Novel fusion protein with improved antibacterial activity against Staphylococcus and use thereof
Patent Information
- Application Number
- KR1020250011261
- Authority / Receiving Office
- KR · KR
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-01-24
- Publication Date
- 2026-08-03
Smart Images

Figure PAT00004_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a novel lysine fusion protein with improved antibacterial activity against Staphylococcus aureus and its uses. Background Technology
[0002] Staphylococcus (Staphylococcus, Staphylococcus Staphylococcus is a genus of Gram-positive bacteria named as such because, when viewed under a microscope, its appearance resembles a cluster of grapes. Staphylococcus is widely distributed in nature and is a bacterium with strong resistance to the environment that can survive for a long time without parasitizing living organisms. It is normally present on the skin, mucous membranes, upper respiratory tract, urinary tract, and digestive tract of healthy people (commensal bacteria), and also exists in the surrounding environment such as air, floors, and furniture; however, it can easily infect the human body through skin wounds or the respiratory system.
[0003] Among the various species of the genus Staphylococcus, Staphylococcus aureus ( Staphylococcus aureus It causes various infections in humans, livestock, and poultry, and leads to serious infections such as pneumonia, endocarditis, osteomyelitis, food poisoning, and infections of the skin or tissues. In addition, known as another staphylococcus species S.pseudintermedius (Staphylococcus pseudintermedius) It is isolated from the skin and mucous membranes of healthy dogs and cats and is one of the major causes of bacterial skin and soft tissue infections. It is also known to affect humans through contact with animals. It is an opportunistic pathogen capable of secreting immunomodulatory toxins and producing biofilms.
[0004] Due to the indiscriminate use of antibiotics, methicillin-resistant strains are rampant and are acquiring resistance to various other antibiotics. In particular, methicillin-resistant Staphylococcus aureus Staphylococcus aureus Multidrug-resistant Staphylococcus aureus (MRSA) is distributed worldwide and causes high mortality rates. To combat these multidrug-resistant Staphylococcus aureus, the development of new antimicrobial agents is required.
[0005] Endolysin or lysin produced by bacteriophages is an enzyme that hydrolyzes peptidoglycan when the bacteriophage releases its offspring out of the cell after completing replication. Since endolysin exists in the cytoplasm during natural bacteriophage infection, it does not damage the cell wall; furthermore, because it utilizes a mechanism different from that of antibiotics, the likelihood of bacteria developing resistance to endolysin is very low. Most endolysins consist of a catalytic domain and a cell wall binding domain (CBD), possessing one or two domains. Due to the modular structure of each catalytic and cell wall binding domain, new chimeric lysins can be generated by combining modules with bacteriocins or phage lysins to improve activity and further enhance stability.
[0006] Resource Stapin is Staphylococcus simulans at It is an isolated antimicrobial enzyme. It effectively cleaves the pentaglycine bridges, which are cross-links of the peptidoglycan layer. This makes it a highly effective agent against Staphylococcus aureus with a high proportion of pentaglycine. Zastorapin consists of a catalytic domain (M23 peptidase) and a cell wall binding domain (SH3).
[0007] ClyC is a hybrid endolysin created by replacing the enzymatic activity domain (EAD) and cell wall binding domain of natural Staphylococcus endolysin. It is known to exhibit not only potent antimicrobial activity against Staphylococcus aureus but also to be effective against biofilms of multidrug-resistant bacteria, including methicillin-resistant Staphylococcus aureus (MRSA), Epidermidis aureus (MRSE), and clinical isolates of Staphylococcus aureus. The SH3 domain of ClyC is Staphylococcus It originated from phage PALS_1, and Staphylococcus The sequence similarity with the SH3 domain of the derived bacteriophage ΦK is 94.2%.
[0008] The inventors of the present invention S. simulans By substituting the SH3 domain of ClyC into the resource stuffin module extracted from, Lsp-ClyC SH3 The above lysine fusion protein is superior in that it exhibits high bactericidal efficacy compared to lysine in bacteriophages and autolysin present on the genome of Staphylococcus aureus.
