Replacing synthetic fertilizers by engineering cereal-associated nitrogen-fixing bacteria to release urea

Abstract

Nitrogen is one of the primary nutrients essential to all forms of life. However, only a few plant species can live in a symbiotic relationship with nitrogen-fixing bacteria and nitrogen must first be converted to a form that plants can utilize. Accordingly, aspects of the present disclosure relate to providing nitrogen fixation to cereal plants using genetically engineered bacteria. In some embodiments, genetically engineered bacteria comprise engineered nucleic acids encoding one or more urea metabolism regulators and / or effect the activity of one or more urea metabolism regulators. In some embodiments, the genetically engineered bacterium release more extracellular urea compared to wildtype counterparts. In some embodiments, extracellular urea is ultimately broken down into ammonia and carbon dioxide which are subsequently used by a plant cell to produce amino acids and glucose, respectively.

Description

[0001] REPLACING SYNTHETIC FERTILIZERS BY ENGINEERING CEREAL-ASSOCIATED NITROGEN-FIXING BACTERIA TO RELEASE UREA

[0002] RELATED APPLICATIONS

[0003] The application claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Application number 63 / 513,087 filed July 11, 2023, and U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, each of which is herein incorporated by reference in its entirety.

[0004] FEDERALLY SPONSORED RESEARCH

[0005] This invention was made with government support under DE-AR0001569 awarded by the U.S. Department of Energy. The government has certain rights in the invention.

[0006] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0007] The contents of the electronic sequence listing (M065670535WO00-SEQ-HCL.xml; Size: 191,731 bytes; and Date of Creation: July 11, 2024) is herein incorporated by reference in its entirety.

[0008] BACKGROUND OF INVENTION

[0009] Availability of nitrogen is one of the principal elements limiting growth and development of crops, particularly in agricultural soils for plant production of food, feed, fiber, and fuel. Excessive use of synthetic fertilizer to meet the food demands of a growing population poses an environmental threat in that it can cause haimful algal blooms and disrupt beneficial soil microbial community. On the other hand, over-farming in many developing countries with a scant supply of fertilizer damages agricultural land and makes small fanners suffer from the poor yield of their crops.

[0010] SUMMARY OF INVENTION

[0011] Nitrogen is one of the primary nutrients essential to all forms of life, including plants. However, nitrogen must first be converted to a form that plants can utilize. Biological Nitrogen Fixation (BNF) is the conversion of atmospheric nitrogen (No) to ammonia (NH3) using the enzyme nitrogenase. This reaction consumes a tremendous amount of energy as N2 contains a triple bond. The bond energy in a nitrogen molecule is about 225 kcal / mol. Few BNFs are performed in nature as a result of a symbiotic relationship between plants and several bacterial species that make up a “nitrogenase enzymatic complex.” The bacterial species that produce the nitrogenase enzymatic complex include diazotrophs, such as cyanobacteria, azotobacteraceae, rhizobia, and frankia.

[0012] However, only a few plant species can live in a symbiotic relationship with diazotrophs. For example, the pea plant from the legume family lives in symbiosis with bacteria from the rhizobia family. In particular, rhizobia bacteria penetrate the pea plant's roots creating root nodules that contain bacteria that fix nitrogen (to ammonia) while the plant donates carbon (sugar) to the biomass.

[0013] Biological nitrogen fixation is carried out by a complex of three proteins (nitrogenase), encoded by nifH, nifD and nifK, which are assembled and activated by additional genes. Yet, at least in some instances, nitrogenase activity alone may lead to ammonia release which is rapidly assimilated into cellular metabolism.

[0014] One example of an enzyme that catalyzes nitrogen assimilation is glutamine synthetase. Previous attempts to reduce glutamine synthetase-dependent assimilation of released ammonia into the cellular environment have shortcomings. For instance, preventing assimilation of ammonia arrests cellular growth and genetic changes for modulating glutaminase function commonly yields mutant bacteria with non- agriculturally suitable properties. Additionally, said mutant bacteria may outcompete its functional peers or lead to glutamine synthetase expression dynamics that are toxic.

[0015] Similar to ammonia, urea is a byproduct of normal cellular metabolism and also may be used as a nitrogen and carbon source by plants. In the absence of urease activity, accumulated urea does not repress nitrogen fixation. Additionally, urea assimilates into cellular metabolism and does not yield growth arrest required by existing strategies for modulating ammonia assimilation.

[0016] Accordingly, aspects of the present disclosure relate to providing nitrogen fixation to cereal plants using genetically engineered bacteria. In some embodiments, the genetically engineered bacteria release more extracellular urea compared to a non-genetically engineered counterpart bacteria. In some embodiments, the genetically engineered bacteria release a higher extracellular urea to extracellular ammonia ratio compared to a non-genetically engineered counterpart bacteria. In some embodiments, the genetically engineered bacteria are epiphytic bacteria, endophytic bacteria, and / or plant root- associated bacteria. In some embodiments, the genetically engineered bacteria are Azorhizobium caulinodans. In some embodiments, genetically engineered bacteria comprise one or more urea metabolism regulators with altered functions. In some embodiments, genetically engineered bacteria comprise one or more variant urea catabolism genes. In some embodiments, the one or more variant urea catabolism genes comprise a variant urease gene cluster. In some embodiments, the variant urease gene cluster comprises a deletion of the ure cluster. In some embodiments, the one or more variant urea catabolism genes comprise a variant urea carboxylase gene. In some embodiments, the variant urea carboxylase gene comprises a deletion of the uc gene. In some embodiments, the one or more variant urea catabolism genes comprise a variant allophanate hydrolase gene. In some embodiments, the variant allophanate hydrolase gene comprises a deletion of the ah gene.

[0017] In some embodiments, genetically engineered bacteria comprise an engineered nucleic acid encoding an arginase. In some embodiments, the engineered nucleic acid comprises a rocF gene from Bacillus subtilis. In some embodiments, the engineered nucleic acid encodes an arginase gene variant which is codon optimized and / or is operably linked to a heterologous regulatory sequence.

[0018] In some embodiments, genetically engineered bacteria comprise an engineered nucleic acid encoding a carbamoyltransferase gene. In some embodiments, the genetically engineered bacteria comprise the carbamoyltransferase gene is encoded by the arg / gene.

[0019] In some embodiments, genetically engineered bacteria comprise an engineered nucleic acid encoding a N- acetylglutamate synthetase gene. In some embodiments, the N- acetylglutamate synthetase gene is encoded by the argA gene.

[0020] In some embodiments, genetically engineered bacteria comprise an engineered nucleic acid comprising an operon. In some embodiments, the operon comprises the arginase gene. In some embodiments, the operon comprises the carbamoyltransferase gene. In some embodiments, the operon comprises the N- acetylglutamate synthetase gene.

[0021] In some embodiments, any one or more of said genes are operably linked to at least one heterologous regulatory sequence. In some embodiments, the at least one heterologous regulatory sequence comprises an inducible promoter or a constitutive promoter. In some embodiments, the inducible promoter comprises an IPTG-inducible promoter. In some embodiments, the constitutive promoter comprises a nitrogenase complex constitutive promoter. In some embodiments, the nitrogenase complex constitutive promoter comprises the nijH' promoter. In some aspects, the present disclosure further provides a composition comprising the genetically engineered bacteria and an agricultural carrier. In some embodiments, the composition further comprises one or more cereal plants. In some embodiments, the composition further comprises one or more cereal plant seeds. In some embodiments, the composition further comprises cereal plant soil. Additionally, in other aspects, the present disclosure further provides methods for providing fixed nitrogen in the form of urea to a cereal plant, a cereal plant seed, or to soil thereof.

[0022] BRIEF DESCRIPTION OF DRAWINGS

[0023] FIGs. 1A-1B show an overview of how urea is used by plants for carbon fixation purposes. FIG. 1A shows a cartoon of a cereal plant wherein synthetic urea is applied directly to plant tissues and subsequently broken down to yield ammonia (NH3) and carbon dioxide (CO2) which are subsequently used as substrates in a plant photosynthetic pathway. FIG. IB shows a diagram of how bacteria (e.g., epiphytic, endophytic, and / or plant-root associated bacteria in cereal plant soil) comprising nitrogenase synthesize intracellular ammonia (NH3) which, via the urea cycle, recombines with carbon dioxide (CO2) to produce urea. Urea is ultimately released from the cell where it can be broken down into ammonia (NH3) and carbon dioxide (CO2) which are subsequently used by a plant cell to produce amino acids and glucose, respectively.

[0024] FIGs. 2A-2C show a non-limiting example of a genetic engineering strategy to remove the urea catabolizing route in Azorhizobium caulinodans. FIG. 2A shows a non-limiting example of a urea catabolism pathway in A. caulinodans, and its associated metabolites, catalyzed by urea carboxylase (uc gene) and allophanate hydrolase (ah gene) to produce ammonia (NH3) and carbon dioxide (CO2). FIG. 2B shows representative cell streaking analyses, wherein genetically engineered A. caulinodans comprising one or more deletion (A) variants of urea catabolism genes (urease gene cluster (ure)', ure and ah', or ure, uc and ah) were struck on L3 minimal medium (MM) supplemented with 5mM glutamine or 20mM urea. FIG. 2C shows representative growth dynamics data (left- side panel) and extracellular urea production (right side panel) of genetically engineered A. caulinodans comprising one or more deletion (A) variants of urea catabolism genes ure, ure and ah', or ure, uc and ah) grown in L3 minimal media supplemented with 20mM urea. In the right-side panel, the initial concentration of media is represented as a dotted line. FIGs. 3A-3D show non-limiting examples of genetic engineering strategies to increase extracellular urea production in A. caulinodans comprising deletion (A) variants of ure, uc and ah genes. FIG. 3A shows a genetic engineering strategy for expression of an exogenous arginase in genetically engineered A. caulinodans, wherein an engineered nucleic acid (engineered pBRRl plasmid) comprising a codon optimized rocF gene variant derived from Bacillus subtilis was operably linked to an inducible regulatory sequence (a lac operator PlacOl comprising an IPTG- inducible promoter) and a ribosomal binding site (RBS) (left side panel), thereby yielding overexpression of heterologous rocF (right side panel) in A. caulinodans comprising deletion variants of ure, uc and ah genes. FIG. 3B shows a genetic engineering strategy for expression of an exogenous arginase in genetically engineered A. caulinodans, wherein an engineered operon (provided on an engineered pBRRl plasmid) comprising a codon optimized rocF gene variant derived from B. subtilis and a carbamoyltransferase encoded by a argl gene variant were operably linked to an inducible regulatory sequence (a lac operator (PlacO ) comprising an IPTG-inducible promoter) and respective ribosomal binding sites (RBS) (left side panel), thereby yielding ovcrcxprcssion of heterologous arginase and heterologous carbamoyltransferase in A. caulinodans comprising deletion variants of ure, uc and ah genes. FIG. 3C shows representative data from extracellular urea production assays of genetically engineered A. caulinodans grown minimal media (MM), wherein the genetically engineered A. caulinodans comprised either: deletion of the ure, uc and ah genes only; deletion of the ure, uc and ah genes and a heterologous, codon optimized rocF gene variant; deletion of the ure, uc and ah genes, a heterologous, codon optimized rocF gene variant, and an arg A gene variant encoding a heterologous N- acetylglutamate synthetase comprising a substitution of histidine to tyrosine at amino acid residue position 16 (H16Y); or deletion of the ure, uc and ah genes, a heterologous, codon optimized rocF gene variant, and a heterologous argl gene variant. FIG. 3D shows representative data from analyses of an A. caulinodans strain comprising deletions of the ure, uc, and ah genes, and an arginase rocF gene (left panel) which is derived from a Rhizobia that is not A. caulinodans (strains labeled on x-axis of graph in right panel).

[0025] FIGs. 4A-4B show a non-limiting example of genetic engineering strategy to yield urea biosynthesis under the control of nitrogen fixation. FIG. 4A shows a genetic engineering strategy for expression of an exogenous arginase in genetically engineered A. caulinodans comprising deletion valiants of ure, uc and ah genes, wherein an engineered operon (provided on an engineered pBRRl plasmid) comprised a codon optimized rocF gene variant and an argl gene variant which were operably linked to respective ribosome binding sites (RBS) and an upstream heterologous promoter, (either a lac operator (PlacOl) or a constitutive nifH promoter). FIG. 4B shows representative data from extracellular urea production assays of A. caulinodans strains grown minimal media (MM), wherein said strains were genetically engineered to comprise the engineered nucleic acids of FIG. 4 A.

[0026] FIGs. 5A-5B shows analyses that utilized A. caulinodans comprising a urea-responsive sensor. FIG. 5A shows a non-limiting example of an engineered nucleic acid comprising a urea sensor which utilizes an AraC-like Transcriptional Activator from Providencia smart ii (UreR). FIG. 5B shows results obtained from analyses of fluorescent reporter gene expression in A. caulinodans comprising the UreR sensor.

[0027] FIGs. 6A-6B shows analyses that utilized A. caulinodans comprising a urea-responsive sensor that couples bacterial growth to increased urea concentrations. FIG. 6A shows a non-limiting example of an engineered nucleic acid comprising a urea sensor which provides antibiotic resistance in response to urea treatment. FIG. 6B shows results obtained from analyses of A. caulinodans growth in the presence of antibiotic and varying concentrations of urea.

[0028] FIGs. 7A-7C shows analyses that utilized A. caulinodans that were positively selected for genetic modifications that result in increased urea production. FIG. 7A shows a non-limiting example of an engineered nucleic acid comprising a urea sensor which provides antibiotic resistance in response to urea treatment. FIG. 7B shows introduction of the urea sensor into A. caulinodans comprising deletions of ure, uc, and ah. FIG. 7C shows results obtained from analyses of A. caulinodans growth in the presence of antibiotic and varying concentrations of urea.

[0029] DETAILED DESCRIPTION OF INVENTION

[0030] Aspects of the present disclosure relate to providing nitrogen fixation to cereal plants using genetically engineered bacteria. Disclosed herein are engineered nitrogen-fixing microbes (e.g., genetically engineered bacteria) which are able to efficiently release fixed nitrogen. Engineered bacteria described herein will typically comprise disrupted function of a urea catabolism regulator and express an arginase. In some aspects, the disclosure relates to genetically engineered bacteria that comprise engineered nucleic acids. In some embodiments, engineered nucleic acids include exogenous nucleic acids, such as transformed plasmids and / or structurally altered endogenous nucleic acids, such as genetically engineered host chromosome sequences which comprise mutated native genes and / or deleted native genes. In some embodiments, expression of said engineered nucleic acids in genetically engineered bacteria promote increased levels of extracellular urea. In some embodiments, said increases in extracellular' urea arise as a result of increased urea production and / or disrupted native routes (e.g., enzymatic pathways) which break down urea in genetically engineered bacteria. The result is that the bacteria release significant amounts of urea during nitrogen-fixation, which may be used to supplement nitrogen requirements of cereal crops. In some embodiments the production of the urea can be tightly controlled. For instance, in some embodiments, the production of urea may be made dependent on nitrogen fixing conditions by connecting the gene expressions to a promoter which is inducible only under certain conditions, such as when nitrogen fixation is occurring.

[0031] In some embodiments, genetically engineered bacteria comprise one or more engineered nucleic acids that encode one or more urea metabolism regulators with altered structure and / or function (e.g., an endogenous bacterial chromosome that is genetically engineered to comprise a urea catabolism gene comprising an inactivating mutation and / or an engineered nucleic comprising an arginase gene). In some embodiments, expression of said engineered nucleic acids increase urea production by effecting flux of metabolic pathways that utilize urea and other metabolites as substrates.

[0032] In some embodiments, urea metabolism regulators are encoded by variant genes in genetically engineered bacteria. In some embodiments, variant genes encoding urea metabolism regulators produce, upon expression, a urea metabolism regulator which alters endogenous urea metabolism in genetically engineered bacteria. In some embodiments, one or more genes encoding urea metabolism regulators that breakdown urea are deleted in genetically engineered bacteria. In some embodiments, one or more genes encoding urea metabolism regulators which metabolize ammonia and / or other metabolites during urea production are expressed. For instance, in some embodiments, one or more genes encoding urea metabolism regulators which metabolize ammonia and / or other metabolites during urea production are over-expressed in genetically engineered bacteria.

[0033] In some embodiments, genetically engineered bacteria express one or more genes encoding urea metabolism regulators which are operably linked to non-natural expression regulatory sequences. In some embodiments, one or more genes that increase urea production are genetically upregulated. In some embodiments, the one or more genes are genetically upregulated by operably linked said gene(s) to a heterologous promoter. In some embodiments, the heterologous promoter comprises an inducible promoter or a constitutive promoter.

[0034] In some embodiments, genetically engineered bacteria comprise a combination of urea metabolism regulators with altered functions. For example, in some embodiments, genetically engineered bacteria comprise a deletion in one or more genes in order to reduce urea degradation in addition to an engineered sequence comprising a gene which upregulates urea production.

[0035] In some embodiments, genetically engineered bacteria are delivered to a cereal plant for biofertilization purposes. In some embodiments, cereal plants include cultivated forms of grasses (Poaceae), such as wheat (c.g., spelt, cinkorn, emmer, kamut, durum and triticalc), rye, barley, rice, wild rice, maize (corn), millet, sorghum, teff, fonio oats and pseudocereals, such as amaranth, quinoa and buckwheat.

[0036] In some embodiments, genetically engineered bacteria are contacted with germinating seeds of cereal plants, emerging seedlings of cereal plants, and / or cereal plant vegetation (e.g., belowground portions, such as plant roots and above ground portions). In some embodiments, genetically engineered bacteria are delivered to soil of cereal plants or seeds thereof.

[0037] Genetically Engineered Bacteria

[0038] A genetically engineered bacteria, as used herein, is a bacteria comprising one or more different nucleic acids (e.g., engineered nucleic acids described herein), relative to a non-genetically engineered counterpart bacteria, such as, for instance, a nucleic acid comprising one or more deleted nucleotides (e.g., nucleotides located in codons or regulatory sequences), one or more deleted nucleic acids (e.g., genes), one or more modified nucleotides (e.g., substitutions of a natural or nonnatural nucleotide, such as a chemically modified nucleotide) one or more modified nucleic acids (e.g., replacement of a native regulatory sequence with a heterologous regulatory sequence), and / or one or more inserted heterologous or exogenous nucleic acids (e.g., an insertion of a gene or a regulatory sequence). For instance, in some embodiments, the genetically engineered bacteria may comprise one or more variant urea catabolism genes.

[0039] In some embodiments, genetically engineered bacteria described herein are plant endosymbionts which do not cause disease in plants for at least some or all of the plant life cycle. In some embodiments, genetically engineered bacteria are cereal plant endosymbionts. In some embodiments, genetically engineered bacteria are not natural plant endosymbionts but have been genetically engineered to not cause disease in plants. For example, in some embodiments, a genetically engineered bacteria comprise one or more mutated genes that are pathogenic to plants, such as one or more genes involved in production of an effector.

[0040] In some embodiments, genetically engineered bacteria described herein comprise epiphytic bacteria, endophytic bacteria, and / or plant root-associated bacteria. In some embodiments, genetically engineered epiphytic bacteria, genetically engineered endophytic bacteria, and / or genetically engineered plant root-associated bacteria occupy the intracellular or extracellular spaces of cereal plant tissue. In some embodiments, genetically engineered epiphytic bacteria, genetically engineered endophytic bacteria, and / or genetically engineered plant root- associated bacteria “colonize” cereal plant tissue. In some embodiments, said genetically engineered epiphytic bacteria, genetically engineered endophytic bacteria, and / or genetically engineered plant root-associated bacteria become established, stable, and undergo cellular reproduction when in contact with cereal plant tissue. In some embodiments, genetically engineered epiphytic bacteria are found on the leaves, stems, flowers, fruits, seeds, and / or roots of a cereal plant. In some embodiments, genetically engineered endophytic bacteria are found in or on the leaves, stems, flowers, fruits, seeds, and / or roots of a cereal plant. In some embodiments, genetically engineered root-associated bacteria are found in or on the leaves, stems, flowers, fruits, seeds, and / or roots of a cereal plant.

