Recombinant antigen protein for preventing acute hepatopancreatic necrosis disease in shrimp and vaccine composition comprising same
Recombinant antigen proteins targeting PirA and PirB toxins from Vibrio parahaemolyticus, combined with MBP and histidine tags, address the challenge of AHPND in shrimp farming by stimulating an immune response and reducing mortality, offering an antibiotic-free solution.
Patent Information
- Application Number
- PCT/KR2025/001714
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-05
- Filing Date
- 2025-02-05
- Publication Date
- 2026-05-15
AI Technical Summary
The rapid spread of Acute Hepatopancreatic Necrosis Disease (AHPND) in shrimp farming, caused by Vibrio parahaemolyticus bacteria, leads to high mortality rates and has been difficult to manage with existing methods, particularly due to antibiotic resistance issues.
Development of recombinant antigen proteins comprising PirA or PirB toxins of Vibrio parahaemolyticus, combined with a maltose-binding protein (MBP) and a histidine tag, expressed in a vector system and administered as a vaccine or feed additive to stimulate an immune response in shrimp.
The recombinant antigen proteins effectively prevent AHPND by inducing an immune response, reducing shrimp mortality and providing an alternative to antibiotics, while maintaining stability and growth performance.
Smart Images

Figure KR2025001714_15052026_PF_FP_ABST
Abstract
Description
Recombinant antigen protein for the prevention of acute hepatopancreatic necrosis in shrimp and vaccine composition containing the same
[0001] The present application relates to a recombinant antigen protein for the prevention of acute hepatopancreatic necrosis disease in shrimp and a vaccine composition containing the same.
[0002] Acute hepatopancreatic necrosis disease (AHPND) is a disease that has recently surged in shrimp farming. Caused by Vibrio parahaemolyticus bacteria, it produces insect toxins that cause up to 100% mortality within as little as six hours or one week. These insect toxins are produced through the expression of specific genes present in a particular plasmid (Photorhabdus insect-related toxins, Pir toxin) within the bacteria; consequently, because the bacteria are motile and can easily move from place to place, this disease spreads much faster than viral shrimp diseases that have previously attracted attention, such as White Spot Virus (WSSV), Tauravirus (TSV), and Infectious Myonecrosis Virus (IMNV). AHPND originated in China in 2009 and rapidly spread to various Asian countries, including Thailand, Malaysia, and Vietnam, within a year. Outside of Asia, it emerged in Mexico and spread to other Central American countries, causing significant damage to the majority of the shrimp market. In Korea, it first occurred in 2015–2016 and caused significant damage, and research is currently underway for the prevention and management of this disease. The excessive use of antibiotics to manage AHPND has led to antibiotic resistance, making it urgent to find an alternative.
[0003] Although it has been known that shrimp, which are invertebrates, lack an adaptive immune response, research results have been reported since the late 1980s indicating that vibriosis in cultured shrimp was prevented by vaccination (Itami T. Takahashi Y. Nakamura Y (1989) Efficacy of vaccination against vibriosis in cultured kuruma prawns Penaeus japonicus. Journal of Aquatic Animal Health, 1: 234-242.;).
[0004] Against this technological backdrop, there is a growing need for the development of immune boosters or feed additives capable of effectively preventing AHPND, but the current situation remains inadequate.
[0005] One aspect provides a recombinant antigen protein comprising PirA (Photorhabdus insect-related toxin A) or PirB (Photorhabdus insect-related toxin B), which are toxin proteins of Vibrio parahaemolyticus; a maltose-binding protein (MBP); and a histidine tag.
[0006] One aspect provides a recombinant PirA protein comprising PirA (Photorhabdus insect-related toxin A), a toxin protein of Vibrio parahaemolyticus; a maltose-binding protein (MBP); and a histidine tag.
[0007] One aspect provides a recombinant PirB protein comprising PirB (Photorhabdus insect-related toxin B), a toxin protein of Vibrio parahaemolyticus; a maltose-binding protein (MBP); and a histidine tag.
[0008] Another aspect provides a recombinant expression vector comprising: a polynucleotide sequence encoding PirA or PirB, which are toxin proteins of Vibrio parahaemolyticus; a polynucleotide sequence encoding a maltose-binding protein (MBP); and a polynucleotide sequence encoding a histidine tag.
[0009] Another aspect is to provide host cells transformed with the aforementioned recombinant expression vector.
[0010] Another aspect is to provide a composition comprising the recombinant PirA protein, the recombinant PirB protein, or a combination thereof.
[0011] Another aspect provides a vaccine composition for the prevention of acute hepatopancreatic necrosis disease (AHPND) in shrimp comprising the recombinant PirA protein, the recombinant PirB protein, or a combination thereof.
[0012] Another aspect is to provide a shrimp feed additive comprising the above-mentioned vaccine composition.
[0013] Another aspect provides the use of a composition comprising the recombinant PirA protein, the recombinant PirB protein, or a combination thereof for the preparation of a vaccine or vaccine composition for preventing acute hepatopancreatic necrosis disease (AHPND) in shrimp.
[0014] Another aspect provides the use of a composition comprising the recombinant PirA protein, the recombinant PirB protein, or a combination thereof, for the manufacture of a feed additive for preventing acute hepatopancreatic necrosis disease (AHPND) in shrimp.
[0015] Another aspect provides a method for preventing Acute Hepatopancreatic Necrosis Disease (AHPND) in shrimp or preventing shrimp mortality caused by AHPND, comprising the step of administering an effective amount of a composition containing the recombinant PirA protein, the recombinant PirB protein, or a combination thereof to an individual in need thereof.