[0009] Accordingly, the inventors of the present invention [use] the above Lsp-ClyC SH3 While conducting research to improve the activity of a fusion protein, the present invention was completed by confirming that removing six tagged histidines to verify the production and expression amount of the protein enhances bactericidal activity. The problem to be solved
[0010] The objective of the present invention is to provide a lysine fusion protein having specific antibacterial activity against Staphylococcus aureus.
[0011] Another objective of the present invention is to provide a nucleic acid molecule encoding the lysine fusion protein.
[0012] Another objective of the present invention is to provide a pharmaceutical composition, antibiotic, disinfectant, and feed additive composition for the prevention or treatment of infectious diseases caused by Staphylococcus aureus, comprising the lysine fusion protein as an active ingredient. means of solving the problem
[0013] To achieve the above objective, the present invention provides a lysine fusion protein composed of any one amino acid sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 3, and SEQ ID NO. 5.
[0014] In addition, the present invention provides a nucleic acid molecule encoding the lysine fusion protein.
[0015] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of infectious diseases caused by Staphylococcus aureus, an antibiotic, a disinfectant, and a feed additive composition comprising the lysine fusion protein as an active ingredient. Effects of the invention
[0016] The present invention relates to a novel lysine fusion protein with improved antimicrobial activity against Staphylococcus aureus and its uses. The lysine fusion protein of the present invention can be used as a pharmaceutical composition for the prevention or treatment of infectious diseases caused by Staphylococcus aureus, and can also be applied as an antibiotic, disinfectant, or feed additive, and is expected to be widely applied in fields such as food hygiene and the livestock industry. Brief explanation of the drawing
[0017] Fig. 1a shows the novel chimeric lysine Lsp-ClyC SH3 This is a domain schematic diagram. Fig. 1b shows the novel chimeric lysine Lsp-ClyC SH3 This is a diagram predicting the three-dimensional structure of a protein. Fig. 1c is a cell-free expression system ( in vitro Novel chimeric lysine Lsp-ClyC generated from transcription / translation SH3 Shows the Western blotting results of (Lane 1: Lsp-ClyC SH3, Lane 2: DNA negative sample, M: Protein molecular weight marker ) . Fig. 2a shows a novel chimeric lysine (Lsp-ClyC SH3 This is a graph showing the results of evaluating the antibacterial efficacy of ) against Staphylococcus aureus CCARM3806. Fig. 2b shows a novel chimeric lysine (Lsp-ClyC SH3 This is a graph showing the results of evaluating the antibacterial efficacy of ) against Staphylococcus aureus CCARM3825. Fig. 2c is a novel chimeric lysine (Lsp-ClyC SH3This is a graph showing the results of evaluating the antibacterial efficacy of ) against Staphylococcus aureus CCARM3832. Fig. 2d shows the new chimeric lysine (Lsp-ClyC SH3 This is a graph showing the results of evaluating the antibacterial efficacy of ) against Staphylococcus aureus CCARM3837. Fig. 3a shows a novel chimeric lysine (Lsp-ClyC SH3 This is a graph showing the results of evaluating the colony reduction efficacy of ) against Staphylococcus aureus CCARM3806 in milk. Fig. 3a shows a novel chimeric lysine (Lsp-ClyC SH3 This is a graph showing the results of evaluating the colony reduction efficacy of ) against Staphylococcus aureus CCARM3825 in milk. Fig. 3a shows a novel chimeric lysine (Lsp-ClyC SH3 This is a graph showing the results of evaluating the colony reduction efficacy of ) against Staphylococcus aureus CCARM3832 in milk. Fig. 3a shows a novel chimeric lysine (Lsp-ClyC SH3 This is a graph showing the results of evaluating the colony reduction efficacy of ) against Staphylococcus aureus CCARM3837 in