Plasmid system for recombinant adeno-associated virus packaging and use thereof
By using recombinant enzyme systems, such as the Cre-lox system during rAAV production, the error packaging rate of the plasmid backbone nucleic acid sequence is reduced, the problem of low purity and titer of rAAV is solved, and the purity and drug properties of viral products are significantly improved.
Patent Information
- Application Number
- PCT/CN2024/130732
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-04
- Filing Date
- 2024-11-08
- Publication Date
- 2025-06-12
AI Technical Summary
During the production process of recombinant adeno-associated virus (rAAV), the plasmid backbone nucleic acid sequence is easily mispacked into the AAV virus capsid, resulting in a decrease in viral purity and titer, resulting in unpredictable side effects.
Using a recombinase system, by designing plasmids containing recombinase recognition site sequences and/or recombinase sequences, for example, using the Cre-lox system, loxP sites are inserted into the plasmid to reduce the error packaging rate of the plasmid backbone nucleic acid sequence.
It effectively reduces the residue of plasmid backbone nucleic acid sequence in rAAV and improves the purity and drug properties of viral products.
Smart Images

Figure CN2024130732_12062025_PF_FP_ABST
Abstract
Description
A plasmid system for packaging recombinant adeno-associated virus and its application Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a plasmid system for packaging recombinant adeno-associated virus and an application thereof. Background Art
[0002] As a gene therapy vector, recombinant adeno-associated virus (rAAV) has the characteristics of high safety and strong transduction ability. Currently, several rAAV-based gene therapy drugs are on the market, and many rAAV-based gene therapy clinical trials are underway. rAAV production systems mainly include plasmid transfection production systems based on HEK293 cells, production systems based on insect cells and baculovirus, and production systems based on HEK293 cells and adenovirus. The plasmid transfection production system based on HEK293 cells can be cultured in adherent and suspension cultures, and also includes single-plasmid or multi-plasmid transfection methods. It is simple and rapid, and is a widely used rAAV production system. Taking the classic three-plasmid transfection production system as an example, this production system involves the use of three plasmids to co-transfect HEK293 cells: an auxiliary plasmid pHelper, which provides nucleic acid sequences capable of expressing adenovirus element proteins; an auxiliary plasmid pRep-Cap, which provides nucleic acid sequences capable of expressing AAV's Rep and Cap proteins, where the Rep protein is responsible for the replication of the AAV genome and assists in the assembly of AAV genome particles, and the Cap protein constitutes the AAV shell; a plasmid including the target sequence, which can be abbreviated as pGOI, with a 5'ITR and 3'ITR sequence in the natural AAV genome upstream and downstream of the target sequence.
[0003] During the rAAV production process, the plasmid backbone nucleic acid sequence (ori nucleic acid sequence related to plasmid replication, resistance gene nucleic acid sequence related to plasmid screening, etc.) will be incorrectly packaged into the AAV virus capsid by ITR / ITR-like or random means, reducing the purity and titer of the rAAV virus, causing unpredictable side effects, and posing risks to gene therapy in vivo.
[0004] Summary of the Invention
[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a plasmid system for packaging recombinant adeno-associated virus and its application.
[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:
[0007] In the first aspect, the present invention provides a plasmid system for rAAV packaging, which comprises: a plasmid containing two terminal inverted repeat sequences, an adenovirus helper plasmid and an rAAV recombinant packaging plasmid; at least one of the plasmids containing two terminal inverted repeat sequences, the adenovirus helper plasmid and the rAAV recombinant packaging plasmid has a recombinase recognition site sequence and / or a recombinase sequence of the sequence inserted into it.
[0008] The plasmid system of the present invention adopts a recombinase system, which can effectively reduce the rate of erroneous packaging of non-rAAV-related sequences into the AAV viral capsid during the rAAV production process, reduce the residual plasmid backbone nucleic acid sequence in rAAV, and improve the purity of the rAAV product, thereby greatly improving the drugability of the rAAV product.