[0041] In some embodiments, genetically engineered epiphytic bacteria, genetically engineered endophytic bacteria, and / or genetically engineered plant root-associated bacteria as described herein comprise a-Proteobacteria, P-Proteobacteria, y-Proteobacteria, Firmicutes, or Actinobacteria (e.g., a-Proteobacteria, -Proteobacteria, y-Proteobacteria, Firmicutes, or Actinobacteria that comprise nitrogen fixation genes, such as a strain that naturally comprises a nif cluster). In some embodiments, genetically engineered bacteria are gram-negative bacteria. In some embodiments, genetically engineered bacteria are Salmonella (e.g., .S'. typhimurium, such as strains selected from SL1344, LT2, and DW01). In some embodiments, genetically engineered bacteria are Yersinia (e.g., Y. pestis). In some embodiments, genetically engineered bacteria are Vibrio (e.g., V. cholerae). In some embodiments, genetically engineered bacteria are Bradyrhizobium (e.g., B. japonicum). In some embodiments, genetically engineered bacteria are Kosakonia (e.g., K. sacchari). In some embodiments, genetically engineered bacteria are Azospirillum (e.g., A. brasilense). In some embodiments, genetically engineered bacteria are Agrobacterium (e.g., A. tumefaciens) . In some embodiments, genetically engineered bacteria are Gluconacetobacter (e.g., G. diazotrophic us). In some embodiments, genetically engineered bacteria are Pseudomonas (e.g., P. aeruginosa, P. syringae pv. aclinidiae, P. slutzeri, or P. protogens). In some embodiments, genetically engineered bacteria are Escherichia coli (e.g., the strain H7:0157). In some embodiments, genetically engineered bacteria are Xanthomonas e.g., X. axonopodis pv. citri). In some embodiments, genetically engineered bacteria arc Rhodobacter (e.g., R. sphaeroides). In some embodiments, genetically engineered bacteria are Klebsiella (e.g., K. oxytoca, K. variicola, and K. pneumoniae). In some embodiments, genetically engineered bacteria arc Azotobacter (e.g., A. chroococcum and A. vinelandii). In some embodiments, genetically engineered bacteria are Rhizobia (e.g., Rhizobia of the class a-proteobacteria or of the class P-proteobacteria). In some embodiments, genetically engineered bacteria are a species of the genus Rhizobium (e.g., R. leguminosarum and R. sp. IRBG74). In some embodiments, genetically engineered bacteria are a species of the genus Sinorhizobium (Ensifer) (e.g., .S', meliloti). In some embodiments, genetically engineered bacteria are a species of the genus Azorhizobium (e.g., A. caulinodans). In some embodiments, genetically engineered bacteria are a species referred to by an Organism Identifier described in U.S. Provisional Application number 63 / 513,087 filed July 11, 2023, and / or U.S. Provisional Application number 63 / 632,173 filed April 10, 2024 at Table 1, Table 3, Table 4, or Table 5, each of which is incorporated by reference for the contents found in each of Table 1, Table 3, Table 4, and Table 5.

[0042] In some embodiments, genetically engineered bacteria described herein comprise one or more urea metabolism regulators. As used herein, a “urea metabolism regulator” refers to a protein (e.g., an enzyme, transcription factor, signaling protein, etc.) or a gene thereof which, upon expression, influences the synthesis and / or breakdown of urea in bacteria. This term applies to both natural forms (e.g., urea metabolism regulators encoded by genes with wildtype coding sequences operably linked to native regulatory sequences) and non-natural forms thereof (e.g., urea metabolism regulators encoded by genes that are engineered, such variant genes with codon optimized coding sequence coding sequences and / or genes operably linked to a heterologous regulatory sequence). Non-limiting examples of both natural urea metabolism regulators and engineered counterparts thereof are further described herein. In some embodiments, for example, a urea metabolism regulator, or an engineered urea metabolism regulator, is a gene or a protein involved in the breakdown of urea (also referred to herein as a urea catabolism regulator) described herein. In some embodiments, for example, a urea metabolism regulator, or an engineered urea metabolism regulator, is a gene or a protein involved in the production of urea (also referred to herein as a urea synthesis regulator) described herein. Accordingly, this term encompasses molecules that influence urea levels either directly (e.g., an enzyme that catalyzes reactions resulting in urea synthesis or breakdown into metabolites) or indirectly (e.g., a transcription factor or signaling protein which regulates the activity of a direct urea metabolism regulator, such as an urea biosynthetic enzyme encoded by a urea catabolism gene, or a transcription factor which regulates an enzyme that produces a co-factor or co-cnzymc of a urea biosynthetic enzyme).

[0043] Engineered Nucleic Acids

[0044] In some embodiments, the present disclosure relates to engineered nucleic acids that can be used to produce genetically engineered bacteria described herein. In some embodiments, genetically engineered bacteria comprise one or more (e.g., two, three, four, five, six, seven, etc.) engineered nucleic acids.

[0045] As used herein, an “engineered nucleic acid” refers to nucleic acids that are produced in a non-natural setting. In some embodiments, engineered nucleic acids comprise naturally occurring gene sequences comprising naturally-occurring components derived from one or more genetic sources which have been covalently combined to yield an engineered nucleic acid. However, a nucleic acid sequence existing in its native state in its natural host is not an engineered nucleic acid.

[0046] Accordingly, in some embodiments, nucleic acids are considered engineered when a non- naturally occurring sequence has been generated in a laboratory setting. In some embodiments, engineered nucleic acids may be: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; and / or (iii) synthesized by, for example, chemical synthesis. In some embodiments, an engineered nucleic acid is one which has been manipulated by recombinant DNA techniques well known in the art e.g., by genetic engineering techniques using restriction enzymes, ligases, and similar recombinant techniques as described by, for example, Sambrook et al., Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, N.Y.; (1989), or Ausubel et al., Current Protocols in Molecular Biology, Current Protocols (1989), and DNA Cloning: A Practical Approach, Volumes I and II (ed. D. N. Glover) IREL Press, Oxford, (1985); each of which is incorporated herein by reference. Thus, a nucleotide sequence contained in a vector in which 5' and 3' restriction sites are known, or for which polymerase chain reaction (PCR) primer sequences may be designed, is considered engineered. In some embodiments, an engineered nucleic acid is substantially purified.

[0047] In some embodiments, engineered nucleic acids of the present disclosure comprise approximately 1-60,000 nucleotides. In some embodiments, engineered nucleic acids comprise approximately 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-200, 200- 300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1,000, 1,000-1,100, 1,100-1,200, 1,200-1,300, 1,300-1,400, 1,400-1,500, 1,500-1,600, 1,600-1,700, 1,700-1,800, 1,800-1,900, 1,900- 2,000, 2,000-2,100, 2,100-2,200, 2,200-2,300, 2,300-2,400, 2,400-2,500, 2,500-2,600, 2,600-2,700, 2,700-2,800, 2,800-2,900, 2,900-3,000, 3,000-3,100, 3,100-3,200, 3,200-3,300, 3,300-3,400, 3,400- 3,500, 3,500-3,600, 3,600-3,700, 3,700-3,800, 3,900-4,000, 4,000-4,100, 4,100-4,200, 4,200-4,300,

[0048] 4.300-4,400, 4,400-4,500, 4,500-4,600, 4,600-4,700, 4,700-4,800, 4,800-4,900, 4,900-5,000, 5,000-

[0049] 5.100, 5,100-5,200, 5,200-5,300, 5,300-5,400, 5,400-5,500, 5,500-5,600, 5,600-5,700, 5,700-5,800,

[0050] 5.800-5,900, 5,900-6,000, 6,000-6,100, 6,100-6,300, 6,200-6,300, 6,300-6,400, 6,400-6,500, 6,500-

[0051] 6.600, 6,600-6,700, 6,700-6,800, 6,800-6,900, 6,900-7,000, 7,000-7,100, 7,100-7,200, 7,200-7,300,

[0052] 7.300-7,400, 7,400-7,500, 7,500-7,600, 7,600-7,700, 7,700-7,800, 7,800-7,900, 7,900-8,000, 8,000-

[0053] 8.100, 8,100-8,200, 8,200-8,300, 8,300-8,400, 8,400-8,500, 8,500-8,600, 8,600-8,700, 8,700-8,800,

[0054] 8.800-8,900, 8,900-9,000, 9,000-9,100, 9,100-9,200, 9,200-9,300, 9,300-9,400, 9,400-9,500, 9,500-

[0055] 9.600, 9,600-9,700, 9,700-9,800, 9,800-9,900, 9,900-10,000, 10,000-15,000, 15,000-20,000, 20,000-30,000, 30,000-40,000, 40,000-50,000, or 50,000-60,000 nucleotides. However, in some embodiments, larger engineered nucleic acids may be used to generate genetically engineered bacteria. For example, in some embodiments, an engineered nucleic acid comprises 60,000-70,000, 70,000-80,000, 80,000-90,000, 90,000-100,000, or more than 100,000 nucleotides. In some embodiments, an engineered nucleic acid sequence comprises DNA. In some embodiments, an engineered nucleic acid sequence comprises RNA. In some embodiments, an engineered nucleic acid sequence comprises a combination of DNA and RNA. In some embodiments, an engineered nucleic acid comprises double- stranded DNA. In some embodiments, an engineered nucleic acid comprises single- stranded DNA. In some embodiments, an engineered nucleic acid comprises double-stranded RNA. In some embodiments, an engineered nucleic acid comprises single- stranded RNA. In some embodiments, an engineered nucleic acid comprises a double-stranded nucleic acid comprising a combination of DNA and RNA nucleotides. In some embodiments, an engineered nucleic acid comprises a double-stranded nucleic acid (e.g., DNA, RNA, or a combination of DNA / RNA) comprising gaps (e.g., stretches of sequence about, 1, 5, 10, 25, 50, 100 or more nucleotides in length) of single-stranded sequence at any position within the molecule. In some embodiments, an engineered nucleic acid is linear. In some embodiments, an engineered nucleic acid is circular. In some embodiments, an engineered nucleic acid comprises at least one single-stranded nick.

[0056] Non-limiting examples of engineered nucleic acids include engineered regulatory sequences, gene variants, engineered operons, expression constructs, vectors (e.g., plasmids and engineered artificial chromosomes), genetically engineered endogenous chromosomes, and engineered bacteriophage genomes. Further examples of engineered nucleic acids include, but are not limited to, nucleic acids described herein which are engineered to comprise nitrogen fixation genes (e.g., a refactored nif cluster), nucleic acids engineered to comprise gene variants (e.g., variants of urea metabolism regulators, such as urea catabolism regulators and / or urea synthesis regulators), and nucleic acids engineered to comprise deletions (e.g., deletions of urea metabolism regulators, such as deletions of a nif gene (e.g., nifA and / or nifL), a urea catabolism regulator (e.g., a are cluster gene, a uc gene, and / or an ah gene).

[0057] Nitrogen Fixation

[0058] In some embodiments, genetically engineered bacteria described herein comprise one or more nitrogen fixation genes. As used herein, a “nitrogen fixation gene” refers to a gene which, upon expression, influences the conversion of atmospheric nitrogen (N2) into other usable nitrogenous molecules (e.g., nitrogen in the form of ammonia, nitrites, nitrates, etc.) in bacteria. This term applies to both natural forms (e.g., genes with wildtype coding sequences operably linked to native regulatory sequences, such as a wildtype nif cluster gene from a natural nif cluster of a Rhizobia) and non-natural forms thereof (e.g., those that are engineered, such as a codon-optimized nif gene in a refactored nif cluster). Non-limiting examples of both natural nitrogen fixation genes and engineered counterparts thereof are further described herein. Accordingly, this term encompasses molecules that influence nitrogen fixation either directly (e.g., a nitrogenase) or indirectly (e.g., a transcription factor or signaling protein which regulates a nitrogenase).

[0059] In some embodiments, nitrogen fixation genes described herein comprise one or more nif cluster genes. In some embodiments, the one or more nif genes are derived from a Cyanthoece sp. nif cluster, Paenibacillus poly my xa nif cluster, Klebsiella pneumoniae nif cluster, K. oxytoca nif cluster, Azotobacter vinelandii nif cluster, Pseudomonas stutzeri nif cluster, Azospirillum brasilense nif cluster, Rhodobacter sphaeroides nif cluster, or Rhodopseudomonas palustris nif cluster. In some embodiments, the one or more nif genes are derived from a Rhizobia nif cluster, such as an R. leguminosarum nif cluster, an Azorhizobium caulinodans nif cluster, or a Sinorhizobium meliloti nif cluster. Non-limiting examples of nif cluster genes include nifA (encodes a nitrogenase- specific transcriptional activator protein (NifA), responsible for regulating the expression of other nif genes), nifB (encodes a protein involved in the synthesis of the iron-molybdenum cofactor, essential for the activation of nitrogenase), nifD (encodes one of the two subunits of the nitrogenase molybdenumiron (MoFe) protein, which actively participates in the reduction of nitrogen to ammonia), nifE (encodes a protein involved in the synthesis of FeMo-co (iron-molybdenum cofactor), a critical element in the nitrogenase MoFe protein), ni / F (encodes flavodoxin, which is an electron carrier that transfers electrons to nitrogenase), nifH (encodes the nitrogenase iron protein (Fe protein or dinitrogenase reductase), playing a pivotal role in electron transfer within the nitrogenase complex), nif J (encodes flavodoxin oxidoreductase, which oxidizes pyruvate and transfer high energy electrons to flavodoxin to flavodoxin (encoded by nz / F) to power nitrogen fixation), nifK (encodes the other subunit of the nitrogenase MoFe protein, working in conjunction with NifD to facilitate nitrogen fixation), nifL (encodes for a nitrogenase- specific regulatory protein (NifL which collaborates with NifA to modulate nitrogen fixation in response to varying oxygen levels), nifM (encodes a protein involved in maturation of the Fe protein), nifN (encodes a protein involved in the synthesis of FeMo-co, contributing to the structural integrity of the nitrogenase complex), nifQ (encodes a protein involved in the synthesis of the iron-molybdenum cofactor, contributing to the overall functionality of nitrogenase), nifS (encodes a protein involved in the synthesis of the ironmolybdenum cofactor, crucial for the proper functioning of nitrogenase), nifT (encodes an accessory protein), nifU (encodes a protein involved in iron-sulfur cluster assembly), nifV (encodes a protein involved in the synthesis of the iron-molybdenum cofactor, contributing to the maturation of functional nitrogenase), nifW (encodes a protein involved in the synthesis of the iron-molybdenum cofactor, playing a role in nitrogenase activation), nifX (encodes a protein that may be involved in the assembly or stabilization of the nitrogenase complex, contributing to its overall structural organization), nifY (encodes a protein involved in synthesis and insertion of FeMo-co), nifZ (encodes a protein involved in maturation of the MoFe protein). In some embodiments, genetically engineered bacteria comprise one or more genes encoding components of a nitrogenase (e.g., genes selected from nifH, nifD, and nifK), and one or more genes involved in iron molybdenum cofactor formation (e.g., genes selected from nifB, nifE, nifF, nifj, nifM, nifN, nifQ, nifS, niff, nifU, nifV, nifW, nifY, and nifZ). In some embodiments, genetically engineered bacteria comprise a nifH gene, a nifD gene, and / or a nifK gene. In some embodiments, genetically engineered bacteria comprise a nifH gene sequence and / or amino acid sequence, a nifD gene sequence and / or amino acid sequence, and a nifK gene sequence and / or amino acid sequence. In some embodiments, a nifH gene, a nifD gene, and / or a nifK gene comprises a nucleotide sequence referenced in Table 1 of U.S. Provisional Application number 63 / 513,087 filed July 11, 2023, and / or U.S. Provisional Application number 63 / 632,173 filed April 10, 2024 and / or encodes an amino acid sequence as referenced in Table 1 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, which is incorporated herein by reference. In some embodiments, genetically engineered bacteria comprise one or more genes involved in iron molybdenum cofactor formation (e.g., genes selected from nifB, nifE, nifF, nifj, nifM, nifN, nifQ, nifS, nifE, nifU, nifV, nifW, nifY, and nifZ) that are derived from a bacteria that naturally comprises a nifH gene sequence, a nifD gene sequence, and / or a nifK gene sequence referenced in Table 1 of U.S. Provisional Application number 63 / 632,173. In some embodiments, genetically engineered bacteria comprise a nifB gene, a nifE gene, and / or a nifN gene. In some embodiments, genetically engineered bacteria comprise a nifH gene, a nifD gene, a nifK gene, a nifB gene, a nifE gene, and a nifN gene. In some embodiments, the nifB gene sequence, the nifE gene sequence, and the nifN gene sequence are derived from a bacteria that naturally comprises a nifH gene, a nifD gene, and / or a nifK gene referenced in Table 1 of U.S. Provisional Application number 63 / 632,173.

[0060] In some embodiments, genetically engineered bacteria described herein naturally comprise nitrogen fixation genes. For example, in some embodiments, genetically engineered bacteria naturally comprise a nif cluster. Non-limiting examples of such bacteria include P. polymyxa, K. pneumoniae, K. oxytoca, A. vinelandii, A. brasilense, R. sphaeroides, R. palustris, K. oxytoca, Rhizobium, Mesorhizboium, Sinorhizobium, Azorhizobium, P. stutzeri, etc. In some embodiments, genetically engineered bacteria are a nitrogen-fixing bacteria of the genus Rhizobium, Mezorhizobium, Sinorhizobium (Ensifer), Bradyrhizobium, Phyllobacterium, Microvirga, Azorhizobium, Ocrhobaclrum, Melhylobacterium, Devosia, Shinella (class of a- proteobacteria), Burkholderia, Cupriavidus (formerly Rai si onia) (class of -proteobacteria). Rhizobia taxonomy has been previously described (see, e.g., Berrada & Benbrahim (2014). Taxonomy of the Rhizobia: Current Perspectives. British Microbiology Research Journal, 4(6): 616-639, which is incorporated by reference herein for disclosures related to biological characteristics of Rhizobia).

[0061] In some embodiments, genetically engineered bacteria described herein do not naturally comprise nitrogen fixation genes and are engineered to comprise exogenous nitrogen fixation genes. In some embodiments, genetically engineered bacteria comprise a non-engineered nif cluster which has been transferred from a first bacteria which naturally fixes nitrogen to a second bacteria that does not. For example, in some embodiments, native m / genes from P. polymyxa, K. pneumoniae, K. oxytoca, A. vinelandii, A. brasilense, R. sphaeroides, R. palustris, K. oxytoca, Rhizobium, Mesorhizboium, Sinorhizobium, Azorhizobium, P. stutzeri have been transferred to a bacteria that naturally lacks nitrogen fixation genes. As a further example, in some embodiments, native nif genes from K. oxytoca, P. stutzeri, or A. vinelandii have been transferred to E. coli or Pseudomonas protegens Pf-5. In some embodiments, one or more genes encoding components of a nitrogenase (e.g., one or more genes selected from nifEl, nifD, and nifK), and one or more genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE, nifF, nif J, nifM, nifN, nifQ, nifS, nifE, nifU, niJV, nifW, nifY, and nifZ) are transferred to bacteria that naturally lacks nitrogen fixation genes. In some embodiments, a nifEl gene, a nifD gene, a nifK gene is transferred to bacteria that naturally lacks nitrogen fixation genes. In some embodiments, a nifB gene, a nifE gene, and a nifN gene is transferred to bacteria that naturally lacks nitrogen fixation genes. In some embodiments, a nifH gene, a nifD gene, a nifK gene, a nifB gene, a nifE gene, and a nifN gene are transferred to bacteria that naturally lack nitrogen fixation genes. In some embodiments, a nifH gene sequence, a nifD gene sequence, and a nifK gene sequence referenced in Table 1 of U.S. Provisional Application number 63 / 632,173 are transferred to bacteria that natural lack nitrogen fixation genes. In some embodiments, a nifB gene, a nifE gene, and a nifN gene are t ran s ferrod to bacteria that natural lack nitrogen fixation genes, wherein the nifB gene sequence, the nifE gene sequence, and the nifN gene sequence are derived from a bacteria that naturally comprises a nifH gene sequence, a nifD gene sequence, and a nifK gene sequence referenced in Table 1 of U.S. Provisional Application number 63 / 632,173.