milk. Fig. 4a is chimeric lysine with histidine removed (Lsp-ClyC SH3- This is a graph showing the results of evaluating the antibacterial efficacy of dHis against Staphylococcus aureus CCARM3806. Fig. 4b is chimeric lysine with histidine removed (Lsp-ClyC SH3 This is a graph showing the results of evaluating the antibacterial efficacy of -dHis against Staphylococcus aureus CCARM3825. Fig. 4c is chimeric lysine with histidine removed (Lsp-ClyC SH3 This is a graph showing the results of evaluating the antibacterial efficacy of -dHis against Staphylococcus aureus CCARM3832. Fig. 4d is chimeric lysine with histidine removed (Lsp-ClyC SH3This is a graph showing the results of evaluating the antibacterial efficacy of -dHis against Staphylococcus aureus CCARM3837. Fig. 5a is chimeric lysine with histidine removed (Lsp-ClyC SH3 -dHis)'s S. pseudotermedius This is a graph showing the results of evaluating the antibacterial efficacy of KVNOP1. Fig. 5a is chimeric lysine with histidine removed (Lsp-ClyC SH3 -dHis)'s S. pseudotermedius This is a graph showing the results of evaluating the antibacterial efficacy of KVNOP2. Fig. 5a is chimeric lysine with histidine removed (Lsp-ClyC SH3 -dHis)'s S. pseudotermedius This is a graph showing the results of evaluating the antibacterial efficacy of KVNOP18. Fig. 5a is chimeric lysine with histidine removed (Lsp-ClyC SH3 -dHis)'s S. pseudotermedius This is a graph showing the results of evaluating the antibacterial efficacy against KVNOP19. Fig. 5a is chimeric lysine with histidine removed (Lsp-ClyC SH3 -dHis)'s S. pseudotermedius This is a graph showing the results of evaluating the antibacterial efficacy of KVNOP42. Fig. 5a is chimeric lysine with histidine removed (Lsp-ClyC SH3 -dHis)'s S. pseudotermedius This is a graph showing the results of evaluating the antibacterial efficacy of KVNOP242. Specific details for implementing the invention
[0018] The present invention will be described in detail below.
[0019] The present invention provides a lysine fusion protein composed of the amino acid sequence of SEQ ID NO. 2 or 4.
[0020] The lysine fusion protein of the present invention is composed of the M23 peptidase and linker of lysostaphin (Lps) and the SH3 domain of chimeric lysine (ClyC) (Fig. 1). Specifically, M23 peptidase is a domain with peptidoglycan hydrolase activity, and SH3 (bacterial SH domain) is known to be a cell wall binding domain. The cell wall binding domain is important for increasing enzyme activity, and it is known that enzyme activity decreases rapidly when the cell wall binding domain is artificially deleted.
[0021] The above lysine fusion protein may be composed of the amino acid sequence of SEQ ID NO. 2, and may be composed of the amino acid sequence of SEQ ID NO. 4 when produced in a cell-free synthesis system, which may be encoded by the gene sequence of SEQ ID NO. 3 or SEQ ID NO. 5. To produce the protein in a cell-free synthesis system, the sequence of an E. coli phage-derived PT7 promoter was added to the DNA template of the lysine fusion protein, and the sequence of a T7 terminator for efficient protein production termination and a T term (160 bp) containing six histids was added. The above sequence is disclosed in Korean Patent Application No. 10-2014-0120706.
[0022] The above lysine fusion protein is Staphylococcus ( Staphylococcus It has specific antibacterial activity against ), and the antibacterial specific activity of the lysine fusion protein may be characterized by breaking down the cell wall of Staphylococcus aureus.
[0023] The above staphylococcus is Staphylococcus aureus ( Staphylococcus aureus ) and Staphylococcus pseudintermedius It may be one or more selected from the group consisting of, but is not limited thereto.
[0024] The above Staphylococcus aureus is a methicillin-resistant Staphylococcus aureus. Staphylococcus aureus , MRSA) or methicillin-sensitive Staphylococcus aureus (Methicillin-sensitivity Staphylococcus aureus It may be MSSA, but is not limited to.