[0009] As a preferred embodiment of the plasmid system of the present invention, the recombinase comprises a tyrosine recombinase or a serine recombinase. As a preferred embodiment of the plasmid system of the present invention, the tyrosine recombinase comprises at least one recombinase from any one of the Cre-lox, FLP-FRT, Dre-rox, and R-RS systems; and the serine recombinase comprises at least one recombinase from any one of the CinH-RS2, ParA-MRS, β-six, γδ-res, phiC31, TP901-1, R4, and Bxb1 systems.
[0010] Site-specific recombinases can specifically recognize and mediate recombination between specific sites, thereby achieving mutations such as gene knockout, insertion, inversion, and ectopic sites at specific sites. Cre (cyclization recombinase) is a recombinase derived from the P1 bacteriophage. The catalytic activity contained in its C-terminus can catalyze the recombination of DNA molecules containing the loxP (locus of X-over in P1) site. The loxP site consists of two 13bp inverted palindromic sequences and an 8bp intermediate spacer sequence. The inverted palindromic sequence serves as the recognition and binding site for the Cre enzyme. By designing two oriented loxP site sequences in the region near the target DNA fragment on the circular plasmid backbone, the Cre enzyme recognizes the loxP sequences and recombines the plasmid to produce two small circular plasmids. This separates the target DNA fragment from the vector backbone, thereby reducing the probability of ITR / ITR-like mediating the packaging of the vector backbone.
[0011] As a preferred embodiment of the plasmid system of the present invention, the plasmid system comprises pGOI, pRep-Cap and pHelper inserted with the site sequence recognized by the recombinase. Preferably, the plasmid system comprises GOI, pRep-Cap and pHelper inserted with loxP.
[0012] As a preferred embodiment of the plasmid system of the present invention, the plasmid system comprises pGOI, pRep-Cap, and pHelper inserted with the recombinase recognition site sequence, and pAAVS1 inserted with the recombinase sequence. Preferably, the plasmid system comprises pGOI, pRep-Cap, and pHelper inserted with loxP, and pAAVS1 inserted with Cre.
[0013] As a preferred embodiment of the plasmid system of the present invention, the plasmid system comprises pGOI and pRep-Cap inserted with the recombinase recognition site sequence, and pHelper- inserted with the recombinase sequence. Preferably, the plasmid system comprises pGOI and pRep-Cap inserted with loxP, and pHelper inserted with Cre.
[0014] The plasmid pGOI includes ITR sequences from different serotypes and their optimized sequences. The plasmid pRep-Cap includes nucleic acid sequences expressing Rep protein and Cap protein from different serotypes and their optimized sequences. The plasmid pHelper includes nucleic acid sequences expressing adenovirus original proteins from different helper virus plasmids and their optimized sequences.
[0015] In a second aspect, the present invention provides a cell for rAAV production, wherein the cell stably expresses a recombinase; the cell comprises the plasmid system; the plasmid system comprises pGOI, pRep-Cap and pHelper inserted with a site sequence recognizing the recombinase.
[0016] Preferably, the recombinase is Cre recombinase; the plasmid system includes pGOI, pRep-Cap and pHelper inserted with loxP.
[0017] In a third aspect, the present invention provides a method for reducing the residual plasmid backbone nucleic acid sequence in rAAV, using the plasmid system to transfect packaging cells.
[0018] As a preferred embodiment of the method described in the present invention, the packaging cells include at least one of HEK293, HEK293T, HEK293F, HEK293A, Hela, Vero, CHO, and other cells used for rAAV production.
[0019] In a fourth aspect, the present invention applies the plasmid system and the cells in rAAV production.