[0062] However, in some embodiments, genetically engineered bacteria described herein comprise a refactored nif cluster. As used herein, a “refactored nif cluster” (which may also be referred to as a “refactored exogenous nif cluster”) comprises a set of nif cluster genes which are sufficient for nitrogen fixation but have been structurally altered to exhibit expression properties that are not exhibited by native nif clusters. For example, in some embodiments, a refactored nif cluster comprises one or more genes encoding components of a nitrogenase (c.g., one or more genes selected from nifH, nifD, and nifK), and one or more genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE, nifE, nifj, nifM, nifN, nifQ, nifS, nifE, nifU, nifV, nifW, nifY, and nifZ). In some embodiments, one or more genes encoding components of a nitrogenase (e.g., one or more genes selected from nifH, nifD, and nifK), and one or more genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE, nifF, nif J, nifM, nifN, nifQ, nifS, nifE, nifU, nifV, nifW, nifY, and nifZ) are transferred to bacteria that naturally lacks nitrogen fixation genes. In some embodiments, a refactored nif cluster comprises a nifH gene, a nifD gene, a nifK gene, a nifB gene, a nifE gene, and a nifN gene. In some embodiments, a refactored nif cluster comprises a nifH gene sequence, a nifD gene sequence, and a nifK gene sequence referenced in Table 1 of U.S. Provisional Application number 63 / 632,173. In some embodiments, a refactored nif cluster comprises a nifB gene, a nifE gene, and a nifN gene, wherein the nifB gene sequence, the nifE gene sequence, and the nifN gene sequence are derived from a bacteria that naturally comprises a nifH gene sequence, a nifD gene sequence, and a nifK gene sequence referenced in Table 1 of U.S. Provisional Application number 63 / 632,173. In some embodiments, a refactored nif cluster comprises each of the nif genes comprised in the native counterpart nif cluster. For example, in some embodiments, a refactored nif cluster comprises the same set of nif genes in each of the operons relative to the operons in the native counterpart nif cluster. In some embodiments, maintaining the same set of nif genes in each of the operons relative to the operons in the native counterpart nif cluster is useful for maintaining the relative stoichiometries of the nitrogen fixation proteins upon expression of a refactored nif cluster in genetically engineered bacteria. As a further example, in some embodiments, a refactored nif cluster comprises one or more of the operons which comprises a different set of nif genes relative to the corresponding operon in the native counterpart nif cluster (e.g., wherein one or more of the genes have been moved to different operons but not deleted from the refactored nif cluster). In some embodiments, altering the set of nif genes in one or more of the operons relative to the set of nif genes in the corresponding operons in the native counterpart / / / 'cluster is useful for altering the relative stoichiometries of the nitrogen fixation proteins upon expression of a refactored nif cluster in genetically engineered bacteria. However, in some embodiments, a refactored nif cluster described herein comprises one or more nif genes which have been inactivated or deleted. In some embodiments, a gene which is inessential for nitrogen fixation activity is inactivated or deleted from a refactored nif cluster, and / or a gene that inhibits nitrogen fixation is inactivated or deleted from a refactored nif cluster. For example, in some embodiments, a refactored nif cluster does not comprise a nifA gene and / or a nifL gene.

[0063] Additionally, as used herein, both bacteria that naturally fix nitrogen and those that do not naturally fix nitrogen may be engineered to comprise a refactored nif cluster. Accordingly, the refactoring process may not only be used to alter the expression dynamics of a nif cluster as, in some embodiments, refactoring allows transfer, stable uptake, and / or non-natural regulatory control of nif cluster genes. In some embodiments, refactoring gives rise to structurally re-organized nif cluster genes which enables expression of said engineered sequences in host bacteria that do not comprise the same transcriptional and / or translational regulatory machinery as the host bacteria from which the native nif cluster was derived from and engineered. In some embodiments, refactoring gives rise to structurally re-organized nif cluster genes which enables expression of said engineered sequences in bacteria that naturally comprise a nif cluster under conditions that normally repress nif cluster expression, such as during exposure to oxygen and / or ammonium. In some embodiments, a refactored nif cluster described herein comprises engineered coding sequences not naturally found in the corresponding native nif cluster. For example, in some embodiments, a refactored m' clustcr comprises variant nif genes, such as those that have been codon optimized based on which host strain will be engineered to comprise said refactored nif cluster. In some embodiments, genetically engineered bacteria comprise one or more codon optimized genes encoding components of a nitrogenase (e.g., one or more genes selected from nifH, nifD, and nifK), and one or more codon optimized genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE, nifF, nifj, nifM. nifN, nifQ, nifS, nifF, nifU, nifV, nifW, nifY, and nf' Z). In some embodiments, genetically engineered bacteria comprise a codon optimized nifH gene sequence, a codon optimized nifD gene sequence, and a codon optimized nifK gene sequence derived from a m' / gcnc sequence as referenced in Table 1 U.S. Provisional Application number 63 / 513,087 filed July 11, 2023, and / or U.S. Provisional Application number 63 / 632,173 filed April 10, 2024. In some embodiments, genetically engineered bacteria comprise a codon optimized nifH gene, a codon optimized nifD gene, a codon optimized nifK gene, a codon optimized nifB gene, a codon optimized nifE gene, and a codon optimized nifN gene. In some embodiments, the codon optimized nifB gene sequence, the codon optimized nifE gene sequence, and the codon optimized nifN gene sequence are derived from a bacteria that naturally comprises a nifH gene sequence, a nifD gene sequence, and a nifK gene sequence referenced in Table 1 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, which is incorporated herein by reference. In some embodiments, a refactored nif cluster described herein is engineered by constructing non-natural operons comprising nif genes. For example, in some embodiments, nif cluster refactoring involves structurally re-organizing native m' / 'clustcr genes by altering genomic sequences which intervene coding sequences, ordering nif genes into modular units, and / or introducing heterologous sequences, such as spacer sequences, between nif cluster genes. In some embodiments, a refactored nif cluster comprises one or more modular units (e.g., transcriptional units, such as cistrons or operons) comprising one or more genes encoding components of a nitrogenase (e.g., one or more genes selected from nifH, nifD, and nifK), and one or more modular units comprising one or more genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE, nifF, nifj, nifM, nifN, nifQ, nifS, nifE, nifU, ni / V, nifW, nifY, and nifZ). In some embodiments, genetically engineered bacteria comprise a refactored nif cluster, wherein the refactored nif cluster comprises an operon comprising a nifH gene sequence, a nifD gene sequence, and a nifK gene sequence that comprises or is derived from (e.g., is a codon optimized variant) a m' / 'gcnc sequence as referenced in Table 1 of U.S. Provisional Application number 63 / 513,087 filed July 11, 2023, and / or U.S. Provisional Application number 63 / 632,173 filed April 10, 2024. In some embodiments, genetically engineered bacteria comprise a refactored nif cluster, wherein the refactored nif cluster comprises an operon comprising a nifB gene, a nifE gene, and / or a nifN gene. In some embodiments, genetically engineered bacteria comprise a refactored nif cluster, wherein the refactored nif cluster comprises an operon comprising a nifH gene, a nifD gene, and a nifK gene and an operon comprising an operon comprising a nifB gene, a nifE gene, and / or a nifN gene. In some embodiments, the nifB gene sequence, the nifE gene sequence, and the nifN gene sequence are derived from a bacteria that naturally comprises a nifH gene sequence, a nifD gene sequence, and a nifK gene sequence referenced in Table 1 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, which is incorporated herein by reference.

[0064] In some embodiments, native regulatory sequences operably linked to nif cluster genes arc altered, removed, and / or replaced with heterologous regulatory sequences (e.g., to produce a refactored nif cluster described herein). A heterologous regulatory sequence can be utilized based on the bacteria engineered to comprise nif cluster genes and can include, but are not limited to, transcriptional and translational regulatory sequences that are active in the bacteria comprising the engineered nucleic acid carry ing the nif genes. For example, such heterologous regulatory sequences may comprise promoters, enhancers, ribosomal binding sites, transcription start and / or stop sites, translation start and / or stop sites, transcription repressors, transcription terminators, and / or other regulatory sequences. In some embodiments, a refactored nif cluster comprises one or more modular units (e.g., transcriptional units, such as operons) comprising one or more genes encoding components of a nitrogenase (e.g., one or more genes selected from nifH, nifD, and nifK), and one or more modular units comprising one or more genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE, nifF, nifj, nijM, nifN, nifQ, nifS, nifE, nifU, nifV, nifW, nifY, and niJZ). wherein each of the modular units are operably linked to one or more regulatory sequences (e.g., heterologous regulatory sequences). In some embodiments, a refactored nif cluster comprises one or more modular units (e.g., transcriptional units, such as cistrons or operons) comprising one or more genes encoding components of a nitrogenase (e.g., one or more genes selected from nifH, nifD, and nifK), and one or more modular units comprising one or more genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE, nifF, nifj, nifM, nifN, nifQ, nifS, nifE, nifU, nifV, nifW, nifY, and nifZ), wherein each of the modular units are operably linked to a promoter (e.g., a heterologous promoter) and a transcription terminator (e.g., a heterologous transcription terminator). In some embodiments, genetically engineered bacteria comprise a nifH gene sequence, a nifD gene sequence, and a nifK gene sequence that comprises or is derived from (e.g., is a codon optimized variant) a nif gene sequence as referenced in Table 1 of U.S. Provisional Application number 63 / 632,173 and which are operably linked to at least one heterologous regulatory sequence. In some embodiments, genetically engineered bacteria comprise a refactored nif cluster, wherein the refactored nif cluster comprises an operon comprising a nifB gene, a nifE gene, and / or a nifN gene. In some embodiments, genetically engineered bacteria comprise a refactored nif cluster, wherein the refactored nif cluster comprises an operon comprising a nifH gene, a nifD gene, and a nifK gene and an opcron comprising an operon comprising a nifB gene, a nifE gene, and / or a nifN gene. In some embodiments, the nifB gene sequence, the nifE gene sequence, and the nifN gene sequence are derived from bacteria that naturally comprises a nifH gene sequence, a nifD gene sequence, and a nifK gene sequence referenced in Table 1 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, which is incorporated herein by reference. In some embodiments, a heterologous regulatory sequence described herein is a regulatory sequence described in Table 6. In some embodiments, a heterologous regulatory sequence is a T7-RNA polymerase responsive sequence described herein (see, e.g., Table 6). In some embodiments, a heterologous regulatory sequence is an IPTG-inducible promoter, a DAPG-inducible promoter, a tryptophan-inducible promoter, a tetracycline-inducible promoter, a 3OC6HSL-inducible promoter, a salicylic acid-inducible promoter, an octopine-inducible promoter, a nopaline-inducible promoter, an arabinose-inducible promoter, a cuminic acid-inducible promoter, or a naringenin-inducible promoter described herein (see, e.g., Table 6). In some embodiments, a sequence comprising one or more nif genes is operably linked to a T7 RNA polymerase-responsive promoter and the genetically engineered bacteria comprise aT7 RNA polymerase gene which is operably linked to a constitutive promoter or an inducible promoter (e.g., a DAPG-inducible promoter, a tetracycline-inducible promoter, a tryptophan-inducible promoter, a 3OC6HSL-inducible promoter, a salicylic acid-inducible promoter, an octopine-inducible promoter, a nopaline-inducible promoter, an arabinose-inducible promoter, a cuminic acid-inducible promoter, or a naringenin-inducible promoter described herein (see, e.g., Table 6)).

[0065] In some embodiments, refactored nif cluster described herein comprise one or more controllers. As used herein, a “controller” refers to a nucleic acid encoding a sensor or circuit which regulates the stability and dynamics of gene expression. Accordingly, in some embodiments, controllers comprise a promoter. In some embodiments, a promoter found in a controller may comprise an inducible promoter. In some embodiments, a promoter found in a controller comprises an RNA polymerase-responsive promoter (e.g., a T7 RNA polymerase-responsive promoter) which is operably linked to a sequence comprising one or more nif genes and the controller comprises an RNA polymerase gene (e.g., a T7 RNA polymerase gene) which is operably linked to an inducible promoter (e.g., an IPTG-inducible promoter, a DAPG-inducible promoter, a tetracycline-inducible promoter, a tryptophan-inducible promoter a 3OC6HSL-inducible promoter, a salicylic acidinducible promoter, an octopinc-induciblc promoter, a nopaline-inducible promoter, an arabinose- inducible promoter, a cuminic acid-inducible promoter, or a naringenin-inducible promoter (see, e.g., Table 6)). In some embodiments, a controller comprises an inducible promoter which is operably linked to an RNA polymerase gene and located in a nucleic acid comprising one or more nif genes operably linked to the promoter corresponding to the RNA polymerase. In some embodiments, a controller comprises sequences recognized by an IPTG-inducible T7 RNA polymerase and the corresponding IPTG-inducible promoter which is operably linked to the T7 RNA polymerase gene. In other embodiments, a controller comprises an inducible promoter which is operably linked to an RNA polymerase gene and located in a nucleic acid which is separate from a nucleic acid comprising one or more nif genes operably linked to the promoter corresponding to the RNA polymerase (e.g., a plasmid comprising a controller and a bacterial chromosome comprising the one or more m / ' genes). In some embodiments, controllers comprise a system for stabile plasmid maintenance. For example, in some embodiments, a system for stabile plasmid maintenance comprises a partitioning system, such as the RK6 partitioning system or the RK2 partitioning system encoded by parCBA and parDE operons. However, such embodiments should not be considered limiting as, any promoter or partitioning system known in the art may be used to construct a controller.

[0066] In some embodiments, a refactored nif cluster described herein is expressed in genetically engineered bacteria off of a vector (e.g., a plasmid) or stably integrated into the host bacteria’s endogenous chromosome. For example, in some embodiments, a vector comprising a refactored nif cluster may be maintained using an antibiotic resistance marker or a partitioning system. However, in some embodiments, chromosomal integration of a refactored nif cluster is achieved by introducing an engineered nucleic acid comprising the refactored nif cluster and a mini-Tn7 system which induces genome integration at the Tn7 attachment site (attTn7) located downstream of the essential ghnS gene.

[0067] In some embodiments, the refactoring process enables transfer or engineered nif genes to a variety of host bacterial strains, such as a strain of genetically engineered bacteria described herein . In some embodiments, such host strains do not naturally comprise the ability to fix nitrogen. In some embodiments, refactored nif genes derived from a first bacterial strain in a genus is transferred to a second bacterial strain of the same genus which naturally lacks nif genes (e.g., refactored nif genes derived from P. stutzeri which have been transferred to P. protegens Pf-5). In some embodiments, refactored nif genes derived from a first bacterial strain in a genus is transferred to a second bacterial strain of a different genus which naturally lacks nif genes (e.g., refactored nif genes derived from K. oxytoca or A. vinelandii which have been transferred to a Rhizobia species). In some embodiments, a genetically engineered bacteria that naturally lacks nif genes comprises a refactored nif cluster comprising one or more modular units (e.g., transcriptional units, such as operons) comprising one or more genes encoding components of a nitrogenase (e.g., one or more genes selected from nifH. nifD, and nifK), and one or more modular units comprising one or more genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE, nifF, nifj, nifM, nifN, nifQ, niJS. nijT, nifU, nifV, nijW, nifY, and nifZf In some embodiments, a genetically engineered bacteria that naturally lacks nif genes comprises a refactored nif cluster, wherein the refactored nif cluster comprises an operon comprising a nifH gene, a nifD gene, and a nifK gene, and an operon comprising a nifB gene, a nifE gene, and / or a nifN gene. In some embodiments, genetically engineered bacteria that naturally lacks nif genes comprises a refactored nz / 'cluster comprising a first operon comprising nifDKYEN. a second operon comprising nifj, a third operon comprising nifBQ, a fourth operon comprising nifF, and a fifth operon comprising nifUSVWZM. In some embodiments, genetically engineered bacteria that naturally lacks nif genes comprises a refactored nif cluster comprising a first operon comprising nifHDKTY, a second operon comprising nifENX, a third operon comprising nif J, a fourth operon comprising nifBQ, a fifth operon comprising nifF, and a sixth operon comprising nifUSVWZM. In some embodiments, genetically engineered bacteria that naturally lacks nif genes is engineered to comprise a refactored nif cluster, wherein the refactored nif cluster does not comprise nif A and / or nifL.

[0068] In other embodiments, the refactoring process enables increased and / or inducible expression of nitrogen fixation enzymes in bacteria that naturally comprise nif genes. In some embodiments, refactored nif genes derived from a first bacterial strain in a genus is transferred to a second bacterial strain of a different genus which naturally comprises nif genes (e.g., refactored nif genes derived from A. caulinodans which have been transferred to a Rhizobia). In some embodiments, genetically engineered bacteria arc Rhizobia of the class a-proteobacteria e.g., Rhizobia of the genus Rhizobium, Mesorhizobium, Bradyrhizobium, Burkholderia, Azorhizobium, Sinorhizobium (Ensifer)) and comprise an exogenous nif cluster (e.g., a native nif cluster or a refactored nif cluster) derived from a photosynthetic a-proteobacteria or one or more nif gene regulatory sequences thereof. In some embodiments, Rhizobia of the class a-proteobacteria and comprising an exogenous nif cluster (e.g., a native nif cluster or a refactored nif cluster) derived from a photosynthetic a- proteobacteria or one or more nif gene regulatory sequences thereof are capable of fixing nitrogen under aerobic free-living conditions. In some embodiments, genetically engineered bacteria are Rhizobia of the class P-proteobacteria (e.g., Rhizobia of the genus Burkholderia or Cuprivadus) and comprise a refactored nif cluster derived from a free-living diazotroph, a symbiotic diazotroph, a photosynthetic a-proteobacteria, a y-proteobacteria, a cyanobacteria, or a firmicutes. In some embodiments, Rhizobia of the class -proteobacteria and comprising a refactored nif cluster derived from a free-living diazotroph, a symbiotic diazotroph, a photosynthetic a-proteobacteria, a y- proteobacteria, a cyanobacteria, or a firmicutes are capable of fixing nitrogen under aerobic free- living conditions. In some embodiments, a refactored nif cluster transferred from a free-living diazotroph, a symbiotic diazotroph, a photosynthetic a-proteobacteria, a y-proteobacteria, a cyanobacteria, or a firmicutes to Rhizobia comprises codon optimized nif genes, nif genes which have been structurally re-organized into different operons, and / or nif genes which are operably linked to heterologous regulatory sequences that are active in the Rhizobia. In some embodiments, a refactored nif cluster in A. caulinodins comprises a nifA gene. In some embodiments, genetically engineered A. caulinodins comprising a refactored nif cluster comprises a nifA gene and a rpoN gene which are each operably linked to a heterologous regulatory sequence (e.g., a regulatory sequence that overexpresses rpoN in A. caulinodansf In some embodiments, Rhizobia comprising a refactored nif cluster does not comprise nifA and / or nifL. In some embodiments, a refactored nif cluster in Rhizobia comprises one or more modular units (e.g., transcriptional units, such as operons) comprising one or more genes encoding components of a nitrogenase (e.g., one or more genes selected from nifH, nifD, and nifK), and one or more modular units comprising one or more genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE. nifF, nifj, nifM. nifN, nifQ, nifS, ni / T, nifU. nijV, nifW, nifY, and nifZ). In some embodiments, a refactored nif cluster in Rhizobia comprises an operon comprising a nifH gene, a nifD gene, and a nifK gene, and an operon comprising a nifB gene, a nifE gene, and / or a nifN gene. In some embodiments, a refactored nif cluster in Rhizobia comprises a first operon comprising nifHDKTY, a second opcron comprising nifENX, a third opcron comprising nifl, a fourth opcron comprising nifBQ, a fifth operon comprising nifF, and a sixth operon comprising m' / US VWZM.

[0069] Accordingly, the present disclosure relates, at least in part, to compositions and methods for engineering nitrogen fixation pathways (e.g., by utilizing nif cluster refactoring) in bacteria that can be utilized for biofertilization of plants (e.g., edible plants, such as cereal plants). Additionally, a variety of bacteria, both those that naturally fix nitrogen and those that do not naturally fix nitrogen, have been genetically engineered to comprise refactored nif genes. Further embodiments of nucleic acids comprising nif cluster genes, refactored nif clusters, methods of producing refactored nif clusters, and methods of engineering bacteria to fix nitrogen using refactored nif cluster are described in the art. See, e.g., US Patent No. 10,968,446, U.S. Patent No.: US 11,479,516 B2, WO 2020 / 190363 Al, and Ryu et al. (2020). Control of nitrogen fixation in bacteria that associate with cereals. Nat. Microbiol. 5(2): 314-330, which are incorporated by reference herein in their entireties.

[0070] In some embodiments, genetically engineered bacteria described herein comprise a single nucleic acid comprising all of the genes required for nitrogen fixation capabilities. For example, in some embodiments, said nucleic acid is an endogenous chromosome (e.g., one comprising a genetically engineered chromosomal sequence) or an exogenous nucleic acid (e.g., an engineered nucleic acid, such as a vector).

[0071] In some embodiments, genetically engineered bacteria described herein comprise a plurality of nucleic acids (e.g., two, three, four, five, or more) that together provide all of the genes required for nitrogen fixation. For example, in some embodiments, a genetically engineered bacteria comprise one or more nitrogen fixation genes that are integrated into the endogenous bacterial chromosome and an exogenous vector comprising one or more additional nitrogen fixation genes. In some embodiments, a genetically engineered bacteria comprise one or more nitrogen fixation genes on a first vector and one or more nitrogen fixation genes on a second vector.

[0072] Non-limiting examples of nifH. nifD, and nifK gene and protein sequences are described in U.S. Provisional Application number 63 / 513,087 filed July 11, 2023, and / or U.S. Provisional Application number 63 / 632,173 filed April 10, 2024 at Table 1 titled “Non-limiting Examples of Native nifH Sequences, nifD Sequences, and nifK Sequences”, and can be used in genetically engineering bacteria as described herein. The accession numbers provided for nifH, nifD, and nifK gene and protein sequences in Table 1 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, which is incorporated herein by reference can be accessed through the KEGG BRITE Database (a database of annotated genomes that can provide a list of all known orthologs of a given gene or protein that performs a specific metabolic function) along with taxonomic information and other nif cluster gene sequences for the corresponding organisms that the nifH, nifD, and nifK sequences are derived from. For example, nitrogen fixation genes other than nifH, nifD, and nifK (e.g., nifB, nifE, nifF, nif J, nifM, nifN, nifQ, nifS, niff, nifU, nifV, nifW, nifY, and / or nifZ) can also be obtained through the KEGG BRITE Database including, but not limited to, other nitrogen fixation genes naturally found in the host bacteria of the Organism Identifier corresponding to the nifH, nifD, and nifK sequences referenced in Table 1 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, which is incorporated herein by reference, and utilized in producing the genetically engineered bacteria described herein.