[0025] In addition, the present invention provides a nucleic acid molecule encoding the lysine fusion protein.
[0026] The above nucleic acid molecule may include the base sequence of SEQ ID NO. 3 or 5, as described above.
[0027] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of infectious diseases caused by Staphylococcus aureus, comprising the lysine fusion protein as an active ingredient.
[0028] As previously described, the above pharmaceutical composition is effective in treating infectious diseases caused by Staphylococcus aureus because the lysine fusion protein degrades the cell wall of Staphylococcus aureus and specifically kills the bacteria.
[0029] Infectious diseases caused by the above-mentioned staphylococcus include all diseases generally known to those skilled in the art. For example, since staphylococcus causes food poisoning, skin or tissue infections, shock caused by toxins, pneumonia, bacteremia, mastitis, or arthritis, the above-mentioned pharmaceutical composition may be a pharmaceutical composition for the prevention or treatment of food poisoning, skin or tissue infections, shock caused by toxins, pneumonia, bacteremia, mastitis, or arthritis.
[0030] As used in this specification, the term "treatment" means both the suppression of infectious diseases caused by Staphylococcus and the alleviation of infectious diseases caused by Staphylococcus.
[0031] The pharmaceutically acceptable carriers included in the above pharmaceutical composition are those commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the above pharmaceutical composition may additionally include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
[0032] The above pharmaceutical composition may be used by applying or spraying it onto the diseased area, or it may be administered orally or parenterally. In the case of parenteral administration, it may be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, or topically.
[0033] Suitable application, spraying, and dosage of the above pharmaceutical composition vary depending on factors such as the method of formulation, mode of administration, age, body weight, sex, severity of disease symptoms, food, time of administration, route of administration, excretion rate, and response sensitivity, and a physician or veterinarian who is usually skilled can easily determine and prescribe a dosage effective for the desired treatment. Generally, the above pharmaceutical composition may contain 0.0001-10% (w / v) of the lysine fusion protein of the present invention as an active ingredient, and preferably 0.001-1% (w / v).
[0034] The above pharmaceutical composition may be prepared in a unit dose form or contained in a multi-dose container by being formulated using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily carried out by a person skilled in the art to which the present invention belongs. In this case, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet, or capsule, and may additionally include a dispersant or a stabilizer.
[0035] In addition, the present invention provides an antibiotic comprising the lysine fusion protein as an active ingredient.
[0036] The above lysine fusion protein is as described above.
[0037] The above antibiotics refer to preparations that are provided in the form of drugs and can kill bacteria, and collectively refer to preservatives, disinfectants, and antimicrobial agents.
[0038] The above-mentioned antibiotic can primarily be utilized as a preventive and therapeutic agent for diseases caused by Staphylococcus aureus. Additionally, it can be used to treat diseases caused by Staphylococcus aureus that has acquired resistance to existing antibiotics.
[0039] In addition, the antibiotic composition of the present invention may be formulated in liquid, semi-solid, or solid forms, such as solid formulations like powders, granules, and tablets, liquid formulations like suspensions or injectable solutions, and semi-solid formulations like creams, lotions, gels, and pastes.
[0040] The dosage of the composition of the present invention refers to the amount required to achieve the effect of killing Staphylococcus in the subject. Accordingly, it can be adjusted according to various factors including the type of disease, severity of the disease, type of formulation, age, weight, general health condition, gender, diet, route of administration, time and duration of administration, and concurrently used drugs.
[0041] The composition of the present invention can be administered in a conventional manner through routes such as oral, intravenous, arterial, abdominal, intramuscular, transdermal, nasal, inhalation, or rectal.