[0020] Compared with the prior art, the present invention has the following beneficial effects:
[0021] The plasmid system of the present invention adopts a recombinase system. When rAAV is produced, the proportion of plasmid backbone nucleic acid sequences (ori nucleic acid sequences related to plasmid replication, resistance gene nucleic acid sequences related to plasmid screening, etc.) that are incorrectly packaged into the AAV virus capsid is greatly reduced, which can reduce the residual plasmid backbone nucleic acid sequences in rAAV, effectively improve the purity of the rAAV product, and thus greatly improve the drugability of the rAAV product. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 shows rAAV packaging after adding Cre recombinase to digest the plasmid in vitro;
[0023] Figure 1, panels a-c: In vitro Cre recombinase was added to digest the plasmid pGOI-loxP. The digested plasmid pGOI-loxP, pRep-Cap, and pHelper plasmids were used together for rAAV production (+Cre group). The pGOI, pRep-Cap, and pHelper plasmids were used for rAAV production (CT group). The rAAV packaging WPRE titer (a), ori titer (b), and reverse packaging efficiency (c) were measured. Panels d-f: The WPRE titer (d), ori titer (e), and reverse packaging efficiency (f) of the +Cre group compared to the control CT group.
[0024] Figure 2 is a map of the pAAVS1 plasmid.
[0025] Figure 3 shows the addition of pAAVS1 / Cre plasmid for rAAV packaging;
[0026] Figure 3 (a-c): rAAV production using the pGOI-loxP, pRep-Cap, pHelper, and pAAVS1 / Cre plasmids (+pCre group); rAAV production using the pGOI-loxP, pRep-Cap, pHelper, and pAAVS1 plasmids (EV group); WPRE titer (a), ori titer (b), and reverse packaging efficiency (c) of rAAV packaging. Figures d-f: WPRE titer (d), ori titer (e), and reverse packaging efficiency (f) of the +pCre group compared to the control EV group.
[0027] Figure 4 shows rAAV packaging after adding the Cre recombinase expression cassette nucleic acid sequence to the plasmid pHelper. In Figure 4, panels a-c show the pGOI-loxP, pRep-Cap, and pHelper / Cre plasmids used for rAAV production (+Cre group), and the pGOI-loxP, pRep-Cap, and pHelper plasmids used for rAAV production (EV group), with the WPRE titer (a), ori titer (b), and reverse packaging efficiency (c) of the rAAV packaging. Panels d-f show the WPRE titer (d), ori titer (e), and reverse packaging efficiency (f) of the +Cre group compared to the control EV group.
[0028] FIG5 shows rAAV packaging using Cre-KI cells stably expressing Cre recombinase;
[0029] Figure 5 (a-c) shows the WPRE titer (a), ori titer (b), and reverse packaging efficiency (c) of rAAV packaged in Cre-KI cells stably expressing Cre recombinase, transfected with pGOI-loxP, pRep-Cap, and pHelper plasmids (Cre-KI group). The WPRE titer (d), ori titer (e), and reverse packaging efficiency (f) of rAAV packaged in 293T cells transfected with pGOI, pRep-Cap, and pHelper plasmids (293T group) were compared with those in the Cre-KI group. DETAILED DESCRIPTION
[0030] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0031] Unless otherwise specified, the experimental methods used in the examples are conventional methods. Materials and reagents used are commercially available unless otherwise specified. The WPRE titer is the copy number of the target DNA fragment; the ori titer is the copy number of the vector backbone; and the reverse encapsulation rate is the ratio of the vector backbone copy number to the target DNA fragment copy number.
[0032] Example 1: rAAV packaging after in vitro addition of Cre recombinase to digest the plasmid
[0033] (1) Vector construction and plasmid extraction
[0034] Based on the sequence information of the Cre recombinase recognition site loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT) and the pGOI plasmid information (Addgene: 27970), a pair of chimeric primers containing the loxP sequence were designed for amplifying the vector backbone (loxP-VB-F: tcacaccgcatacgtcaaagcaaccATAACTTCGTATAGCATACATTATACGAAGTTATATagtacgcgccctgtagcg; loxP-VB-R: gaaccgtaaaaaggccgcgttgctgATAACTTCGTATAATGTATGCTATACGAAGTTATgcgtttttccataggctccg). Primers were also designed for amplifying the GOI fragment (GOI-F: cagcaacgcggcctttttacggttc; GOI-R: ggttgctttgacgtatgcggtgtga).
