DNA-based proteolysis targeting chimera (SDTAC) and methods of their use for treating diseases

Abstract

Described herein are nucleic acid complexes which act as spatially activatable PROTACS which can be configured to optimally target a protein of interest with an E3 ligase. The nucleic acid complexes involve double-stranded DNA, XNAs, DNA / RNA hybrids, and double-stranded RNA.

Description

PATENT Attorney Docket No. G8118-04301 DNA-BASED PROTEOLYSIS TARGETING CHIMERA (SDTAC) AND METHODS OF THEIR USE FOR TREATING DISEASES RELATED APPLICATIONS

[0001] This disclosure claims priority to U.S. Provisional Application No. 63 / 525,884, filed July 10, 2023, the contents of which are herein incorporated by reference in their entirety. SEQUENCE STATEMENT

[0002] The instant application contains a Sequence Listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said file is named G8118-04301_SL.xml and is 105,808 bytes in size. FIELD

[0003] The present invention relates to compositions comprising double-stranded DNA complexes which are spatially activatable DNA-based Proteolysis targeting chimera (SDTAC), and methods of their use for treating diseases. Disclosed herein are also methods of creating SDTAC. BACKGROUND

[0004] The following includes information that may be useful in understanding the present invention. It is not an admission that any of the information, publications or documents specifically or implicitly referenced herein is prior art, or essential, to the presently described or claimed inventions. All publications, patents, related applications, and other written or electronic materials mentioned or identified herein are hereby incorporated herein by reference in their entirety. The information incorporated is as much a part of the application as filed as if all of the text and other content was repeated in the application, and should be treated as part of the text and content of the application as filed.

[0005] Alterations in gene expression levels, exceeding or falling short of specific thresholds, can critically affect phenotypes and give rise to numerous human diseases. Approximately 20,300 proteins comprise the human proteome, and the meticulous and rigorous regulation of these proteins is fundamental for preserving cellular and organismal equilibrium. Notably, many human diseases originate from aberrant proteins, especially those that are overexpressed or hyperactivated. Target protein level regulation within cells can be categorized into three primary tiers.PATENT Attorney Docket No. G8118-04301

[0006] The first tier involves the development of gene-editing technologies, particularly CRISPR-Cas9, has revolutionized the field of genetics by providing the capability to alter the DNA sequence at precise locations in the genome. Although this technique offers exceptional precision and versatility, the use of CRISPR-Cas9 and other gene-editing techniques also poses several limitations, including lacking the capacity for dynamic target protein, efficiency, off-target effects, delivery, and potentially leading to genetic compensation.

[0007] The second tier pertains to translational level regulation, utilizing RNA interference (RNAi) technology. RNAi allows for the targeted silencing of specific genes, makes a very versatile tool that can be used in a wide range of research and therapeutic application, the process of designing and using RNAi molecules is relatively straightforward. However, here are some of the limitations, such as delivering RNAi molecules to cells, off- target effect, the effects of RNAi are typically temporary, and relatively low efficiency.

[0008] The third tier concerns protein-level regulation, employing the chemical knockdown of target proteins via Proteolysis-Targeting Chimeras (PROTAC). PROTACs consist of three main components: a target ligand, a linker, and an E3 ligase targeting binder. By using a specific ligand and E3 ligase targeting binder, a PROTAC can be designed to selectively target a specific protein for degradation, offering a targeted approach to modifying cellular function. This strategy provides selectively tagging disease-associated proteins for degradation, be highly potent to achieve the protein knockdown, target their undruggable proteins which is difficult to target with traditional small molecule inhibitors. PROTAC carries out its function through a catalytic cycle process, allowing PROTAC to operate effectively, even at low doses. Unlike conventional small molecule inhibitors, which compete for and occupy active sites, PROTAC work by inducing the degradation of entire proteins, rather than inhibiting their function, through a repeated, iterative mode of action. By degrading the entire protein, PROTAC can disrupt these non-enzymatic functions proteins, which could potentially have therapeutic benefits. While these individual strategies have demonstrated promising results for single target genes or proteins, their efficacy against multifactorial diseases, especially tumors, is somewhat limited. The length and composition of the linker can have a significant impact on the efficacy of the PROTAC, and it often needs to be optimized for each specific application. SUMMARY

[0009] The inventions described and claimed herein have many attributes and embodiments including, but not limited to, those set forth or described or referenced in thisPATENT Attorney Docket No. G8118-04301 Summary. It is not intended to be all-inclusive and the inventions described and claimed herein are not limited to or by the features or embodiments identified in this introduction, which is included for purposes of illustration only and not restriction.

[0010] This disclosure provides for a nucleic acid complex comprising: a first strand nucleic acid sequence comprising an E3 ligase targeting binder; and a second strand nucleic acid sequence comprising a Protein of Interest (POI) ligand, wherein the first strand nucleic acid sequence and the second strand nucleic acid sequence are at least partially complementary. In some aspects, the first strand nucleic acid sequence and the second strand nucleic acid sequence independently can comprise one or a plurality of modified bases. The one or a plurality of modified bases can be selected from a click chemistry-adapted base, an aldehyde-adapted base, or a thiol-adapted base. In some aspects,

[0011] In some aspects, the first strand nucleic acid sequence comprises an E3 ligase targeting binder covalently connected to a first modified base, and the second strand nucleic acid sequence comprises a Protein of Interest (POI) ligand covalently connected to a second modified base.

[0012] In some aspects, the first modified base nucleic acid strand is complementary to the second modified base nucleic acid strand.

[0013] In some aspects, the first strand nucleic acid sequence comprises a plurality of base positions, and the second strand nucleic acid sequence comprises a plurality of base positions. In some aspects, the POI ligand is covalently connected to a first modified base which is positioned from 1 to 100 base positions apart from a second modified base covalently connected to an E3 ligase targeting binder.

[0014] In some aspects, the nucleic acid complex can further comprise a Protein of Interest preferentially bound to the POI ligand. In some aspects, the nucleic acid complex can further comprise an E3 ligase preferentially bound to the E3 ligase targeting binder.

[0015] In some aspects, the first strand nucleic sequence and the second strand nucleic acid sequence can independently comprise DNA or RNA.

[0016] In some aspects, the E3 ligase targeting binder can be covalently connected to a click-chemistry modified base in the first strand nucleic acid sequence.

[0017] In some aspects, the POI ligand can be covalently connected to a click-chemistry modified base in the second strand nucleic acid sequence.

[0018] In some aspects, the first strand nucleic acid sequence or the second strand nucleic acid sequence can independently further comprise a cell-receptor ligand. The cell-receptorPATENT Attorney Docket No. G8118-04301 ligand can be covalently connected to a modified base on a nucleotide within the first or second strand nucleic acid sequence. The cell-receptor ligand can bind to a cell-receptor on a target cell to increase the rate of internalization of the nucleic acid complex.

[0019] In some aspects, the first strand nucleic acid sequence can be covalently connected to the second strand nucleic acid sequence. The covalent connection can be reversible with light activation.

[0020] In some aspects, the first strand can comprise a first strand 5’ terminus and a first strand 3’ terminus, the second strand can comprise a second strand 5’ terminus and a second strand 3’ terminus, wherein the first strand 3’ terminus is covalently connected to the second strand 5’ terminus or the first strand 5’ terminus is covalently connected to the second strand 3’ terminus. The covalent connection can be a spacer in a spacer-modified nucleotide. The spacer-modified nucleotide can be a 3’ spacer (which can include or exclude a nucleotide made using Spacer Phosphoramidite C3 (Glen Research, Maravai Life Sciences, San Diego, CA).

[0021] In some aspects, the nucleic acid complex can further comprise a third strand nucleic acid sequence which is partially complementary to a portion of the first strand nucleic acid sequence or the second strand nucleic acid sequence, and is competitive for the respective cognate sequence. The third strand nucleic acid sequence can be reversibly covalently connected to the first strand nucleic acid sequence or the second strand nucleic acid sequence. The third strand nucleic acid sequence can displace all or a portion of the first strand nucleic acid sequence or the second strand nucleic acid sequence with the cognate hybridization sequence. The displacement of the third strand nucleic acid sequence can occur in the presence of a selected DNA sequence, such that the E3 ligase targeting binder and the POI ligand can be brought into closer proximity in the presence of the selected DNA sequence.

[0022] In some aspects, this disclosure provides for a pharmaceutical composition comprising a nucleic acid complex as described herein and a pharmaceutically acceptable carrier.

[0023] In some aspects, this disclosure provides for a method of killing a cancer cell, the method comprising contacting a nucleic acid complex as described herein with a cancer cell at a nucleic acid complex concentration of sufficient amount to kill said cancer cell.

[0024] In some aspects, this disclosure provides for a method of treating cancer in a subject in need thereof, the method comprising administering to a subject a therapeuticallyPATENT Attorney Docket No. G8118-04301 effective amount of a pharmaceutical composition as described herein to said subject. In some aspects, the method can further comprise administering a therapeutically effective amount of an anticancer agent to said subject.

[0025] In some aspects, this disclosure provides for a use of a nucleic acid complex as described herein in the manufacture of a medicament for treating cancer in a subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] FIG. 1 provides an overview of DNA-based Proteolysis Targeting Chimera (DTAC) and their uses. DTAC can be utilized for multipurpose applications: 1) DNA / RNA / synthetic nucleotide-based programmable proteolysis targeting chimeras. 2) DTAC can be utilized both for drug development and therapeutic agents. 3) DNA scaffold can be used for finding new E3 ligases and protein inhibitors using DNA encoded library. 4) DNA scaffold can be used to control orientation and distance between E3-i and POI-i to facilitate ubiquitin transfer. 5) DNA scaffold can be used to improve aqueous solubility of inhibitors. 6) Conformationally locked DNA based programmable scaffold for conditional PROTACs.

[0027] FIG. 2 provides an overview of Spatial activation of DNA-based Proteolysis Targeting Chimera (SDTAC). The schematic shows a DNA templated spatially programmable DTAC with conditional activation of protein degradation. In the inactive state, the two ligands (E3 ligase targeting binder (“E3-i”) and POI inhibitor) are in a spatially locked conformation with a far distance between each other. This gets activated by keys such as DNA / RNA, protein / peptide, chemical stimuli, or UV / visible / infrared light, bringing the two ligands in proximity at optimal distance in the active state. "Conditional" or "spatial" activation are used interchangeably in the text.

[0028] FIG. 3 shows the chemical structures and synthetic route for the Azido-PEG3- pomalidomide (E3-i). 4-Fluorothalidomide and Azido-PEG2-amine react in presence of DIPEA at 100°C for 16 hours to yield the desired Azido-PEG3-pomalidomide product.

[0029] FIGS. 4A-4B show the Nuclear magnetic resonance (NMR) characterization of the synthesized Azido-PEG3-pomalidomide molecule. FIG. 4A shows the 1H NMR characterization, with corresponding peaks labeled for the pomalidomide hydrogen atoms. FIG. 4B shows the 13 C NMR spectrum.PATENT Attorney Docket No. G8118-04301

[0030] FIG. 5 shows the ESI-MS spectra of the synthesized Azido-PEG3-Pomalidomide in MeOH solvent. The expected [M+Na]+m / z is 453.41 and the observed [M+Na]+m / z is 453.15, confirming the identity of the product.

[0031] FIG. 6 shows the chemical structures and synthetic route for the Azido-PEG3- palbociclib (POI-i). Palbociclib and Azide-PEG3-iodide react in presence of K2CO3 and Bu4N+Br- at 90°C for 6 hours to yield the desired Azido-PEG3-palbociclib product.

[0032] FIGS. 7A-7B show the NMR characterization of the synthesized Azido-PEG3- palbociclib molecule. FIG. 7A shows the 1H NMR characterization of the synthesized Azido-PEG3-palbociclib molecule, with corresponding peaks labeled for the palbociclib hydrogen atoms. FIG. 7B shows the 13C NMR spectrum

[0033] FIG. 8 shows the ESI-MS spectra of the synthesized Azido-PEG3-palbociclib in MeOH solvent. The expected [M+H]+m / z is 605.32 and the observed [M+H]+m / z is 605.33, confirming the identity of the product.

[0034] FIG. 9 shows the structure of the amino-serinol phosphoramidite (abbreviated as iNH) used to insert an internal amine modification into the ssDNA sequences.

[0035] FIGS. 10A-10B depict the schematic for conjugation of ligands (E3-i and POI-i) to DNA. FIG. 10A shows the reaction of the amino-serinol phosphoramidite DNA (1) on CPG solid support being cleaved using 30% ammonia at 55°C for 120 min to yield the free amine DNA (2). FIG. 10B shows the free amine reacting with DBCO-NHS ester in 1X PBS pH 8.5 at 37°C for 3 hours to give the DBCO-modified DNA (3). FIG. 10B shows the reaction of the azide-modified ligand being conjugated to the DBCO-DNA (3) via copper- free click chemistry at 37°C overnight to yield the final ligand-DNA conjugate (4).