[0073] Urea Metabolism Regulators and Engineered Urea Metabolism Regulators

[0074] In some embodiments, genetically engineered bacteria described herein comprise one or more urea metabolism regulators. In some embodiments, a urea metabolism regulator is a gene or protein product thereof which influences the kinetics or flux through a pathway which effects urea synthesis or breakdown. In some embodiments, a urea metabolism regulator is a gene or protein product thereof involved in urea breakdown (e.g., see below discussion of regulators of urea catabolism and engineered regulators thereof). In some embodiments, a urea metabolism regulator is a gene or protein product thereof involved in urea synthesis (e.g., see below discussion of regulators of urea synthesis and engineered regulators thereof).

[0075] In some embodiments, a urea metabolism regulator described herein comprises an enzyme. In some embodiments, the enzyme is involved in a urea biosynthetic pathway. In some embodiments, the enzyme is involved in a urea degradation pathway.

[0076] In some embodiments, a urea metabolism regulator described herein comprises a transcriptional regulator. In some embodiments, the transcriptional regulator regulates the expression of an enzyme involved in urea metabolism.

[0077] In some embodiments, a urea metabolism regulator described herein comprises a signaling protein. In some embodiments, the signaling protein regulates the expression of an enzyme involved in urea metabolism. In some embodiments, the signaling protein regulates a transcriptional regulator that regulates the expression of an enzyme involved in urea metabolism.

[0078] Urea Catabolism

[0079] In some embodiments, a urea metabolism regulator involved in urea breakdown is encoded by a gene referred to as a “urea catabolism gene.”

[0080] In some embodiments, a urea catabolism gene described herein comprises one or more sequences of the urease gene cluster. In some embodiments, a urea catabolism gene comprises one or more sequences of the re urease gene cluster. The are urease gene cluster in epiphytic bacteria, endophytic bacteria, and / or plant root-associated bacteria typically comprises both structural genes and accessory genes. The structural genes include ureA, ureB, ureC* and combinations thereof. The accessory genes can include one or more of ureD, ureE, ureF, ureG, ureH, and are J. In some embodiments, genetically engineered bacteria lack a structural gene or accessory gene of the urease gene cluster and the function of the gene is performed by a distant gene, such as HupE / ureJ. Nonlimiting examples of ure urease gene cluster sequences in epiphytic bacteria, endophytic bacteria, and / or plant root-associated bacteria are shown in Table 2 and Table 3 of U.S. Provisional Application number 63 / 632,173, filed April 10, 2024, which is incorporated herein by reference.

[0081] In some embodiments, a urea catabolism gene described herein regulates the regulates a reaction wherein urea is reacted with carbon dioxide to produce a metabolite of urea breakdown. In some embodiments, a urea catabolism gene comprises a urea carboxylase gene. In some embodiments, a urea carboxylase gene is encoded by the uc gene. In some embodiments a urea catabolism gene comprises an allophanate hydrolase gene. In some embodiments, an allophanate hydrolase gene is encoded by the ah gene.

[0082] In some embodiments, genetically engineered bacteria described herein comprise at least one engineered nucleic acid comprising one or more (e.g., two, three, four, five, six, seven, etc.) non-natural sequences which encode and / or regulate the expression of a urea metabolism regulator and / or effect the activity of a urea metabolism regulator. In some embodiments, the one or more non-natural sequences which encode a urea metabolism regulator comprise a mutation in a gene encoding a urea catabolism regulator (e.g., a gene variant or a deleted gene). In some embodiments, the one or more non-natural sequences which encode a urea metabolism regulator comprise a codon optimized arginase gene. In some embodiments, the one or more non-natural sequences which regulate the expression of a urea metabolism regulator comprise a heterologous regulatory sequence that reduces expression of a urea catabolism regulator (e.g., a mutated promoter, a non-functional start codon, or a premature stop codon). In some embodiments, the one or more non-natural sequences which regulate the expression of a urea metabolism regulator comprise a heterologous regulatory sequence that increases expression of an arginase gene (e.g., an inducible promoter or a constitutive promoter). In some embodiments, the one or more non-natural sequences which effect the activity of a urea metabolism regulator comprise a heterologous regulatory sequence that is operably linked to a urea catabolism regulator and / or an inactivating mutation in a urea catabolism regulator. In some embodiments, the one or more non-natural sequences which effect the activity of a urea metabolism regulator comprise a heterologous regulatory sequence operably linked to an arginase gene and / or a codon-optimized arginase gene.

[0083] In some embodiments, genetically engineered bacteria described herein comprise at least one engineered nucleic acid comprising sequences encoding one or more (e.g., two, three, four, five, six, seven, etc.) urea metabolism regulators with altered functions relative to a urea metabolism regulator not encoded by an engineered nucleic acid (e.g., a wildtype urea metabolism regulator). In some embodiments, the urea metabolism regulator with altered function is a urea catabolism regulator encoded by a variant gene. In some embodiments, the urea metabolism regulator with altered function is a urease enzymatic complex which lacks one or more subunits and / or comprises one or more mutated subunits.

[0084] Urea catabolism regulators, including urease, urea carboxylase, and allophanate hydrolase, can be genetically engineered to decrease urea breakdown in genetically engineered bacteria described herein. In some embodiments, genetically engineered bacteria comprise an engineered nucleic acid encoding a urease gene cluster. In some embodiments, genetically engineered bacteria comprise an engineered nucleic acid encoding a ure gene cluster. In some embodiments, genetically engineered bacteria comprise an engineered nucleic acid encoding a uc gene. In some embodiments, genetically engineered bacteria comprise an engineered nucleic acid encoding an allophanate hydrolase gene. In some embodiments, genetically engineered bacteria comprise an engineered nucleic acid encoding an ah gene.

[0085] Non-limiting examples of ureA, ureB, and ureC gene sequences that can be used in genetically engineered bacteria as described herein are set forth in Table 2. Further non-limiting examples of ureA, ureB. and ureC gene sequences and protein sequences are described in U.S. Provisional Application number 63 / 632,173 filed April 10, 2024 at Table 3 titled “Non-limiting Examples of ureA Sequences, ureB Sequences, and ureC Sequences”, and can be used in genetically engineering bacteria as described herein. The accession numbers provided for ureA, ureB, and ureC gene and protein sequences in Table 3 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, which is incorporated herein by reference can be accessed through the KEGG BRITE Database (a database of annotated genomes that can provide a list of all known orthologs of a given gene or protein that performs a specific metabolic function) along with taxonomic information and other ure cluster gene sequences for the corresponding organisms of the Organism Identifiers in Table 3 that the ureA, ureB, and ureC sequences in Table 3 are derived from, and can be utilized in producing genetically engineered bacteria described herein. Nonlimiting examples of uc and ah gene and protein sequences are described in U.S. Provisional Application number 63 / 632,173 filed April 10, 2024 at Table 4 titled “Non-limiting Examples of uc Sequences and ah Sequences”, and can used in genetically engineering bacteria as described herein. The accession numbers provided for uc and ah gene and protein sequences in Table 4 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, which is incorporated herein by reference can be accessed through the KEGG BRITE Database along with taxonomic information for the corresponding organisms of the Organism Identifiers in Table 4 that the uc and ah sequences in Table 4 are derived from, and can be utilized in producing genetically engineered bacteria described herein.

[0086] In some embodiments, genetically engineered bacteria described herein comprise: a valiant of one or more urease genes described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024 and / or a deletion of one or more urease genes described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173; filed April 10, 2024 a variant of an ac gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024 or a deletion of an ac gene described in Table 4 of U.S. Provisional Application number 63 / 632,173; filed April 10, 2024 a variant of a uc gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, which is incorporated herein by reference or a deletion of a uc gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024; or any combination thereof. In some embodiments, genetically engineered bacteria comprising a variant of one or more urease genes described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024 and / or a deletion of one or more urease genes described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, a variant of an ac gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, or a deletion of an ac gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024, and / or a variant of a uc gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024 or a deletion of a uc gene described in Table 4 of U.S. Provisional Application number 63 / 632,173, filed April 10, 2024, further comprises one or more nitrogen fixation genes as described herein (e.g., a nif cluster comprising nifll, nifD, nijK, nifB, nifE, nijF, nif J, nifM, nifN, nifQ, nifS, nijT, nifU, nijV, nifW, nifY, and / or nifZ derived from a host bacteria comprising a sequence described in Table 1 of U.S. Provisional Application number 63 / 632,173 filed April 10, 2024).

[0087] Urea metabolism regulators involved in the production of urea from ammonia and carbon dioxide can be genetically engineered to increase urea production in genetically engineered bacteria described herein. Increasing the flux through process that produce urea from ammonia and carbon dioxide can include genetically engineered urea metabolism regulators that are involved in the conversion of L-arginine to urea and ornithine, the formation of citrulline from ornithine and carbamoyl phosphate, and / or the formation of N- acetylglutamate from glutamate and acetyl coenzyme-A. In some embodiments, genetically engineered bacteria described herein comprise an engineered nucleic acid encoding an arginase. In some embodiments, the arginase is encoded by a rocF gene from Bacillus subtilis. In some embodiments, genetically engineered bacteria described herein comprise an engineered nucleic acid encoding a carbamoyltransferase gene. In some embodiments, the carbamoyltransferase gene is encoded by the argl gene. In some embodiments, genetically engineered bacteria described herein comprise an engineered nucleic acid encoding a N- acetylglutamate synthetase gene. In some embodiments, the N-acetylglutamate synthetase gene is encoded by the argA gene.

[0088] Table 2. Representative Native Urease Gene Cluster Sequences

[0089] Inactivating Mutations and Gene Valiants of Urea Metabolism Regulators

[0090] In some embodiments, a urea metabolism regulator encoded by an engineered nucleic acid described herein comprises a gene variant described herein. In some embodiments, the gene variant comprises a substitution of at least one nucleotide, an insertion of at least one nucleotide, and / or a deletion of at least one nucleotide relative to a corresponding wildtype gene of the urea metabolism regulator. In some embodiments, the gene variant comprises a plurality of nucleotides which are not found in a corresponding wildtype sequence of the urea metabolism regulator. For example, in some embodiments, a gene variant comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800,

[0091] 800-900, 900-1,000, 1,000-1,100, 1,100-1,200, 1,200-1,300, 1,300-1,400, 1,400-1,500, 1,500-1,600, 1,600-1,700, 1,700-1,800, 1,800-1,900, 1,900-2,000, 2,000-2,100, 2,100-2,200, 2,200-2,300, 2,300- 2,400, 2,400-2,500, 2,500-2,600, 2,600-2,700, 2,700-2,800, 2,800-2,900, 2,900-3,000 or more nucleotide positions which differ relative to a corresponding wildtype sequence.

[0092] Accordingly, a gene variant described herein will typically comprise less than 100% sequence identity to a corresponding wildtype gene. In some embodiments, the gene variant comprises at least 10-25%, 25-50%, or 50-99% sequence identity to a corresponding wildtype gene. In some embodiments, the gene variant comprises at least 70% sequence identity to a corresponding wildtype gene. In some embodiments a gene valiant comprises at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity to a corresponding wildtype gene of the urea metabolism regulator.

[0093] A gene variant described herein can be engineered to comprise one or more differing nucleotide positions relative to a corresponding wild-type gene encoding urea metabolism regulator to increase or decrease the function of the urea metabolism regulator in genetically engineered bacteria. In some embodiments, the one or more differing nucleotide positions in a gene variant occurs in a coding sequence. In some embodiments, gene variants comprise: a synonymous mutation, a nonsynonymous, a conservative mutation, a nonconservative mutation, a frameshift, a premature stop codon, or any combination thereof. In some embodiments, a gene variant comprises a codon optimized coding sequence. In some embodiments, a coding sequence for a urea catabolism regulator is engineered to comprise an inactivating mutation which decreases the levels and / or activity of the urea catabolism regulator. Inactivating mutations in a gene variant of a urea catabolism regulator can include any insertion, substitution, deletion, or combination thereof which results in a loss of function in the encoded urea catabolism regulator. As non-limiting examples, an inactivating mutation in a urea catabolism gene can be a substitution, insertion, and / or deletion that results in a truncation, a disruption of a sequence involved in the enzymatic breakdown of urea, or both. Accordingly, engineering bacteria to comprise an inactivating mutation in a gene encoding a urea catabolism regulator can comprise introducing nonsynonymous and / or nonconservative mutations (e.g., to disrupt a start codon, generate a frameshift, introduce a premature stop codon, reduce the function of an enzymatic domain, or any combination thereof). An inactivating mutation can also comprise a gene deletion. In some embodiments, an engineered nucleic acid comprises a deletion of a gene involved in regulating urea metabolism. In some embodiments, a codon optimized coding sequence is used to express a urea metabolism regulator derived from a first host bacteria in a second host bacteria. In some embodiments, a coding sequence for a urea metabolism regulator derived from a first host bacteria is codon optimized to increase the levels and / or activity of the urea metabolism regulator in a second host bacteria. In some embodiments, genetically engineered bacteria release more extracellular urea compared to non-genetically engineered counterpart bacteria. In some embodiments, extracellular urea release from genetically engineered bacteria is increased by 1-2 fold, 1-5 fold, 1-10 fold, or 1-25 fold relative to non-genetically engineered counterpart bacteria. In some embodiments, extracellular urea release from genetically engineered bacteria is increased by about 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 11 fold, 12 fold, 13 fold, 14 fold, 15 fold, 16 fold, 17 fold, 18 fold, 19 fold, 20 fold, 21 fold, 22 fold, 23 fold, 24 fold, or 25 fold relative to non-genetically engineered counterpart bacteria. In some embodiments, extracellular urea release from genetically engineered bacteria is increased by more than 25 fold (e.g., 26-50 fold, 51-75 fold, or more).

[0094] In some embodiments, genetically engineered bacteria described herein comprise a variant urea catabolism gene described herein. In some embodiments, a gene variant comprising an inactivating mutation in a coding sequence is a ure cluster gene variant. In some embodiments, an inactivating mutation in a ure cluster gene variant disrupts the enzymatic breakdown of urea. Disrupting the enzymatic breakdown of urea can involve mutating a sequence in a ure cluster involved in substrate binding, co-factor or co-enzyme binding, or binding to urease subunits for formation of a functional enzyme complex. In some embodiments, a ure cluster gene variant comprises an inactivating mutation in a ureA coding sequence, an inactivating mutation in a ureB coding sequence, an inactivating mutation in a ureC coding sequence, or any combination thereof. In some embodiments, a ure gene variant comprises an inactivating mutation in a ureD coding sequence, an inactivating mutation in a ureE coding sequence, an inactivating mutation in a ureF coding sequence, or any combination thereof. In some embodiments, a ure cluster gene variant comprises an inactivating mutation in one or more structural genes selected from ureA, ureB, and ureC (see, e.g., the sequences described in Table 2 and Table 3 of U.S. Provisional Application number 63 / 632,173) and an inactivating mutation in one or more accessory genes selected from ureD, ureE, and ureF (e.g., wherein the ureD, ureE, and ureF genes are naturally found in a host bacteria of an Organism Identifier corresponding to a ureA, ureB, or ureC sequence described in Table 3 of U.S. Provisional Application number 63 / 632,173). In some embodiments, genetically engineered bacteria comprising a ure cluster gene variant comprise an inactivating mutation in a uc gene coding sequence (e.g., wherein the uc gene is naturally found in a host bacteria corresponding to an Organism Identifier described in Table 1, Table 3, Table 4, and / or Table 5 of U.S. Provisional Application number 63 / 632,173, such as wherein the natural form of the uc gene comprises a sequence described in Table 4), an inactivating mutation in an ah gene coding sequence (e.g., wherein the ah gene is naturally found in a host bacteria corresponding to an Organism Identifier described in Table 1, Table 3, Table 4, and / or Table 5 of U.S. Provisional Application number 63 / 632,173, such as wherein the natural form of the ah gene comprises a sequence described in Table 4), or both.

[0095] In some embodiments, genetically engineered bacteria described herein comprise a deletion in a urease gene. In some embodiments, genetically engineered bacteria comprise a deletion in the ure gene cluster. For example, in some embodiments, genetically engineered bacteria comprise a deletion of a structural gene selected from a ureA gene, a ureB gene, and a ureC (e.g., wherein the ureA, ureB, and ureC genes are naturally found in a host bacteria of an Organism Identifier described in Table 3 of U.S. Provisional Application number 63 / 632,173). As a further example, in some embodiments, genetically engineered bacteria comprise a deletion in an accessory gene selected from a ureD gene, a ureE gene, and a ureF gene (e.g., wherein the ureD, ureE, and ureF genes are naturally found in a host bacteria of an Organism Identifier corresponding to a ureA, ureB, or ureC sequence described in Table 3 of U.S. Provisional Application number 63 / 632,173). In some embodiments, genetically engineered bacteria comprise a deletion of two or more structural genes selected from ureA, ureB, and ureC (e.g., wherein the ureA, ureB, and ureC genes are naturally found in a host bacteria of an Organism Identifier described in Table 3 of U.S. Provisional Application number 63 / 632,173). In some embodiments, genetically engineered bacteria comprise a deletion of two or more accessory genes selected from ureD, ureE, and ureF (e.g., wherein the ureD, ureE, and ureF genes are naturally found in a host bacteria of an Organism Identifier corresponding to a ureA, ureB, or ureC sequence described in Table 3 of U.S. Provisional Application number 63 / 632,173). In some embodiments, genetically engineered bacteria comprise one or more deletions of a ure cluster gene (e.g., a deletion of a ureA gene, a ureB gene, and / or a ureC gene, such as a deletion of a gene sequence described in Table 2 of U.S. Provisional Application number 63 / 632,173) and one or more ure cluster gene coding sequences comprising an inactivating mutation (e.g., a ureD gene, ureE gene, and / or ureF gene, such as wherein the ureD, ureE, and ureF genes are naturally found in a host bacteria of an Organism Identifier corresponding to a ureA, ureB, or ureC sequence described in Table 3 of U.S. Provisional Application number 63 / 632,173).

[0096] In some embodiments, genetically engineered bacteria comprise a deletion in a urea carboxylase gene. In some embodiments, genetically engineered bacteria comprise a deletion in the uc gene (e.g., a deletion of a uc gene sequence described in Table 4 of U.S. Provisional Application number 63 / 632,173).

[0097] In some embodiments, genetically engineered bacteria comprise a deletion in an allophanate hydrolase gene. In some embodiments, genetically engineered bacteria comprise a deletion in the ah gene (e.g. a deletion of an ah gene sequence described in Table 4 of U.S. Provisional Application number 63 / 632,173).

[0098] In some embodiments, genetically engineered bacteria comprise a plurality (e.g., two, three, four, five, or more) variant urea catabolism genes. In some embodiments genetically engineered bacteria comprise a deletion of the uc gene and an inactivating mutation in one or more ure genes. In some embodiments, genetically engineered bacteria comprise a deletion in a urease gene and a urea carboxylase gene. In some embodiments, genetically engineered bacteria comprise a deletion in the ure and uc genes (e.g., deletions of one or more ure sequences described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173, and a deletion of a uc sequence described in Table 4 of U.S. Provisional Application number 63 / 632,173). In some embodiments, genetically engineered bacteria comprise a deletion in the urease and allophanate hydrolase genes. In some embodiments genetically engineered bacteria comprise a deletion of the ah gene and an inactivating mutation in one or more ure genes (e.g., an inactivating mutation in one or more ure sequences described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173, and a deletion of an ah sequence described in Table 4). In some embodiments, genetically engineered bacteria comprise a deletion in the ure and ah genes (e.g., deletions of one or more ure sequences described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173, and a deletion of an ah sequence described in Table 4 of U.S. Provisional Application number 63 / 632,173). In some embodiments, genetically engineered bacteria comprise a deletion in the urea carboxylase and allophanate hydrolase genes. In some embodiments, genetically engineered bacteria comprise a deletion in the uc and ah genes (e.g., deletion of a uc sequence and a deletion of an ah sequence described in Table 4 of U.S. Provisional Application number 63 / 632,173). In some embodiments, genetically engineered bacteria comprise a deletion of the uc gene, a deletion of the ah gene, and an inactivating mutation in one or more ure genes (e.g., deletion of a uc sequence, a deletion of an ah sequence described in Table 4 of U.S. Provisional Application number 63 / 632,173, and an inactivating mutation in one or more ure sequences described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173). In some embodiments, genetically engineered bacteria comprise a deletion in the urease, urea carboxylase, and allophanate hydrolase genes. In some embodiments, genetically engineered bacteria comprise a deletion in the ure, uc and ah genes (e.g., deletion of a uc sequence, a deletion of an ah sequence described in Table 4 of U.S. Provisional Application number 63 / 632,173, and a deletion of one or more ure sequences described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173).

