 90% sequence identity with a contiguous sequence of Sequence ID No. 20, and an oligonucleotide primer having a length of 15 to 20 nucleotides and having at least 90% sequence identity with a contiguous sequence of Sequence ID No. 21, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of Sequence ID No. 2 as a template; (c) A pair of oligonucleotide primers consisting of the sequence of SEQ ID NO: 22 and oligonucleotide primers consisting of the sequence of SEQ ID NO: 23; (d) A pair of oligonucleotide primers, each having a length of 15–22 nucleotides and having at least 90% sequence identity with a contiguous sequence of Sequence ID No. 22, and having at least 90% sequence identity with a contiguous sequence of Sequence ID No. 23, wherein the pair is capable of amplifying an amplification fragment using a polynucleotide consisting of all or part of the sequence of Sequence ID No. 2 as a template; (e) A pair of oligonucleotide primers comprising the sequence of SEQ ID NO: 20 and the sequence of SEQ ID NO: 21, wherein the pair is capable of amplifying an amplified fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template; (f) A pair of oligonucleotide primers comprising the sequence of SEQ ID NO: 22 and the sequence of SEQ ID NO: 23, wherein the pair is capable of amplifying an amplified fragment using a polynucleotide consisting of all or part of the sequence of SEQ ID NO: 2 as a template.
Citation Information
Patent Citations
Steering device for rear wheels
JP1987026165A
Method for controlling activity of rice ssiia, and mutant therefor
JP2005269928A
Nucleic acid encoding enzyme synthesizing starch of starch granule-bonded type, primer pair, inhibitor, and glutinous genus fagopyrum plant
JP2012223137A
WHEAT FLOUR PREPARED FROM WHEAT DELETED WITH ENZYME ACTIVITY OF TWO GBSSI AND TWO SSIIa
JP2013188206A
Barley and its uses
JP2013500022A