[0042] The above-mentioned antibiotic utilizes lysine protein as an antimicrobial agent and possesses the significant advantage of not inducing bacterial resistance, unlike conventional antibiotics; therefore, it can be utilized as a novel antibiotic with a longer product life cycle compared to existing antibiotics. In other words, while the scope of use for most antibiotics inevitably shrinks as they face increasing resistance, the above-mentioned antibiotic containing lysine fusion protein as an active ingredient is expected to have a longer product life cycle as an antibiotic because it can fundamentally resolve the issue of resistance. Accordingly, the above-mentioned antibiotic can be effectively utilized as an antibiotic with excellent antibacterial, bactericidal, and preservative effects.
[0043] In addition, the present invention provides a disinfectant comprising the lysine fusion protein as an active ingredient.
[0044] The above lysine fusion protein is as described above.
[0045] The above disinfectant has high utility value as a disinfectant for preventing secondary infections in hospitals, food hygiene, and the livestock industry. For example, it can be used as a disinfectant and food additive in the food industry, and can also be usefully used as a disinfectant for cooking areas and cooking equipment.
[0046] In addition, the present invention provides a feed additive composition comprising the lysine fusion protein as an active ingredient.
[0047] The above lysine fusion protein is as described above.
[0048] Antibiotics used as feed additives in the livestock and fisheries industries are employed for disease prevention; however, the administration of antibiotics for preventive purposes poses a problem by increasing the likelihood of antibiotic resistance and allowing antibiotic residues in livestock to be transferred to humans. If antibiotics are absorbed into the human body through meat, they can induce antibiotic resistance. Furthermore, as the variety of antibiotics mixed into feed increases, the probability of multidrug-resistant bacteria developing also rises. Therefore, there is a need for new feed additives that are more environmentally friendly and can resolve the issues associated with the use of conventional antibiotics.
[0049] The feed of the present invention may be prepared by separately manufacturing the lysine fusion protein in the form of a feed additive and mixing it into the feed, or by directly adding it during the production of the feed. The lysine fusion protein in the feed of the present invention may be in a liquid or dry state. The lysine fusion protein of the present invention may be mixed in powder form at a component ratio of 0.05 to 10 weight%, preferably 0.1 to 2 weight%, of the weight of the feed. In addition, the feed may additionally include conventional additives that can enhance the shelf life of the feed, in addition to the bacteriophage of the present invention.
[0050] The feed additive composition of the present invention may include binders, emulsifiers, preservatives, etc. added to prevent quality degradation, and may include amino acid preparations, vitamin preparations, enzyme preparations, probiotics, flavoring agents, non-protein nitrogen compounds, silicate preparations, buffers, coloring agents, extractants, oligosaccharides, etc. added to the feed to increase utility, and may additionally include feed mixing agents, etc.
[0051] The present invention will be explained in detail below through examples.
[0052] However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.
[0053] <Example 1> Production of a Novel Lysine Gene Candidate Group
[0054] To derive a candidate group of chimeric lysine genes with improved antimicrobial activity, a novel chimeric lysine Lsp-ClyC, composed of the M23 peptidase and linker of lysostaphin (Lps) and the SH3 domain of chimeric lysine (ClyC), was developed. SH3 A DNA template was created.
[0055] Specifically, Lsp-ClyC SH3 In order to construct the M23 peptidase and linker portion Staphylococcus simulans The gene was artificially synthesized by adding a start codon (ATG) to 162 amino acids at positions 248–409 of Lps (Accession number AAB53783.1) and optimizing the codon and GC composition to facilitate E. coli expression and subsequent experimental steps. The domain containing codons 248 through 409 was used to create Lsp_F and Lsp-ClyC SH3 It was amplified using the -linker_R primer (Table 1). Next, a gene encoding 87 amino acids at positions 195–281 containing the SH3 (LysPALS1) domain of ClyC was synthesized. For the construction of the ClyC SH3 domain, Lsp-ClyC SH3 -linker_F and ClyC SH3 Lsp-ClyC was amplified with _R primers (Table 1) and cloned by splicing via SOE-PCR (Splicing by overlap extension-polymerase chain reaction). SH3 The domain and tertiary structure of the chimeric lysine are shown in Figs. 1a and 1b, respectively, and Lsp-ClyC SH3 The base and amino acid sequences of chimeric lysine are shown in Table 2.