[0099] Urea Synthesis

[0100] In some embodiments, a urea metabolism regulator described herein is a gene or protein product thereof involved in synthesizing urea. In some embodiments, a urea metabolism regulator is involved in regulating the production of ammonia during nitrogen fixation. In some embodiments, a urea metabolism regulator involved in synthesizing ammonia is a nitrogenase (e.g., a nitrogenase encoded by a nif cluster described herein). In some embodiments, a urea metabolism regulator involved in synthesizing urea regulates the conversion of L-arginine to urea and ornithine. In some embodiments, a gene involved in synthesizing urea is an arginase gene. In some embodiments, an arginase gene in genetically engineered bacteria is derived from a different bacterial strain (e.g., an exogenous rocF gene in A. caulinodans that is derived from a different rhizobia). In some embodiments, an arginase gene is a rocF gene derived from Bacillus subtilis. In some embodiments, a urea metabolism regulator regulates the reaction between ornithine and carbamoyl phosphate forming citrulline and inorganic phosphate. In some embodiments, a urea metabolism regulator is carbamoyltransferase. In some embodiments, a carbamoyltransferase gene is an arg I gene. In some embodiments, a urea metabolism regulator is involved in synthesizing urea regulates the formation of N-acetylglutamate from glutamate and acetyl coenzyme- A. In some embodiments, a urea metabolism regulator is N-acetylglutamate synthetase. In some embodiments, a N-acetylglutamate synthetase gene is an argA gene. In some embodiments, a urea metabolism regulator is an argBCDJ gene. In some embodiments, a urea metabolism regulator is an arG gene. In some embodiments, a urea metabolism regulator is an argH gene. In some embodiments, a urea metabolism regulator is a carAB gene.

[0101] An engineered nucleic acid described herein can comprise one or more genes encoding a urea metabolism regulator described herein which is involved in synthesizing urea including, but not limited to, a gene encoding an arginase. In some embodiments, the engineered nucleic acid encodes an arginase gene variant. In some embodiments, the arginase gene variant is codon optimized. In some embodiments, an arginase gene is encoded by a rocF gene, such as a rocF gene derived from Bacillus subtilis or a Rhizobia described herein. In some embodiments, an engineered nucleic acid comprising a gene encoding an arginase also comprises a carbamoyltransferase gene and / or a N-acetylglutamate synthetase gene. In some embodiments, the carbamoyltransferase gene is encoded by the argl gene. In some embodiments, the N-acetylglutamate synthetase gene is encoded by the argA gene. In some embodiments, an engineered nucleic acid comprises an operon comprising the arginase gene, the carbamoyltransferase gene, the N-acetylglutamate synthetase gene, or any combination thereof. In some embodiments, at least one heterologous regulatory sequence is operably linked to the operon. The at least one heterologous regulatory sequence can comprise any of the regulatory sequences described herein. In some embodiments, the at least one heterologous regulatory sequence comprises a nifH promoter.

[0102] Non-limiting examples of arginase gene and protein sequences are described in U.S. Provisional Application number 63 / 632,173 at Table 5 titled “Non-limiting Examples of Arginase Sequences”, and can used in genetically engineering bacteria as described herein. The accession numbers provided for arginase gene and protein sequences in Table 5 of U.S. Provisional Application number 63 / 632,173 can be accessed through the KEGG BRITE Database (a database of annotated genomes that can provide a list of all known orthologs of a given gene or protein that performs a specific metabolic function) along with taxonomic information, carbamoyltransferase gene, and N-acetylglutamate synthetase gene sequences for the corresponding organisms of the Organism Identifiers in Table 5 of U.S. Provisional Application number 63 / 632,173 that the arginase sequences in Table 5 are derived from, and can be utilized in producing genetically engineered bacteria described herein.

[0103] In some embodiments, genetically engineered bacteria described herein comprises: a variant of one or more urease genes described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173 and / or a deletion of one or more urease genes described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173; a variant of an ac gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 or a deletion of an ac gene described in Table 4 of U.S. Provisional Application number 63 / 632,173; a variant of a uc gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 or a deletion of a uc gene described in Table 4 of U.S. Provisional Application number 63 / 632,173; an arginase gene described in Table 5 of U.S. Provisional Application number 63 / 632,173 or a variant thereof; or any combination thereof. In some embodiments, genetically engineered bacteria comprising a variant of one or more urease genes described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173 and / or a deletion of one or more urease genes described in Table 2 or Table 3 of U.S. Provisional Application number 63 / 632,173, a variant of an ac gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 or a deletion of an ac gene described in Table 4 of U.S. Provisional Application number 63 / 632,173, a variant of a uc gene described in Table 4 of U.S. Provisional Application number 63 / 632,173 or a deletion of a uc gene described in Table 4 of U.S. Provisional Application number 63 / 632,173, and / or an arginase gene described in Table 5 of U.S. Provisional Application number 63 / 632,173 or a variant thereof, further comprises one or more nitrogen fixation genes as described herein (e.g., a nif cluster comprising nifH, ni / D' , nifK, ni / B, nifE, nifF, nifj, nifM, nifN, nifQ, nifS, niff, nifU, nifV, nifW, nifY, and / or nifZ derived from a host bacteria comprising a sequence described in Table 1 of U.S. Provisional Application number 63 / 632,173), a carbamoyltransferase gene (e.g., a carbamoyltransferase gene naturally found in a host bacteria of an Organism Identifier described in Table 1, Table 3, Table 4, and / or Table 5 of U.S. Provisional Application number 63 / 632,173) or a variant thereof, and / or a N-acetylglutamate synthetase gene (e.g., a N-acetylglutamate synthetase gene naturally found in a host bacteria of an Organism Identifier described in Table 1, Table 3, Table 4, and / or Table 5 of U.S. Provisional Application number 63 / 632,173, each of which is incorporated by reference) or a variant thereof.

[0104] Plant Biofortification, Phytohormones, and Plant Defense Systems

[0105] In addition to being genetically engineered to release urea, genetically engineered bacteria described herein can comprise further modifications that alter the nutrient content of a plant, promote plant growth, and / or provide a plant defense system. For example, genetically engineered bacteria described herein can comprise one or more genes that produce a vitamin that is released so that it is available to a plant inoculated with the genetically engineered bacteria. As a further example, genetically engineered bacteria described herein can comprise one or more genes that are useful for plant defense, such as genes that provide defense against plant pathogens. Genetically engineered bacteria described herein can also be engineered to comprise one or more genes that produce a plant growth-stimulating hormone.

[0106] In some embodiments, genetically engineered bacteria described herein comprise one or more genes encoding components of a metabolic pathway that produces a plant biofortification product. In some embodiments, a plant biofortification product is a vitamin, such as vitamin A (carotenoids, such as retinol), vitamin C (ascorbic acid), vitamin E (tocopherols and tocotrienols), vitamin K (phylloquinone), B vitamins (e.g., thiamine, riboflavin, niacin, folate, etc.), and vitamin H (biotin). In some embodiments, genetically engineered bacteria comprise one or more genes encoding components of a metabolic pathway that produces vitamin A. Non-limiting examples of genes involved in the production of vitamin A include those encoding phytoene synthase, phytoene desaturase, zeta-carotene desaturase, carotenoid isomerase, and beta-carotene hydroxylase. In some embodiments, genetically engineered bacteria comprise one or more genes encoding components of a metabolic pathway that produces vitamin C. Non-limiting examples of genes involved in the production of vitamin C include those encoding GDP-mannose 3,5-epimerase, L-galactose-1- phosphate phosphatase, L-galactose-1 -dehydrogenase, and L-galactono-l,4-lactone dehydrogenase. In some embodiments, genetically engineered bacteria comprise one or more genes encoding components of a metabolic pathway that produces vitamin E. Non-limiting examples of genes involved in the production of vitamin E include those encoding homogentisate phytyltransferase, tocopherol cyclase, and tocopherol methyltransferase. In some embodiments, genetically engineered bacteria comprise one or more genes encoding components of a metabolic pathway that produces vitamin K. Non-limiting examples of genes involved in the production of vitamin K include MenA ( 1 ,4-dihydroxy-2-naphthoate octaprenyltransferase), MenB (1 ,4-dihydroxy-2-naphthoate polyprenyltransferase), MenC (O-succinylbenzoate synthase), MenD (2-succinyl-6-hydroxy-2,4- cyclohexadiene- 1 -carboxylate synthase), MenE (2-succinyl-6-hydroxy-2,4-cyclohexadiene-l- carboxylate 2,3-dehydrogenase), and other proteins involved in the conversion of chorismate to menaquinone. In some embodiments, genetically engineered bacteria comprise one or more genes encoding components of a metabolic pathway that produces a B vitamin. Non-limiting examples of genes involved in the production of B vitamins include those encoding thiamine synthase, riboflavin synthase, tryptophan synthase, tryptophan 2-monooxygenase, kynurenine formamidase, kynurenine aminotransferase, kynureninase, phosphoribosylanthranilate isomerase, niacin synthase, pantothenate synthetase, and pyridoxine synthase. In some embodiments, genetically engineered bacteria comprise one or more genes encoding components of a metabolic pathway that produces biotin. Non-limiting examples of genes involved in the production of biotin include those encoding biotin synthase, dcthiobiotin synthetase, pimcloyl-CoA synthase, and dcthiobiotin deaminase. In some embodiments, an engineered nucleic acid encoding components of a metabolic pathway that produces a plant biofortification product is operably linked to a regulatory sequence described herein.

[0107] In some embodiments, genetically engineered bacteria described herein comprise one or more genes encoding components of a pathway that produces a plant-growth stimulating molecule, such as a phytohormone. Non-limiting examples of molecules that stimulate plant growth include auxins, cytokinins, gibberellins, brassinosteroids, abscisic acid, ethylene, jasmonic acid, salicylic acid, strigolactones, polyamines, nitric oxide (NO), peptides (e.g., CLE peptides, expansins, root growth factor 1, RALF peptides, ENOD40, phytosulf okines, systemin, and feronia). Non-limiting examples of genes involved in the production of molecules which are capable of stimulating plant growth include tryptophan aminotransferase-related genes, flavin monooxygenase-like genes, isopentenyltransferase genes, a GA20ox gene, a GA3ox gene, a DET2 gene, BR6ox genes, 9-cis- epoxycarotenoid dioxygenase genes, ACC synthase genes, ACC oxidase genes, lipoxygenase genes, phenylamine ammonia-lyase genes, carotgenoid cleavage dioxygenase genes, nitric oxide synthase genes, EXPA, EXPB, RGF1, CLAVAT3, RALF, PSK genes, prosystemin genes, and the feronia genes. In some embodiments, an engineered nucleic acid encoding components of a metabolic pathway that produces a plant-growth stimulating molecule is operably linked to a regulatory sequence described herein.

[0108] In some embodiments, genetically engineered bacteria described herein comprise one or more genes of a plant defense system. Plant defense systems can be used to refer to one or more genes that are useful for promoting plant health, plant resistance (e.g., resistance to pathogens and / or competitors), and / or deter plant predators. In some embodiments, genetically engineered bacteria comprise one or more genes for making a plant cell resistant to a pathogen, such as enzymatic domains, enzymes, or inhibitory peptides that inactivate (e.g., modify and / or degrade) a molecule produced by a pathogen and / or prevent a plant pathogen from becoming established in a plant (e.g., prevent plant infection and / or prevent pathogen propagation). In some embodiments, a plant pathogen is a virus, a bacterium, a fungus, or a parasite. In some embodiments, a plant pathogen is a fungi belonging to the phylas Ascomycota such as Fusarium spp., Thielaviopsis spp., Verticullium spp., Magnaporthe grisea, Sclerotinia sclerotiorum or Basidiomycota, Ustilago spp., Rhizoctonia spp., Phakospora pachyrhizi, Puccinia spp., or Armillaria spp. In some embodiments, a plant pathogen is a bacteria, such as Burkholderia, xanthomonas spp., Pseudomonas spp., Phytoplasma, Spiroplasma. In some embodiments, a plant pathogen is a nematode, such as Phytomonas, Cephaleuros, broomrape, mistletoe, dodder, Pythium spp., Phytophthora spp., Plasmodiophora. or Spongospora. In some embodiments, a plant pathogen is associated with a crop disease, such as banana bunchy top, black bunchy top, black sigatoka, Panama disease, Fusarium head blight, powdery, mildew, bailey stem rust, African cassava mosaic disease, bacteria blight, cassava brown streak disease, bacterial blight, Fusarium wilt, Verticillium wilt, Aspergillus ear rot, Giberella stalk and ear rot, grey leaf spot, basal stem rot, bud rot, groundnut rosette disease, potato brown rot, late blight, Phoma stem canker, Sclerotinia stem rot, rice clast, rice bacterial blight, sheath blight, Anthracnose, Turcicum leaf blight, soybean cyst nematode disease, Asian soybean rust, Cercospora leaf spot, rhizomania, Ratoon stuntling, red rot, sweet potato virus disease, late blight, tomato yellow leaf curl, Fusarium head blight, wheat stem rust, wheat yellow rust, anthracnose, or yam mosaic disease. In some embodiments, genetically engineered bacteria comprise one or more genes involved in the production an insecticide or pesticide. Non-limiting examples of insecticides and pesticides include Bacillus thurigiensis toxins, neuropeptides (e.g., allatostatins, tachykinins, and myosuppressins), ion channel modulators (e.g., agents derived from venoms, such as snake venoms and spider venoms), lectins, plant-derived protease inhibitors, plant- derived proteinase inhibitors, and antimicrobial peptides. In some embodiments, genetically engineered bacteria comprise one or more genes encoding a pesticide that is used to defend a plant against a plant competitor, such as a weed (e.g., grass weeds, broadleaf weeds, perennial weeds, etc.) and / or a sedge (e.g., yellow nutsedge). In some embodiments, genetically engineered bacteria comprise one or more genes involved in the production of an allelopathic compound, an essential oil, or other molecule which promotes endophytic colonization of a bacteria or fungus that is pathogenic to a plant competitor. In some embodiments, genetically engineered bacteria comprise one or more genes that produce a molecule that is toxic and / or a deterrent against an herbivore, such as one or more genes involved in the production of an alkaloid (e.g., alkaloids produced by endophytic bacteria). In some embodiments, an engineered nucleic acid encoding components of a plant-defense system is operably linked to a regulatory sequence described herein.

[0109] Regulatory Sequences for Control of Engineered Nucleic Acids

[0110] In some embodiments, engineered nucleic acids encoding a urea metabolism regulator as described herein comprises one or more (e.g., two, three, four, five, six, seven, etc.) regulatory sequences (e.g., variant regulatory sequences, such as heterologous regulatory sequences). In some embodiments, a urea metabolism regulator comprising altered function is operably linked to regulatory sequence (e.g., variant regulatory sequences, such as heterologous regulatory sequences) described herein. In some embodiments, a urea metabolism regulator comprising altered function is encoded by a gene variant described herein and operably linked to regulatory sequence (e.g., variant regulatory sequences, such as heterologous regulatory sequences) described herein. In some embodiments, engineered nucleic acids encoding components of a metabolic pathway that produces a plant biofortification product, components of a metabolic pathway that produces a plant-growth stimulating molecule, and / or components of a plant-defense system described herein is operably linked to one or more regulatory sequences.

[0111] As used herein, a “regulatory sequence” is a DNA sequence which modulates the expression, stability, and / or levels of an RNA when operably linked to a gene sequence. As used herein, a nucleic acid sequence and regulatory sequences are “operably linked” when they are covalently linked in such a way as to place the expression or transcription of the nucleic acid sequence under the influence or control of the regulatory sequences. For example, two DNA sequences are said to be operably linked if induction of a promoter in the 5’ regulatory sequences results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation or (2) interfere with the ability of the promoter region to direct the transcription of the coding sequences.

[0112] In some embodiments, an engineered nucleic acid described herein comprises one or more variant regulatory sequences. In some embodiments, the variant regulatory sequence effects the expression of a urea metabolism regulator. For example, in some embodiments, said variant comprises a substitution of one or more nucleotides, a deletion of one or more nucleotides, and / or an addition of one or more nucleotides relative to a corresponding wildtype regulatory sequence of the gene encoding urea metabolism regulator. In some embodiments, a variant regulatory sequence comprises a plurality of nucleotides which are not found in a corresponding wildtype regulatory sequence. For example, in some embodiments, a variant regulatory sequence comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-20, 20-30, 30-40, 40-50, or more nucleotides which differ relative to a corresponding wildtype regulatory sequence. In some embodiments, the variant regulatory sequence prevents expression of a gene involved in urea metabolism. In some embodiments, an engineered nucleic acid comprises a variant regulatory sequence (e.g., a transcription start site, a mutated ribosomal binding site, etc.) and a wildtype coding sequence of a urea metabolism regulator gene.

[0113] In some embodiments, engineered nucleic acids described herein comprise one or more regulatory sequences which are heterologous to (e.g., not naturally found in either its wildtype or a mutant form thereof) the coding sequence of gene encoding a urea metabolism regulator. In some embodiments, a urea metabolism regulator is encoded by a gene comprising a wild-type coding sequence but also comprises a heterologous regulatory sequence. In some embodiments, the arginase gene is operably linked to a heterologous regulatory sequence. In some embodiments, a carbamoyltransferase gene is operably linked to a heterologous regulatory sequence. In some embodiments, a N-acetylglutamate synthetase gene described herein is operably linked to a heterologous regulatory sequence. In some embodiments, a heterologous regulatory sequence of a gene encoding a urea catabolism regulatory comprises an inactivating mutation, such as a pre- mature stop codon or a non-functional start codon that prevents the expression of a urease gene, a urea carboxylase gene, or an allophanate hydrolase gene.

[0114] In some embodiments, a regulatory sequence described herein is 5’ or upstream of a proteincoding sequence. In some embodiments, a regulatory sequence described herein is 3’ or downstream of a protein-coding sequence. In some embodiments, engineered nucleic acids described herein comprise one or more promoter sequences, ribosome binding sites, ribozymes, enhancer sequences, response elements, a polymerase-binding site, protein recognition sites, inducible elements, protein binding sequences, 5' and 3 ' untranslated regions (UTRs), transcriptional start sites, transcription terminator sequences, polyadenylation sequences, and / or introns. In some embodiments, an engineered nucleic acid comprises one or more regulatory sequences that regulate transcription (e.g., any one or more of a promoter, an enhancer, a transcription factor binding sequence, a transcriptional start sequence, transcription termination sequence, etc.) and / or one or more regulatory sequences that regulate translation (e.g., any one or more of a 5’ UTR, a translation initiation regulatory sequence, a Shine-Dalgamo sequence, a start codon, a ribosome binding site, a 3’ UTR, a translation termination sequence, a stop codon, etc.). In some embodiments, a regulatory sequence described herein will increase the expression of a gene. In other embodiments, a regulatory sequence described herein will decrease the expression of a gene. In some embodiments, a regulatory sequence is a protein-binding sequence, for example, a transcription factor binding site or a ribosome binding site (RBS).

[0115] In some embodiments, a regulatory sequence described herein is located within a proteincoding sequence. In some embodiments, a protein-coding sequence is regulated by one or more regulatory sequences. Non-limiting examples of regulatory sequences include the bacteriophage T7 promoter, sigma 70 promoter, sigma 54 promoter, lac promoter, rho-dependent terminator, stem- loop / rho-independent terminator.

[0116] In some embodiments, engineered nucleic acids described herein comprise constitutive promoters. Constitutive promoters maintain constant expression of a gene regardless of the conditions or physiological state of a cell. In some embodiments, a constitutive promoter is a comprises a nitrogenase complex constitutive promoter. In some embodiments, a nitrogenase complex constitutive promoter comprises the nifH promoter. Other non-limiting examples of constitutive promoters are those associated with housekeeping genes. For example, in some embodiments, a constitutive promoter comprises a promoter of an rRNA gene or a metabolic enzyme (e.g., GAPDH, phosphoglycerol kinase, dihydrofolate reductase, etc.).