[0016] One aspect provides a recombinant antigen protein comprising PirA (Photorhabdus insect-related toxin A) or PirB (Photorhabdus insect-related toxin B), which are toxin proteins of Vibrio parahaemolyticus; a maltose-binding protein (MBP); and a histidine tag. Specifically, one aspect provides a recombinant PirA protein comprising PirA (Photorhabdus insect-related toxin A), which are toxin proteins of Vibrio parahaemolyticus; a maltose-binding protein (MBP); and a histidine tag. One aspect provides a recombinant PirB protein comprising PirB (Photorhabdus insect-related toxin B), which are toxin proteins of Vibrio parahaemolyticus; a maltose-binding protein (MBP); and a histidine tag.
[0017] The term “recombinant antigen protein” may be used interchangeably with the terms “recombinant antigen” or “recombinant protein.”
[0018] Acute Hepatopancreatic Necrosis of the Nerve (AHPND), a concern in shrimp farming, is caused by strains of Vibrio parahaemolyticus. PirA and PirB, proteins encoded by plasmids in V. parahaemolyticus, are known as major toxic factors that induce AHPND. The aforementioned PirA or PirB proteins may be known amino acid sequences derived from Vibrio parahaemolyticus, and may be identical to, for example, the sequences of PirA (accession number: KM067908.1) and PirB (accession number: KP324996.1) provided by NCBI.
[0019] The above MBP (Maltose-binding Protein) is a protein involved in transporting and degrading maltodextrin and can be bound for the expression of an active recombinant antigen protein, enabling the expression of the recombinant antigen protein not only in cell lysates but also in the form of a water-soluble protein. In one embodiment, the MBP may be connected to the N-terminus of the toxin protein of PirA or PirB. The MBP may be a known MBP sequence, for example, a sequence registered in Genbank No. EF431917 may be used.
[0020] The above histidine-tag may be a polyhistidine-tag and may be 3 to 10, for example, 3, 4, 5, 6, 7, 8, 9, or 10 histidine-tags (3X HIS, 4X HIS, 5X HIS, 6X HIS, 7X HIS, 8X HIS, 9X HIS, 10X HIS). In one embodiment, the histidine-tag may be connected to the N-terminus of PirA or PirB. Specifically, the histidine-tag may be connected to the N-terminus of MBP. More specifically, the recombinant antigen protein may be formed by connecting the histidine-tag, MBP, and PirA or PirB in sequence from the N-terminus to the C-terminus.
[0021] In one embodiment, the recombinant antigen protein may be a recombinant PirA protein or a recombinant PirB protein, specifically, a fusion protein of 6XHis-MBP-PirA or 6XHis-MBP-PirB. The 6XHis-MBP-PirA recombinant protein may include or be composed of the amino acid sequence of SEQ ID NO. 9. The 6XHis-MBP-PirA recombinant protein may have at least 80%, e.g., 85%, 90%, 95%, 97%, or 98% sequence identity with the amino acid sequence of SEQ ID NO. 9. The 6XHis-MBP-PirB recombinant protein may include or be composed of the amino acid sequence of SEQ ID NO. 10. The above 6XHis-MBP-PirB recombinant protein may have at least 80%, for example, 85%, 90%, 95%, 97%, or 98% sequence identity with the amino acid sequence of SEQ ID NO. 9.
[0022] The term "sequence identity" refers to the degree of similarity of amino acid residues or bases between sequences after aligning both sequences to match as closely as possible in a specific comparison region. Sequence identity can be verified according to methods known in the art. The percentage of sequence identity can be determined using known sequence comparison programs, such as NCBI's BLAST.
[0023]
[0024] Another aspect provides a recombinant expression vector comprising: a polynucleotide sequence encoding PirA or PirB, which are toxin proteins of Vibrio parahaemolyticus; a polynucleotide sequence encoding a maltose-binding protein (MBP); and a polynucleotide sequence encoding a histidine tag.
[0025] A recombinant expression vector according to one aspect may include a conventional promoter sequence, a translation initiation sequence, and a terminator sequence to enable the expression of a recombinant antigen protein. For example, the recombinant expression vector may be pHis6-MBP_PirA and pHis6-MBP_PirB as shown in FIGS. 1a and 1b.
[0026] The recombinant expression vector may produce a recombinant antigen protein of 6XHis-MBP-PirA or 6XHis-MBP-PirB. The recombinant expression vector may include a polynucleotide sequence encoding a recombinant antigen protein of 6XHis-MBP-PirA or 6XHis-MBP-PirB. In one embodiment, the recombinant expression vector may include a variant sequence having at least 80%, e.g., 85%, 90%, 95%, 97%, or 98% sequence identity with the polynucleotide sequence of SEQ ID NO. 11. In one embodiment, the recombinant expression vector may include the polynucleotide sequence of SEQ ID NO. 12, or a variant sequence having at least 80%, for example, 85%, 90%, 95%, 97%, or 98% sequence identity with the nucleotide sequence of SEQ ID NO. 12.
[0027]
[0028] Another aspect provides a host cell transformed with the above-mentioned recombinant expression vector.
[0029] The term “transformation” may use known methods for introducing nucleic acids into an organism, cell, tissue, or organ, and may be performed by selecting an appropriate available technique depending on the host cell within the scope understood by those skilled in the art. Such methods include, but are not limited to, the heat shock method, electroporation, protoplasmic fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, stirring using silicon carbide fibers, Agrobacterium-mediated transformation, PEG, dextran sulfate, lipofectamine, etc.