[0056] Primer name Sequence (5'-3') Sequence number Lsp_F ATGGCGGCAACGCATGAACACTC 6 Lsp-ClyC SH3- linker_R CGATTCCGGTTTGTACCAAGGTACCATATTTGTTAGTTTTTC 7 Lsp-ClyC SH3 -linker_F GAAAACTAACAAATATGGTACTTGGTACAAACCGGAATCG 8 ClyC SH3 _R CTTGAATGTTCCCCAGGCAAC 9
[0057]
[0058] <Example 2> Synthesis of Chimeric Lysine Protein Using a Cell-Free Synthesis System
[0059] Using a cell-free expression system, chimeric lysine protein (Lsp-ClyC SH3 Synthesized ).
[0060] Specifically, an 87bp sequence containing a T7 promoter and a ribosome binding site is Lsp-ClyC SH3 The gene was linked by SOE-PCR using P T7-F and P-Lsp-linker-R primers, and a 160 bp sequence containing a stop codon, six histidines, and a T7 terminator was positioned after the lysine gene using ClyC SH3 Linkage was performed by SOE-PCR using the -T-linker-F primer and T term-R primer (Table 3). Finally, the entire gene was linked with the P_T7-F primer and T term-R The product was amplified by PCR using primers, and the amplified product was purified to a high concentration of 400-600 ng / 1 μL. The primers and nucleotide sequences used are shown in Tables 3 and 4 below, respectively.
[0061] Primer name Sequence (5'-3') Sequence number P_T7 (37mer)-F TCGAAATTAATACGACTCACTATAGGGAGACCACAAC 10 P-Lsp-linker-R GTGTTCATGCGTTGCCGCCATATGTATATCTCCTTCTTAAAG 11 ClyC SH3 -T-linker-F GTTGCCTGGGGAACATTCAAGAAGGGTCATCATCACCATCAC 12 T term (37mer)-R GAGGGGATCCAGATCTTGGGATAAAAAAAACAGATAG 13
[0062]
[0063] * In Table 4, the sequence in bold at the N-term represents the T7 promoter (P T7, 87 bp) sequence, and the sequence in bold at the C-term represents the stop codon and 6 histidines, T7 terminator (His 160 bp) sequence.
[0064] Cell-free protein synthesis was performed according to the protocol of the Expressway™ mini cell-free expression system (Invitrogen), and for DNA-negative samples, DNase / RNase-free distilled water was added instead of DNA, and the location of the generated protein (approx. 28 kDa) was confirmed in the Western blot using a 6x histidine antibody (Fig. 1c).
[0065] <Example 3> Synthesis of Histidine-Removed Chimeric Lysine Protein
[0066] To evaluate the antimicrobial activity of chimeric lysine protein against Staphylococcus aureus by histidine removal, P_T7-Lsp-ClyC SH3 -T term-dHis (973bp) was synthesized.
[0067] Specifically, a sequence (T term-dHis in Table 6) was synthesized by removing the 8-amino acid sequence containing 6 histidine sequences of the T7 terminator (160 bp). P T7-Lsp-ClyC SH3 Gene and T term-dHis The genes were linked by SOE-PCR using dHis-linker_R and dHis-linker_F primers, respectively, and cell-free protein synthesis was performed. The final T term-dHis is 136 bp. The primers used and the synthesized nucleotide sequences are shown in Tables 5 and 6 below, respectively.
[0068] Primer name Sequence (5'-3') Sequence number dHis-linker_F GCCTGGGGAACATTCAAGTGAGTTTAAAACTATATAG 14 dHis-linker_R CTATATAGTTTAAACTCACTTGAATGTTCCCCAGGC 15
[0069]
[0070] * In Table 6, the sequence in bold at the N-terminus represents the T7 promoter (P T7, 87 bp) sequence, and the sequence in bold at the C-terminus represents the sequence (136 bp) with the 8 amino acid sequence including 6 histidine of the T7 terminator (160 bp) removed.