[0117] In some embodiments, engineered nucleic acids described herein comprise inducible promoters. Inducible promoters allow regulation of gene expression, which is dependent on, for example, the presence of an exogenously supplied compound, environmental factor (e.g., temperature, metabolites, etc.), or the presence of a specific physiological state (e.g., gene expression associated with cell growth and / or replication). Non-limiting examples of inducible promoters which are regulated by exogenously supplied agents include the IPTG-inducible promoter, the DAPG-inducible promoter, the tetracycline-inducible promoter, the tryptophan- inducible promoter, the 3OC6HSL-inducible promoter, the salicylic acid-inducible promoter, the octopine-inducible promoter, the nopaline-inducible promoter, the arabinose-inducible promoter, the cuminic acid-inducible promoter, the naringenin-inducible promoter, the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system, the ecdysone insect promoter, a tetracycline -repressible nucleic acid, a tctracyclinc-induciblc nucleic acid, a RU486-induciblc nucleic acid, the rapamycin-inducible nucleic acid. For further details, see, e.g., WO 98 / 10088; No et ah, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996); Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992); Gossen et al., Science, 268:1766-1769 (1995); Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998); Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther., 4:432-441 (1997); and Magari et al, J. Clin. Invest., 100:2865-2872 (1997). Inducible promoters and inducible nucleic acids thereof are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech, and Ariad.

[0118] In some embodiments, an engineered nucleic acid described herein comprises a spacer sequence. The term “spacer sequence” may be used herein to refer to a stretch of nucleotides that separate (or intervene) two nucleic acid sequences. In some embodiments, an engineered nucleic acid comprises a plurality of spacer sequences. In some embodiments, an engineered nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more spacer sequences. Generally, a spacer comprises one or more nucleotides in length. In some embodiments, a spacer comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, a spacer comprises 10-20 nucleotides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length). In some embodiments, a spacer comprises more than 20 nucleotides in length. In some embodiments, a spacer comprises 20-100 nucleotides in length (e.g., 20-25, 25-3030-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 nucleotides in length) or more than 100 nucleotides in length (e.g., 100-120, 120-140, 140-160, 160-170, 170-180, 180-200, 200-250, 250-300, 300-400, or 400-500 nucleotides). In some embodiments, an engineered nucleic acid comprising one or more urea metabolism regulator genes comprises a heterologous spacer sequence in a location that comprises a naturally occurring spacer. A heterologous spacer sequence will typically differ in length relative to a corresponding naturally occurring spacer sequence by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 nucleotides. In some embodiments, a heterologous spacer sequence differs by 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 nucleotides in length relative to a corresponding naturally occurring spacer sequence. In some embodiments, a heterologous spacer sequences differs by more than 100 nucleotides relative to a corresponding naturally occurring spacer sequence.

[0119] A spacer sequence described herein can be located between any two nucleic acid sequences in order to modulate the expression of a gene encoded therein including, but not limited to, being inserted between two regulatory sequences, between a regulatory sequence and a gene (e.g., a gene operably linked to the regulatory sequence), or between two genes (e.g., two genes located in an operon). In some embodiments, a heterologous spacer sequence is used to disrupt the operable linkage between a gene and its promoter, such as to decrease the expression of a urea catabolism regulator gene. In some embodiments, heterologous spacer sequence is used to operably link a first gene and a single gene in an operon (e.g., a cistron). In some embodiments, a heterologous spacer sequence is used to disrupt an operon, such as to remove a first gene from an operon that naturally comprises the first gene and a second gene. In some embodiments, engineering genes to be encoded by a single operon is used to couple the expression dynamics of each of the genes encoded in the operon. In some embodiments, separating genes into different operons is used to alter the expression dynamics of genes naturally encoded in the same operon. Altering the expression dynamics of genes by moving the genes into or out of an operon can be used to, for example, control expression levels, expression rates, and / or the conditions under which a set of genes is expressed in a genetically engineered bacteria. In some embodiments, a heterologous spacer is inserted between a Shine-Dalgamo sequence and a translation initiation codon which are operably linked to a gene encoding a urea catabolism regulator to decrease the translation of an mRNA encoded by the gene. In some embodiments, a heterologous spacer is inserted between a Shine- Dalgamo sequence and translation initiation codon which are operably linked to a gene encoding an arginase to increase translation of the arginase. In some embodiments, a spacer described herein comprises a sequence that is designed to not form base pair-base-pair interactions (e.g., hybridize) with nucleotides comprised within the spacer.

[0120] In some embodiments, a regulatory sequence described herein (e.g., a heterologous regulatory sequence) comprises a nucleotide sequence in Table 6.

[0121] Table 6. Non-Limiting Examples of Regulatory Sequences

[0122] Engineered Transcriptional Units and Operons

[0123] In some embodiments, an engineered nucleic acid described herein comprises one or more genes which are organized into transcriptional units. In some embodiments, an engineered nucleic acid comprises a plurality of transcriptional units, such as two transcriptional units, three transcriptional units, four transcriptional units, five transcriptional units, six transcriptional units, seven transcriptional units, eight transcriptional units, nine transcriptional units, ten transcriptional units, or more than ten transcriptional units. Each transcriptional unit can comprise one gene (e.g., a cistron comprising one gene) or a plurality of genes (e.g., an operon). In some embodiments, a transcriptional unit comprises a plurality of genes, such as an operon that comprises two genes, three genes, four genes, five genes, six genes, seven genes, eight genes, nine genes, ten genes, or more than ten genes. In some embodiments, an engineered nucleic acid comprises a plurality of operons, such as two operons, three operons, four operons, five operons, six operons, seven operons, eight operons, nine operons, ten operons, or more than ten operons. The one or more genes in a transcriptional unit can be selected from any of the genes described herein, such as genes encoding urea metabolism regulators and nif genes.

[0124] In some embodiments, genetically engineered bacteria described herein comprise an engineered nucleic acid comprising an operon. In some embodiments, the operon comprises at least two genes encoding urea metabolism regulators. In some embodiments, an operon comprising a gene encoding urea metabolism regulator is a urea metabolism regulator which is heterologous to (e.g., not naturally encoded in its wildtype form or a mutant form thereof by the genome) a wildtype counterpart of the genetically engineered bacteria. In some embodiments, the at least two (e.g., two, three four, five, etc.) genes encoding urea metabolism regulators of the operon comprise an arginase gene (e.g., an arginase gene described in Table 5 of U.S. Provisional Application number 63 / 632,173, which is incorporated herein by reference) or a variant thereof, a carbamoyltransferase gene (e.g., a carbamoyltransferase gene naturally found in a host bacteria of an Organism Identifier described in Table 1, Table 3, Table 4, and / or Table 5 of U.S. Provisional Application number 63 / 632,173) or a variant thereof; and / or a N-acetylglutamate synthetase gene (e.g., a N- acctylglutamatc synthetase gene naturally found in a host bacteria of an Organism Identifier described in Table 1, Table 3, Table 4, and / or Table 5 of U.S. Provisional Application number 63 / 632,173) or a variant thereof.

[0125] In some embodiments, genetically engineered bacteria described herein comprise an engineered nucleic acid comprising one or more transcriptional units (e.g., operons), wherein each of the one or more transcriptional units comprise a / u' / 'gcnc. In some embodiments, the engineered nucleic acid comprises one or more genes encoding components of a nitrogenase (e.g., one or more genes selected from nifH, nifD, and niJK). and one or more genes involved in iron molybdenum cofactor formation (e.g., one or more genes selected from nifB, nifE, nifF, nifj, nifM, nifN, nifQ, nifS, nifE, nifU, nijV, nifW, nifY, and nifZ). In some embodiments, the one or more genes comprise a nifH gene, a nifD gene, a nifK gene, a nifB gene, a nifE gene, and a nifN gene. In some embodiments, the one or more genes comprise a nifH gene, a nifD gene, and a nifK gene described in Table 1 of U.S. Provisional Application number 63 / 632,173. In some embodiments, the one or more genes comprise one or more genes selected from nifB, nifE, nifF, nif J, nifM, nifN, nifQ, nifS, nifE, nifU, niJV, nifW, nifY, and nifZ, which are found in bacteria referred to by an Organism Identifier described in Table 1 of U.S. Provisional Application number 63 / 632,173. A gene, or a plurality thereof, in a transcriptional unit can be operably linked to one or more regulatory sequences described herein. In some embodiments, a regulatory sequence operably linked to a transcriptional unit is native to a gene comprised in the transcriptional unit. Tn some embodiments, a regulatory sequence operably linked to a transcriptional unit is a heterologous regulatory sequence. In some embodiments, a regulatory sequence operably linked to a transcriptional unit comprises a nucleotide sequence set forth in Table 6. In some embodiments, a heterologous regulatory sequence operably linked to a transcriptional unit is a regulatory sequence which is active in a genetically engineered bacteria comprising the engineered nucleic acid. In some embodiments, an engineered nucleic acid comprises one or more transcriptional units which are each preceded by a promoter and followed by a transcription terminator. In some embodiments, an engineered nucleic acid comprises one or more transcriptional units, wherein each transcriptional unit is separated by a spacer sequence described herein.

[0126] In some embodiments, an operon comprising at least two genes encoding urea metabolism regulators described herein are operably linked to at least one heterologous regulatory sequence. In some embodiments, the at least one heterologous regulatory sequence comprises an inducible promoter. In some embodiments, the inducible promoter comprises an IPTG-inducible promoter. In some embodiments, the at least one heterologous regulatory sequence comprises a constitutive promoter. In some embodiments, the constitutive promoter comprises a nitrogenase complex constitutive promoter. In some embodiments, the nitrogenase complex constitutive promoter comprises the nifH promoter. In some embodiments, an operon comprises one or more nucleotide sequences set forth in Table 7.

[0127] Table 7. Non-limiting Examples of Sequences for Operons Encoding Urea Synthesis Regulators Vectors

[0128] In some embodiments, engineered nucleic acids encoding one or more urea metabolism regulators described herein comprise a vector. In some embodiments, engineered nucleic acids comprising one or more n / ' genes described herein (e.g., a refactored nif cluster) comprise a vector. In some embodiments, vectors are single-stranded. In some embodiments, vectors are doublestranded. In some embodiments, vectors are circular (e.g., artificial chromosomes, such as artificial bacterial chromosomes, or plasmids, such as circular plasmids, nanoplasmids, and minicircle plasmids). In some embodiments, vectors are linear. In some embodiments, vectors are plasmids. In some embodiments, a plasmid comprises the pBBRl plasmid.

[0129] In some embodiments, vectors comprise a nucleic acid for stable maintenance, such as for promoting maintenance in a cell comprising the vector. In some embodiments, a nucleic acid for stable maintenance comprises an antibiotic resistance gene. In some embodiments, a nucleic acid for stable maintenance comprises a partitioning system. In some embodiments, a partitioning system comprises an RK2 partitioning system (e.g., one comprising parCBA and / or parDE operons).

[0130] Plants and Seeds Thereof

[0131] The disclosure also relates to plants and seeds comprising genetically engineered bacteria described herein. In some embodiments, a plant comprises genetically engineered bacteria on and / or in one or more tissues or a plant, such as in the root system and / or the leaf tissues of the plant. Plants and plant seeds can be of any species, including those that are grown in soil supplemented with exogenous nitrogen sources, such as fertilizers. Additionally, plants and seeds can be used in a naturally occurring form or a non-naturally occurring form. For example, in some embodiments, a plant or a seed is genetically engineered. Genetically engineered plants and seeds include those that have been directly genetically engineered (e.g., a plant or a seed comprising cells that have been subjected to one or more conditions that introduce an exogenous nucleic acid into the one or more cells) or those that arise as offspring from plants and seeds thereof that have been directly genetically engineered. In some embodiments, a plant is a genetically engineered plant or a descendant of a genetically engineered plant. In some embodiments, a seed is a genetically engineered seed or a seed germinated from a genetically engineered plant. In some embodiments, a plant or a seed thereof is an edible plant. In some embodiments, an edible plant or a seed thereof is a cultivated form of grass (Poaceae), a lentil, a legume, an oilseed, a tuber or root, a fruit, a vegetable, a nut, a beverage crop, a spice, or an herb. In some embodiments, a cultivated form of grass or a seed thereof is a cereal or pseudocereal, such as wheat, spelt, einkom, emmer, kamut, durum and triticale, rye, barley, rice, wild rice, maize (corn), millet, sorghum, teff, fonio oats, amaranth, quinoa, or buckwheat pulses. In some embodiments, a legume or a seed thereof is chickpea, pea, soybean, fava bean, mung bean, black-eyed pea, kidney bean, pigeon pea, or cowpeas. In some embodiments, an oilseed or a plant thereof is canola, sunflower, soybeans, cottonseed, peanut, sesame, safflower, flaxseed, mustard, or olive. In some embodiments, a tuber or root is potato, sweet potato, cassava, yam, taro, beetroot, turnip, carrot, radish, or ginger. In some embodiments, a fruit or a seed thereof is apple, banana, orange, mango, pineapple, grape, strawberry, watermelon, avocado, lemon, lime, papaya, or tomato. In some embodiments, a vegetable or a seed thereof is cucumber, bell pepper, spinach, lettuce, broccoli, cauliflower, eggplant, zucchini, or onion. In some embodiments, a nut or a seed thereof is almond, walnut, pistachio, cashew, pecan, hazelnut, macadamia, Brazil nut, pine nut, or chestnut. In some embodiments, a beverage crop is coffee, tea, cocoa, sugarcane, or hops. In some embodiments, a spice or a seed thereof is black pepper, vanilla, cinnamon, nutmeg, clove, or cardamom. In some embodiments, an herb is basil, thyme, rosemary, or oregano. In some embodiments, a plant or a seed thereof is a fibrous crop, such as cotton, hemp, jute, ramie, kenaf, sisal, abaca, or coir.

[0132] Compositions

[0133] In some embodiments, compositions of the present disclosure comprise one or more bacterial cells (e.g., a cell population, such as a population of genetically engineered bacteria described herein) and an agricultural carrier.

[0134] In some embodiments, genetically engineered bacteria are combined with one or more of the agents described herein to yield a composition suitable for combining with a plant, a seed, or seedling. In some embodiments, genetically engineered bacteria are obtained from growth culture, for example, using a synthetic growth medium. In some embodiments, genetically engineered bacteria are cultured on solid media, for example, on petri dishes, scraped off and suspended into the preparation. In some embodiments, genetically engineered bacteria at different growth phases are used. For example, in some embodiments, genetically engineered bacteria at lag phase, early-log phase, mid-log phase, late-log phase, stationary phase, early death phase, or death phase can be used.

[0135] In some embodiments, compositions comprise genetically engineered bacteria in the presence of at least 1,000 seeds, for example, at least 5,000 seeds, at least 10,000 seeds, at least 20,000 seeds, at least 30,000 seeds, at least 50,000 seeds, at least 70,000 seeds, at least 80,000 seeds, at least 90,000 seeds, or more. In some embodiments, the seeds are that of an edible plant. In some embodiments, the edible plant is a cultivated form of grass (Poaceae), a lentil, a legume, an oilseed, a tuber or root, a fruit, a vegetable, a nut, a beverage crop, a spice, or an herb. In some embodiments, the cultivated form of grass is a cereal or pseudocereal, such as wheat, spelt, einkom, emmer, kamut, durum and triticale, rye, barley, rice, wild rice, maize (corn), millet, sorghum, teff, fonio oats, amaranth, quinoa, or buckwheat pulses. In some embodiments, the legume is chickpea, pea, soybean, fava bean, mung bean, black-eyed pea, kidney bean, pigeon pea, or cowpeas. In some embodiments, the oilseed is canola, sunflower, soybeans, cottonseed, peanut, sesame, safflower, flaxseed, mustard, or olive. In some embodiments, a tuber or root is potato, sweet potato, cassava, yam, taro, beetroot, turnip, carrot, radish, or ginger. In some embodiments, the fruit is apple, banana, orange, mango, pineapple, grape, strawberry, watermelon, avocado, lemon, lime, papaya, or tomato. In some embodiments, the vegetable is cucumber, bell pepper, spinach, lettuce, broccoli, cauliflower, eggplant, zucchini, or onion. In some embodiments, the nut of is almond, walnut, pistachio, cashew, pecan, hazelnut, macadamia, Brazil nut, pine nut, or chestnut. In some embodiments, the beverage crop is coffee, tea, cocoa, sugarcane, or hops. In some embodiments, the spice is black pepper, vanilla, cinnamon, nutmeg, clove, or cardamom. In some embodiments, the herb is basil, thyme, rosemary, or oregano. In some embodiments, a plant or a seed thereof is a fibrous crop, such as cotton, hemp, jute, ramie, kenaf, sisal, abaca, or coir. In some embodiments, seeds in a composition described herein are genetically engineered seeds or seeds germinated from a genetically engineered plant.

[0136] In some embodiments, compositions comprise genetically engineered bacteria in the presence of a discrete weight of seeds, for example, at least 1 lb, at least 2 lbs, at least 5 lbs, at least 10 lbs, at least 30 lbs, at least 50 lbs, at least 70 lbs, or more. In some embodiments, a substantially uniform population of seeds comprising the modified bacteria is provided in other aspects of the invention. In some embodiments, at least 10%, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or more of the seeds in the population, contains the genetically engineered bacteria in an amount effective to colonize a plant. In some embodiments, at least 10%, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or more of the seeds in the population comprise at least 100 CFU on its surface, for example, at least 200 CFU, at least 300 CFU, at least 1,000 CFU, at least 3,000 CFU, at least 10,000 CFU, at least 30,000 CFU, at least 100,000 CFU, at least 300,000 CFU, or at least 1,000,000 CFU per seed or more.

[0137] In some embodiments, composition comprising a substantially uniform population of plants is provided. In some embodiments, a population comprises two or more plants, such as 2-10 plants. 10-25 plants, 25-50 plants, or more than 50 plants. In some embodiments, a population comprises at least 100 plants, for example, at least 300 plants, at least 1,000 plants, at least 3,000 plants, at least 10,000 plants, at least 30,000 plants, at least 100,000 plants or more. In some embodiments, plants are grown from the seeds comprising the genetically engineered as described herein. In some embodiments, there is an increased uniformity with respect to the genetically engineered bacteria within the plant population. For example, in some embodiments, a substantial portion of the population of plants, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or more of the seeds or plants in a population, comprise a threshold number of the genetically engineered bacteria. In some embodiments, the threshold number comprises at least 100 CFU, for example at least 300 CFU, at least 1,000 CFU, at least 3,000 CFU, at least 10,000 CFU, at least 30,000 CFU, at least 100,000 CFU, or more, in the plant or a part of the plant. In some embodiments, a substantial portion of the population of plants, for example, in at least 1%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or more of the plants in the population, the genetically engineered bacteria that is provided to the seed or seedling represents at least 10%, least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% of the total microbe population in the plant / seed. In some embodiments, agricultural carriers comprise a solid carrier. In some embodiments, agricultural carriers comprise a solid, such as diatomaceous earth, loam, silica, alginate, clay, bentonite, vermiculite, seed cases, other plant and animal products, or combinations, including granules, pellets, wheat, bran, vermiculite, clay, talc, bentonite, diatomaceous earth, fuller's earth, mineral carriers such as kaolin clay, pyrophyllite, bentonite, montmorillonite, diatomaceous earth, acid white soil, vermiculite, and pearlite, and inorganic salts such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, ammonium chloride, and calcium carbonate. In some embodiments, organic fine powders such as wheat flour, wheat bran, and rice bran may be used.

[0138] In some embodiments, agricultural carriers comprise a liquid. In some embodiments, liquid carriers include vegetable oils such as soybean oil and cottonseed oil, glycerol, ethylene glycol, polyethylene glycol, propylene glycol, polypropylene glycol, or suspensions. In some embodiments, agricultural carriers comprise a liquid solution or suspension, wherein the genetically engineered bacteria can be mixed or suspended in aqueous solutions. In some embodiments, agricultural carriers comprise liquid diluents, aqueous solutions, petroleum distillates, or other liquid carriers.

[0139] In some embodiments, agricultural earners comprise a surfactant. Non-limiting examples of surfactants include nitrogen-surfactant blends, such as Prefer 28 (Cenex), Surf-N(US), Inhance (Brandt), P-28 (Wilfarm) and Patrol (Helena); esterified seed oils include Sun-It II (AmCy), MSO (UAP), Scoil (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel); and organo- silicone surfactants include Silwet L77 (UAP), Silikin (Terra), Dyne-Amic (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis), and Century (Precision).

[0140] In some embodiments, agricultural carriers comprise seeds, seed coats, granular carriers, soil, solid carriers, liquid slurry carriers, and / or liquid suspension carriers. In some embodiments, agricultural carriers comprise biologically compatible dispersing agents, such as nonionic, anionic, amphoteric, or cationic dispersing and emulsifying agents. In some embodiments agricultural carriers comprise wetting agents, a synthetic surfactant, a water-in-oil emulsion, a wettable powder, granules, gels, agar strips or pellets, thickeners, microencapsulated particles, and / or liquids, such as aqueous suspensions.