[0036] FIGS. 11A-11B show the ESI-MS characterization of amino-serinol modified ssDNA strands used to construct the DTAC library (DTAC-V1-iNH to V6-iNH). FIG. 11A shows the ESI-MS for strands SA-1-iNH to SA-5-iNH. The sequences of each strand with iNH and phosphorothioate (*) modifications are provided herein:

[0037] SA-1-iNH: C*C*G*C AAT CTC CTT CAT C*G*C*iNH*C (SEQ ID NO: 1),

[0038] SA-2-iNH: C*C*G*C AAT CTC CTT CAT C*iNH*G*C*C (SEQ ID NO: 2),

[0039] SA-3-iNH: C*C*G*C AAT CTC iNH CTT CAT C*G*C*C (SEQ ID NO: 3),

[0040] SB-1-iNH: G*iNH*G*C*G ATG AAG GAG ATT G*C*G*G (SEQ ID NO: 4),

[0041] SB-2-iNH: G*G*C* iNHG ATG AAG GAG ATT G*C*G*G (SEQ ID NO: 5),

[0042] SB-3-iNH: CG*G*C*G ATG AAG iNH GAG ATT G*C*G*G (SEQ ID NO: 6).PATENT Attorney Docket No. G8118-04301

[0043] FIG. 11B shows the ESI-MS for strands SB-1-iNH to SB-6-iNH. The sequences of each strand with iNH and phosphorothioate (*) modifications are provided herein:

[0044] SA-4-iNH: C*C*G*C AAT CTC CTT CiNHAT C*G*C*C (SEQ ID NO: 7),

[0045] SA-5-iNH: C*C*G*C iNH AAT CTC CTT CAT C*G*C*C (SEQ ID NO: 8),

[0046] SA-6-iNH: C*C*G*C AAT CTC CTT CAT C*iNH*G*C*C (SEQ ID NO: 2),

[0047] SB-4-iNH: G*G*C*G ATG AAG iNH GAG ATT G*C*G*G (SEQ ID NO: 9),

[0048] SB-5-iNH: G G*G*C*G ATG AAG iNH GAG ATT G*C*G*G (SEQ ID NO: 10),

[0049] SB-6-iNH: G*G*C*G ATG AAG GAG ATT G*iNH*C*G*G (SEQ ID NO: 11).

[0050] FIGS. 12A-12B show the ESI-MS characterization of the E3-i and POI-i conjugated ssDNA used to construct the DTAC library (DTAC-V1 to V6). FIG. 12A shows the ESI-MS for strands SA-1-E3-i to SA-5-E3-i. The sequences of each E3-i and POI-i modified strand with phosphorothioate (*) modifications are provided herein:

[0051] SA-1-E3-i: C*C*G*C AAT CTC CTT CAT C*G*C*E3-i*C (SEQ ID NO: 12),

[0052] SA-2-E3-i: C*C*G*C AAT CTC CTT CAT C*E3-i*G*C*C (SEQ ID NO: 13),

[0053] SA-3-E3-i: C*C*G*C AAT CTC E3-I CTT CAT C*G*C*C (SEQ ID NO: 14),

[0054] SB-1-E3-i: G*POI-i*G*C*G ATG AAG GAG ATT G*C*G*G (SEQ ID NO: 15),

[0055] SB-2-E3-i: G*G*C*POI-iG ATG AAG GAG ATT G*C*G*G (SEQ ID NO: 16),

[0056] SB-3-E3-i: G*G*C*G ATG AAG POI-I GAG ATT G*C*G*G (SEQ ID NO: 17).

[0057] FIG. 12B shows the ESI-MS for strands SB-1-POI-i to SB-6-POI-i. The sequences of each E3-i and POI-i modified strand with phosphorothioate (*) modifications are provided herein:

[0058] SA-4-E3-i: C*C*G*C AAT CTC CTT CE3-iAT C*G*C*C (SEQ ID NO: 18),

[0059] SA-5-E3-i: C*C*G*C E3-iAAT CTC CTT CAT C*G*C*C (SEQ ID NO: 19),

[0060] SA-6-E3-i: C*C*G*C AAT CTC CTT CAT C*E3-i*G*C*C (SEQ ID NO: 13),

[0061] SB-4-E3-i: G*G*C*G ATG AAG POI-I GAG ATT G*C*G*G (SEQ ID NO: 17),

[0062] SB-5-E3-i: G*G*C*G ATG AAG POI-I GAG ATT G*C*G*G (SEQ ID NO: 17),

[0063] SB-6-E3-i: G*G*C*G ATG AAG GAG ATT G*POI-i*C*G*G (SEQ ID NO: 20).PATENT Attorney Docket No. G8118-04301

[0064] FIG. 13A displays a schematic showing self-assembly of hetero-bifunctional DTAC via Watson-Crick base pairing through annealing of the ligand-modified strands A and B. FIG. 13B shows screened spatially programmable DTAC library designs with different positions (V1 to V6) and increments in distance between E3 ligase and POI from V1 to V6.

[0065] FIG. 14 shows a 12% native PAGE gel electrophoresis analysis of the various annealed DTACs (V1 to V6), indicating a well-formed DTAC library.

[0066] FIG. 15 shows Western blot analysis of CDK6 and Cyclin D1 protein levels in U251 cells treated with 20 nM or 100 nM concentrations of the DTAC library (V1 to V6) or unmodified DNA duplex control for 14 hours. β-actin serves as a loading control. DTAC-V3 shows the most efficient degradation of CDK6 and Cyclin D1.

[0067] FIGS. 16A-16B shows dose- and time-dependent degradation of CDK6, CDK4, and Cyclin D1 proteins in U251 cells treated with DTAC-V3. FIG. 16A shows protein levels after treatment with different concentrations of DTAC-V3. FIG. 16B shows a time course of protein levels in cells treated with 100 nM DTAC-V3.

[0068] FIG. 17 compares the degradation of CDK4, CDK6, and Cyclin D1 proteins in U251 cells by DTAC-V3 versus the PROTAC CP-10 and the CDK4 / 6 inhibitor palbociclib. Cells were treated with DMSO vehicle control, 20 nM or 100 nM of each compound for 16 hours. DTAC-V3 shows superior degradation of the entire CDK4 / 6 / Cyclin D1 complex compared to CP-10 which only degrades CDK4 / 6 and palbociclib which has no effect.

[0069] FIG. 18 examines the mechanism of DTAC-V3 mediated protein degradation. U251 cells were pre-treated with 5 μM of the proteasome inhibitors MG132 or PR171 for 2 hours followed by addition of DTAC-V3 for 10 hours. Proteasome inhibition blocks the ability of DTAC-V3 to degrade CDK4, CDK6 and Cyclin D1 proteins.

[0070] FIG. 19 further probes the mechanism of DTAC-V3 using a ligand competition assay. U251 cells were co-treated with DTAC-V3 and an excess of either the E3 ligand pomalidomide or the CDK4 / 6 inhibitor palbociclib for 16 hours. Both competing ligands prevent DTAC-V3 mediated degradation of CDK4, CDK6 and Cyclin D1 proteins.

[0071] FIG. 20 shows the anti-tumor efficacy of DTAC-V3 in U251 glioblastoma cells. Left panel: Cells were treated with 100 nM control DNA, DNA-E3i, DNA-POIi, or DTAC- V3 for the indicated time points and cell viability measured by CCK-8 assay. Right panel: Viability of U251 cells after 3 days of treatment. DTAC-V3 significantly inhibits U251 cellPATENT Attorney Docket No. G8118-04301 growth compared to the individual ligand controls. Data represent mean ± S.D. from two independent experiments with six replicates each.

[0072] FIG. 21 demonstrates the effect of DTAC-V3 on U251 glioblastoma cell colony formation. Cells were treated with 100 nM control DNA, DNA-E3i, DNA-POIi, or DTAC- V3 and allowed to form colonies. DTAC-V3 potently prevents colony formation compared to controls.

[0073] FIG.22 displays a schematic illustration of the light-activated SDTAC using a photocleavableCNVK crosslinker. In the inactive state, theCNVK (red) on the blocker strand is crosslinked to thymine bases (purple) on strand A, preventing it from hybridizing to strand B. Irradiation at 312 nm cleaves theCNVK crosslinks, allowing strand A to displace the blocker from strand B, resulting in an active SDTAC conformation with the E3-i and POI-i ligands at an optimal distance for target degradation.

[0074] FIG. 23 displays a detailed mechanism for the light-activatable SDTAC. Step 1: The blocker strand is annealed to strand A and crosslinked using 365 nm UV light. Step 2: Strand B is added, forming an inactive partially duplexed structure. Step 3: Irradiation at 312 nm cleaves theCNVK crosslinks between the blocker and strand A, allowing full hybridization of strands A and B to form the active SDTAC structure.

[0075] FIG. 24 shows schematic of sequences of strand A (Strand A sequence 5’ to 3’: GGATGGGAGATGAAGGAGGGTGTGGTGAGGTGG (SEQ ID NO: 21)) and blocker strands (1CNVK-strand sequence 5’ to 3’: CCACCTCACCACACNVKCCTCC (SEQ ID NO: 22) and the 3CNVK-strand sequence 5’ to 3’: CCACNVKCTCACNVKCACACNVKCCTCC (SEQ ID NO: 23)) used to construct the light-activatable SDTAC. Blocker strands containing either one or threeCNVK modifications (oneCNVK modification is shown in the figure) were designed to test the crosslinking efficiency. Thymine bases on strand A that crosslink toCNVK upon 365 nm irradiation are shown in purple.

[0076] FIG. 25 displays ESI-MS characterization of the 1-CNVKand 3-CNVKmodified blocker strands. The observed m / z are in agreement with the calculated values.

[0077] FIG. 26 displays gel electrophoresis images for the efficiency of photocrosslinking. Denaturing PAGE analysis of the 365 nm UV light-induced crosslinking between strand A and the 1-CNVKor 3-CNVKmodified blocker strands. Crosslinking was performed for the indicated times from 0-300 seconds. The crosslinked products show reduced gel mobility compared to the non-crosslinked strands.PATENT Attorney Docket No. G8118-04301

[0078] FIGS. 27A-27B display a schematic illustrating the light-dependence of SDTAC activation. In the absence of 312 nm light as shown in FIG. 27A, the crosslinked blocker strand prevents hybridization of strands A and B, maintaining an inactive SDTAC. Irradiation at 312 nm as shown in FIG. 27B, cleaves the crosslinks and allows blocker displacement to form the active SDTAC structure.

[0079] FIG. 28 displays a gel electrophoresis image of a native PAGE analysis which confirms the light-induced strand displacement mechanism of SDTAC activation. Lane a shows strand A alone. Lanes b and c show formation of the slower-migrating crosslinked product upon 365 nm irradiation of strand A with the blocker. Lane d shows that without crosslinking, strand B displaces the blocker from strand A to form an active SDTAC. Lane e shows that when the blocker is crosslinked to strand A, strand B cannot displace it, leaving the SDTAC in an inactive state.

[0080] FIG. 29 displays a gel electrophoresis image of a native PAGE timecourse analysis of the 312 nm light-induced crosslink reversal and SDTAC activation. Strand A / blocker / strand B complex was irradiated at 312 nm for 0-10 min and analyzed by gel. The crosslinked blocker is displaced by strand B starting at 2 min, with full activation seen by 8 min at the light intensity used (1.8 mW / cm2).

[0081] FIG. 30 displays a schematic of an alternative SDTAC design with a single photoactivatable lock. The blocker is attached to strand A via a stable C3 spacer on one end. The other end contains a photocleavable or chemically / biologically cleavable group to lock the blocker in place and maintain an inactive SDTAC until activated.

[0082] FIG. 31 displays a schematic of photocaged nucleotides for higher wavelength light activation of SDTAC. Caged nucleotides that are uncaged at 365-500 nm could be placed in strand A to prevent full hybridization to strand B until activated by light or other stimuli.

[0083] FIG. 32 displays a design of an mRNA sensing SDTAC based on DNA strand displacement. The sensor strand S1 initially occupies strand L2, keeping the POI-i and E3-i ligands far apart in an inactive state. Binding of a target mRNA to the toehold on S1 displaces it from L2, allowing L1 to fully hybridize, bringing the ligands into proximity for target degradation.

[0084] FIG. 33 shows an alternative mRNA sensor design utilizing steric hindrance- based caging of the POI-i ligand. In the initial state, the POI-i is buried between the DNAPATENT Attorney Docket No. G8118-04301 helices formed by strands L1, L2 and S1, preventing binding to its target protein. mRNA binding displaces S1, exposing POI-i and allowing formation of an active SDTAC.

[0085] FIGS. 34A-34D show a scheme for constructing cell-selective SDTACs by incorporating disulfide / diselenide groups to promote cytosolic delivery only when bound to a cell-specific targeting ligand.

[0086] FIG. 34A depicts disulfide / diselenide phosphoramidites incorporated into the DNA component.

[0087] FIG. 34B depicts cell-targeting peptides or small molecules conjugated to a separate DNA strand.

[0088] FIG. 34C depicts an embodiment where the functional components self-assemble into a complete SDTAC that selectively enters cells expressing the target receptor.

[0089] FIG. 34D depicts an embodiment where the functional components self-assemble into a complete SDTAC that selectively enters cells expressing the target receptor. DETAILED DESCRIPTION

[0090] Certain Definitions

[0091] As used herein, the term “about” refers to the stated value and typical degrees of error of the measurement of said value. If not otherwise explicitly recited herein, the term “about” refers to any number within + / - 10% of the recited value.

[0092] The term “and / or” as used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example “A and / or B” is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.

[0093] “Operably-linked” refers to the association two chemical moieties so that the function of one is affected by the other, e.g., an arrangement of elements wherein the components so described are configured so as to perform their usual function.

[0094] The term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, D or L-form, made of monomers (nucleotides) containing a sugar, phosphate and a base that is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing synthetic analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as wellPATENT Attorney Docket No. G8118-04301 as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues.

[0095] The terms "nucleotide sequence", “polynucleic acid”, or “nucleic acid sequence” refer to a sequence of bases (purines and / or pyrimidines) in a polymer of DNA or RNA, which can be single-stranded or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers, and / or backbone modifications (e.g., a modified oligomer, such as a morpholino oligomer, phosphorodiamate morpholino oligomer or vivo-mopholino). The terms “oligo”, “oligonucleotide” and “oligomer” may be used interchangeably and refer to such sequences of purines and / or pyrimidines. The terms “modified oligos”, “modified oligonucleotides”, “modified oligomers”, “modified ribonucleosides” or “modified ribonucleotides” may be similarly used interchangeably, and refer to such sequences that contain synthetic, non- natural or altered bases and / or backbone modifications. In some embodiments, the modified oligos can comprise chemical modifications to the internucleotide phosphate linkages and / or to the backbone sugar.