[0035] The pGOI plasmids were then amplified using loxP-VB-F / loxP-VB-R and GOI-F / GOI-R, respectively. The amplification system consisted of 25 μL of 2× KOD OnePCR Master Mix (ToYoBo, #KMM-101), 1.0 μL of 10 μM forward primer, 1.0 μL of 10 μM reverse primer, and 20 ng of DNA template, made up to 50 μL with sterile water. Amplification conditions were as follows: 95°C initial denaturation for 3 min; 98°C denaturation for 10 sec, 58°C annealing for 5 sec, and 68°C extension for 10 sec / kb (32 cycles); and 68°C extension for 3 min. After amplification, the target DNA fragments were excised and purified using the HiPure Gel Pure DNA Micro Kits (Megan, #D21111-03) to obtain the GOI and VB fragments.
[0036] Using the Gibson Assembly method, the two purified DNA fragments were ligated. The reaction system consisted of 15 μL of 3 / 4× Gibson Assembly Master Mix, 100 ng of the vector backbone fragment, and 100 ng of the GOI fragment, made up to 20 μL with sterile water. Mix thoroughly and incubate at 50°C for 30 minutes. The ligated DNA was transformed into XL10-Gold Chemically Competent Cells (Shanghai Weidi, #DL1050). After screening using LB medium containing ampicillin, single clones were selected and sent to Qingke Bio for sequencing. The resulting plasmid contained loxP sequences at the 5' end of the 5' ITR and the 3' end of the 3' ITR of the pGOI plasmid, designated pGOI-loxP.
[0037] Extract high-concentration, high-purity pGOI, pGOI-loxP, pRep-Cap, and pHelper plasmids. Add Cre recombinase (New England Biolabs, #M0298S) in vitro to reconstitute the pGOI-loxP plasmid. The recombination reaction system consists of: 5.0 μL 10× Cre Recombinase Buffer, 4.0 μL Cre Recombinase, 1.0 μg pGOI-loxP plasmid, and make up to 50 μL with sterile water. Enzyme digestion conditions are: incubation at 37°C for 50 minutes and 70°C for 10 minutes. After completion of the reaction, purify using HiPure Gel Pure DNA Micro Kits.
[0038] (2) rAAV packaging and titer determination
[0039] One day before transfection, 293T cells were suspended in DMEM medium and counted at 6×10 6 Cells / dish were evenly plated on a 10-cm cell culture dish and cultured at 37°C and 5% CO2 until the cell confluence was about 80%.
[0040] The plasmids of the CT group were: pGOI, pRep-Cap, pHelper; the plasmids of the +Cre group were: pGOI-loxP, pRep-Cap, pHelper after Cre recombinase recombination.
[0041] On the day of transfection, replace the culture medium with fresh DMEM. Add pGOI, pRep-Cap, and pHelper (CT group) and pGOI-loxP, pRep-Cap, and pHelper (+Cre group) recombined with Cre recombinase at a ratio of 2.0 μg: 2.5 μg: 2.5 μg, with three replicates per group. Mix the plasmid DNA with 0.5 mL of DMEM, and then mix 0.5 mL of DMEM with 8.4 μL of PEIpro. Then, add the PEIpro mixture to the DNA mixture and mix thoroughly. Let it stand at room temperature for 15 minutes. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for culture.
[0042] 72 hours after transfection, cells were lysed by adding 1% chloroform and collected into 50 mL centrifuge tubes. After nuclease digestion, the rAAV was concentrated and purified using PEG8000. After DNase I digestion, the purified rAAV was assayed for WPRE and ori titers by qRT-PCR. A standard curve was generated using serial dilutions of a plasmid standard. The WPRE and ori titers of the rAAV samples were calculated based on the standard curve.
[0043] pGOI-loxP, pRep-Cap and pHelper plasmids digested with Cre recombinase were added in vitro and used together for rAAV production (+Cre group). Compared with the rAAV production with pGOI, pRep-Cap and pHelper plasmids (CT group), the ratio of plasmid backbone reverse packaging into rAAV capsid (reverse packaging rate) in rAAV produced by +Cre group was reduced to 0.4 times that of control CT group.