[0141] In some embodiments, agricultural earners comprise a tackifier or adherent, such as agents useful for combining the genetically engineered bacteria with carriers that comprise other compounds (e.g., control agents that are not biologic), to yield a coating composition. In some embodiments, such compositions help create coatings around the plant or seed to maintain contact between the microbe and other agents with the plant or plant part. In some embodiments, adherents are selected from the group consisting of: alginate, gums, starches, lecithins, formononetin, polyvinyl alcohol, alkali formononetinate, hesperetin, polyvinyl acetate, cephalins, Gum Arabic, Xanthan Gum, Mineral Oil, Polyethylene Glycol (PEG), Polyvinyl pyrrolidone (PVP), Arabinogalactan, Methyl Cellulose, PEG 400, Chitosan, Polyacrylamide, Polyacrylate, Polyacrylonitrile, Glycerol, Triethylene glycol, Vinyl Acetate, Gellan Gum, Polystyrene, Polyvinyl, Carboxymethyl cellulose, Gum Ghatti, and polyoxyethylene-polyoxybutylene block copolymers.

[0142] In some embodiments, agricultural carriers are prepared from wettable powders, granules, gels, agar strips or pellets, thickeners, microencapsulated particles, grain or legume products, ground grain or beans, broth or flour derived from grain or beans, starch, sugar, or oil.

[0143] In some embodiments, agricultural earners comprise a microbial stabilizer, such as a desiccant. As used herein, a "desiccant" can include any compound or mixture of compounds that can be classified as a desiccant regardless of whether the compound or compounds are used in such concentrations that they in fact have a desiccating effect on the liquid inoculant. In some embodiments, such desiccants are compatible with the modified bacteria used, and promote the ability of the microbial population to survive application on the seeds and to survive desiccation. Non-limiting examples of suitable desiccants include one or more of trehalose, sucrose, glycerol, methylene glycol, non-reducing sugars and sugar alcohols (e.g., mannitol or sorbitol).

[0144] In some embodiments, agricultural carriers comprise one or more agents such as a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, and a nutrient. In some embodiments, such agents are compatible with the agricultural seed or seedling onto which the formulation is applied (e.g., it should not be deleterious to the growth or health of the plant).

[0145] Methods

[0146] Genetically engineered bacteria described herein can be used in methods of the disclosure to, for example, function as a biofertilizer. Genetically engineered bacteria used in the methods described herein will typically provide fixed nitrogen to a plant, a seed, or soil in the form of urea after being contacted with the plant, the seed, or the soil. The genetically engineered bacteria will typically comprise an inactivating mutation in a urease gene cluster and an engineered nucleic acid comprising an arginase gene. In some embodiments, genetically engineered bacteria used in methods described herein are epiphytic bacteria, endophytic bacteria, and / or plant root-associated bacteria, such as bacteria that are capable of becoming established in a plant.

[0147] Genetically engineered bacteria described herein can be utilized in any or all steps of an agricultural process for fertilizing soil, planting a crop, and / or growing a crop. In some embodiments, methods of the present disclosure comprise delivering genetically engineered bacteria to a cereal plant, a cereal plant seed, or soil thereof. In some embodiments, genetically engineered bacteria are provided as a composition which is contacted with a cereal plant, a cereal plant seed, or soil thereof. In some embodiments, methods of the present disclosure comprise contacting a plant or a plant seed with soil that has been contacted with genetically engineered bacteria described herein or a composition thereof. In some embodiments, methods of the present disclosure comprise planting and / or growing a plant or a plant seed. In some embodiments, a plant or a plant seed has been directly contacted with genetically engineered bacteria (e.g., inoculated with genetically engineered bacteria) cither before, during, and / or after being planted. In some embodiments, a plant or a plant seed is planted and / or grown in soil contacted with genetically engineered bacteria before, during, and / or after being planting. In some embodiments, methods of the present disclosure comprise collecting a plant or a plant seed from soil that has been contacted with genetically engineered bacteria described herein or a composition thereof.

[0148] In some embodiments, an arginase gene in an engineered nucleic acid is operably linked to an inducible promoter and a method comprises contacting genetically engineered bacteria, a plant, a plant seed, and / or soil with an agent capable of inducing expression of the arginase gene. In some embodiments, an agent that is contacted with genetically engineered bacteria, a plant, a plant seed, and / or soil is IPTG, DAPG, tryptophan, tetracycline, 3OC6HSL, salicylic acid, octopine, a nopaline, arabinose, cuminic acid, or naringenin.

[0149] In some embodiments, one or more nif cluster genes in an engineered nucleic acid are operably linked to an inducible promoter and a method comprises contacting genetically engineered bacteria, a plant, a plant seed, and / or soil with an agent capable of inducing expression of the one or more nif cluster genes. In some embodiments, an agent that is contacted with genetically engineered bacteria, a plant, a plant seed, and / or soil is IPTG, DAPG, tryptophan, tetracycline, 3OC6HSL, salicylic acid, octopine, a nopaline, arabinose, cuminic acid, or naringenin.

[0150] In some embodiments, genetically engineered bacteria are inoculated in growth medium and grown with proper dilution steps for hours or days prior to contacting the cereal plant, seed, or soil thereof. In some embodiments, growth medium is supplemented with appropriate antibiotics and / or inducers. In some embodiments, genetically engineered bacteria are subsequently transferred to a separate container prior to contacting the cereal plant, seed, or soil thereof.

[0151] In some embodiments, genetically engineered bacteria are contacted with seeds (e.g., cereal plant seeds). In some embodiments, plant seeds (e.g., cereal plant seeds) are surface-sterilized seeds. In some embodiments, seeds are washed with diluted ethanol and / or other sterilizing solutions. In some embodiments, seeds are contacted with agar plates prior to seed germination.

[0152] Plants and plant seeds used in the methods of the disclosure can be of any species, including, but not limited to, those that are grown in soil supplemented with exogenous nitrogen sources, such as fertilizers. Additionally, plants and seeds can be used in a naturally occurring form or a non- naturally occurring form. In some embodiments, a plant is a genetically engineered plant or a descendant of a genetically engineered plant. In some embodiments, a seed is a genetically engineered seed or a seed germinated from a genetically engineered plant.

[0153] In some embodiments, a plant or a seed thereof used in the methods described herein is an edible plant. In some embodiments, an edible plant or a seed thereof is a cultivated form of grass (Poaceae), a lentil, a legume, an oilseed, a tuber or root, a fruit, a vegetable, a nut, a beverage crop, a spice, or an herb. In some embodiments, a cultivated form of grass or a seed thereof (Poaceae) is a cereal or pseudocereal, such as wheat, spelt, einkorn, emmer, kamut, durum and triticale, rye, barley, rice, wild rice, maize (corn), millet, sorghum, teff, fonio oats, amaranth, quinoa, or buckwheat pulses. In some embodiments, a legume or a seed thereof is chickpea, pea, soybean, fava bean, mung bean, black-eyed pea, kidney bean, pigeon pea, or cowpeas. In some embodiments, an oilseed or a plant thereof is canola, sunflower, soybeans, cottonseed, peanut, sesame, safflower, flaxseed, mustard, or olive. In some embodiments, a tuber or root is potato, sweet potato, cassava, yam, taro, beetroot, turnip, carrot, radish, or ginger. In some embodiments, a fruit or a seed thereof is apple, banana, orange, mango, pineapple, grape, strawberry, watermelon, avocado, lemon, lime, papaya, or tomato. In some embodiments, a vegetable or a seed thereof is cucumber, bell pepper, spinach, lettuce, broccoli, cauliflower, eggplant, zucchini, or onion. In some embodiments, a nut or a seed thereof is almond, walnut, pistachio, cashew, pecan, hazelnut, macadamia, Brazil nut, pine nut, or chestnut. In some embodiments, a beverage crop is coffee, tea, cocoa, sugarcane, or hops. In some embodiments, a spice or a seed thereof is black pepper, vanilla, cinnamon, nutmeg, clove, or cardamom. In some embodiments, an herb is basil, thyme, rosemary, or oregano. In some embodiments, a plant or a seed thereof is a fibrous crop, such as cotton, hemp, jute, ramie, kenaf, sisal, abaca, or coir.

[0154] EXAMPLES

[0155] Example 1

[0156] This Example describes non-limiting examples of strategies for genetically engineering bacteria to produce increased concentrations of extracellular urea.

[0157] Introduction

[0158] Synthetic fertilizers arc economically and environmentally costly. Nitrogenous fertilizers arc the primary cost input of cereal crops in the US, often being more expensive than the seed itself and accounting for up to 40% of total operating costs. The production of ammonia for fertilizer is also heavily dependent on natural gas, meaning prices are incredibly volatile. The production and transportation of synthetic fertilizers accounts for -3% annual green-house gas emissions and consumes 5% of the global natural gas supply. Only 20% of nitrogen fertilizer reaches the plant when applied to the field, the rest entering the environment through runoff, volatilization, or mineralization.

[0159] While cereal crops are heavily dependent on synthetic fertilizers, legumes generally do not require intensive fertilization due to a highly evolved symbioses with nitrogen- fixing bacteria found in nodules on legume roots. These bacteria, called Rhizobia. can convert inert dinitrogen gas to biologically available ammonia using the enzyme nitrogenase. During symbiosis, the plant provides plentiful energy in the form of carbohydrates to power microbial nitrogen-fixation; in turn Rhizobia release large quantities on ammonia to support plant growth. While many Rhizobia reside in cereal roots, they generally do not fix nitrogen or release ammonia in this environment and, therefore, cereals are heavily dependent on synthetic fertilizers. It has been a long-standing goal of biotechnology to engineer Rhizobia residing in cereal roots to behave like the legume-colonizing relatives and release fixed nitrogen to support cereal growth and reduce synthetic fertilizer usage.

[0160] Several strategies have been employed to improve nitrogen fixation in cereal-associated bacteria. The most common is to remove the native regulation of the enzyme nitrogenase. This can be done by knocking out negative regulators of nitrogenase expression such as iiifL' . or overexpressing its cognate transcriptional activator, nifA. This leads to constitutive expression of nitrogenase that is insensitive to excess nitrogen in the environment.

[0161] Overexpressing nitrogenase alone generally does not lead to ammonia release because ammonia is rapidly assimilated into cellular metabolism by the enzyme glutamine synthetase (gs). Knocking out gs is lethal to the cell so a common alternative is to knock out its regulator glnE and heterologously express an engineered form of the regulator that contains only the protein domain responsible for negatively regulating gs. This domain, referred to as a unidirectional adenyltransferase (uAT), adenylates gs to keep the enzyme in its ‘off’ state and prevents the assimilation of ammonia into biomass. These engineered cells can accumulate ammonia in the range of 0.1 -4mM in optimized cellular cultures and can provide plant growth benefits in lab.

[0162] However, this strategy has many shortcomings. Preventing assimilation of ammonia arrests cellular growth, meaning the bacteria cannot colonize soils in the field. The genetic system is also inherently unstable because a mutation in uAT leads to a mutant bacteria outcompeting its functional peers. The expression of uAT must also be specifically tuned as overexpression is toxic to the cell, while underexpression leads to ammonia assimilation into biomass. This means that the strategy may not be feasible in agriculturally relevant soil bacteria which lack well characterized genetic parts.

[0163] Genetic Engineering Strategy Overview

[0164] FIGs. 1A-1B show an overview of how urea is used by plants for carbon fixation purposes. FIG. 1A shows a cartoon of a cereal plant wherein synthetic urea is applied directly to plant tissues and subsequently broken down by bacterial ureases and abiotic hydrolysis to yield ammonia (NH3) and carbon dioxide (CO2). Ammonia and carbon dioxide are subsequently used as substrates in a plant photosynthetic pathway and thereby assimilated into plant biomass or is lost to the environment through leaching or volatilization. Less frequently, liquid urea solutions are applied directly to plant tissue through foliar application. FIG. IB shows a diagram of how a diazotrophic bacteria (e.g., epiphytic, endophytic, and / or plant-root associated bacteria in cereal plant soil) comprising nitrogenase synthesize intracellular ammonia (NH3) which, via the arginine biosynthesis pathway, recombines with carbon dioxide (CO2) to produce urea. Urea is ultimately released from the cell where it can be broken down into ammonia (NH3) and carbon dioxide (CO2) which are subsequently used by a plant cell to produce amino acids and glucose, respectively. Overexpression of arginase releases urea containing the fixed nitrogen and carbon dioxide, which is passively released from the bacteria in the absence of a urea catabolism pathway. Urea released from bacteria associated with plant roots would be quickly assimilated into plant cells and hydrolyzed into ammonia and carbonate. During photosynthesis, the elevated carbonate levels can support increased rates of photosynthesis to sequester carbon into plant biomass while the fixed nitrogen supports the plant nitrogen demand.

[0165] Urea can be catabolized by two independent enzymatic routes in bacteria. Urea can be catabolized into ammonia and carbonate by the enzyme urease, which is the product of multiple genes contained in the urease gene cluster. Alternatively, urea can be carboxylatcd to form allophanate, an intermediate metabolite in the atrazine degradation pathway. Allophanate is then metabolized to ammonia and carbonate by the enzyme allophanate hydrolase. In certain cases, urea carboxylase and allophanate hydrolase are found within a single, multi-domain enzyme.

[0166] By genetically engineering bacteria to produce urea instead of ammonia, finetuning of gs expression and avoiding the toxicity of preventing nitrogen assimilation into cellular biomass is no longer an issue. Additionally, in some embodiments, genetically engineered bacteria are more stable than their ammonia producing counterparts. While said genetically engineered bacteria are still releasing fixed nitrogen, the fixed nitrogen is provided in the form of urea that assimilates into cellular metabolism and circumvents growth arrest required by existing strategies. Additionally, mutants that have lost the ability to produce urea still cannot catabolize urea found in cell culture, decreasing the mutant’s fitness advantage. In some embodiments, this improves microbe colonization of cereal roots and storage stability. Finally, when synthetic urea is applied to plant tissue, it is broken down into ammonia and carbon dioxide. Because the concentration of carbon dioxide is limiting during photosynthesis, some of the urea-derived carbon dioxide is sequestered into plant biomass. This means that when delivered to the plant, urea biosynthesis is a path towards carbon fixation.

[0167] Methods and Results

[0168] Herein, a genetically engineered bacteria (exemplary work performed on wheat endophyte, Azorhizobium caulinodans ORS571) which releases biosynthesized urea during nitrogen fixation is described.

[0169] FIGs. 2A-2C show a non-limiting example of a genetic engineering strategy to remove the urea catabolizing route in Azorhizobium caulinodans. FIG. 2A shows a non-limiting example of a urea catabolism pathway in A. caulinodans, and its associated metabolites, catalyzed by urea carboxylase (uc gene) and allophanate hydrolase (ah gene) to produce ammonia (NH3) and carbon dioxide (CO2). FIG. 2B shows representative cell streaking analyses, wherein genetically engineered A. caulinodans (a wheat endophyte) engineered to be unable to grow aerobically on urea as a sole nitrogen source. A. caulinodans comprising one or more deletion (A) variants of urea catabolism genes (urease gene cluster (wre); ure and ah', or ure, uc and ah) were struck on L3 minimal medium (MM) supplemented with 5mM glutamine or 20mM urea. A. caulinodans strains lacking either urease alone (AureABCEFG) or in combination with allophanate hydrolase (Aah) and urea carboxylase (Auc) were streaked onto L3 minimal media with 5mM glutamine or 20mM urea as a sole source of fixed nitrogen under aerobic conditions. The A. caulinodans strains were able to grow robustly under all conditions except for the strain lacking urease, allophanate hydrolase, and urea carboxylase in the presence of urea. FIG. 2C shows representative growth dynamics data (left-side panel) and extracellular urea production (right side panel) of genetically engineered A. caulinodans comprising one or more deletion (A) variants of urea catabolism genes (ure', ure and ah', or ure, uc and ah) grown in L3 minimal media supplemented with 20mM urea. The final cell density of urea catabolism knock-out strains was recorded after 24 hours of growth and the final concentration of urea was quantified using a theosemicarbazide-based colorimetric assay.

[0170] FIGs. 3A-3D show non-limiting examples of genetic engineering strategies to increase extracellular urea production in A. caulinodans comprising deletion (A) variants of ure, uc and ah genes. FIG. 3A shows a genetic engineering strategy for expression of an exogenous arginase in genetically engineered A. caulinodans, wherein an engineered nucleic acid (engineered pBRRl plasmid) comprising a codon optimized rocF gene variant derived from Bacillus subtilis was operably linked to an inducible regulatory sequence (a lac operator (PlacOl) comprising an IPTG- inducible promoter) and a ribosomal binding site (RBS) (left side panel), thereby yielding overexpression of heterologous rocF (right side panel) in A. caulinodans comprising deletion variants of ure, uc and ah genes. FIG. 3B shows a genetic engineering strategy for expression of an exogenous arginase in genetically engineered A. caulinodans, wherein an engineered operon (provided on an engineered pBRRl plasmid) comprising a codon optimized rocF gene variant derived from B. subtilis and a carbamoyltransferase encoded by a argl gene variant were operably linked to an inducible regulatory sequence (a lac operator (PlacOl) comprising an IPTG-inducible promoter) and respective ribosomal binding sites (RBS) (left side panel), thereby yielding overexpression of heterologous arginase and heterologous carbamoyltransferase in A. caulinodans comprising deletion variants of ure, uc and ah genes. FIG. 3C shows representative data from extracellular urea production assays of genetically engineered A. caulinodans grown minimal media (MM), wherein the genetically engineered A. caulinodans comprised either: deletion of the ure, uc and ah genes only; deletion of the ure, uc and ah genes and a heterologous, codon optimized rocF gene variant; deletion of the ure, uc and ah genes, a heterologous, codon optimized rocF gene variant, and an argA gene variant encoding a heterologous N- acetylglutamate synthetase comprising a substitution of histidine to tyrosine at amino acid residue position 16 (H16Y); or deletion of the ure, uc and ah genes, a heterologous, codon optimized rocF gene variant, and a heterologous argl gene variant. The concentration of urea in the supernatant of cell cultures was quantified after 48 hours of diazotrophic growth in L3 Minimal Media lacking nitrogen. FIG. 3D shows representative data from analyses of an A. caulinodans strain comprising deletions of the ure, uc, and ah genes, and an arginase (rocF) gene (left panel) which is derived from a Rhizobia that is not A. caulinodans (strains labeled on x-axis of graph in right panel). Arginase activity was measured using urea quantification in L3 minimal media after 48 hours of diazotrophic growth under inducing conditions (ImM IPTG). The results indicated that bacteria (e.g., nitrogen-fixing bacteria, such as A. caulinodans) genetically engineered to comprise an engineered nucleic acid encoding one or more urea metabolism regulators (e.g., an arginase gene, such as a rocF gene including, but not limited to, a rocF gene derived from a different bacteria and / or operably linked to a heterologous regulatory sequence, and / or a gene encoding a carbamoyltransferase, such as an argl gene) produces and releases greater amounts of urea as compared to control counterpart bacteria that lack the engineered nucleic acid.

[0171] FIGs. 4A-4B show a non-limiting example of genetic engineering strategy to yield urea biosynthesis under the control of nitrogen fixation. FIG. 4A shows a genetic engineering strategy for expression of an exogenous arginase in genetically engineered A. caulinodans comprising deletion variants of ure, uc and ah genes, wherein an engineered operon (provided on an engineered pBRRl plasmid) comprised a codon optimized rocF gene variant and an argl gene variant which were operably linked to respective ribosome binding sites (RBS) and an upstream heterologous promoter, (either a lac operator (PlacOl) or a constitutive nifH promoter). FIG. 4B shows representative data from extracellular urea production assays of A. caulinodans strains grown minimal media (MM), wherein said strains were genetically engineered to comprise the engineered nucleic acids of FIG. 4A. Engineered A. caulinodans strains expressing the synthetic urea biosynthesis operon downstream from the nifH promoter released urea under nitrogen-fixing conditions without the addition of a chemical inducer at levels comparable to full induction of the lactose-inducible promoter.

[0172] Conclusions

[0173] All urea catabolizing routes in the bacteria were identified and removed including the urease gene cluster ure, urea carboxylase uc, and allophanate hydrolase ah. The strain A. caulinodans Au re Auc Aah was unable to grow in minimal media when urea was provided as the sole nitrogen source.

[0174] Then, a heterologously overexpressed codon optimized arginase gene rocF, from Bacillus subtilis, was expressed and stably maintained on plasmid vector BBR1. To decrease regulatory risk associated with using genetic sequences from distantly related species, arginase genes from more taxonomically related Rhizobia bacteria were also characterized on the BBR1 plasmid vector. This gene hydrolyses arginine into urea and ornithine. To improve flux through this pathway, overexpression of ornithine carbamoyltransferase arg ) and N-acetylglutamate synthetase (argA) was employed. Finally, the original genetic construct relied upon the addition of IPTG to induce urea biosynthesis. An alternative construct was employed which comprised a promoter for the catalytical elements of nitrogenase (PnifH) upstream of the engineered operon. The resulting strain was stable when growing in rich media but maintained its ability to release urea when grown under nitrogen-fixing conditions. These strains were able to accumulate MOOpM urea when grown under nitrogen-fixing conditions in 48 hours of growth.