[0030] In one embodiment, the host cell may be one selected from the group consisting of Escherichia coli, Pseudomonas, Bacillus, Streptomyces, fungi, and yeast, and preferably may be Escherichia coli. The Escherichia coli may be DH5α or BL21(DE3).
[0031]
[0032] Another aspect provides a composition comprising the recombinant PirA protein, the recombinant PirB protein, or a combination thereof. Another aspect provides a vaccine composition for preventing acute hepatopancreatic necrosis disease (AHPND) in shrimp comprising the recombinant antigen protein. Specifically, it may provide a vaccine composition for preventing acute hepatopancreatic necrosis disease (AHPND) in shrimp comprising the recombinant PirA protein, the recombinant PirB protein, or a combination thereof. The recombinant PirA protein may be a fusion protein of 6XHis-MBP-PirA, and the recombinant PirB protein may be a fusion protein of 6XHis-MBP-PirB.
[0033] The above vaccine composition may be a composition for preventing mortality caused by shrimp AHPND. For example, the above vaccine composition may be an immunogenic composition.
[0034] The term "prevention" refers to any action taken to block the occurrence of a disease in advance, suppress it, or delay its progression. For example, it refers to preventing the occurrence of a disease or its characteristic features, hindering its occurrence, or defending against or protecting against the occurrence of a disease or its characteristic features.
[0035] In one embodiment, the shrimp may be a shrimp of the genus Penaeus, for example, whiteleg shrimp (Penaeus vannamei), tiger shrimp (Penaeus monodon), kuruma shrimp (Penaeus japonicus), etc.
[0036] In one embodiment, the composition or vaccine composition may contain 0.5 μg to 30 μg of the recombinant PirA protein based on 1 g by weight, for example, 0.5 μg to 20 μg, 0.5 μg to 15 μg, 0.5 μg to 13 μg, 0.5 μg to 12.5 μg, 0.5 μg to 10 μg, 0.5 μg to 8 μg, 0.5 μg to 6 μg, 0.5 μg to 4 μg, 0.5 μg to 3 μg, 0.5 μg to 2.5 μg, 0.5 μg to 2 μg, 0.5 μg to 1.5 μg, 0.5 μg to 1.3 μg, 0.5 μg to 1.25 μg, 1 μg to 20 μg, 1 μg to 15 μg, 1 μg to 13 μg, 1 μg to 12.5 μg, 1 μg to 10 µg, 1 µg to 8 µg, 1 µg to 6 µg, 1 µg to 4 µg, 1 µg to 3 µg, 1 µg to 2.5 µg, 1 µg to 2 µg, 1 µg to 1.5 µg, 1 µg to 1.3 µg, 1 µg to 1.25 µg, 1.2 µg to 20 µg, 1.2 µg to 15 µg, 1.2 µg to 13 µg, 1.2 µg to 12.5 µg, 1.2 µg to 10 µg, 1.2 µg to 8 µg, 1.2 µg to 6 µg, 1.2 µg to 4 µg, 1.2 µg to 3 µg, 1.2 µg to 2.5 µg, 1.2 µg to 2 µg, 1.2 µg to 1.5 µg, 1.2 µg to 1.3 µg, 1.2 µg to 1.25 µg, It may be 1.25 µg to 20 µg, 1.25 µg to 15 µg, 1.25 µg to 13 µg, 1.25 µg to 12.5 µg, 1.25 µg to 10 µg, 1.25 µg to 8 µg, 1.25 µg to 6 µg, 1.25 µg to 4 µg, 1.25 µg to 3 µg, 1.25 µg to 2.5 µg, 1.25 µg to 2 µg, 1.25 µg to 1.5 µg, or 1.25 µg to 1.3 µg.
[0037] In one embodiment, the composition or vaccine composition may contain 2 µg to 120 µg of the recombinant PirB protein based on 1 g by weight, for example, 2 µg to 100 µg, 2 µg to 80 µg, 2 µg to 60 µg, 2 µg to 50 µg, 2 µg to 40 µg, 2 µg to 30 µg, 2 µg to 20 µg, 2 µg to 15 µg, 2 µg to 10 µg, 2 µg to 8 µg, 2 µg to 5 µg, 3.5 µg to 100 µg, 3.5 µg to 80 µg, 3.5 µg to 60 µg, 3.5 µg to 50 µg, 3.5 µg to 40 µg, 3.5 µg to 30 µg, 3.5 µg to 20 µg, 3.5 µg to 15 µg, 3.5 µg to 10 µg, 3.5 µg It may be up to 8 µg, 3.5 µg to 5 µg, 5 µg to 120 µg, 5 µg to 100 µg, 5 µg to 80 µg, 5 µg to 60 µg, 5 µg to 50 µg, 5 µg to 40 µg, 5 µg to 30 µg, 5 µg to 20 µg, 5 µg to 15 µg, 5 µg to 10 µg, or 5 µg to 8 µg.