[0044] Example 2: Adding pAAVS1 / Cre plasmid for rAAV packaging
[0045] (1) Vector construction and plasmid extraction
[0046] Cre recombinase sequence information (GenBank accession: AY056050) was obtained from the GeneBank database and gene synthesis was performed. Primers for amplifying the Cre fragment (Cre-F: ttacaaagacgatgacgataagATGTCCAATCTCCTGACTGTTCA; Cre-R: agcgagctctaggaattcttaTCAGTCACCATCTTCGAGCAGTC) and for amplifying the backbone of the pAAVS1 plasmid (the plasmid map is shown in Figure 2 , and the nucleotide sequence is shown in SEQ ID No. 1) (VB-F: tgataagaattcctagagctcgct; VB-R: catcttatcgtcatcgtctttgtaa) were designed.
[0047] Cre-F / Cre-R was used to amplify the Cre gene fragment, and VB-F / VB-R was used to amplify the pAAVS1 plasmid. The amplification system consisted of 25 μL of 2× KOD OnePCR Master Mix (TOYOBO, #KMM-101), 1.0 μL of 10 μM forward primer, 1.0 μL of 10 μM reverse primer, and 20 ng of DNA template, made up to 50 μL with sterile water. Amplification conditions were as follows: initial denaturation at 95°C for 3 min; denaturation at 98°C for 10 sec, annealing at 58°C for 5 sec, and extension at 68°C for 10 sec / kb (32 cycles); and extension at 68°C for 3 min. After amplification, the target DNA fragment was excised and purified using a 1.0% agarose gel using HiPure Gel Pure DNA Micro Kits (Megan, #D21111-03) to obtain the Cre gene fragment and the pAAVS1-VB fragment.
[0048] The two purified DNA fragments were ligated using the Gibson Assembly method. The reaction system consisted of 7.5 μL of 3 / 4× Gibson Assembly Master Mix, 100 ng of the Cre gene fragment, and 100 ng of the pAAVS1-VB fragment, made up to 10 μL with sterile water. Mix thoroughly and incubate at 50°C for 30 minutes. The ligated DNA was transformed into XL10-Gold Chemically Competent Cells and screened using LB medium containing ampicillin. Single clones were selected and sent to Qingke Bio for sequencing. The resulting plasmid, containing the Cre coding sequence inserted into the pAAVS1 plasmid, was named pAAVS1 / Cre.
[0049] Extract high-concentration and high-purity pGOI-loxP, pRep-Cap, pHelper, pAAVS1, and pAAVS1 / Cre plasmids.
[0050] (2) rAAV packaging and titer determination
[0051] One day before transfection, 293T cells were suspended in DMEM medium and counted at 6×10 6 Cells / dish were evenly plated on a 10-cm cell culture dish and cultured at 37°C and 5% CO2 until the cell confluence was about 80%.
[0052] The plasmids for the EV group were: pGOI-loxP, pRep-Cap, pHelper, and pAAVS1; the plasmids for the +Cre group were: pGOI-loxP, pRep-Cap, pHelper, and pAAVS1 / Cre.
[0053] On the day of transfection, replace the culture medium with fresh DMEM. Mix pGOI-loxP, pRep-Cap, pHelper, and pAAVS1 (EV group) and pGOI-loxP, pRep-Cap, pHelper, and pAAVS1 / Cre (+Cre group) at a ratio of 2.0 μg:2.5 μg:2.5 μg:0.5 μg, respectively, with three replicates per group. Mix the plasmid DNA with 0.5 mL of DMEM, and then mix 9.0 μL of PEIpro with 0.5 mL of DMEM. Add the PEIpro mixture to the DNA mixture and mix thoroughly. Let it stand at room temperature for 15 minutes. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for culture.
[0054] 72 hours after transfection, cells were lysed by adding 1% chloroform and collected into 50 mL centrifuge tubes. After nuclease digestion, the rAAV was concentrated and purified using PEG8000. After DNase I digestion, the purified rAAV was assayed for WPRE and ori titers by qRT-PCR. A standard curve was generated using serial dilutions of a plasmid standard. The WPRE and ori titers of the rAAV samples were calculated based on the standard curve.