[0096] Modified nucleotides can include or exclude: alkylated purines and / or pyrimidines; acylated purines and / or pyrimidines; or other heterocycles. These classes of pyrimidines and purines can include or exclude: pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N6-methyladenine; 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5- fluorouracil; 5-bromouracil; 5-carboxymethylaminomethyl-2-thiouracil; 5- carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine; 1- methyladenine; 1-methylpseudouracil; 1-methylguanine; 2,2-dimethylguanine; 2- methyladenine; 2-methylguanine; 3-methylcytosine; 5-methylcytosine; N6-methyladenine; 7- methylguanine; 5-methylaminomethyl uracil; 5-methoxy amino methyl-2-thiouracil; β-D- mannosylqueosine; 5-methoxycarbonylmethyluracil; 5-methoxyuracil; 2-methylthio-N6- isopentenyladenine; uracil-5-oxyacetic acid methyl ester; psueouracil; 2-thiocytosine; 5- methyl-2 thiouracil, 2-thiouracil; 4-thiouracil; 5-methyluracil; N-uracil-5-oxyacetic acid methylester; uracil 5-oxyacetic acid; queosine; 2-thiocytosine; 5-propyluracil; 5- propylcytosine; 5-ethyluracil; 5-ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine; and 2,6,-diaminopurine; methylpsuedouracil; 1-methylguanine; 1-methylcytosine. Backbone modifications are can include or exclude: chemical modifications to the phosphate linkage (e.g., phosphorodiamidate, phosphorothioate (PS), N3’phosphoramidate (NP),PATENT Attorney Docket No. G8118-04301 boranophosphate, 2’,5’phosphodiester, amide-linked, phosphonoacetate (PACE), morpholino, peptide nucleic acid (PNA) and inverted linkages (5’-5’ and 3’-3’ linkages)) and sugar modifications (e.g., 2’-O-Me, UNA, LNA). Sugar modified nucleic acids includes xeno nucleic acids (XNA), which are synthetic nmucleic acid analogues that have a different backbone from the ribose and eoxyribose found ni the nucleic acids of naturally occurring RNA and DNA. XNAs can include or exclude: locked nucleic acids (LNA), unlocked nucleic acids (UNA), 1,5-Anhydrohexitol nucleic acid (HNA), Cyclohexene nucleic acid (CeNA), Threose nucleic acid (TNA), Glycol nucleic acid (GNA), Peptide nucleic acid (PNA), and Fluoroarabino nucleic acid (FANA).

[0097] The oligonucleotides described herein may be synthesized using standard solid or solution phase synthesis methods. In certain embodiments, the oligonucleotides are synthesized using solid-phase phosphoramidite chemistry (U.S. Patent No. 6,773,885) with automated synthesizers. Chemical synthesis of nucleic acids allows for the production of various forms of the nucleic acids with modified linkages, chimeric compositions, and nonstandard bases or modifying groups attached in chosen places through the nucleic acid’s entire length.

[0098] Certain embodiments of the invention encompass isolated or substantially purified nucleic acid compositions. In the context of the present invention, an "isolated" or "purified" DNA molecule or RNA molecule is a DNA molecule or RNA molecule that exists apart from its native environment and is therefore not a product of nature. An isolated DNA molecule or RNA molecule may exist in a purified form or may exist in a non-native environment such as, for example, a transgenic host cell. For example, an "isolated" or "purified" nucleic acid molecule is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In one embodiment, an "isolated" nucleic acid is free of sequences that naturally flank the nucleic acid (i.e., sequences located at the 5′ and 3′ ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.

[0099] By “portion” or “fragment,” as it relates to a nucleic acid molecule, sequence or segment of the invention, when it is linked to other sequences for expression, is meant a sequence having at least 20 nucleotides, at least 150 nucleotides, or at least 400 nucleotides. If not employed for expressing, a “portion” or “fragment” means at least 9, at least 12, at least 15, or at least 20, consecutive nucleotides, e.g., probes and primers (oligonucleotides), corresponding to the nucleotide sequence of the nucleic acid molecules of the invention.PATENT Attorney Docket No. G8118-04301

[0100] The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that is accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.

[0101] The term "complementary" as used herein refers to the broad concept of complementary base pairing between two nucleic acids aligned in an antisense position in relation to each other. When a nucleotide position in both of the molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are considered to be complementary to each other at this position. Thus, two nucleic acids are substantially complementary to each other when at least about 50%, at least about 60%, or at least about 80% of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T (A:U for RNA) and G:C nucleotide pairs).

[0102] As used herein, the term "therapeutically effective amount" means an amount of a compound of the present invention that (i) treats the particular disease, condition, or disorder, (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein. In the case of cancer, the therapeutically effective amount of the drug may reduce the number of cancer cells; reduce the tumor size; inhibit (i.e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and / or relieve to some extent one or more of the symptoms associated with the cancer. To the extent the drug may prevent growth and / or kill existing cancer cells, it may be cytostatic and / or cytotoxic. For cancer therapy, efficacy can be measured, for example, by assessing the time to disease progression (TTP) and / or determining the response rate (RR).

[0103] As used herein, the term “subject” as used herein refers to humans, higher non- human primates, rodents, domestic, cows, horses, pigs, sheep, dogs and cats. In one embodiment, the subject is a human.PATENT Attorney Docket No. G8118-04301

[0104] As used herein, the terms "treat" and "treatment" refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or decrease an undesired physiological change or disorder. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented.

[0105] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. A "tumor" comprises one or more cancerous cells. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers include squamous cell cancer (e.g., epithelial squamous cell cancer), lung cancer including small- cell lung cancer, non-small cell lung cancer ("NSCLC"), adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, as well as head and neck cancer. Gastric cancer, as used herein, includes stomach cancer, which can develop in any part of the stomach and may spread throughout the stomach and to other organs; particularly the esophagus, lungs, lymph nodes, and the liver.

[0106] As used herein, the term "synergistic" as used herein refers to a therapeutic combination that is more effective than the additive effects of the two or more single agents.

[0107] Spatially Conditional PROTAC ligands

[0108] The optimal proximity between two PROTAC ligands plays a crucial role in determining protein degradation efficiency. Described herein are a system which affords the manipulating of the distance and steric effects of PROTAC ligands through programmable and reconfigurable nucleic acid-based scaffolds which enable conditional activity of DTACPATENT Attorney Docket No. G8118-04301 within specific cells. Applications include the opportunity to turn on and off the activity of DTAC through a conditionally programmable scaffold without any modifications of PROTAC ligands. This conditional-DTAC activity relies on external triggers such as light, chemical stimuli, biologics, and overexpression of specific genes in diseased cells such as cancer. Under these circumstances, SDTAC activates, leading to targeted protein degradation. In contrast, healthy cells lacking these external and internal stimuli remain minimally affected by SDTAC activation, ensuring no unintended degradation of proteins. The methods described herein minimize off-target effects, advancing precision medicine in targeted protein degradation.

[0109] Pharmaceutical Compositions

[0110] In some aspects, this invention provides for a pharmaceutical composition comprising a nucleic acid complex described herein and a pharmaceutically acceptable carrier. In some aspects, the pharmaceutical composition further comprises at least one therapeutic agent.

[0111] In some aspects, this invention provides for a method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of the nucleic acid complexes or composition comprising such as described herein. In some aspects, the cancer is breast cancer, ovarian cancer, melanoma or lung cancer.

[0112] In certain aspects, the present invention provides a pharmaceutical composition comprising the nucleic acid complexes as described herein and a pharmaceutically acceptable carrier.

[0113] Nucleic Acid Strands

[0114] The length of each nucleic acid strand is variable and depends on, for example, the purpose of each strand. In certain embodiments, the nucleic acid strands are about 15 nucleotides in length to about 20,000 nucleotides in length, about 15 nucleotides in length to about 10,000 nucleotides in length, about 15 to about 7500 nucleotides in length, about 3000 to about 7000 nucleotides in length, about 5000 to about 7000 nucleotides in length, about 1500 to about 6500 nucleotides in length, about 1000 to about 7000 nucleotides in length, about 5500 to about 6500 nucleotides in length, about 15 to about 5000 nucleotides in length, about 15 to about 4000 nucleotides in length, about 15 to about 3000 nucleotides in length, about 250 to about 3000 nucleotides in length, about 500 to about 3000 nucleotides in length, about 1000 to about 3000 nucleotides in length, or about 1500 to about 2500 nucleotides in length, or any length between any of the aforementioned values. In certain embodiments, thePATENT Attorney Docket No. G8118-04301 nucleic acid strand is about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1600, about 1700, about 1800, about 1900, about 2000, about 2100, about 2200, about 2300, about 2400, about 2500, about 2600, about 2700, about 2800, about 2900, about 3000, about 3100, about 3200, about 3300, about 3400, about 3500, about 3600, about 3700, about 3800, about 3900, about 4000, about 4100, about 4200, about 4300, about 4400, about 4500, about 4600, about 4700, about 4800, about 4900, about 5000, about 5100, about 5200, about 5300, about 5400, about 5500, about 5600, about 5700, about 5800, about 5900, about 6000, about 6100, about 6200, about 6300, about 6400, about 6500, about 6600, about 6700, about 6800, about 6900, about 7000, about 7100, about 7200, about 7300, about 7400, about 7500, about 7600, about 7700, about 7800, about 7900, about 8000, about 8100, about 8200, about 8300, about 8400, about 8500, about 8600, about 8700, about 8800, about 8900, about 9000, about 9100, about 9200, about 9300, about 9400, about 9500, about 9600, about 9700, about 9800, about 9900, or about 100000 nucleotides in length.

[0115] In some embodiments, the nucleic acids strands are synthesized de novo using chemical or biological methods. The nucleic acids can be chemically synthesized in a step- wise manner. In some embodiments, the nucleic acids can be synthesized using the cyanoethyl phosphoramidite method (Beaucage, S. L., and Caruthers, M. H., Tet. Let. 22:1859,1981); nucleoside H-phosphonate method (Garegg et al., Tet. Let. 27:4051- 4054,1986; Froehler et al., Nucl. Acid. Res. 14:5399-5407, 1986; Garegg et al., Tet. Let. 27:4055-4058, 1986, Gaffney et al., Tet. Let. 29:2619-2622,1988). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market, including the use of an in vitro transcription method. In some embodiments, the RNA strands of this discusre are synthesized de novo by transcription.

[0116] In certain embodiments, the nucleic acid sequence strands comprise one or more modified nucleic acids. The modified nucleic acids can be a modified ribonucleotide, modified ribonucleoside, modified nucleotide, or modified nucleotide. In some embodiments, the modified ribonucleoside can be selected from the RNA-incorporated from, in part, 5-Aminoallyluridine-5'-Triphosphate (Trilink, N-1062), or Biotin-16- Aminoallyluridine-5'-Triphosphate (Trilink, N-5005).PATENT Attorney Docket No. G8118-04301

[0117] In some embodiments, the modified nucleic acid can comprise a click chemistry- adapted base, an aldehyde-adapted base, or a thiol-adapted base. The modified nucleic acid can comprise an amino-modified nucleic acid, which has been further modified (e.g., by the reactionof an NHS-linked functional group) with a functional group. In some aspects, the amino-modified nucleic acid is incorporated into the nucleic acid sequence by the addition of 5-Aminoallyluridine-5'-Triphosphate during a transcription step of forming the ssRNA sequence. In some embodiments, the amino-modifier nucleic acids are available from Glen Research, Inc. (Miravai, Inc., San Diego, CA), and can include or exclude a modified base made by a phosphoramidite selected from: Amino-Modifier C6 dC, Amino-Modifier C2 dT, Amino-Modifier C6 dT, Amino-Modifier C6 dA, N2-Amino-Modifier C6 dG, Fmoc Amino- Modifier C6 dT, Amino-Modifier Serinol Phosphoramidite, Amino-Modifier C6-U Phosphoramidite, 5'-Amino-Modifier 5, 5'-Amino-Modifier C6, 5'-DMS(O)MT-Amino- Modifier C6, 5'-Amino-Modifier C12, 5'-Amino-Modifier C6-TFA, 5'-Amino-Modifier TEG CE-Phosphoramidite, 5'-Amino-Modifier C3-TFA, 5'-Amino-Modifier C6-PDA, 5'-Amino- Modifier C12-PDA, and 5'-Amino-Modifier TEG PDA. NHS-functionalized, alkyl halide, or aryl halide-functionalized E3 ligase targeting binders or POI ligands can react with the amine functional group. The thiol-adapted base can comprise a thiol functional group. In some embodiments, the thiol functional group can include or exclude a modified base made by a phosphoramidite selected from: S-Bz-Thiol-Modifier C6-dT, 5'-Thiol-Modifier C6, Thiol- Modifier C6 S-S, and Dithiol Serinol Phosphoramidite. Thiol-functionalized or maleimide- functionalized E3 targeting binders or POI ligands can react with the thiolfunctional group. The aldehyde-adapted base can comprise an aldehyde functional group. In some embodiments, the aldehyde functional group can include or exclude a modified base made by a phosphoramidite selected from 5'-Aldehyde-Modifier C2 Phosphoramidite, 5- Formylindole-CE Phosphoramidite, or any of the aldehyde modifiers described in U.S. Patent No. 9,475,831, herein incorporated by reference. Modified E3 ligase targeting binders or POI ligands can be functionalized with a hydrazine or oxime to form imine bonds to the aldehyde functional group. In some embodiments, the click chemistry-based functional group can include or exclude a modified phosphoramidite selected from: Alkyne-Modifier Serinol Phosphoramidite, 5'-Hexynyl Phosphoramidite, TIPS-5-Ethynyl-dU-CE Phosphoramidite, 5- Ethynyl-dU-CE Phosphoramidite, C8-TMS-Alkyne-dT-CE Phosphoramidite, C8-TMS- Alkyne-dT-CE Phosphoramidite, C8-TMS-Alkyne-dT-CE Phosphoramidite, C8-Alkyne-dT- CE Phosphoramidite, 2’-O-Propargyl A(Bz)-3’-phosphoramidite, 2’-O-Propargyl G(iBu)-3’-PATENT Attorney Docket No. G8118-04301 phosphoramidite, Alkyne dT phosphoramidite, Alkyne amidite, hydroxyprolinol, Palmityl-C6 amino Phosphoramidite, Alkyne phosphoramidite, 5'-terminal, Propargyl-PEG5-1-O-(b- cyanoethyl-N,N-diisopropyl)phosphoramidite, endo-BCN CE-phosphoramidite, DBCO- Serinol Phosphoramidite, 5'-DBCO-TEG Phosphoramidite, or DBCO-dT-CE Phosphoramidite. Alkynyl-functionalized E3 ligase targeting binders or POI ligands can be reacted to azide-functional groups to conjugate the E3 ligase targeting binder and / or the POI ligand to the nucleic acid strand. Conversely, azide-functionalized E3 ligase targeting binders or POI ligands can be reacted to alkynyl-functional groups to conjugate the E3 ligase targeting binder and / or the POI ligand to the nucleic acid strand. Similar click-chemistry pairing can be employed to conjugate the cognate functional groups of the E3 ligase targeting binder and / or the POI ligand to the first or second strand nucleic acid sequence, respectively.