[0038] In one embodiment, the weight ratio of the recombinant PirA protein and the recombinant PirB protein may be 1:1 to 20, for example, 1:1 to 16, 1:1 to 14, 1:1 to 12, 1:1 to 10, 1:1 to 8, 1:1 to 7, 1:1 to 6, 1:1 to 5, 1:1 to 4.5, 1:1 to 4, 1:1 to 3, 1:1.5 to 16, 1:1.5 to 14, 1:1.5 to 12, 1:1.5 to 10, 1:1.5 to 8, 1:1.5 to 7, 1:1.5 to 6, 1:1.5 to 5, 1:1.5 to 4.5, 1:1.5 to 4, 1:1.5 to 3, 1:2 to 20, 1:2 to 16, 1:2 to 14, 1:2 to 12, 1:2 to 10, 1:2 to 8, 1:2 to 7, 1:2 to 6, 1:2 to 5, 1:2 to 4.5, 1:2 to 4, 1:2 to 3, 1:3 to 20, 1:3 to 16, 1:3 to 14, 1:3 to 12, 1:3 to 10, 1:3 to 10, 1:3 to 8, 1:3 to 7, 1:3 to 6, 1:3 to 5, 1:3 to 4.5, 1:3 to 4, 1:3.5 to 20, 1:3.5 to 16, 1:3.5 to 14, It may be 1:3.5 to 12, 1:3.5 to 10, 1:3.5 to 8, 1:3.5 to 7, 1:3.5 to 6, 1:3.5 to 5, 1:3.5 to 4.5, or 1:3.5 to 4.
[0039] In one embodiment, the molar ratio of the recombinant PirA protein and the recombinant PirB protein may be 1:0.5 to 3, for example, 1:0.5 to 2.5, 1:0.5 to 2, 1:0.5 to 1.5, 1:0.5 to 1.3, 1:0.5 to 1, 1:0.7 to 3, 1:0.7 to 2.5, 1:0.7 to 2, 1:0.7 to 1.5, 1:0.7 to 1.3, 1:0.7 to 1, or 1:1.
[0040] The above composition or vaccine composition may further comprise an adjuvant or a known carrier or additive acceptable for pharmaceutical, food, or feed use. The pharmaceutically acceptable carrier may facilitate the storage of the immunogen and the administration of the immunogen to an individual. The pharmaceutically acceptable carrier may include components such as buffer solution, sterile water, ordinary saline or phosphate-buffered saline, sucrose, histidine, salts, and polysorbates. The additive may include binders, emulsifiers, preservatives, antimicrobial agents, etc., added to prevent quality degradation, and may include amino acids, vitamins, minerals, enzymes, flavorings, antioxidants, etc., added to the feed to enhance efficacy. In addition, it may further comprise feed mixers, etc., but is not limited thereto.
[0041] The dosage of the above composition or vaccine composition may be appropriately determined by the experience of a person skilled in the art, and may be appropriately determined according to the weight, age, health condition, diet, excretion rate and severity of the disease of the shrimp, etc.
[0042] The duration of administration of the above composition or vaccine composition may be appropriately determined by the experience of a person with ordinary knowledge in the relevant technical field, and may be administered for 1 to 5 weeks, for example, 1 to 4 weeks, 1 to 3 weeks, 1 to 2 weeks, 1 to 10 weeks, 2 to 5 weeks, 2 to 4 weeks, 2 to 3 weeks, 3 to 5 weeks, or 3 to 4 weeks, or 5 weeks or less, 4 weeks or less, 3 weeks or less, 2 weeks or less, or 1 week or less.
[0043]
[0044] Another aspect is to provide a shrimp feed additive comprising the above-described vaccine composition. In one embodiment, the feed additive may be coated on the surface of the feed or may be mixed together during the production of the feed. Since the feed additive contains or utilizes the aforementioned recombinant antigen protein or vaccine composition as is, the common details between them are omitted to avoid excessive complexity in this specification.
[0045] The above feed additive may be powder feed, solid feed, moist pellet feed, dry pellet feed, EP (Extruder Pellet) feed, raw feed, etc., but is not limited thereto, and the feed additive of the present invention may be supplied to a monogastric animal alone or mixed with feed.
[0046]
[0047] Another aspect provides a method for preventing Acute Hepatopancreatic Necrosis Disease (AHPND) in an individual, comprising the step of administering an effective amount of the recombinant antigen protein; the vaccine composition; or the composition comprising the recombinant PirA protein, the recombinant PirB protein, or a combination thereof to an individual in need thereof. Since the method comprises or utilizes the aforementioned recombinant antigen protein, composition, or vaccine composition as is, the description of the common details among them is omitted to avoid excessive complexity in this specification.
[0048] The term “individual” may refer to aquacultureable fish or crustaceans excluding humans who have developed or are likely to develop acute hepatopancreatic necrosis disease, but for the purposes of the present invention, it may refer to shrimp. The individual may be an individual that requires the expression of a target protein or the induction of a specific response following the expression of a target protein, for example, an effect of stimulating an acquired immune response.
[0049] The term "administering" may mean the placement of a recombinant antigen protein according to one embodiment into an individual by a method or route that results in at least partial localization of the recombinant antigen protein according to one embodiment to a desired site.
[0050] The term "effective amount" refers to an amount effective enough to produce the effect mentioned above.
[0051] The step of administering to an individual the above-mentioned recombinant antigen protein; the above-mentioned vaccine composition; or the above-mentioned recombinant PirA protein, the above-mentioned recombinant PirB protein, or a combination thereof refers to vaccination, and may mean the step of administering a vaccine through the administration of the above-mentioned recombinant antigen protein. The route of administration of the above-mentioned recombinant antigen protein, vaccine composition, or composition may be oral administration. The above-mentioned feed may be supplied in the same amount and at the same feeding interval as conventional feed.