[0055] Four plasmids, pGOI-loxP, pRep-Cap, pHelper, and pAAVS1 / Cre, were used for rAAV production (+Cre group). Compared with four plasmids, pGOI-loxP, pRep-Cap, pHelper, and pAAVS1, which were used for rAAV production (EV group), the ratio of plasmid backbone reverse packaging into rAAV capsid (reverse packaging rate) in rAAV produced by the +Cre group was reduced to 0.05 times that of the control EV group.
[0056] Example 3: rAAV packaging after adding the Cre recombinase expression cassette nucleic acid sequence to the plasmid pHelper
[0057] (1) Vector construction and plasmid extraction
[0058] Primers were designed to amplify a fragment containing the Cre expression cassette (pHel-Cre-F: acgtcgacgtttaaaccaCGTTACATAACTTACGGTAAATGG; pHel-Cre-R: gcctttgagtgagctgatcatatgTCCCCAGCATGCCTGCTATTCTC).
[0059] pAAVS1 / Cre was amplified using pHel-Cre-F / pHel-Cre-R. The amplification system consisted of 25 μL 2× KOD OnePCR Master Mix (ToYoBo, #KMM-101), 1.0 μL 10 μM forward primer, 1.0 μL 10 μM reverse primer, and 20 ng of DNA template, made up to 50 μL with sterile water. Amplification conditions were as follows: initial denaturation at 95°C for 3 min; denaturation at 98°C for 10 sec, annealing at 58°C for 5 sec, and extension at 68°C for 10 sec / kb (32 cycles); and extension at 68°C for 3 min. After amplification, the target DNA fragment was excised and purified using a HiPure Gel Pure DNA Micro Kit (Megan, D21111-03) to obtain the TelN expression cassette fragment.
[0060] The pHelper plasmid (GenBank: AF369965) was digested with NdeI (ThemoFisher Scientific, #FD0583). The digestion system consisted of 5.0 μL of 10× FastDigest buffer, 2.0 μL of NdeI enzyme, and 2.0 μg of pHelper plasmid, made up to 50 μL with sterile water. Digestion conditions were: incubation at 37°C for 30 min and 65°C for 5 min. After digestion, the DNA was purified using HiPure Gel Pure DNA Micro Kits.
[0061] Using the Gibson Assembly method, ligate the Cre expression cassette fragment to the digested pHelper. The reaction system consists of 15 μL of 3 / 4× Gibson Assembly Master Mix, 20 ng of digested pHelper, and 10 ng of the Cre expression cassette fragment, made up to 20 μL with sterile water. Mix thoroughly and incubate at 50°C for 30 minutes. Transform the ligated DNA into XL10-Gold Chemically Competent Cells and select using LB medium containing ampicillin. Single clones were selected and sent to Qingke Bio for sequencing. The resulting plasmid, containing the Cre expression cassette inserted into the pHelper plasmid, was named pHelper / Cre.
[0062] Extract high-concentration and high-purity pGOI-loxP, pRep-Cap, pHelper, and pHelper / Cre plasmids.
[0063] (2) rAAV packaging and titer determination
[0064] One day before transfection, 293T cells were suspended in DMEM medium and counted at 6×10 6 Cells / dish were evenly plated on a 10-cm cell culture dish and cultured at 37°C and 5% CO2 until the cell confluence was about 80%.
[0065] Set the plasmids for the EV group: pGOI-loxP, pRep-Cap, pHelper; the plasmids for the +Cre group: pGOI-loxP, pRep-Cap, pHelper / Cre.
[0066] On the day of transfection, replace the culture medium with fresh DMEM. Mix pGOI-loxP, pRep-Cap, pHelper (EV group) and pGOI-loxP, pRep-Cap, pHelper / Cre (+Cre group) at a ratio of 2.0 μg:2.5 μg:2.5 μg, respectively, with three replicates per group. Mix the plasmid DNA with 0.5 mL of DMEM, and then mix 0.5 mL of DMEM with 8.4 μL of PEIpro. Then, add the PEIpro mixture to the DNA mixture and let it stand at room temperature for 15 minutes. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for culture.