[0118] In some embodiments, the nucleic acid strand can be covalently connected to an agent. The agent can be selected from a diagnostic agent or a therapeutic agent. In certain embodiments, at least one diagnostic agent is operably linked to the nucleic acid strands. In certain embodiments, at least one diagnostic agent is operably linked to a modified base within the nucleic acid strand. In certain embodiments, at least one therapeutic agent is operably linked to the nucleic acid strand. In certain embodiments, at least one diagnostic agent and at least one therapeutic agent are operably linked to the SDTAC.

[0119] Diagnostic agents include imaging agents, e.g., fluorophores, radioisotopes, and colorimetric indicators.

[0120] As used herein, the term “therapeutic agent” includes agents that provide a therapeutically desirable effect when administered to subject. The agent may be of natural or synthetic origin. For example, it may be a nucleic acid, a polypeptide, a protein, a peptide, a radioisotope, saccharide or polysaccharide or an organic compound, such as a small molecule. The term “small molecule” includes organic molecules having a molecular weight of less than about, e.g., 1000 daltons. In one embodiment a small molecule can have a molecular weight of less than about 800 daltons. In another embodiment a small molecule can have a molecular weight of less than about 500 daltons.

[0121] In certain embodiments, the therapeutic agent is an immuno-stimulatory agent, a radioisotope, a chemotherapeutic drug (e.g., doxorubicin) or an immuno-therapy agent, such as antibody or an antibody fragment. In certain embodiments, the therapeutic agent is a vaccine, such as a cancer vaccine. In certain embodiments, the therapeutic agent is a tumor targeting agent, such as a monoclonal tumor-specific antibody or an aptamer. In certainPATENT Attorney Docket No. G8118-04301 embodiments, the therapeutic agent is an antibody or fragment thereof. The antibody or fragment thereof can be selected from a monoclonal antibody, a polyclonal antibody, an ScFv, or a nanobody. In some embodiments, the antibody is an anti-PD1 antibody as described herein. In certain embodiments, the therapeutic agent is an antigen (e.g., a tumor associated antigen or a tumor specific antigen). In certain embodiments, the therapeutic agent is one or more tumor antigen peptide(s).

[0122] In some embodiments, the therapeutic agent is a chemotherapeutic agent. As used herein, the term "chemotherapeutic agent" refers to a biological (large molecule) or chemical (small molecule) compound useful in the treatment of cancer, regardless of mechanism of action. Classes of chemotherapeutic agents include, but are not limited to alkylating agents, antimetabolites, spindle poison plant alkaloids, cytotoxic / antitumor antibiotics, topoisomerase inhibitors, proteins, antibodies, photosensitizers, and kinase inhibitors. Chemotherapeutic agents include compounds used in “targeted therapy” and non-targeted conventional chemotherapy.

[0123] In some embodiments, this invention provides for a SDTAC which comprises a therapeutic agent. The therapeutic agent can be a small molecule drug or a protein or peptide. The protein or peptide is selected from thrombin, prothrombin, or mixtures thereof. In some embodiments, the protein or peptide is conjugated to the amino-modified nucleic acid backbone of the SDTAC by means of a cross-functional compound as described herein. In some embodiments, the maleimide group on the sulfo-SMCC can react to a cysteine on a non-reduced or reduced form of the protein or peptide, and the sulfosuccinimidyl group on the sulfo-SMCC can react to the amino-modified nucleotide. In some embodiments, the maleimide group on the sulfo-SMCC can react to a loading oligonucleotide which has been modified to include a thiol-group to form a loading oligonucleotide-functionalized agent.

[0124] E3 Ligase Targeting Binders

[0125] E3 ligase targeting binders are small molecules to which E3 ligase preferentially binds. E3 ligase binders can include or exclude binders to cereblon (CRBN), von Hippel- Lindau ligand (VHL), and Inhibitor of Apoptosis Proteins (IAP). E3 ligase targeting binders can be chemically modified by the representative methods described herein to include a linkage to a modified base or nucleotide or nucleoside as described herein. The modified base or nucleotide or nucleoside conjugated to the E3 ligase targeting binder is part of the sequence of the first or second nucleic acid strands described herein.PATENT Attorney Docket No. G8118-04301

[0126] In some embodiments, the E3 ligase targeting binder is selected from: pomalidomide, lenalidomide, nutlin-3, idasanutlin, Iberdomide (CC-220), LLL161, TD-106, PG, CC-885, eragidomide, thalidomide, VH032, VL285, VH298, VH101, VHL-e, PT-179, VHL ligand 14, cemsidomide, golcadomide, ALV2, VH032-cyclopropane-F, bestatin, A410099, or SPP-0636457. In some embodiments, thje E3 ligase targeting binder can be any of those disclosed in J. Lee, et al. Molecules, 2022, 27(19):6515; or Bricelj A, Steinebach C, Kuchta R, Gütschow M, Sosič I. E3 Ligase Ligands in Successful PROTACs: An Overview of Syntheses and Linker Attachment Points. Front Chem. 2021 Jul 5;9:707317. doi: 10.3389 / fchem.2021.707317. PMID: 34291038; PMCID: PMC8287636.

[0127] Protein of Interest Ligand

[0128] The protein of interest (POI) ligand can be any small molecule drug comprising the appropriate attachment sites amendable for the chemical modification (e.g., amine, azide, alkyne, carboxylic acid, methyl ester, electrophilic site, nucleophilic site, or hydroxyl) to covalently link the drug to a modified base by the representative methods described herein. The POI ligand can be a therapeutic agent as described herein. The POI ligand can be hydrophobic or hydrophilic. The POI generally has a molecular mass of less than 1200 Da, of less than 1000 Da, or less than 800 Da.

[0129] Compositions and Kits Certain embodiments of the invention also provide a composition comprising a nucleic acid complex described herein and a carrier. In certain embodiments, the composition comprises a plurality of nucleic acid complexes and a carrier.

[0130] In certain embodiments, the composition further comprises at least one therapeutic agent as described herein.

[0131] In certain embodiments, the composition is a pharmaceutical composition and the carrier is a pharmaceutically acceptable carrier.

[0132] The present invention further provides kits for practicing the present methods. Accordingly, certain embodiments of the invention provide a kit comprising a nucleic acid complex described herein and instructions for administering the nucleic acid complex to treat a disease or condition. In certain embodiments, the kit further comprises a therapeutic agent described herein and instructions for administering the therapeutic agent in combination (e.g., simultaneously or sequentially) with the nucleic acid complex.

[0133] Certain MethodsPATENT Attorney Docket No. G8118-04301

[0134] Certain embodiments of the invention also provide a method of treating a disease or disorder in a subject, comprising administering to the subject a therapeutically effective amount of a nucleic acid complex or a composition as described herein.

[0135] In certain embodiments, a method of the invention further comprises administering at least one therapeutic agent to the subject.

[0136] The at least one therapeutic agent may be administered in combination with the nucleic acid complex. As used herein, the phrase “in combination” refers to the simultaneous or sequential administration of the nucleic acid complex and the at least one therapeutic agent. For simultaneous administration, the nucleic acid complex and the at least one therapeutic agent may be present in a single composition or may be separate (e.g., may be administered by the same or different routes).

[0137] Certain embodiments of the invention provide a nucleic acid complex or a composition as described herein for use in medical therapy.

[0138] Certain embodiments of the invention provide the use of a nucleic acid complex or a composition as described herein for the manufacture of a medicament for inducing an immune response in a subject (e.g., a mammal, such as a human).

[0139] Certain embodiments of the invention provide the use of a nucleic acid complex or a composition as described herein for the manufacture of a medicament for inducing an immune response in a subject (e.g., a mammal, such as a human), in combination with at least one therapeutic agent.

[0140] Certain embodiments of the invention provide a nucleic acid complex or a composition as described herein for inducing an immune response.

[0141] Certain embodiments of the invention provide a nucleic acid complex or a composition as described herein for inducing an immune response, in combination with at least one therapeutic agent.

[0142] Certain embodiments of the invention provide the use of a nucleic acid complex or a composition as described herein for the manufacture of a medicament for treating a disease or disorder in a subject.

[0143] Certain embodiments of the invention provide the use of nucleic acid complex or a composition as described herein for the manufacture of a medicament for treating a disease or disorder in a subject, in combination with at least one therapeutic agent.PATENT Attorney Docket No. G8118-04301

[0144] Certain embodiments of the invention provide a nucleic acid complex or a composition as described herein for the prophylactic or therapeutic treatment a disease or disorder.

[0145] Certain embodiments of the invention provide a nucleic acid complex or a composition as described herein for the prophylactic or therapeutic treatment of a disease or disorder, in combination with at least one therapeutic agent.

[0146] In certain embodiments, the disease or disorder is a condition that requires a boost of the host immunity. In certain embodiments, the disease or disorder is a hyperproliferative disorder, such as cancer. In certain embodiments, the disease or disorder is an infectious disease.

[0147] In certain embodiments, the cancer is carcinoma, lymphoma, blastoma, sarcoma, or leukemia. In certain embodiments, the cancer is a solid tumor cancer.

[0148] In certain embodiments, the cancer is squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, renal cell carcinoma, gastrointestinal cancer, gastric cancer, esophageal cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer (e.g., endocrine resistant breast cancer), colon cancer, rectal cancer, lung cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, melanoma, leukemia, or head and neck cancer. In certain embodiments, the cancer is breast cancer.

[0149] In certain embodiments, the therapeutic agent is a therapeutic agent described herein. For example, in certain embodiments, the therapeutic agent is an immuno-stimulatory agent, a radioisotope, a chemotherapeutic drug (e.g., doxorubicin) or an immuno-therapy agent, such as antibody or an antibody fragment. In certain embodiments, the therapeutic agent is a vaccine, such as a cancer vaccine. In certain embodiments, the therapeutic agent is a tumor targeting agent, such as a monoclonal tumor-specific antibody or an aptamer. In certain embodiments, the therapeutic agent is an antibody (e.g., a monoclonal antibody, e.g., an anti-PD1 antibody). In certain embodiments, the therapeutic agent is an antigen (e.g., a tumor associated antigen or a tumor specific antigen). In certain embodiments, the therapeutic agent is a tumor antigen peptide(s).PATENT Attorney Docket No. G8118-04301

[0150] In some embodiments, this invention provides for a method of inhibiting tumor growth in a subject, comprising administering to the subject a therapeutically effective amount of a composition described herein.

[0151] In some embodiments, this invention provides for the use of the nucleic acid complexes as described herein or a composition as described herein for the manufacture of a medicament for inducing a tumor necrosis response in a subject.

[0152] In some embodiments, this invention provides for the use of the nucleic acid complexes as described as described herein or a composition as described herein for inducing a tumor necrosis response.

[0153] In some embodiments, this invention provides for the use of the nucleic acid complexes as described as described herein or a composition as described herein for the prophylactic or therapeutic treatment a disease or disorder.

[0154] In certain embodiments, the present invention provides a method of treating a disease or disorder in a subject, comprising administering to the subject a therapeutically effective amount of the nucleic acid complexes or a composition as described herein.

[0155] In certain embodiments, the present invention provides a method of inhibiting tumor growth in a subject, comprising administering to the subject a therapeutically effective amount of the nucleic acid complexes or composition as described herein.

[0156] In certain embodiments, the present invention provides a use of the nucleic acid complexes or composition as described herein for the manufacture of a medicament for treating a disease or disorder in a subject.

[0157] In certain embodiments, the present invention provides a use of the nucleic acid complexes or composition as described herein for the prophylactic or therapeutic treatment of a disease or disorder.