[0052]
[0053] Another aspect provides a use of a composition comprising the recombinant PirA protein, the recombinant PirB protein, or a combination thereof for the manufacture of a vaccine or vaccine composition for preventing Acute Hepatopancreatic Necrosis Disease (AHPND) in shrimp. Another aspect provides a use of a composition comprising the recombinant PirA protein, the recombinant PirB protein, or a combination thereof for the manufacture of a feed additive for preventing Acute Hepatopancreatic Necrosis Disease (AHPND) in shrimp. Since the above uses include or utilize the aforementioned recombinant antigen protein, composition, or vaccine composition as is, common details among them are omitted to avoid excessive complexity in this specification.
[0054] Recombinant antigen proteins according to one aspect can maintain stability under seawater treatment conditions and not only do not affect the growth of shrimp but can also significantly reduce shrimp mortality, so they can be usefully used as immune enhancers or feed additives in shrimp farming.
[0055] Figure 1a is a vector map of a recombinant expression vector pHis6-MBP_PirA containing a polynucleotide encoding a 6XHis-MBP-PirA recombinant protein according to one aspect; and Figure 1b is a vector map of a recombinant expression vector pHis6-MBP_PirB containing a polynucleotide encoding a 6XHis-MBP-PirB recombinant protein according to one aspect.
[0056] FIG. 2a is a vector map of a recombinant expression vector pET28a(+)_PirA containing a polynucleotide encoding a 6XHis-PirA recombinant protein according to one aspect; and FIG. 2b is a vector map of a recombinant expression vector pET28a(+)_PirB containing a polynucleotide encoding a 6XHis-PirB recombinant protein according to one aspect.
[0057] Figure 3 shows the results of SDS-PAGE analysis performed on E. coli transformed with recombinant expression vectors (pHis6-MBP_PirA, pHis6-MBP_PirB, pET28a(+)_PirA, pET28a(+)_PirB) according to one pattern, cultured under high temperature conditions after IPTG induction, lysed, and separated into whole cell lysate (Total fraction), soluble fraction, and insoluble fraction.
[0058] Figure 4 shows the results of SDS-PAGE analysis performed on E. coli transformed with recombinant expression vectors (pHis6-MBP_PirA, pHis6-MBP_PirB, pET28a(+)_PirA, pET28a(+)_PirB) according to one aspect, cultured under low temperature conditions after IPTG induction, lysed, and separated into whole cell lysate (Total fraction), soluble fraction, and insoluble fraction.
[0059] Figure 5a shows the results of confirming the recombinant protein by performing SDS-PAGE analysis after purifying the recombinant antigen protein produced from E. coli transformed with recombinant expression vectors (pHis6-MBP_PirA, pHis6-MBP_PirB, pET28a(+)_PirA, pET28a(+)_PirB) according to one aspect; Figure 5b shows the results of measuring the recovery rate by protein quantification.
[0060] Figure 6 shows the results of evaluating long-term storage stability, seawater salinity condition stability, and high temperature stability for four types of recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, 6XHis-PirB).
[0061] Figure 7 shows the results of evaluating the survival rate after feeding whiteleg shrimp with recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein at low or high concentrations, or after feeding them with recombinant 6XHis-PirA protein and recombinant 6XHis-PirB protein at low or high concentrations, and then challenging them with a Vibrio parahaemolyticus strain that produces PirA and PirB toxins causing AHPND.
[0062] Figure 8a is a graph showing the results of evaluating the survival rate 96 hours after challenge with Vibrio parahaemolyticus strains that produce PirA and PirB toxins causing AHPND, following oral administration of recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein to whiteleg shrimp at different concentrations (0.5X, 1.0X, 5.0X) and antigen feeding periods (1 week, 2 weeks, or 4 weeks); Figure 8b is a table showing the results.
[0063] Figure 9 shows the results of the survival rate evaluation of Figure 8a according to antigen feed concentration.
[0064] Figure 10 shows the results of the survival rate evaluation of Figure 8a, categorized by antigen level and period.
[0065] Figure 11 shows the results of evaluating the survival rate after 10 days when whiteleg shrimp were orally administered recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein at different concentrations (0.5X, 1.0X, 5.0X) for different antigen feeding periods (1 week, 2 weeks, or 4 weeks), followed by challenge with Vibrio parahaemolyticus strains that produce PirA and PirB toxins causing AHPND.
[0066] Figure 12 shows the results of evaluating the expression levels of LGBP, CRSTP, and PPAE2, which are major genes related to the shrimp immune system, after 1 or 3 hours following the oral administration of recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein at different concentrations (0.5X, 1.0X, 10.0X) to whiteleg shrimp for 1 week, and challenge with a Vibrio parahaemolyticus strain that produces PirA and PirB toxins causing AHPND.
[0067] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.
[0068]
[0069] Example 1: Preparation of 6XHis-MBP-PirA / PirB, 6XHis-PirA / PirB recombinant proteins
[0070] 1.1 Construction of Expression Vectors and Recombinant E. coli Strains for Recombinant PirA / PirB Protein Production
[0071] Design of primers and amplification of the target gene via PCR
[0072] The primers used for cloning the PirA and PirB genes of Vibrio parahaemolyticus were designed by referring to the nucleotide sequences of the PirA (accession number: KM067908.1) and PirB (Accession number: KP324996.1) genes registered in NCBI BLAST. The primer sequences shown in Table 1 below were designed by including the NotI and BamHI restriction enzyme sequences for cloning into the pMAL-c6T vector (NEB, Ipswich, MA, USA) or the BamHI and XhoI restriction enzyme sequences for cloning into the pET28a(+) vector, respectively, at the ends of the primers.