[0067] 72 hours after transfection, cells were lysed by adding 1% chloroform and collected into 50 mL centrifuge tubes. After nuclease digestion, the rAAV was concentrated and purified using PEG8000. After DNase I digestion, the purified rAAV was assayed for WPRE and ori titers by qRT-PCR. A standard curve was generated using serial dilutions of a plasmid standard. The WPRE and ori titers of the rAAV samples were calculated based on the standard curve.
[0068] The three plasmids pGOI-loxP, pRep-Cap, and pHelper / Cre were used for rAAV production (+Cre group). Compared with the three plasmids pGOI-loxP, pRep-Cap, and pHelper were used for rAAV production (EV group), the ratio of the plasmid backbone to be packaged into the rAAV capsid (package rate) in the rAAV produced by the +Cre group was reduced to 0.08 times that of the control EV group.
[0069] Example 4: rAAV packaging using Cre-KI cells
[0070] (1) Vector construction and plasmid extraction
[0071] Design sgAAVS1 primers targeting the AAVS1 locus (sgAAVS1-F: CACCtaaggaatctgcctaacagg; sgAAVS1-R: AACcctgttaggcagattcctta). Prepare a primer annealing system: 2.0 μL of 10 μM forward primer and 2.0 μL of 10 μM reverse primer, and make up to 20 μL with sterile water. Incubate at 98°C for 5 min and cool to room temperature.
[0072] The pX330 plasmid (Addgene: 42230) was digested with BpiI (ThemoFisher Scientific, #FD1014). The digestion system consisted of 5.0 μL of 10× FastDigest buffer, 2.0 μL of BpiI enzyme, and 2.0 μg of pX330 plasmid, made up to 50 μL with sterile water. Digestion conditions were: incubation at 37°C for 30 min and 65°C for 5 min. After digestion, the DNA was purified using HiPure Gel Pure DNA Micro Kits.
[0073] Prepare a DNA ligation reaction system: 1.0 μL 10× T4 DNA Ligase Buffer, 1.0 μL T4 DNA Ligase (TaKaRa, #6022), 0.5 μL pX330 digestion product, 2.0 μL annealed primers, and make up to 10 μL with sterile water. Mix thoroughly and incubate at 16°C for approximately 2 hours. Transform the ligated DNA into XL10-Gold Chemically Competent Cells and select using LB medium containing ampicillin. Single clones were selected and sent to Qingke Bio for sequencing. The resulting clone, containing the sgAAVS1 target site inserted into the pX330 plasmid, was designated pX330 / sgAAVS1.
[0074] Extract high-concentration and high-purity pGOI, pGOI-loxP, pRep-Cap, pHelper, pAAVS1 / Cre, and pX330 / sgAAVS1 plasmids.
[0075] (2) Cell transfection and screening
[0076] One day before transfection, 293T cells were suspended in DMEM medium and counted at 1×10 6Plate evenly per well of a 6-well cell culture plate. On the day of transfection, mix the pAAVS1 / Cre plasmid and the pX330 / sgAAVS1 plasmid at a ratio of 2.0 μg:1.0 μg. Add 6.0 μL of P3000 reagent and 125 μL of Opti-MEMI and mix thoroughly. In a separate microcentrifuge tube, add 3.75 μL of Lipofectamin 3000 and 125 μL of Opti-MEMI and mix thoroughly. Next, add the DNA-P3000 mixture to the Lipofectamin 3000 mixture, mix thoroughly, and incubate at room temperature for 15 minutes. Add the transfection mixture to the wells of a 6-well cell culture plate, mix gently, and incubate at 37°C, 5% CO2 for approximately 48–72 hours.
[0077] The transfected cells were collected, suspended in DMEM and counted. 6 Each well of a 6-well cell culture plate was seeded with Puro at a final concentration of 1.0 μg / mL and cultured for approximately 1-2 weeks at 37°C and 5% CO2. Single clones were then isolated and expanded in a 96-well cell culture plate, and the cells were labeled with Cre-KI.
[0078] (3) rAAV packaging and titer determination
[0079] One day before transfection, 293T and Cre-KI cells were suspended in DMEM medium and counted. 6 Cells / dish were evenly plated on a 10-cm cell culture dish and cultured at 37°C and 5% CO2 until the cell confluence was about 80%.