[0071] <Experimental Example 1> Confirmation of Antimicrobial Activity of Chimeric Lysin Protein Against Staphylococcus Aureus Isolates
[0072] Chimeric lysine protein (Lsp-ClyC) synthesized in <Example 2> SH3 Methicillin-resistant Staphylococcus aureus Staphylococcus aureus Experiments were conducted to compare antibacterial activity against strains of , MRSA).
[0073] Specifically, the antimicrobial activity against MRSA strains CCARM3806, CCARM3825, CCARM3832, and CCARM3837 was confirmed using a rapid screening method. Single colonies were cultured overnight in TSB at 200 rpm in a 37 ℃ incubator. The cultured bacteria were treated with 2 x 10⁶ TBS (tryptic soy broth). 7 It was diluted to CFU / mL, and 100 μL was added to a 96-well plate. Up to 1 μL or a minimum of 0.06 μL of protein was mixed with bacteria and incubated at 37°C with shaking at 200 rpm; after 6 hours, OD 600 The values were observed. Antibacterial activity was compared by setting a sample containing triple distilled water instead of DNA Template as a control (DNA Neg).
[0074] As a result, as shown in FIGS. 2a to 2d, Lsp-ClyC SH3 It showed excellent antibacterial activity against all MRSA strains (CCARM3806, CCARM3825, CCARM3832, and CCARM3837).
[0075] <Experimental Example 2> Evaluation of Colony Reduction Efficacy of Chimeric Lysine Protein on Staphylococcus Aureus Isolates in Milk
[0076] Chimeric lysine protein (Lsp-ClyC) produced in <Example 2> SH3 Experiments were conducted to compare the colony reduction efficacy in milk against MRSA strains.
[0077] Specifically, the colony reduction efficacy against MRSA strains CCARM3806, CCARM3825, CCARM3832, and CCARM3837 in milk was confirmed using a rapid screening method. 10 Staphylococcus aureus in fresh milk supplied by Seoul Milk (Seoul Milk Cooperative, Seoul, South Korea) 3 The solution was diluted in milk to a concentration of CFU / mL, and 100 μL of this dilution was added to each well of a 96-well plate. 12 μL of Lsp-ClyC SH3 The sample was added to a 96-well plate and incubated at 37°C for 20 minutes, then shaken at 200 rpm and plated onto TSA (tryptic soy agar). The agar was incubated overnight at 37°C, and the number of colonies was counted the next day. The number of colonies for each chimeric lysine was calculated by comparing it with the control group.
[0078] As a result, as shown in Fig. 3a, Lsp-ClyC SH3 It reduced the number of colonies in all MRSA strains (CCARM3806, CCARM3825, CCARM3832, and CCARM3837).
[0079] <Experimental Example 3> Increase in the antibacterial activity of histidine-removed chimeric lysine protein against Staphylococcus aureus
[0080] Histidine-removed chimeric lysine protein (Lsp-ClyC) produced in <Example 3> SH3 Experiments were conducted to compare the antibacterial activity of -dHis against MRSA strains.
[0081] Specifically, the antimicrobial activity against MRSA strains CCARM3806, CCARM3825, CCARM3832, and CCARM3837 was confirmed using a rapid screening method. Single colonies were cultured overnight in TSB at 200 rpm in a 37 ℃ incubator. The cultured bacteria were treated with 2 x 10⁶ TBS (tryptic soy broth). 7It was diluted to CFU / mL, and 100 μL was added to a 96-well plate. Up to 1 μL or a minimum of 0.015 μL of protein was mixed with bacteria and incubated at 37°C with shaking at 200 rpm; after 6 hours, OD 600 The value was observed.
[0082] As a result, as shown in Figures 4a to 4d, it was shown that the antibacterial activity was increased in all MRSA strains (CCARM3806, CCARM3825, CCARM3832, and CCARM3837).