[0073] Gene site Primer nucleotide sequence (5'→3') Restriction enzyme size (bp) PirA Forward AAGGAAAAAAGCGGCCGCAGTAACAATATAAAACATGAAACTGAC (Sequence No. 1) NotI333 Reverse CGGGATCCTTAGTGGTAATAGATTGTACAGAAAC (Sequence No. 2) BamHIPirB Forward AAGGAAAAAAGCGGCCGCACTAACGAATACGTTGTAACAATGT (Sequence No. 3) NotI1314 Reverse CGGGATCCTTACTTTTCTGTACCAAATTCATCG (Sequence No. 4) BamHIPirA Forward CGGGATCCAGTAACAATATAAAACATGAAACTGAC (Sequence No. 5) BamHI333 Reverse CCGCTCGAGTTAGTGGTAATAGATTGTACAGAAAC (Sequence No. 6)XhoIPirB Forward CGGGATCCACTAACGAATACGTTGTAACAATGT(Sequence No. 7)BamHI1314 Reverse CCGCTCGAGTTACTTTTCTGTACCAAATTCATCG(Sequence No. 8)XhoI
[0074] Vibrio parahaemolyticus was purified from hepatopancreatic tissues of whiteleg shrimp infected with Acute Hepatopancreatic Necrosis Disease (AHPND). PCR was performed using Vibrio parahaemolyticus DNA, 2.5 mM dNTPs, 5 μm each of PirA and PirB forward and reverse primers, and 1 unit of Q5® High-Fiedelity DNA polymerase (NEB, Ipswich, MA, USA). The polymerase chain reaction (PCR) conditions involved denaturation at 98°C for 30 seconds, followed by 35 cycles consisting of 10 seconds at 98°C, 20 seconds at 54°C, and 20–40 seconds at 72°C as a single cycle, and then expansion at 72°C for 2 minutes before terminating the reaction. The PCR products were verified under 1% agarose electrophoresis, confirming that PirA (333 bp) and PirB (1314 bp) were amplified to the expected size.
[0075] Restriction enzyme treatment, target gene insertion, and transformation
[0076] The PirA or PirB gene and expression plasmid were cleaved using NotI and BamHI restriction enzymes and inserted into the corresponding sites of the expression plasmid pMAL-c6T. At this time, to purify and solublely express the corresponding proteins after expression, a histidine (6XHis)-tag and a maltose-binding protein (MBP) were sequentially added to the N-terminus of PirA or PirB. In other words, expression vectors were constructed to express fusion proteins in which the histidine (6XHis)-tag, the maltose-binding protein (MBP), and PirA / PirB were sequentially bound from the N-terminus to the C-terminus, and these were named pHis6-MBP_PirA and pHis6-MBP_PirB (Figs. 1a and 1b).
[0077] In addition, the PirA or PirB gene and expression plasmid were cleaved using BamHI and XhoI restriction enzymes and inserted into the corresponding sites of the expression plasmid pET28a(+). At this time, expression vectors were constructed to enable expression with a histidine (6XHis)-tag attached to the N-terminus of PirA or PirB for purification after expression, and these were named pET28a(+)_PirA and pET28a(+)_PirB (Figs. 2a and 2b).
[0078] Subsequently, recombinant E. coli strains were prepared by transforming each of the four recombinant plasmids (pHis6-MBP_PirA, pHis6-MBP_PirB, pET28a(+)_PirA, and pET28a(+)_PirB) into E. coli BL21(DE3). The gene sequences and the amino acid sequences encoded from the gene sequences are as shown in Table 2 below.
[0079] [Table 2]
[0080]
[0081]
[0082]
[0083] 1.2. Expression and Purification of Recombinant PirA / PirB Proteins
[0084] 1.2.1. Confirmation of protein expression following IPTG induction (incubation at 37°C for 2 hours after induction)
[0085] Among the recombinant E. coli strains prepared in Example 1.1, E. coli transformed with pHis6-MBP_PirA and pHis6-MBP_PirB was inoculated into 100 ml of 2XYT medium containing the antibiotic ampicillin and cultured overnight at 37°C at a speed of 180 rpm, and E. coli transformed with pET28a(+)_PirA and pET28a(+)_PirB was inoculated into 100 ml of 2XYT medium containing the antibiotic kanamycin and cultured overnight at 37°C at a speed of 180 rpm. Afterward, 10 ml of the culture medium was inoculated into 1 L of 2XYT medium containing ampicillin or kanamycin and cultured at 37°C at a speed of 180 rpm until the OD 600 value reached 0.8 to 1.0. After adding IPTG (isopropyl β-D-1-thiogalactopyranoside) (Duchefa) to a final concentration of 0.3 mM, the recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, 6XHis-PirB) were incubated at 37°C at 180 rpm for 2 hours to induce overexpression. The cultured cells were concentrated by centrifugation at 8,000 rpm for 15 minutes, then resuspended in 20 ml of PBS buffer (Phosphate-Buffered Saline buffer, pH 7.4) and lysed by sonication. After separating into whole cell lysate (Total fraction), soluble fraction, and insoluble fraction, SDS-PAGE analysis was performed. The results confirmed that all four types of recombinant proteins were expressed upon IPTG induction, and that the total and soluble expression rates increased when MBP was fused (Fig. 3).