[0175] Example 2

[0176] This Example relates to a genetic sensor that couples urea concentration to the growth of a bacteria permitted bacterial mutagenesis and improvements to the urea release phenotype without direct manipulation of the bacterial genome. Compositions and methods described herein can be used for the selection of strains that mutagenize to increase urea production, without the need to directly insert transgenes as the sensor would be removed following selection.

[0177] A transcription factor was optimized to sense physiologically relevant concentrations of urea in A. caulinodans . UreR, a transcription activator responsible for sensing elevated urea and coordinating the expression of virulence genes in the UTI causing bacteria Providencia stuartii, was used to engineer a urea sensor and promoter pair with a high dynamic range that are operably linked to a fluorescent reporter (FIG. 5A). Contacting engineered A. caulinodans with varying concentrations of urea resulted in dose-dependent increases in fluorescent reporter expression (FIG. 5B). The UreR sensor comprised the nucleotide sequence set forth below:

[0178] ATGGAGTACAAATTTTTCTTGTCCGAAAGTCAAATGGTGCTGAAAGCATTTTACATTGAGTCAGCGATGAT TGCAATGCTGACCGGAGCAAAAGGTAATATTGTCATCAATGGACAGTCCATCGAAATTGAGTCGGATGTA ACTTTGATTATCCCGAAGTATTCCCAGGTGTCATGTAACATTGTCTGCAATACGGTTAAGCAGCCTTTGGA GTTGCATACCCTTAGCATGTCCGCGGAAGAGTTGCAGGCCGTCTTCCTTTTACTGAAAACTTTAATGAAAT CAGGCGCTCCACTGACATCACACCAGCCGATTTATCACATTTCGCCCCCAGAAACGGTTCGCGGGAACTT CAGCTTGTTGAAACAATGCCTTCCACTTAAAAAGCAAAGCGCGTCTCAGGAAGCGTTATTAATGAAACAG TCACTGTATTTCATTCTTATGGCTATTTACCAAGAGGGAATTGATATCCTGAACCTTTTTCGTTTCAACTAC GACGAACCGAAAAACCAAGCAATCACACATCTGATTACTCAGGAACCACAGAAAAAATGGCATTTGGAT GACGTAGCCAAAGCGCTGTTCACGACACCATCAACCCTGCGTCGCCACCTTAACCGCGAGGGCGTGAGCT TTCGTCAATTACTGTTAGATGTTCGTATGGGCATGGCATTGAATTACCTTACATTCTCGAACTATTCGGTTT TCCAGATTAGTCACCGCTGTGGGTTCGGAAGCAACGCCTACTTCTGTGACGTTTTCAAACGCAAGTACAAC ATGACTCCGTCCCAGTTCCGTCTGCAGTCACGTCAAAGCAATGACCCAAACTTTATTACAAACCTGTCGCT GCGTAGCAACCCGATTGAATTTGACAAGGAAATTGATGAGTAG (SEQ ID NO:94)

[0179] However, additional UreR sequences have been previously described, including UreR sequences from Proteus mirabilis and E. Coli.

[0180] An antibiotic selection marker (a nucleic acid encoding chloramphenicol acetyltransferase (cat)) was placed downstream of the UreR promoter such that engineered A. caulinodans became resistant to chloramphenicol only in the presence of a threshold concentration of urea (FIG. 6A). Ribosome binding site (RBS) engineering was used to adjust the expression of cat to produce a library of strains that require different concentrations of urea to survive selection. Contacting engineered A. caulinodans with increasing concentrations of urea led to increased cat expression and increased antibiotic resistance of the strains (FIG. 6B). The synthetic urea biosynthesis operon comprising deletions in ure, uc, and ah was generating in engineered A. caulinodans strains comprising the UreR sensor (FIGs. 7A-7B). The concentration of chloramphenicol needed to abolish growth the strain was increased significantly when the urea biosynthesis operon was induced, suggesting the sensor can couple the growth the strain to its ability to overproduce urea (FIG. 7C).

[0181] EQUIVALENTS

[0182] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure. All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0183] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

[0184] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”

[0185] The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, e.g., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, e.g., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with opcn-cndcd language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

[0186] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, e.g., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (e.g., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0187] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0188] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method arc recited.

[0189] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, e.g., to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of’ and “consisting essentially of’ the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B”, the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B”. NON-LIMITING EMBODIMENTS

[0190] The following numerated embodiments represent non-limiting aspects of the invention: A genetically engineered bacterium comprising a one or more variant urea catabolism genes. The genetically engineered bacterium of embodiment 1 , wherein the one or more variant urea catabolism genes comprise:

[0191] (i) a variant urease gene cluster;

[0192] (ii) a variant urea carboxylase gene; and / or

[0193] (iii) a valiant allophanate hydrolase gene. The genetically engineered bacterium of embodiment 1 or 2, wherein the genetically engineered bacterium is an endophytic bacterium. The genetically engineered bacterium of any one of embodiments 1-3, wherein the genetically engineered bacterium is Azorhizobium caulinodans. The genetically engineered bacterium of embodiment 4, wherein

[0194] (i) the variant urease gene cluster comprises a deletion of the re cluster,

[0195] (ii) the variant urea carboxylase gene comprises a deletion of the uc gene, and / or

[0196] (iii) the variant allophanate hydrolase gene comprises a deletion of the ah gene. The genetically engineered bacterium of any one of embodiments 1-5, further comprising an engineered nucleic acid encoding an arginase. The genetically engineered bacterium of embodiment 6, wherein the engineered nucleic acid comprises a rocF gene from Bacillus subtilis. The genetically engineered bacterium of embodiment 6 or 7, wherein the engineered nucleic acid encodes an arginase gene variant which is codon optimized and / or is operably linked to a heterologous regulatory sequence. The genetically engineered bacterium of any one of embodiments 1-8, further comprising an engineered nucleic acid encoding a carbamoyltransferase gene and / or a N-acetylglutamate synthetase gene. The genetically engineered bacterium of embodiment 9, wherein the carbamoyltransferase gene is encoded by the argl gene and / or the N-acetylglutamate synthetase gene is encoded by the argA gene. The genetically engineered bacterium of any one of embodiments 6-10, wherein the engineered nucleic acid comprises an operon, wherein the operon comprises at least two of: the arginase gene; the carbamoyltransferase gene; and the N-acctylglutamatc synthetase gene, wherein the at least two genes are operably linked to at least one heterologous regulatory sequence. The genetically engineered bacterium of embodiment 11, wherein the at least one heterologous regulatory sequence comprises an inducible promoter or a constitutive promoter. The genetically engineered bacterium of embodiment 12, wherein the inducible promoter comprises an IPTG-inducible promoter and the constitutive promoter comprises a nitrogenase complex constitutive promoter. The genetically engineered bacterium of embodiment 13, wherein the nitrogenase complex constitutive promoter comprises the nifH promoter. The genetically engineered bacterium of any one of embodiments 1-14, wherein the genetically engineered bacterium release more extracellular urea compared to a non-genetically engineered counterpart bacterium. 16. A bacterial cell population comprising one or more of the genetically engineered bacterium of any one of embodiments 1- 15.

[0197] 17. A composition comprising the genetically engineered bacterium of any one of embodiments 1-15 or the bacterial cell population of embodiment 16 and an agricultural carrier.

[0198] 18. The composition of embodiment 17, further comprising one or more cereal plant seeds and / or cereal plant soil.

[0199] 19. A method comprising delivering the genetically engineered bacterium of any one of embodiments 1-15, the bacterial cell population of embodiment 16, or the composition of embodiment 17 or 18 to a cereal plant or to soil where a cereal plant will be planted.

[0200] 20. The method of embodiment 19, wherein the genetically engineered bacteria provide fixed nitrogen in the form of urea to the cereal plant and / or the soil thereof.

[0201] 21. A genetically engineered bacterium comprising:

[0202] (i) an inactivating mutation in a urease gene cluster; and

[0203] (ii) an engineered nucleic acid comprising an arginase gene.

[0204] 22. The genetically engineered bacterium of embodiment 21, wherein the genetically engineered bacterium comprises one or more urease gene deletions.

[0205] 23. The genetically engineered bacterium of embodiment 21 or 22, wherein the genetically engineered bacterium further comprises: an inactivating mutation in a urea carboxylase gene; and / or an inactivating mutation in an allophanate hydrolase gene. The genetically engineered bacterium of any one of embodiments 21-23, wherein the genetically engineered bacterium comprises: a deletion of the ure cluster; a deletion of the uc gene; and / or a deletion of the ah gene. The genetically engineered bacterium of any one of embodiments 21-24, wherein the genetically engineered bacterium does not naturally express an arginase gene. The genetically engineered bacterium of any one of embodiments 21-25, wherein the arginase gene is codon optimized and / or operably linked to at least one regulatory sequence. The genetically engineered bacterium of embodiment 26, wherein the at least one regulatory sequence is heterologous to the arginase gene. The genetically engineered bacterium of any one of embodiments 21-27, wherein the at least one regulatory sequence comprises an inducible promoter or a constitutive promoter. The genetically engineered bacterium of embodiment 28, wherein the inducible promoter is capable of inducing expression of the arginase gene in the presence of an agent. The genetically engineered bacterium of embodiment 28 or 29, wherein the inducible promoter comprises an IPTG-inducible promoter and the constitutive promoter comprises a nitrogenase complex constitutive promoter. The genetically engineered bacterium of embodiment 30, wherein the nitrogenase complex constitutive promoter comprises the nifH promoter. The genetically engineered bacterium of any one of embodiments 21-31, wherein the arginase gene is a rocF gene. The genetically engineered bacterium of embodiment 32, wherein the rocF gene is a Bacillus subtilis rocF gene. The genetically engineered bacterium of any one of embodiments 21-33, wherein the genetically engineered bacterium further comprises a carbamoyltransferase gene and / or a N- acetylglutamate synthetase gene. The genetically engineered bacterium of any one of embodiments 21-34, wherein the engineered nucleic acid comprises an operon, wherein the operon comprises at least one heterologous regulatory sequence operably linked to at least two of: the arginase gene; a carbamoyltransferase gene; and a N-acetylglutamate synthetase gene. The genetically engineered bacterium of embodiment 34 or 35, wherein the carbamoyltransferase gene is an argl gene and / or the N-acetylglutamate synthetase gene is an argA gene. The genetically engineered bacterium of any one of embodiments 21-36, wherein the genetically engineered bacterium comprises one or more nif cluster genes. The genetically engineered bacterium of embodiment 37, wherein the one or more nif cluster genes are heterologous to the genetically engineered bacterium. The genetically engineered bacterium of embodiment 37 or 38, wherein the one or more nif cluster genes are operably linked to at least one heterologous regulatory sequence. The genetically engineered bacterium of embodiment 39, wherein the at least one heterologous regulatory sequence comprises an inducible promoter or a constitutive promoter. The genetically engineered bacterium of embodiment 40, wherein the inducible promoter is capable of inducing expression of an operably linked gene in the presence of an agent. The genetically engineered bacterium of any one of embodiments 21-41, wherein the genetically engineered bacterium comprises a refactored nif cluster. The genetically engineered bacterium of any one of embodiments 21-42, wherein the genetically engineered bacterium is an endophytic bacterium, an epiphytic bacterium, and / or a plant root- associated bacterium. The genetically engineered bacterium of any one of embodiments 21-43, wherein the genetically engineered bacterium is of the class a-proteobacteria, -proteobacteria, or y-proteobacteria. The genetically engineered bacterium of any one of embodiments 21-44, wherein the genetically engineered bacterium is a Rhizobia. The genetically engineered bacterium of any one of embodiments 21-45, wherein the genetically engineered bacterium is Azorhizobium caulinodans. The genetically engineered bacterium of any one of embodiments 21-46, wherein the genetically engineered bacterium release more extracellular urea compared to a non-genetically engineered counterpart bacterium. The genetically engineered bacterium of any one of embodiments 21-47, wherein the genetically engineered bacterium further comprises:

[0206] (iii) one or more genes involved in production of an insecticide;

[0207] (iv) one or more genes involved in production of a pesticide;

[0208] (v) one or more genes involved in production of a plant biofortification product;

[0209] (vi) one or more genes involved in production of a phytohormone; and / or

[0210] (vii) one or more genes involved in production of an allelopathic compound. A bacterial cell population comprising one or more of the genetically engineered bacterium of any one of embodiments 21-48. A composition comprising the genetically engineered bacterium of any one of embodiments 21- 48 or the bacterial cell population of embodiment 49 and an agricultural carrier. The composition of embodiment 50, wherein the composition comprises one or more plant seeds. The composition of embodiment 50 or 51, wherein the agricultural carrier comprises plant soil. The composition of any one of embodiments 50-52, wherein the one or more plant seeds comprise cereal plant seeds and / or the plant soil comprises cereal plant soil. A seed comprising the genetically engineered bacterium of any one of embodiments 21-48, the bacterial cell population of embodiment 49, or the composition of any one of embodiments 50-53. The seed of embodiment 54, wherein the seed is that of an edible plant. The seed of embodiment 54 or 55, wherein the seed is a cereal plant seed. A plant comprising the genetically engineered bacterium of any one of embodiments 21-48, the bacterial cell population of embodiment 49, or the composition of any one of embodiments 50-53. The plant of embodiment 57, wherein the genetically engineered bacterium is present on and / or in one or more tissues of the plant. The plant of embodiment 57 or 58, wherein the genetically engineered bacterium is comprised in the root system of the plant. The plant of any one of embodiments 57-59, wherein the plant is an edible plant. The plant of any one of embodiments 57-60, wherein the plant is a cereal plant. A method comprising delivering the genetically engineered bacterium of any one of embodiments 21-48, the bacterial cell population of embodiment 49, or the composition of any one of embodiments 50-53 to a plant, a plant seed, or to soil where a plant will be planted. A method comprising contacting a plant or a plant seed with soil that has been contacted with the genetically engineered bacterium of any one of embodiments 21-48, the bacterial cell population of embodiment 49, or the composition of any one of embodiments 50-53. The method of embodiment 62 or 63, wherein the method further comprises planting and / or growing the plant or the plant seed. A method comprising collecting a plant or a plant seed from soil that has been contacted with the genetically engineered bacterium of any one of embodiments 21-48, the bacterial cell population of embodiment 49, or the composition of any one of embodiments 50-53. The method of any one of embodiments 63-65, wherein the soil comprises the genetically engineered bacterium. The methods of any one of embodiments 62-66, wherein the plant is an edible plant, or the plant seed is that of an edible plant. The methods of any one of embodiments 62-67, wherein the plant is a cereal plant, or the plant seed is a cereal plant seed. The method of any one of embodiments 62-68, wherein the genetically engineered bacterium provides fixed nitrogen in the form of urea to the plant and / or the soil. The method of any one of embodiments 62-69, wherein the genetically engineered bacterium is an endophytic bacterium, an epiphytic bacterium, and / or a plant root-associated bacterium capable of becoming established in the plant. The method of any one of embodiments 62-70, wherein:

[0211] (a) the plant is wheat, amaranth, quinoa, buckwheat, rye, barley, rice, wild rice, maize, millet, sorghum, teff, fonio, oats, a pseudocereal, spelt, einkorn, emmer, kamut, durum, or triticale; or

[0212] (b) the plant seed is a wheat seed, an amaranth seed, a quinoa seed, a buckwheat seed, a rye seed, a barley seed, a rice seed, a wild rice seed, a maize seed, a millet seed, a sorghum seed, a teff seed, a fonio seed, an oat seed, a pseudocereal seed, a spelt seed, a einkorn seed, an emmer seed, a kamut seed, a durum seed, or atriticale seed. The method of any one of embodiments 62-71, wherein at least one heterologous regulatory sequence is operably linked to the engineered nucleic acid. The method of embodiment 72, wherein the engineered nucleic acid is operably linked to an inducible promoter, and wherein the method further comprises contacting the genetically engineered bacterium, the plant, the plant seed, and / or the soil with an agent capable of inducing expression of the arginase gene. The method of any one of embodiments 62-73, wherein the plant is a genetically engineered plant or a descendant thereof and / or the seed is a genetically engineered seed or a seed germinated from a genetically engineered plant.

Claims

CLAIMSWhat is claimed is:

1. A genetically engineered bacterium comprising:(i) an inactivating mutation in a urease gene cluster; and(ii) an engineered nucleic acid comprising an arginase gene.

2. The genetically engineered bacterium of claim 1, wherein the genetically engineered bacterium comprises one or more urease gene deletions.

3. The genetically engineered bacterium of claim 1 or 2, wherein the genetically engineered bacterium further comprises: an inactivating mutation in a urea carboxylase gene; and / or an inactivating mutation in an allophanate hydrolase gene.

4. The genetically engineered bacterium of any one of claims 1-3, wherein the genetically engineered bacterium comprises: a deletion of the ure cluster; a deletion of the uc gene; and / or a deletion of the ah gene.

5. The genetically engineered bacterium of any one of claims 1-4, wherein the genetically engineered bacterium does not naturally express an arginase gene.

6. The genetically engineered bacterium of any one of claims 1-5, wherein the arginase gene is codon optimized and / or operably linked to at least one regulatory sequence.

7. The genetically engineered bacterium of claim 6, wherein the at least one regulatory sequence is heterologous to the arginase gene.

8. The genetically engineered bacterium of any one of claims 1-7, wherein the at least one regulatory sequence comprises an inducible promoter or a constitutive promoter.

9. The genetically engineered bacterium of claim 8, wherein the inducible promoter is capable of inducing expression of the arginase gene in the presence of an agent.

10. The genetically engineered bacterium of claim 8 or 9, wherein the inducible promoter comprises an IPTG-inducible promoter and the constitutive promoter comprises a nitrogenase complex constitutive promoter.

11. The genetically engineered bacterium of claim 10, wherein the nitrogenase complex constitutive promoter comprises the nifH promoter.

12. The genetically engineered bacterium of any one of claims 1-11, wherein the arginase gene is a rocF gene.

13. The genetically engineered bacterium of claim 1 , wherein the rocF gene is a Bacillus subtilis rocF gene.

14. The genetically engineered bacterium of any one of claims 1-13, wherein the genetically engineered bacterium further comprises a carbamoyltransferase gene and / or a N- acetylglutamate synthetase gene.

15. The genetically engineered bacterium of any one of claims 1-14, wherein the engineered nucleic acid comprises an operon, wherein the operon comprises at least one heterologous regulatory sequence operably linked to at least two of: the arginase gene; a carbamoyltransferase gene; and a N-acetylglutamate synthetase gene.

16. The genetically engineered bacterium of claim 14 or 15, wherein the carbamoyltransferase gene is an argl gene and / or the N-acetylglutamate synthetase gene is an argA gene.

17. The genetically engineered bacterium of any one of claims 1-16, wherein the genetically engineered bacterium comprises one or more nif cluster genes.

18. The genetically engineered bacterium of claim 17, wherein the one or more nif cluster genes are heterologous to the genetically engineered bacterium.

19. The genetically engineered bacterium of claim 17 or 18, wherein the one or more nif cluster genes are operably linked to at least one heterologous regulatory sequence.

20. The genetically engineered bacterium of claim 19, wherein the at least one heterologous regulatory sequence comprises an inducible promoter or a constitutive promoter.

21. The genetically engineered bacterium of claim 20, wherein the inducible promoter is capable of inducing expression of an operably linked gene in the presence of an agent.

22. The genetically engineered bacterium of any one of claims 1-21, wherein the genetically engineered bacterium comprises a refactored nif cluster.

23. The genetically engineered bacterium of any one of claims 1-22, wherein the genetically engineered bacterium is an endophytic bacterium, an epiphytic bacterium, and / or a plant root- associated bacterium.

24. The genetically engineered bacterium of any one of claims 1-23, wherein the genetically engineered bacterium further comprises:(iii) one or more genes involved in production of an insecticide;(iv) one or more genes involved in production of a pesticide;(v) one or more genes involved in production of a plant biofortification product;(vi) one or more genes involved in production of a phytohormone; and / or(vii) one or more genes involved in production of an allelopathic compound.

25. A bacterial cell population comprising one or more of the genetically engineered bacterium of any one of claims 1-24.

26. A composition comprising the genetically engineered bacterium of any one of claims 1-24 or the bacterial cell population of claim 25 and an agricultural carrier.

27. A seed comprising the genetically engineered bacterium of any one of claims 1-24, the bacterial cell population of claim 25, or the composition of claim 26.

28. A plant comprising the genetically engineered bacterium of any one of claims 1-24, the bacterial cell population of claim 25, or the composition of claim 26.

29. A method comprising delivering the genetically engineered bacterium of any one of claims 1-24, the bacterial cell population of claim 25, or the composition of claim 26 to a plant, a plant seed, or to soil where a plant will be planted.

30. A method comprising contacting a plant or a plant seed with soil that has been contacted with the genetically engineered bacterium of any one of claims 1-24, the bacterial cell population of claim 25, or the composition of claim 26.

Images