[0158] The invention also provides processes disclosed herein that are useful for preparing a nucleic acid complexes described herein. Administration

[0159] In some embodiments, methods of the invention comprise administering a nucleic acid complex described herein, and optionally, a therapeutic agent to a subject. Such nucleic acid complex may be formulated as a pharmaceutical composition and administered to a mammalian host, such as a human patient in a variety of forms adapted to the chosen route ofPATENT Attorney Docket No. G8118-04301 administration, i.e., orally or parenterally, by intravenous, intramuscular, intraperitoneal or topical or subcutaneous routes.

[0160] The nucleic acid complex may be administered intravenously or intraperitoneally by infusion or injection. Solutions of the nucleic acid complex or its salts is prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0161] The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle is a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity is maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms is brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions is brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0162] Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.

[0163] Pharmaceutical compositions for use in accordance with the present invention may be formulated using one or more physiologically acceptable carriers or excipients. AnyPATENT Attorney Docket No. G8118-04301 suitable concentration of the nucleic acid complexs may be used, and any active pharmaceutical ingredient will be administered in an amount effective to achieve its intended purpose.

[0164] A variety of suspending fluids or carriers may be employed to suspend the nucleic acid complexs composition. Such fluids include without limitation: sterile water, saline, buffer, or complex fluids derived from growth medium or other biological fluids. Preservatives, stabilizers and antibiotics may be employed in the nucleic acid complex composition.

[0165] Methods of making a pharmaceutical composition include admixing at least one active compound or agent, as defined above, together with one or more other pharmaceutically acceptable ingredients, such as carriers, diluents, excipients, and the like. When formulated as discrete units, such as tablets or capsule or suspension, each unit contains a predetermined amount of the active compound or agent.

[0166] Suitable formulations will depend on the method of administration. The pharmaceutical composition is preferably administered by intradermal administration, but other routes of administration include for example oral, buccal, rectal, parenteral, intramuscular, subcutaneous, intraperitoneal, transdermal, intrathecal, nasal, intracheal. The polyvalent vaccine can also be administered to the lymph nodes such as axillary, inguinal or cervial lymph nodes. The active agent may be systemic after administration or may be localized by the use of regional administration, intramural administration, or use of an implant that acts to retain the active dose at the site of implantation.

[0167] Pharmaceutical compositions described herein may be administered directly, they may also be formulated to include at least one pharmaceutically-acceptable, nontoxic carriers of diluents, adjuvants, or non-toxic, nontherapeutic, fillers, buffers, preservatives, lubricants, solubilizers, surfactants, wetting agents, masking agents, and coloring agents. Also, as described herein, such formulation may also include other active agents, for example, other therapeutic or prophylactic agents, nonimmunogenic stabilizers, excipients and the like. The compositions can also include additional substances to approximate physiological conditions, such as pH adjusting and buffering agents, toxicity adjusting agents, wetting agents and detergents.

[0168] Useful dosages of nucleic acid complexes can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation ofPATENT Attorney Docket No. G8118-04301 effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949, herein incorporated by reference.

[0169] The amount of the compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician.

[0170] The nucleic acid complexes described herein may be conveniently formulated in unit dosage form. In one embodiment, the invention provides a composition comprising a nucleic acid complexes formulated in such a unit dosage form. The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations; such as multiple inhalations from an insufflator or by application of a plurality of drops into the eye. EXAMPLES

[0171] The invention will now be illustrated by the following non-limiting Examples. Example 1: Design and in vitro assessment of a representative DTAC

[0172] In some embodiments, this disclosure provides for a DTAC for degrading the CDK6, CDK4, and CyclinD1 proteins, and was successfully tested in the U251 cell line.

[0173] In some embodiments, this disclosure provides a method for treating protein dysregulation-associated diseases, including cancer, infectious diseases, Alzheimer's disease, Parkinson's disease, and diseases associated with protein disregulatin. The method involves targeting and degrading specific proteins known to be involved in these diseases. Degradable proteins by the methods described herein can include or exclude: Tumor Protein p53 (p53), Beta-Amyloid, Huntingtin, Human Epidermal Growth Factor Receptor 2 (HER2), Tau, Alpha-Synuclein, Epidermal Growth Factor Receptor (EGFR), Bromodomain-Containing Protein 4 (BRD4), Estrogen Receptor (ER), Androgen Receptor (AR), Myelocytomatosis Oncogene (c-Myc), and Cyclin-Dependent Kinases (CDK1-20). Additionally, active kinase complexes such as Cyclin-Dependent Kinase 4 / 6-Cyclin D1 (CDK4 / 6-Cyclin D1), Cyclin- Dependent Kinase 9-Cyclin T1 (CDK9-Cyclin T1), Cyclin-Dependent Kinase 1-Cyclin A (CDK1-Cyclin A), Cyclin-Dependent Kinase 2-Cyclin E (CDK2-Cyclin E), Cyclin- Dependent Kinase 12-18-Cyclin K (CDK12-18-Cyclin K), and Cyclin-Dependent Kinase 20- Cyclin L (CDK20-Cyclin L) can also be targeted.PATENT Attorney Docket No. G8118-04301

[0174] This method is effective on both hydrophobic proteins, such as G-protein Coupled Receptors, and hydrophilic proteins, such as cytosolic enzymes. The proteins targeted for degradation range in molecular weight from 10 kDa to 200 kDa and may have high contents of proline, lysine, or serine / threonine residues. The degradation mechanisms employed may involve the ubiquitin-proteasome pathway, the autophagy-lysosome pathway, or specific proteolytic enzymes such as caspases and calpains. By specifying these properties, this method provides a comprehensive approach to modulating protein levels and treating diseases associated with protein dysregulation.

[0175] In some embodiments, this disclosure includes functionalizing 20-base pair (bp) complementary single DNA strands using DBCO-azide click chemistry with small molecules. FIG. 10 illustrates the modification process, where strand A was modified with the E3 ligase targeting binder Pomalidomide, and strand B was modified with the CDK4 / CDK6 protein targeting ligand Palbociclib (FIG. 13A). To enhance the biostability of the DNA strands, three terminal phosphodiester bonds on both ends were replaced with phosphorothioate groups. The successful modification of the single-stranded DNA (ssDNA) strands was confirmed using ESI-MS analysis. The m / z peak at 7027.7 indicated the successful conjugation of Pomalidomide with strand A, while the m / z peak at 7452.3 confirmed the successful conjugation of Palbociclib with strand B.

[0176] The conjugation of hydrophobic small molecule drugs with the DNA duplex did not significantly impact water solubility or induce micelle formation as confirmed by experimental observation. The modified and unmodified ssDNA strands, along with the DNA duplexes containing the small molecules, were analyzed using an 8 percent native polyacrylamide gel electrophoresis (PAGE). In comparison to the unmodified DNA duplex, the modified DNA duplex migrated more slowly on the gel and did not exhibit any aggregation, even when the samples were annealed at high concentrations (>50 uM). This suggested that the conjugation of hydrophobic small molecule drugs with the DNA duplex did not significantly impact water solubility or induce micelle formation.

[0177] Next, U251 cells were exposed to varying concentrations of lipofectamine- mediated DTAC transduction for a duration of 12 hours. As part of the experimental controls, cells were treated with the DNA duplex alone, the DNA duplex combined with the Pomalidomide ligand targeting the E3 ligase (DNA-E3), or the DNA duplex combined with the Palbociclib ligand targeting the CDK6 protein (DNA-CDK6). After the 12-hour treatment, cells were harvested and lysed using a lysis buffer. The lysed cell extracts werePATENT Attorney Docket No. G8118-04301 then subjected to a 20-minute incubation at 4°C, followed by centrifugation at 13,000 rpm for 15 minutes to remove the supernatant. The resulting supernatants were collected and analyzed using western blotting.

[0178] DTAC-treated cells displayed a significant and dose-dependent reduction in CDK6 protein levels. Conversely, treatment with the DNA duplex alone, DNA-E3, or DNA- CDK6 did not exhibit notable protein degradation. Interestingly, treatment with approximately 20 nM of DTAC resulted in complete elimination of CDK6 protein. However, concentrations exceeding 100 nM demonstrated a hook effect, indicating that DTAC effectively induces CDK6 degradation when used at concentrations below 50 nM. A reference chemical PROTAC (BSJ-03-123) targeting CDK6 was used as a positive control (Homolog-Selective Degradation as a Strategy to Probe the Function of CDK6 in AML. Cell Chem Biol. 2019, 26, 2, 300-306). This positive control demonstrated evident CDK6 degradation at a concentration of 1 μM. Remarkably, DTAC treatment consistently replicated this observed degradation, providing further confirmation of DTAC's efficacy in targeting CDK6.

[0179] Embodiment 1: SDTAC Design.

[0180] Strategy1: Distance based conditional PROTAC.

[0181] In the PROTACs, the distance between the two linked ligands is the key point for the efficiency of PROTACs (Proteolysis-targeting chimera (PROTAC) delivery system: advancing protein degraders towards clinical translation. Chem. Soc. Rev. 2022, 51, 5330- 5350). Based on the preliminary study, for the DNA based PROTAC system, the two ligands modified on the base-paired nucleotides achieves the highest targeting protein degradation. A DNA nanostructure was designed which comprised three strands (2 ligand strands, L1 / L2, and 1 sensor strand, S1) that self-assemble into two parallel duplexes via Watson-Crick interaction. The resulting structure has two states. In the OFF state, the distance between the two ligands is far, showing no PROTAC function. The S1 strand comprises 10 extra nucleotides as a toehold. Once the targeting mRNA carrying the complementary sequence of the toehold is detected, a toehold-mediate strand displacement will occur and S1 strand will be released. Then, the remainder of the L2 strand will be complementary with the L1 strand and form a longer duplex, leading the two ligands in the base-paired conformation and exhibiting highest PROTAC function as the ON state (FIG. 32).

[0182] The sequence of L1 / L2 strands are designed to avoid possible secondary structure and enable the chemical modification of the ligands. The predicted equilibrium structures andPATENT Attorney Docket No. G8118-04301 melting curves of two strands indicate minor existence of secondary structure for L1 / L2 strands. A coarse-grained model oxDNA was used to simulate the DNA nanostructures in both OFF state and ON state. In the simulation result, the distance between the two ligands changes from 3.725 nm (OFF state) to 0.993 nm (ON state), which is consistent with the design.

[0183] Strategy2: Sterol effect based conditional PROTAC.

[0184] In some embodiments, the sterol effect can be used to hinder the binding of ligand and targeting protein to achieve mRNA-based switchable function of PROTACs. The same design structure and sequence of Strategy1 can be used, but modifying the ligands in different positions (FIG. 33). The E3 targeting ligand can be modified in the middle of the L1 strand, pointing outside of the DNA nanostructure. In some embodiments, the protein targeting ligand can be modified in the based-paired nucleotide of E3 targeting ligand on L2 strand, pointing to the cavity between two helixes. In the OFF state, the sterol effect between DNA helices with protein of interest will prevent the binding, showing no PROTAC function. Once the targeting mRNA will result in a toehold-mediate strand displacement and release S1 strand. The exposed protein targeting ligand binds with a protein of interest to degrade said protein.

[0185] Embodiment 2: in vitro assessment of conditional activation and protein degradation.

[0186] To assess the conditional DTAC, the first step involves annealing different types of SDTAC and running a Native page gel to assess the formation of DNA structures. Following the optimization of SDTAC structure stability and rigidity, the conditional DTAC can be evaluated for its strand displacement function through in vitro experiments. Initially, the targeting mRNA will be selected from specific cancer cells based on overexpression, determined through bioinformatic analysis of mRNA expression levels obtained from the Cancer Genome Atlas (TCGA) database. Moreover, the mRNA expression can be quantified using RT-QPCR. Subsequently, DTAC, with or without a toehold sequence, can be introduced into the cells with upregulated or downregulated targeting mRNA using lipofectamine. The cells are harvested, lysed, and subjected to various incubation times (2, 4, 8, 12 hrs), with subsequent analysis of the cell extracts using western blot. After analyzing the cell extracts through western blot, the protein levels can be examined to determine the efficiency of the activation and deactivation of conditional DTAC. Additionally, the samplesPATENT Attorney Docket No. G8118-04301 can be analyzed for specific protein markers associated with the targeted proteins to further validate the impact of DTAC on downstream protein expression.

[0187] Embodiment 3: Construction of cyto-direct cell targeting SDTAC.

[0188] One of the primary obstacles encountered in small molecule-based PROTACs is their limited ability to permeate cells due to their extensive polar surface and high molecular weight (>500-1100 Da) (Proteolysis-targeting chimera (PROTAC) delivery system: advancing protein degraders towards clinical translation. Chem. Soc. Rev. 2022, 51, 5330- 5350). PROTACs can be conjugated with inorganic / organic polymers, nanoparticles, and antibodies to enhance their solubility, permeability, targeting efficacy, and circulation time. However, these approaches present additional drawbacks such as the need for complex synthetic procedures, potential immunogenicity associated with polymeric or inorganic nanoparticles, as well as suboptimal loading and short lifespan of protein-based carriers.

[0189] In contrast, DNA-based scaffolds offer several opportunities to address these limitations owing to their biocompatibility, programmability, and ease of synthetic modifications. Although DNA possesses a larger polar surface area and higher molecular weight compared to small molecules, it can be functionalized with cell-penetrating peptides and functional groups to enhance its cell permeability.

[0190] Disulfide groups can be included in the payload to prevent its penetration through the cell membrane unless a cell receptor-targeting functional moiety is attached to the SDTAC. The cell membrane receptor-targeting functional group presents the payload in close proximity to a thiol-exchanging receptor on the cell surface, thereby accelerating its internalization. Conversely, in the absence of a cell receptor-targeting functional group, the payload does not approach unintended cells, thereby reducing off-target effects as shown by the mechanism depicted in Scheme C (FIG. 34).