[0086]
[0087] 1.2.2. Confirmation of protein expression following IPTG induction (incubation at 18°C for 16 hours after induction)
[0088] Protein expression following IPTG induction was confirmed by performing SDS-PAGE analysis in the same manner as in 2.1, except that the culture conditions after IPTG addition in 1.2.1 were changed to low-temperature culture conditions (culture at 180 rpm for 16 hours) to induce overexpression of recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, 6XHis-PirB). As a result, it was confirmed that the final OD value was higher under low-temperature culture conditions than under 37°C culture conditions. In addition, it was confirmed that the water-soluble expression of His-MBP-PirB and His-PirB increased under low-temperature culture conditions compared to 37°C culture conditions (Fig. 4).
[0089]
[0090] 1.2.3. Purification and Quantification of Recombinant PirA / PirB Proteins
[0091] After lysing the IPTG-induced cells from Section 1.2.2 above, the water-soluble proteins in the eluent were separated by centrifugation at 12,000 rpm for 30 minutes at 4°C. The proteins were then purified by filling a Glass Econo-column with Ni-NTA affinity resin, and native recombinant 6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, and 6XHis-PirB proteins were obtained. The pure recombinant proteins were analyzed using Mini-PROTEAN® TGX Stain-Free™ Protein Gels (Bio-Rad) 15% SDS-PAGE. The purified target proteins were dialyzed using buffer C (PBS buffer, GE healthcare, USA) and then concentrated using Amicon (cut-off 3kDa, Millipore, Germany). Subsequently, the concentrations of the concentrated recombinant 6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, and 6XHis-PirB proteins were measured using the Bradford assay. Specifically, as a result of confirming the bands of the purified recombinant proteins by electrophoresis via 15% SDS-PAGE, bands corresponding to the 6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, and 6XHis-PirB recombinant proteins were observed, and the proportion of the desired target proteins within the total protein of each cell lysate was found to be approximately 33–37% for His-PirA and His-PirB, and over 60% for His-MBP-PirA and His-MBP-PirB (Figs. 5a and 5b). This means that the yield of recombinant PirA / PirB proteins fused with His-MBP is significantly increased compared to recombinant PirA / PirB proteins fused only with His.
[0092]
[0093] Comparative Example 1. Preparation of MBP-6XHis-PirA / PirB recombinant protein
[0094] Recombinant E. coli strains were constructed in the same manner as in Example 1, except that expression vectors (pMBP-His6_PirA and pMBP-His6_PirB) designed to enable expression in which a maltose-binding protein (MBP) and a histidine (6XHis)-tag are sequentially added to the N-terminus of PirA or PirB were used, and MBP-6XHis-PirA and MBP-6XHis-PirB recombinant proteins were expressed and purified.
[0095] Expression vectors for the production of MBP-6XHis-PirA and MBP-6XHis-PirB recombinant proteins were specifically constructed as follows. Based on the pMAL-c6T vector in the same manner as in Example 1 above, the same BamHI and XhoI restriction enzyme cleavage sites were used to construct the vectors. However, the tags were modified to enable the expression of fusion proteins in which a maltose-binding protein (MBP), a histidine (6XHis)-tag, and PirA / PirB are bound sequentially from the N-terminus to the C-terminus. These vectors were named pMBP-His6_PirA and pMBP-His6_PirB. The gene sequences and the amino acid sequences encoded from the gene sequences are as shown in Table 3 below.
[0096] [Table 3]
[0097]
[0098]
[0099]
[0100] Comparative Example 2. Preparation of PirA / PirB-MBP-6XHis recombinant protein
[0101] Recombinant E. coli strains were constructed in the same manner as in Example 1, except that expression vectors (pcMBP-His6_PirA and pcMBP-His6_PirB) designed to enable expression in which a maltose-binding protein (MBP) and a histidine (6XHis)-tag are sequentially added to the C-terminus of PirA or PirB were used, and PirA-MBP-6XHis and PirB-MBP-6XHis recombinant proteins were expressed and purified.
[0102] Expression vectors for the production of PirA-MBP-6XHis and PirB-MBP-6XHis recombinant proteins were specifically constructed as follows. Based on the pMAL-c6T vector in the same manner as in Example 1 above, the same BamHI and XhoI restriction enzyme cleavage sites were used to construct the vectors, but the tags were modified to enable the expression of a fusion protein in which PirA / PirB, maltose-binding protein (MBP), and histidine (6XHis)-tag are sequentially bound from the N-terminus to the C-terminus. Additionally, expression vectors were constructed using the tac promoter, which is a hybrid form of the trp promoter and the lac promoter and can induce high levels of expression in E. coli with IPTG (Isopropyl β-D-1-thiogalactopyranoside), and these were named pcMBP-His6_PirA and pcMBP-His6_PirB. Each gene sequence and the amino acid sequence encoded from the gene sequence are as shown in Table 4 below.
[0103] [Table 4]
[0104]
[0105]
[0106]
[0107] Comparative Example 3. Preparation of PirA / PirB-6XHis-MBP recombinant protein
[0108] Recombinant E. coli strains were constructed in the same manner as in Example 1, except that expression vectors (pcHis6-MBP_PirA and pcHis6-MBP_PirB) designed to enable expression in which a histidine (6XHis)-tag and a maltose-binding protein (MBP) are sequentially added to the C-terminus of PirA or PirB were used, and PirA-6XHis-MBP and PirB-6XHis-MBP recombinant proteins were expressed and purified.