[0083] <Experimental Example 4> Histidine-removed chimeric lysine protein S. pseudotermedius Confirmation of antibacterial activity against
[0084] Histidine-removed chimeric lysine protein (Lsp-ClyC) produced in <Example 3> SH3 using -dHis) S. pseudotermedius The antibacterial activity against the strain was confirmed using the same method.
[0085] Specifically, S. pseudotermedius The antimicrobial activity of strains (KVNOP1, KVNOP2, KVNOP18, KVNOP19, KVNOP42, KVNOP242) was confirmed using a rapid screening method. Strains KVNOP1, KVNOP2, KVNOP18, KVNOP19, KVNOP42, and KVNOP242 were isolated and identified from the skin and mucous membranes of inflamed dogs or cats and were obtained from an animal hospital. Single colonies were cultured overnight in TSB at 200 rpm in a 37°C incubator. The cultured bacteria were 2 x 10⁶ in TBS (tryptic soy broth). 7 It was diluted to CFU / mL, and 100 μL was added to a 96-well plate. Up to 1 μL or 0.015 μL of protein was mixed with bacteria and incubated at 37°C with shaking at 200 rpm; after 6 hours, OD 600 The value was observed.
[0086] As a result, as shown in FIGS. 5a to 5f, the histidine-removed chimeric lysine protein (Lsp-ClyC SH3 -dHis) is all S. pseudotermedius It showed antibacterial activity in strains.
[0087] Synthesizing the above results, Lsp-ClyC, which links the M23 peptidase and linker of lysostafin with the SH3 domain of ClyC SH3 Chimeric lysine is Staphylococcus aureus and S. pseudotermedius It can exhibit excellent antibacterial effects against, and Lsp-ClyC with histidine removed SH3 -dHis is Staphylococcus aureus and S. pseudotermedius It exhibited increased antibacterial activity against Staphylococcus aureus and S. pseudotermedius It has antibacterial activity against [it], so it can be used as a new antibiotic.
[0088] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.
Claims
Claim 1 A lysine fusion protein consisting of the amino acid sequence of SEQ ID NO. 2 or 4. Claim 2 A lysine fusion protein according to claim 1, characterized in that the lysine fusion protein is encoded by the gene sequence of SEQ ID NO. 3 or SEQ ID NO.
5. Claim 3 In claim 1, the lysine fusion protein is a staphylococcus ( Staphylococcus A lysine fusion protein characterized by having specific antibacterial activity against ). Claim 4 In paragraph 3, the above staphylococcus is Staphylococcus aureus ( Staphylococcus aureus ) and Staphylococcus pseudintermedius A lysine fusion protein characterized by being one or more selected from the group consisting of Claim 5 In paragraph 4, the above-mentioned Staphylococcus aureus is a methicillin-resistant Staphylococcus aureus. Staphylococcus aureus , MRSA) or methicillin-sensitive Staphylococcus aureus (Methicillin-sensitivity Staphylococcus aureus A lysine fusion protein characterized by being MSSA. Claim 6 A nucleic acid molecule encoding the lysine fusion protein of claim 1. Claim 7 A nucleic acid molecule according to claim 1, characterized in that the nucleic acid molecule comprises the base sequence of SEQ ID NO. 3 or SEQ ID NO.
5. Claim 8 A pharmaceutical composition for the prevention or treatment of infectious diseases caused by Staphylococcus, comprising the lysine fusion protein of claim 1 as an active ingredient. Claim 9 A pharmaceutical composition according to claim 7, characterized in that the infectious disease is food poisoning, infection of the skin or tissue, shock caused by toxins, pneumonia, bacteremia, mastitis, or arthritis. Claim 10 An antibiotic comprising the lysine fusion protein of claim 1 as an active ingredient. Claim 11 A disinfectant comprising the lysine fusion protein of claim 1 as an active ingredient. Claim 12 A feed additive composition comprising the lysine fusion protein of claim 1 as an active ingredient.