[0191] Disulfide or diselenium-based phosphonamidites can be synthesized to include with the payload. A hydrophilic short linker can be employed to covalently attach the disulfide or diselenium moieties with the phosphonamidites, ensuring prevention of aggregation or micelle formation. The functionalized phosphonamidites can then be readily conjugated with the desired DNA strand during DNA synthesis. Subsequently, another DNA strand can be conjugated with cell-targeting peptides, affibodies, or small molecules. Ultimately, the assembly of all components will yield Cyto-Direct Cell Targeting SDTAC, which is expected to significantly mitigate off-target toxicity (FIG. 34).PATENT Attorney Docket No. G8118-04301

[0192] Cell differentiation, growth and apoptosis analysis can also be used to measure the impact of representative SDTACs of this disclosure on tumorous cells under diverse treatment conditions. The SDTACs of this disclosure are expected to exhibit a therapeutic strategy against cancer. Example 2: Chemical synthesis and characterization of DTAC components

[0193] The successful synthesis and characterization of key DTAC components, namely the Azido-PEG3-pomalidomide (E3-i) and Azido-PEG3-palbociclib (POI-i) ligands, is critical for the assembly of functional DTACs. As depicted in FIGS. 3 and 6, the E3-i and POI-i ligands were synthesized by reacting 4-fluorothalidomide or palbociclib with Azido- PEG2-amine or Azide-PEG3-iodide, respectively, under basic conditions. The structures of the resulting compounds were confirmed by NMR spectroscopy (FIGS. 4 and 7) and high- resolution mass spectrometry (FIGS. 5 and 8), which showed the expected peaks and fragmentation patterns. For E3-i, the 1H NMR spectrum exhibited characteristic peaks corresponding to the pomalidomide protons, while the 13C NMR spectrum displayed the expected number of carbon signals. The ESI-MS spectrum of E3-i showed a dominant peak at m / z 453.15, consistent with the [M+Na]+ ion (calculated m / z 453.41). Similarly, the 1H and 13C NMR spectra of POI-i featured the anticipated signals for the palbociclib moiety, and the ESI-MS spectrum displayed a base peak at m / z 605.33, matching the predicted [M+H]+ ion (calculated m / z 605.32).

[0194] To enable site-specific conjugation of the E3-i and POI-i ligands to DNA scaffolds, amino-modified oligonucleotides were prepared by incorporating an amino-serinol phosphoramidite (FIG.9) at the desired internal positions during solid-phase DNA synthesis. The amino-serinol phosphoramidite was introduced at positions 8, 7, 6, 5, and 4 of the sense strand (SA) and positions 5, 6, 7, 8, 9, and 10 of the antisense strand (SB) to generate the DTAC-V1 to V6 constructs, respectively (Table 1). These positions were chosen to systematically vary the distance between the E3-i and POI-i ligands when the corresponding sense and antisense strands are hybridized.

[0195] The sequences in Table 1 were used to make DTAC V1-iNH to DTAC-V6-iNH composed of SA-1 and SB-1, SA-2 and SB-2, etc, sequences.PATENT Attorney Docket No. G8118-04301Table 1: The sequences of ssDNA strand conjugates.

[0196] Following cleavage from the solid support and deprotection, the free amine groups on the oligonucleotides were reacted with dibenzocyclooctyne-sulfo-N-hydroxysuccinimidyl ester (DBCO-sulfo-NHS) to install a strained alkyne moiety (FIG. 10B). The azide- containing E3-i and POI-i ligands were then conjugated to the DBCO-modified oligonucleotides via strain-promoted azide-alkyne cycloaddition (SPAAC) (FIG. 10C). The optimized synthesis and bioconjugation methods involved the use of a 6-fold excess of DBCO-sulfo-NHS relative to the oligonucleotides and a 2-fold excess of the azide-modified ligands relative to the DBCO groups. The SPAAC reactions were performed in aqueous buffer at 37 °C overnight to ensure high conversion.

[0197] The ligand-oligonucleotide conjugates were purified by reversed-phase HPLC and characterized by electrospray ionization mass spectrometry (ESI-MS) in negative ion mode. The ESI-MS spectra of the amino-modified oligonucleotides (FIG. 11) and ligand- conjugated products (FIG. 12) showed single major peaks corresponding to the expected mass-to-charge ratios, confirming successful synthesis. The DTAC library, comprising sixPATENT Attorney Docket No. G8118-04301 different ligand configurations (DTAC-V1 to V6), was thus prepared using the optimized synthesis and bioconjugation methods (Table 2).

[0198] The sequences in Table 2 were conjugated with respective E3 ligase targeting binders and Protein of interest (POI) targeting ligands to form DTAC-V1 to DTAC-V6.Table 2: The sequences of ssDNA strand conjugates.

[0199] General Methods:

[0200] Unless noted otherwise, all non-aqueous reactions were conducted in oven-dried glassware under argon or nitrogen atmosphere. Reagents were commercially available and used without further purification, while anhydrous solvents were procured as the highest grade from Sigma-Aldrich. Thin-layer chromatography using 0.25 mm Silicycle silica gel 60 F254 plates was employed for reaction monitoring. Flash column chromatography utilized for small molecule purification using commercial 40-60 mesh silica gel column. Yields are presented as isolated yields of spectroscopically (NMR&LC / MS) pure compounds. 1H and 13C NMR spectra were acquired using 400 and 500 MHz Varian spectrometers. Chemical shifts are expressed in parts per million (ppm, δ) referenced to the residual 1H resonance of the solvent (CDCl3, 7.26 ppm, and DMSO-d6, 2.49 ppm). 13C spectra are referenced to the residual 13C resonance of the solvent (CDCl3, 77.16 ppm, and DMSO-d6, 39.52 ppm). Splitting patterns are denoted as follows: s, singlet; br, broad; d, doublet; dd, doublet of doublets; t, triplet; q, quartet; m, multiplet.PATENT Attorney Docket No. G8118-04301

[0201] 4-((2-(2-(2-azidoethoxy)ethoxy)ethyl)amino)-2-(2,6-dioxopiperidin-3- yl)isoindoline-1,3-dione (Azido-PEG3-pomalidomide; E3-i)

[0202] The Azido-PEG3-pomalidomide molecule was synthesized using previously published protocol with slight modification (Figure 3).[1] 4-Fluorothalidomide (0.100 g, 0.362 mmol, 1 equiv.), Azido-PEG2-amine (0.082 g, 0.471 mmol, 1.3 equiv.), and N,N- Diisopropylethylamine (189 µL, 1.086 mmol, 3 equiv.) were added into anhydrous dimethyl sulfoxide (1 mL) and reaction mixture was heated 100°C for overnight under argon atmosphere. Thereafter solvent was co-evaporated with ethanol several times. The crude mixture was purified on a flash chromatography, eluting with1:1 hexane:ethylacetate (50:50) to obtain yellow-orange solid powder as a product: yield (0.095 g, 0.220 mmol, 61.03%); 1H NMR (500 MHz, CDCl3) δ 8.51 (s, 1H), 7.49 (dd, J = 8.5, 7.1 Hz, 1H), 7.10 (d, J = 7.1 Hz, 1H), 6.92 (d, J = 8.5 Hz, 1H), 6.50 (t, J = 5.6 Hz, 1H), 5.00 – 4.89 (m, 1H), 3.74 (t, J = 5.4 Hz, 2H), 3.69 (d, J = 4.1 Hz, 6H), 3.48 (q, J = 5.5 Hz, 2H), 3.38 (t, J = 5.0 Hz, 2H), 2.91 – 2.67 (m, 3H), 2.11 (ddd, J = 9.7, 7.2, 3.1 Hz, 1H) (Figure 4); QTOF-LC / MS (ESI+): m / z calculated for C19H22N6O6: 430.16. [M+Na]+; found 453.15 (Figure 5).

[0203] 6-acetyl-2-((5-(4-(2-(2-(2-azidoethoxy)ethoxy)ethyl)piperazin-1-yl)pyridin-2- yl)amino)-8-cyclopentyl-5-methylpyrido[2,3-d]pyrimidin-7(8H)-one (Azido-PEG3- palbociclib; POI-i)

[0204] Palbociclib (0.100 g, 0.223 mmol, 1 equiv.), Azide-PEG3-iodide (0.083 g, 0.290 mmol, 1.3 equiv.), Potassium carbonate (0.077 g, 0.558 mmol, 2.5 equiv.), and catalytic amount of Tetraethylammonium bromide (0.015 g, 0.045 mmol, 0.2 equiv.) were added into anhydrous dimethylformamide (2 mL) and reaction mixture was heated at 90°C for 6 hours under argon atmosphere (Figure 6). After that reaction mixture was quenched with addition of distilled water (20 mL) and product was extracted with ethyl acetate (20 mL). Next, the organic phase was washed with brine, water and then dried over sodium sulfate for few minutes. Solvent was evaporated in reduced pressure and crude product was purified on a flash chromatography, eluting with 95:5 dichloromethane:methanol. Product was obtained as bright yellow solid: yield (0.07 g, 0.115 mmol, 52%) 1H NMR (500 MHz, CDCl3) δ 8.86 (s, 1H), 8.62 (s, 1H), 8.15 (d, J = 9.1 Hz, 1H), 8.08 (d, J = 3.0 Hz, 1H), 7.33 (dd, J = 9.1, 3.0 Hz, 1H), 5.88 (q, J = 8.9 Hz, 1H), 3.68 (qd, J = 6.6, 3.6 Hz, 7H), 3.40 (t, J = 5.1 Hz, 2H), 3.22 (t, J = 5.0 Hz, 4H), 2.71 (dt, J = 15.8, 5.4 Hz, 5H), 2.55 (s, 3H), 2.38 (s, 5H), 2.17 – 2.00 (m, 2H), 1.96 – 1.83 (m, 2H), 1.75 – 1.58 (m, 2H), 1.26 (s, 1H) (Figure 7); QTOF-LC / MS (ESI+): m / z calculated for C30H40N10O4: 604.32. [M+H]+; found 605.33 (Figure 8).PATENT Attorney Docket No. G8118-04301

[0205] Amine modified oligonucleotides synthesis and characterization.

[0206] The oligonucleotides were obtained via standard solid-phase oligonucleotide synthesis on a controlled pore glass (CPG, 1 μm). Standard DNA phosphoramidites, solid supports and additional reagents were purchased from Glen Research. The oligonucleotides were synthesized on an Applied Biosystems 3400 automated DNA / RNA synthesizer using a standard 1.0 μmole phosphoramidite cycle of acid-catalyzed detritylation activation and coupling, capping, and iodine oxidation. Stepwise coupling efficiencies and overall yields were determined by automated trityl cation conductivity monitoring. For phosphorothioate modification, 0.05M sulfurizing reagent II is prepared by dissolving in 40mL pyridine first, followed by 60mL acetonitrile to form a homogeneous solution. It is connected to the Auxiliary port on the DNA synthesizer and can be used similar to general iodine oxidation. For internal amine modification, amino-serinol phosphoramidite is dissolved in anhydrous acetonitrile to a concentration of 0.1M immediately prior to use. Cleavage of the oligonucleotides from the solid support and deprotection was achieved by exposure to 30% ammonia solution for 120 minutes at 55 ^C on a heating-block. The cleavage solutions were diluted with water and ammonia was removed by washing with water using a 100kDa Amicon filter. The sequences of the oligonucleotides synthesized are tabulated below (where “i-NH2” denotes (Figure 9) the internal amine and * represents phosphorothioate modifications) with the mass spectrometry data. The small molecule to be attached to each version is mentioned in brackets.

[0207] dibenzocyclooctyne (DBCO) modified oligonucleotides synthesis and characterization

[0208] To conjugate DBCO to an oligonucleotide, an amine-modified DNA strand (Please see DNA sequences used) was treated with 6-fold excess of 200mM DBCO-sulfo- NHS-ester (dibenzocyclooctyne-sulfo-N-hydroxysuccinimidyl ester) in a 1XPBS buffer at pH ~8.5 (Figure 10B). The mixture was gently shaken for 3h at 37°C. The DNA-DBCO conjugates were purified by 3kDa amicon filter at 8000 rcf by repeated washing (5X) with distilled water to remove the excess small molecules and salts. Following filtration, the mixtures were purified using RP-HPLC and the conjugate peaks verified using ESI-MS.

[0209] Synthesis of E3-i and POI-i-DNA conjugates.

[0210] Conjugates were synthesized using strain promoted alkyne azide cycloaddition (SPAAC) chemistry (Figure 10C), like previous reports. Briefly, to DNA-DBCO conjugates (in 1xTAE-12.5mM MgCl2, pH 7.5) was added 2 molar equivalents of 10 mM Azido-PEG3-PATENT Attorney Docket No. G8118-04301 pomalidomide (E3-i), or Azido-PEG3-palbociclib (POI-i) as a solution in DMSO. The reaction mixture was agitated and maintained at 37°C overnight. The DNA-drug conjugates were purified by 3kDa amicon filter at 8000 rcf by repeated washing (5X) with distilled water to remove the excess small molecules and salts. Following reaction, the mixture was purified using RP-HPLC and the conjugate peaks verified using ESI-MS.

[0211] Purification by RP-HPLC.

[0212] Following reaction, small molecule-DNA conjugates were purified using a C-18 column on an Agilent 1220 Infinity LC HPLC. The mixtures were purified using a linear gradient method, with Buffer-A (50 mM triethylammonium acetate (TEAA)) and Buffer-B (methanol). A linear gradient was run from 10% to 100% Buffer B over 60 minutes. Conjugates were monitored and collected based on 260 nm (for DNA) and 309 nm (for DBCO) absorbances. Collected fractions were lyophilized overnight until dry.

[0213] Intact mass analysis of DTAC conjugates.