[0080] On the day of transfection, replace the culture medium with fresh DMEM. Mix pGOI, pRep-Cap, and pHelper (293T group) and pGOI-loxP, pRep-Cap, and pHelper (Cre-KI group) at a ratio of 2.0 μg:2.5 μg:2.5 μg, respectively, with three replicates per group. Mix the plasmid DNA with 0.5 mL of DMEM, and then mix 8.4 μL of PEIpro with 0.5 mL of DMEM. Add the PEIpro mixture to the DNA mixture and mix thoroughly. Let it stand at room temperature for 15 minutes. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for culture.
[0081] 72 hours after transfection, cells were lysed by adding 1% chloroform and collected into 50 mL centrifuge tubes. After nuclease digestion, rAAV was concentrated and purified using PEG8000. Purified rAAV was digested with DNase I, and WPRE and ori titers were determined by qRT-PCR. A standard curve was generated using serial dilutions of a plasmid standard. Based on the standard curve, the WPRE and ori titers of the rAAV samples were calculated.
[0082] Cre-KI cells, stably expressing Cre recombinase, were transfected with the pGOI-loxP, pRep-Cap, and pHelper plasmids for rAAV production (Cre-KI group). 293T cells were transfected with the pGOI, pRep-Cap, and pHelper plasmids for rAAV production (293T group). In rAAV produced in the Cre-KI group, the ratio of plasmid backbone encapsidation into rAAV capsids (encapsulation efficiency) was reduced to 0.12-fold compared to the control 293T group.
[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A plasmid system for packaging recombinant adeno-associated virus, characterized in that: The plasmid system comprises: a plasmid containing two terminal inverted repeat sequences, an adenovirus helper plasmid and an rAAV recombinant packaging plasmid; a recombinase recognition site sequence and / or a recombinase sequence of the sequence are inserted into at least one of the plasmids containing two terminal inverted repeat sequences, the adenovirus helper plasmid and the rAAV recombinant packaging plasmid.
2. The plasmid system according to claim 1, characterized in that The recombinase includes tyrosine recombinase or serine recombinase.
3. The plasmid system according to claim 2, characterized in that The tyrosine recombinase includes at least one recombinase in any one of the systems of Cre-lox, FLP-FRT, Dre-rox, and R-RS; the serine recombinase includes at least one recombinase in any one of the systems of CinH-RS2, ParA-MRS, β-six, γδ-res, phiC31, TP901-1, R4, and Bxb1.
4. The plasmid system according to claim 1 or 2, characterized in that The plasmid system comprises pGOI, pRep-Cap and pHelper into which the site sequence recognized by the recombinase is inserted.
5. The plasmid system according to claim 1 or 2, characterized in that The plasmid system comprises pGOI, pRep-Cap and pHelper inserted with the site sequence recognized by the recombinase and pAAVS1 inserted with the recombinase sequence.
6. The plasmid system according to claim 1 or 2, characterized in that The plasmid system comprises pGOI and pRep-Cap inserted with the site sequence recognized by the recombinase, and pHelper inserted with the recombinase sequence.
7. A cell for rAAV production, characterized in that The cell stably expresses the recombinase; the cell comprises the plasmid system according to claim 4.
8. A method for reducing the residual plasmid backbone nucleic acid sequence in rAAV, characterized in that: The packaging cells are transfected using the plasmid system according to any one of claims 1 to 6.
9. The method according to claim 8, characterized in that The packaging cells include at least one of HEK293, HEK293T, HEK293F, HEK293A, Hela, Vero, and CHO.
10. Use of the plasmid system according to any one of claims 1 to 6 and the cell according to claim 7 in rAAV production.
Citation Information
Patent Citations
Methods for adeno-associated viral vector production
CN110785495A
Adenovirus packaging method
CN111733184A
Plasmid system for producing recombinant adeno-associated virus
CN116411024A
Plasmid system for packaging recombinant adeno-associated virus and application of plasmid system
CN117683797A
Recombinant AAV packaging systems
US20020058325A1