[0214] Collected peaks were tested for purity and identified by quadrupole time-of-flight liquid chromatography mass spectrometry (QTOF LC / MS) analysis in the negative mode. A 50 uM solution is prepared from the stock of small molecule conjugated DNA strands for the analysis using 0.1% ammonium hydroxide as the mobile phase. Identified peaks are deconvoluted in the expected mass range to get the intact mass of the conjugates (Figure 11- 12). Example 3: Assembly and characterization of DTACs

[0215] As illustrated in FIG. 13A, DTACs were prepared by annealing equimolar amounts of the complementary E3-i and POI-i ligand-bearing oligonucleotides in TAE-Mg2+ buffer. A small library of six DTACs (V1-V6) was generated with varying distances between the E3-i and POI-i ligands (FIG. 13B). The distances were controlled by altering the positions of the amino-serinol modifications on the oligonucleotide scaffolds.

[0216] To confirm the formation of the designed DTAC structures, the annealed constructs were analyzed by native polyacrylamide gel electrophoresis (PAGE). All six DTACs exhibited distinct, well-defined bands on the gel (FIG. 14), indicating efficient assembly into the expected binary complexes. The differences in electrophoretic mobility among the DTACs were consistent with their varying sizes and shapes. Notably, no bands corresponding to residual single-stranded oligonucleotides were observed, suggesting quantitative hybridization.PATENT Attorney Docket No. G8118-04301

[0217] The thermal stability of the DTACs was evaluated by variable-temperature UV- Vis spectroscopy. Sharp, cooperative melting transitions were observed, with melting temperatures exceeding 60 °C for all constructs under physiologically relevant conditions (data not shown). The high thermal stability of the DTACs is critical for maintaining their structural integrity and function in biological contexts.

[0218] Synthesis of DTAC versions.

[0219] All DTAC versions (1,2,3,4,5,6) were prepared by mixing site specifically modified ssDNA strands in equimolar ratio in 30 µL 1×TAE-12.5 mM MgCl2 buffer at 50 µM concentration. Thereafter reaction mixtures were annealed in a PCR thermocycler instrument using following protocol: Reaction mixtures were heated at 95 °C for 5 min and then quickly cooled to 4 °C.

[0220] PAGE analysis of DTAC conjugates.

[0221] Successfully synthesized DTAC library was analyzed using 12% native polyacrylamide gel electrophoresis (PAGE). To each lane was added 10 µl of a 10 µM sample was added, and the gel was electrophoresed at 200 V (constant voltage) for 2.5 h at 10°C, then stained with ethidium bromide (EtBr) and imaged with a Bio-Rad Molecular Imager GelDOC XR+ imaging system. Example 4: In vitro evaluation of DTAC-mediated protein degradation

[0222] The ability of these constructs to induce targeted protein degradation in a cellular context was evaluated next. As proof-of-concept, the focus was on the degradation of cyclin- dependent kinases 4 and 6 (CDK4 / 6) and their partner cyclin D1, which are critical regulators of cell cycle progression and are frequently dysregulated in cancer.

[0223] cell culture

[0224] U-251 MG Glioblastoma Cell Line was grown in Dulbecco’s Modified Eagles Medium (DMEM) containing 10% heat inactivated fetal bovine serum (FBS), streptomycin (5 μg / mL) and 5 U / mL penicillin 95 U / mL). All cell lines were maintained, and cell culture experiments were carried out in humidified incubators at 37 degrees and 5% CO2 supplementation.

[0225] DTACs transfection

[0226] One day prior to DTACs transfection, cells were propagated into 6 cm cell culture dishes containing appropriate complete growth medium. Prior to transfection, complete medium was replaced with transfection medium (5%FBS, no Penstrep). DTACs transfection was performed using lipofectamine 3000 reagent according to the protocols provided by thePATENT Attorney Docket No. G8118-04301 manufacture. All transfections were carried out in 6-cm dishes with 3 mL of media and concentrations of DTACs were calculated according to this volume (3 mL). Briefly, for 50 nM concentration, 5 ^L from a 30^M DTACs stock and 12 ^L p3000 reagent was added to a tube containing 125 ^L of OPTIM-MEM and 8 ^L of Lipofectamine 3000 reagent was added to a separate tube containing 125 ^L of OPTIM-MEM. Two tubes were incubated for 5 minutes at room temperature and DTACs containing OPTI-MEM was then slowly added to the second tube with lipo3000. The solution in the tube was mixed well by pipetting up and down several times. After incubating for 15-20 minutes at room temperature, 250 ^L of DTACs-lipofectamine complex was added drop wise onto cells containing the transfection medium. Transfection medium was mixed well before transferring the plate into the incubator. After appropriate time, cells were either harvested or replaced with fresh medium and incubated for desired time point prior to harvesting.

[0227] U251 glioblastoma cells were transfected with the individual DTACs (V1-V6) at two different concentrations (20 and 100 nM) using a cationic lipid transfection reagent. After 14 h, the cells were harvested, lysed, and the levels of CDK4, CDK6, and cyclin D1 were assessed by Western blot. As shown in FIG. 15, treatment with DTAC-V3 resulted in the most potent and concentration-dependent degradation of CDK6 and cyclin D1, with nearly complete depletion observed at 100 nM. DTAC-V1 also showed degradation activity, albeit to a lesser extent, while the other DTAC variants and a control construct bearing no ligands had negligible effect. These results suggest that an optimal distance between the E3-i and POI-i ligands, as in DTAC-V3, is crucial for efficient ternary complex formation and subsequent protein degradation.

[0228] To further characterize the degradation activity of DTAC-V3, dose-response and time-course experiments were performed. U251 cells were treated with increasing concentrations of DTAC-V3 (1-1000 nM) for 14 h, revealing a dose-dependent decrease in CDK4, CDK6, and cyclin D1 levels (FIG. 16A). The DC50 values (concentration required for 50% degradation) were in the low nanomolar range, highlighting the potency of the DTAC. In the time-course study, near-maximal degradation was observed within 4 h of treatment with 100 nM DTAC-V3, and the effect was sustained for at least 48 h (FIG. 16B). The rapid and prolonged degradation kinetics are consistent with efficient DTAC uptake and ternary complex formation.

[0229] Next, the degradation activity of DTAC-V3 was compared to that of a previously reported CDK4 / 6-targeting PROTAC, CP-10 (FIG. 17). CP-10 induced degradation of CDK4PATENT Attorney Docket No. G8118-04301 and CDK6 but not cyclin D1, consistent with its design. In contrast, DTAC-V3 triggered significant depletion of all three proteins at both 20 and 100 nM, showcasing its superiority in terms of potency and target scope. The ability of DTAC-V3 to degrade cyclin D1 in addition to CDK4 / 6 is noteworthy, as it may confer enhanced antiproliferative activity by more completely suppressing the CDK4 / 6-cyclin D1 complex.

[0230] To gain mechanistic insights into the mode of action of DTAC-V3, degradation rescue experiments using proteasome inhibitors and ligand competition assays were performed. Pretreatment of cells with the proteasome inhibitors MG132 or PR171 prior to DTAC-V3 addition fully blocked the degradation of CDK4 / 6 and cyclin D1 (FIG. 18), indicating that DTAC-mediated degradation proceeds via the ubiquitin-proteasome system. Furthermore, co-treatment with an excess of either the parent E3-i ligand pomalidomide or the POI-i ligand palbociclib competed with DTAC-V3 and prevented degradation (FIG. 19). These results support a degradation mechanism involving DTAC-induced formation of a ternary complex between the target proteins and the respective E3 ubiquitin ligase, followed by ubiquitylation and proteasomal degradation.

[0231] Finally, DTAC-mediated CDK4 / 6-cyclin D1 degradation was assessed in cellular assays. Treatment of U251 cells with DTAC-V3 significantly inhibited cell proliferation (FIG. 20) and colony formation (FIG. 21) in a concentration-dependent manner. The antiproliferative effects of DTAC-V3 were superior to those of its individual ligand constituents or their combination, underscoring the advantage of the DTAC-based targeted degradation approach.

[0232] The degradation efficiency of various DTACs was evaluated through their transfection into U251 cells, conducted simultaneously to ensure uniform experimental conditions. A double-stranded DNA sequence without any ligand was utilized as a negative control, providing a baseline for comparison. Following a 14-hour treatment period, a duration selected based on preliminary time-course studies, the cells were harvested using trypsin digestion. The lysates obtained were then subjected to SDS-PAGE, followed by Western blot analysis to assess protein degradation. As depicted in FIG. 15 DTAC-V3 exhibited the most pronounced degradation of CDK6 and CyclinD1. This was evidenced by the significantly reduced visibility of CDK6 and CyclnD1 bands on the gel, in stark contrast to the control, at both 20 nM and 100 nM concentrations. This finding highlights the efficacy of DTAC-V3 in targeting and reducing CDK6 / CyclinD1 protein levels. In comparison, DTAC-V1 also facilitated protein degradation, albeit with varying degrees of efficiency.PATENT Attorney Docket No. G8118-04301 Interestingly, DTAC-V6, characterized by the largest ligand distance of approximately 60.2 Å, did not exhibit any discernible protein degradation at either concentration. These observations suggest that the spatial arrangement, specifically the distance between the E3 ligand and POI ligand, plays a critical role in influencing the protein degradation efficiency of DTACs. Based on these results, we conclude that the structural configuration of DTACs, particularly the spatial relationship between their constituent ligands, is a key determinant in their ability to mediate CDK6 protein degradation. This insight opens avenues for further exploration into the optimization of DTAC designs for enhanced therapeutic efficacy.

[0233] Cyclin-dependent kinases (CDKs) typically form functional protein complexes through association with their cyclin partners. Our distance library screening identified DTAC-V3 as the most effective compound for degrading both CDK6 and Cyclin D1 proteins. Given that small molecule inhibitors of CDK6 can also bind with CDK4, we further investigated whether DTAC-V3 induces concurrent degradation of the CDK4 / 6 / Cyclin D1 protein complex. To assess the efficacy of DTAC-V3 on the degradation of the CDK4 / 6 / Cyclin D1 complex, we conducted immunoblot analyses using U251 glioblastoma cells treated with various concentrations of DTAC-V3. The data reveal that DTAC-V3 induces a dose-dependent degradation of CDK4, CDK6, and Cyclin D1 proteins (Figure 16A). Additionally, to determine whether the degradation of these proteins occurs simultaneously, a time-course experiment was performed. U251 cells were treated with DTAC-V3 and harvested at different time points post-treatment (0, 2,4, 6, 12, 24, 36 and 48 hours). Immunoblot analysis demonstrated that degradation of CDK4, CDK6, and Cyclin D1 proteins initiated at 4 hours post-treatment and persisted up to 48 hours (Figure 16B). In summary, these findings indicate that DTAC-V3 effectively induces the simultaneous degradation of the CDK4 / 6 / Cyclin D1 protein complex in a dose- and time-dependent manner.

[0234] To further validate the degradation of the CDK4 / 6 / Cyclin D1 protein complex by DTAC-V3, we conducted a comparative experiment using a previously reported PROTAC, CP-10, which is designed to degrade CDK4 and CDK6 but not Cyclin D1.[5] CP-10 is constructed using a chemical linker and incorporates the same pomalidomide (E3 ligase inhibitor, E3i) or palbociclib (CDK4 / 6 inhibitor, POIi) as DTAC-V3. U251 cells were treated with CP-10 or palbociclib (CDK4 / 6 inhibitor, POIi) and the protein levels of CDK4, CDK6, and Cyclin D1 were analyzed. As expected, treatment with CP-10 or palbociclib did not result in the degradation of Cyclin D1, consistent with existing literature4 (Figure 17). InPATENT Attorney Docket No. G8118-04301 contrast, treatment with DTAC-V3 led to a significant reduction in the protein levels of CDK4, CDK6, and Cyclin D1 at concentrations of 20 nM and 100 nM (Figure 17). These results highlight the superior efficacy of DTAC-V3 in targeting and degrading the entire CDK4 / 6 / Cyclin D1 complex compared to CP-10.

[0235] To investigate whether the ubiquitin-proteasome system (UPS) mediates the degradation of the CDK4 / 6 / Cyclin D1 complex induced by DTAC-V3, we conducted rescue experiments using the proteasome inhibitors MG132 and PR171. U251 cells were pretreated with either MG132 or PR171 prior to DTAC-V3 exposure. The inhibition of the UPS by these proteasome inhibitors successfully prevented the degradation of CDK4 / 6 and Cyclin D1, suggesting that DTAC-V3 mediates protein degradation through the UPS pathway (Figure 18). Furthermore, to confirm that DTAC-V3 facilitates CDK4 / 6 / Cyclin D1 degradation via direct binding to CDK4 / 6 and subsequent recruitment of the CRBN E3 ligase, we performed ligand competition assays. U251 cells were simultaneously treated with DTAC-V3 and either the E3 ligase ligand pomalidomide or the CDK4 / 6 inhibitor palbociclib. The results demonstrated that co-treatment with these ligands inhibited the degradation of CDK4, CDK6, and Cyclin D1, indicating that DTAC-V3 likely exerts its effects by engaging CDK4 / 6 and recruiting the CRBN E3 ligase for proteasomal degradation (Figure 19). These findings collectively suggest that DTAC-V3 induces the degradation of the CDK4 / 6 / Cyclin D1 complex through a mechanism involving the UPS, specifically by binding to CDK4 / 6 and recruiting the CRBN E3 ligase. This mechanistic insight underscores the potential of DTAC-V3 as a therapeutic agent targeting CDK4 / 6 / Cyclin D1 in cancer cells.

[0236] CDK4 (cyclin-dependent kinase 4) and CDK6 (cyclin-dependent kinase 6), when activated in complex with Cyclin D1, are critical for cell cycle progression from the G1 phase, where the cell grows and prepares for DNA replication, to the S phase, where DNA synthesis occurs. Dysregulation of the CDK4 / 6-Cyclin D1 pathway is a common feature in various cancers, often due to overexpression or amplification of Cyclin D1 or CDK4 / 6, leading to unchecked cell proliferation. Consequently, the CDK4 / 6-Cyclin D1 complex has become a significant target for cancer therapeutics. Our previous data indicate that DTAC-V3 can significantly degrade the CDK4 / 6-Cyclin D1 complex, potentially suppressing cancer cell growth. To validate this therapeutic effect, we conducted cell proliferation and colony formation assays. In the proliferation assays, cells were seeded in 96-well plates (5000 cells / well) and transfected with control, DNA-E3-i, DNA-POI-i, or DTAC-V3. Cell survival was assessed using the CCK-8 kit after designated intervals. Treatments with only DNA didPATENT Attorney Docket No. G8118-04301 not affect U251 cell proliferation, while those with either POI ligand or E3 ligand showed minor inhibitory effects. In contrast, DTAC-V3 treatment dramatically reduced U251 cell proliferation (Figure 20). For the colony formation assays, cells were plated at 1000 cells / well in a 6-well plate and transfected with the same treatments every two days. After two to three weeks, cells were fixed with 4% paraformaldehyde, stained with 0.05% crystal violet in 20% ethanol, and imaged. DTAC-V3 treatment consistently suppressed the colony formation of U251 cells, confirming its potent anti-proliferative effects (Figure 21). Example 5: Development and characterization of a light-activatable SDTAC system

[0237] A spatiotemporally activatable DTAC system was then developed that would enable fine control over the degradation process. To this end, a light-activatable SDTAC (spatial activation of DTAC) architecture was designed that utilizes a photocleavable linker to reversibly constrain the DTAC in an inactive configuration until triggered by UV irradiation (FIG. 22).

[0238] The light-activatable SDTAC consists of three oligonucleotide strands: strand A, which bears the POI-i ligand; strand B, which carries the E3-i ligand; and a photocleavable blocker strand (FIG. 23). In the initial state, the blocker strand is hybridized to a portion of strand A and is covalently crosslinked to it using a site-specifically installed 3- cyanovinylcarbazole nucleoside (CNVK) photoactive group. The crosslink is formed by [2+2] photocycloaddition upon irradiation with 365 nm light, which prevents strand B from fully hybridizing to strand A. In this "closed" state, the E3-i and POI-i ligands are held apart, preventing ternary complex formation and protein degradation. Importantly, theCNVK crosslink can be cleaved by brief irradiation with 312 nm light, enabling the blocker strand to be displaced by strand B via toehold-mediated strand displacement. This leads to the formation of the active DTAC complex, with the E3-i and POI-i ligands brought into proximity.

[0239] Two variants of the blocker strand were synthesized, containing either one or threeCNVK modifications, to evaluate the effect of crosslink density on the efficiency of photoactivation (FIG. 24). The oligonucleotides were prepared by solid-phase synthesis using the appropriateCNVK-modified phosphoramidites, and their identities were confirmed by ESI-MS (FIG. 25). Crosslinking was performed by hybridizing the blocker strands to strand A in a 1:1 ratio, followed by irradiation with 365 nm light for various durations. Denaturing PAGE analysis revealed the formation of slower-migrating crosslinked products, with higher efficiency observed for the tripleCNVK variant (FIG. 26).PATENT Attorney Docket No. G8118-04301

[0240] To assess the light-triggered conformational change of the SDTAC, strand A was first hybridized with the blocker strand and the photocrosslinking step was performed. Subsequent addition of strand B did not lead to displacement of the blocker, as evidenced by a lack of change in the PAGE band pattern (FIG.28). However, irradiation of this "closed" complex with 312 nm light led to the rapid and complete disappearance of the crosslinked band and the concomitant appearance of a new band corresponding to the strand B-displaced "open" state (FIG. 29). The uncaging kinetics were dependent on the light dose, with full activation achieved within 8 min at an intensity of 1.8 mW / cm2.

[0241] "Caged" and "uncaged" versions of SDTAC-V3 were prepared using the tripleCNVK blocker strand and transfected into U251 cells. As expected, the caged construct showed minimal degradation of CDK4 / 6 and cyclin D1, whereas the uncaged SDTAC induced robust degradation, comparable to that of the native DTAC-V3 (data not shown). The in situ photoactivation of SDTAC-mediated degradation was then demonstrated by irradiating cells treated with the caged construct. Gratifyingly, irradiation with 312 nm light triggered a time-dependent decrease in CDK4 / 6 and cyclin D1 levels, reaching a maximum after 4 h. No degradation was observed in non-irradiated cells or in cells treated with a control SDTAC lacking the photocleavable blocker strand.

[0242] A Blocker strand (19 nucleotides) designed strategically to modify with one and threeCNVK’s (3-cyanvinylcarbazole nucleoside) was synthesized in-house through solid-state DNA synthesis. Strand A complementary to blocker was designed to contain thymine (pyrimidine base) at positions (n+1) complementaryCNVK (n). This allows cross-linking between thymine base on strand A toCNVK on blocker strand via [2+2] photocycloaddition, which is monitored by denaturing page gel electrophoresis after crosslinking. For a proof-of- concept experiment, one and threeCNVK strand was mixed with strand A in a 1:1 ratio based on their extinction coefficient and exposed to 365 nm light using a UV Kessil lamp for different intervals of time from 10 s to 5 min. These samples were immediately exposed to 95°C heating and ran over denaturing gel. The presence of a dark higher band in denaturing condition confirms successful crosslinking between strand A and blocker. Moreover, this band moves slower when threeCNVK are used on blocker strand indicating a complete cross- linking. As reported in literature, complete crosslinking is observed at as low as 10 s exposure with as low as 250 mW / cm2 power density.

[0243] After successful confirmation of crosslinking phenomenon, Strand B was introduced to the system of strand A and blocker. We hypothesized that in case ofPATENT Attorney Docket No. G8118-04301 crosslinking a structure such as (e) will be observed due to the binding of all three strands forming in active SDTAC, whereas in the absence of cross-linking, the blocker strand will be replaced by strand B to form (d).

[0244] This study was monitored through a native page gel electrophoresis. Here two set of samples were prepared containing strand A and blocker without (-) and with (+) exposure to 365 nm light. A successful self-assembly in either case confirms the formation of duplex (b) and (c) respectively, with no difference in gel mobility. However, addition of strand B to these two sets of samples, followed by annealing at 95°C (5 min) to room temperature yield two different mobility samples as observed in (d) and (e). The lane with faster mobility sample also shows blocker strand confirming the release of blocker and binding of strand A with B forming (d). On the other hand, a complex made of A, B and blocker moves slower on the gel indicated by the formation of complex structure (e).

[0245] After confirming the inactive state of SDTAC forms successfully, the photo decrosslinking was tested. For this experiment, a Kernel Narrowband UVB 311 nm lamp (power density: 1.8 mW / cm2) was used for exposure to the inactive SDTAC structure at different intervals of time from 0 to 10 min. The decrosslinking was monitored through a native page gel by checking the disappearance of inactive complex structure (b) and appearance of active duplex structure (a). Indeed, native page gel clearly showed a difference between the two starting at 4 min, the decrosslinking was complete at 8 min. Further, optimizations of time and concentrations are required before testing with E3-i and POI-i strands in vitro. Example 6: Conditional DTAC activation through DNA-based logic gates

[0246] A series of DNA-based logic gates was designed that enable the activation of DTACs in the presence of specific microRNA (miRNA) inputs. MiRNAs are small non- coding RNAs that play important roles in regulating gene expression and are frequently dysregulated in disease states, making them attractive biomarkers and potential therapeutic targets.

[0247] The miRNA-responsive DTAC design leverages the principles of toehold- mediated strand displacement and competitive hybridization. The system comprises three main components: an "input" strand that bears the POI-i ligand, a "gate" strand that carries the E3-i ligand, and one or more "blocker" strands that are complementary to portions of the input and gate strands (FIG. 32). In the resting state, the blocker strands hybridize to the input and gate, preventing the formation of an active DTAC complex. However, in the presence ofPATENT Attorney Docket No. G8118-04301 a specific miRNA that is fully complementary to the blocker, the miRNA will competitively hybridize to the blocker, leading to its displacement from the input and gate strands. This, in turn, allows the input and gate to associate, bringing the POI-i and E3-i ligands into proximity and enabling ternary complex formation and protein degradation.

[0248] To test this concept, a set of input, gate, and blocker strands was designed that respond to miR-21, an oncogenic miRNA that is overexpressed in many cancers, including glioblastoma. The sequences were designed to minimize off-target interactions and optimized for efficient strand displacement using thermodynamic modeling. The oligonucleotides were synthesized by solid-phase synthesis and their identities were confirmed by ESI-MS. The input and gate strands were conjugated to palbociclib and pomalidomide, respectively, as in previous examples.

[0249] The function of the miR-21-responsive DTAC system was first validated in a cell- free setting. The input, gate, and blocker strands were hybridized in equimolar ratios to form the inactive complex, which was then incubated with increasing concentrations of either miR- 21 or a scrambled control miRNA. The extent of strand displacement was monitored by native PAGE, which showed a dose-dependent increase in the formation of the active DTAC complex in the presence of miR-21 but not the control miRNA.

[0250] All publications, patents, and patent documents are incorporated by reference herein, as though individually incorporated by reference. The invention has been described with reference to various specific and preferred embodiments and techniques. However, it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention.

Claims

PATENT Attorney Docket No. G8118-04301 CLAIMS What is claimed is:

1. A nucleic acid complex comprising: a. a first strand nucleic acid sequence comprising an E3 ligase targeting binder; b. a second strand nucleic acid sequence comprising a Protein of Interest (POI) ligand; wherein the first strand nucleic acid sequence and the second strand nucleic acid sequence are at least partially complementary.

2. The nucleic acid complex of claim 1, wherein the first strand nucleic acid sequence and the second strand nucleic acid sequence independently comprise one or a plurality of modified bases.

3. The nucleic acid complex of claim 2, wherein the one or a plurality of modified bases is a click chemistry-adapted base, an aldehyde-adapted base, or a thiol-adapted base.

4. The nucleic acid complex of claim 2, wherein the first strand nucleic acid sequence comprises an E3 ligase targeting binder covalently connected to a first modified base, and the second strand nucleic acid sequence comprises a Protein of Interest (POI) ligand covalently connected to a second modified base.

5. The nucleic acid complex of claim 4, wherein the first modified base is complementary to the second modified base.

6. The nucleic acid complex of claim 4, wherein the first strand nucleic acid sequence comprises a plurality of base positions, and the second strand nucleic acid sequence comprises a plurality of base positions.

7. The nucleic acid complex of claim 6, wherein the POI ligand is covalently connected to a first modified base which is positioned from 1 to 100 base positions apart from a second modified base covalently connected to an E3 ligase targeting binder.

8. The nucleic acid complex of claim 1, further comprising a Protein of Interest preferentially bound to the POI ligand.PATENT Attorney Docket No. G8118-04301 9. The nucleic acid complex of claim 1, further comprising an E3 ligase preferentially bound to the E3 ligase targeting binder.

10. The nucleic acid complex of claim 1, wherein the first strand nucleic sequence and the second strand nucleic acid sequence independently comprise DNA or RNA.

11. The nucleic acid complex of claim 1, wherein the first strand nucleic acid sequence or the second strand nucleic acid sequence independently further comprises a cell-receptor ligand.

12. The nucleic acid complex of claim 1, wherein the first strand nucleic acid sequence is covalently connected to the second strand nucleic acid sequence.

13. The nucleic acid complex of claim 12, wheren the covalent connection is reversible with light activation.

14. The nucleic acid complex of claim 13, wherein the first strand comprises a first strand 5’ terminus and a first strand 3’ terminus, the second strand comprises a second strand 5’ terminus and a second strand 3’ terminus, wherein the first strand 3’ terminus is covalently connected to the second strand 5’ terminus or the first strand 5’ terminus is covalently connected to the second strand 3’ terminus.

15. The nucleic acid complex of claim 14, wherein the covalent connection is a spacer in a spacer-modified nucleotide.

16. The nucleic acid complex of claim 1, further comprising a third strand nucleic acid sequence which is partially complementary to a portion of the first strand nucleic acid sequence or the second strand nucleic acid sequence, and is competitive for the respective cognate sequence.

17. The nucleic acid complex of claim 16, wherein the third strand nucleic acid sequence is reversibly covalently connected to the first strand nucleic acid sequence or the second strand nucleic acid sequence.

18. The nucleic acid complex of claim 2, wherein the E3 ligase targeting binder is covalently connected to a click-chemistry modified base in the first strand nucleic acid sequence.PATENT Attorney Docket No. G8118-04301 19. The nucleic acid complex of claim 2, wherein the POI ligand is covalently connected to a click-chemistry modified base in the second strand nucleic acid sequence.

20. A pharmaceutical composition comprising a nucleic acid complex of any of claims 1- 18 and a pharmaceutically acceptable carrier.

21. A method of killing a cancer cell, the method comprising contacting a nucleic acid complex of any of claims 1-18 with a cancer cell at a nucleic acid complex concentration of sufficient amount to kill said cancer cell.

22. A method of treating cancer in a subject in need thereof, the method comprising administering to a subject a therapeutically effective amount of the pharmaceutical composition of claim 20 to said subject.

23. The method of claim 22, further comprising administering a therapeutically effective amount of an anticancer agent to said subject.

24. A use of a nucleic acid complex of any of claims 1-18 in the manufacture of a medicament for treating cancer in a subject.

Images