[0109] Expression vectors for the production of PirA-6XHis-MBP and PirB-6XHis-MBP recombinant proteins were specifically constructed as follows. Based on the pMAL-c6T vector in the same manner as in Example 1 above, the same BamHI and XhoI restriction enzyme cleavage sites were used to construct the vectors, but the tags were modified to enable the expression of a fusion protein in which PirA / PirB, a histidine (6XHis)-tag, and a maltose-binding protein (MBP) are sequentially bound from the N-terminus to the C-terminus. Additionally, expression vectors were constructed using a tac promoter, which is a hybrid form of the trp promoter and the lac promoter and can induce high levels of expression in E. coli with IPTG (Isopropyl β-D-1-thiogalactopyranoside), and these were named pcHis6-MBP_PirA and pcHis6-MBP_PirB. Each gene sequence and the amino acid sequence encoded from the gene sequence are as shown in Table 5 below.
[0110] [Table 5]
[0111]
[0112]
[0113]
[0114] Comparative Example 4. Preparation of 6XHis-GST-PirA / PirB recombinant protein
[0115] Recombinant E. coli strains were constructed in the same manner as in Example 1, except that expression vectors (pHis6-GST_PirA and pHis6-GST_PirB) designed to enable expression in which a histidine (6XHis)-tag and glutathione-S-transferase (GST) protein are sequentially added to the N-terminus of PirA or PirB were used, and 6XHis-GST-PirA and 6XHis-GST-PirB recombinant proteins were expressed and purified.
[0116] Expression vectors for the production of 6XHis-GST-PirA and 6XHis-GST-PirB recombinant proteins were specifically constructed as follows. Based on the pMAL-c6T vector in the same manner as in Example 1 above, the same BamHI and XhoI restriction enzyme cleavage sites were used to construct the vectors. However, the tags were modified to enable the expression of a fusion protein in which a histidine (6XHis)-tag, glutathione-S-transferase (GST), and PirA / PirB are sequentially bound from the N-terminus to the C-terminus. These vectors were named pHis6-GST_PirA and pHis6-GST_PirB. The respective gene sequences and the amino acid sequences encoded from the gene sequences are shown in Table 6 below.
[0117] [Table 6]
[0118]
[0119]
[0120]
[0121] Comparative Example 5. Preparation of PirA / PirB-GST-6XHis recombinant protein
[0122] Recombinant E. coli strains were constructed in the same manner as in Example 1, except that expression vectors (pcGST-His6_PirA and pcGST-His6_PirB) designed to enable expression in which glutathione-S-transferase protein (GST) and histidine (6XHis)-tag are sequentially added to the C-terminus of PirA or PirB were used, and PirA-GST-6XHis and PirB-GST-6XHis recombinant proteins were expressed and purified.
[0123] The expression vectors for the production of PirA-GST-6XHis and PirB-GST-6XHis recombinant proteins were specifically constructed as follows. They were constructed based on the pMAL-c6T vector using the same BamHI and XhoI restriction enzyme cleavage sites as in Example 1 above, but the tags were modified to enable the expression of a fusion protein in which PirA / PirB, glutathione-S-transferase (GST), and histidine (6XHis)-tag are sequentially bound from the N-terminus to the C-terminus, and the promoter for expression was prepared as a hybrid form of the trp promoter and the lac promoter, E. Expression vectors using a tac promoter capable of inducing high levels of expression with IPTG (Isopropyl β-D-1-thiogalactopyranoside) in coli were constructed and named pcGST-His6_PirA and pcGST-His6_PirB. The gene sequences and the amino acid sequences encoded from the gene sequences are shown in Table 7 below.
[0124] [Table 7]
[0125]
[0126]
[0127]
[0128] Comparative Example 6. Preparation of HA-MBP-PirA / PirB recombinant protein
[0129] Recombinant E. coli strains were constructed in the same manner as in Example 1, except that expression vectors (pHA-MBP_PirA and pHA-MBP_PirB) designed to enable expression in which hemagglutinin protein (HA) and maltose-binding protein (MBP) are sequentially added to the N-terminus of PirA or PirB were used, and HA-MBP-PirA and HA-MBP-PirB recombinant proteins were expressed and purified.
[0130] Expression vectors for the production of HA-MBP-PirA and HA-MBP-PirB recombinant proteins were specifically constructed as follows. Based on the pMAL-c6T vector in the same manner as in Example 1 above, expression vectors were constructed using the same BamHI and XhoI restriction enzyme cleavage sites, but with modified tags to enable the expression of a fusion protein in which hemagglutinin protein (HA), maltose-binding protein (MBP), and PirA / PirB are sequentially bound from the N-terminus to the C-terminus. These vectors were named pHA-MBP_PirA and pHA-MBP_PirB. The gene sequences and the amino acid sequences encoded from the gene sequences are as shown in Table 8 below.
[0131] [Table 8]
[0132]
[0133]
[0134]
[0135] Comparative Example 7. Preparation of HA-GST-PirA / PirB recombinant protein
[0136] Recombinant E. coli strains were constructed in the same manner as in Example 1, except that expression vectors (pHA-GST_PirA and pHA-GST_PirB) designed to allow expression in which hemagglutinin protein (HA) and glutathione-S-transferase protein (GST) are sequentially added to the N-terminus of PirA or PirB were used, and HA-GST-PirA and HA-GST-PirB recombinant proteins were expressed and purified.
[0137] Expression vectors for the production of HA-GST-PirA and HA-GST-PirB recombinant proteins were specifically constructed as follows. Based on the pMAL-c6T vector in the same manner as in Example 1 above, the same BamHI and XhoI restriction enzyme cleavage sites were used to construct the vectors. However, the tags were modified to enable the expression of a fusion protein in which hemagglutinin protein (HA), glutathione-S-transferase protein (GST), and PirA / PirB are sequentially bound from the N-terminus to the C-terminus. These vectors were named pHA-GST_PirA and pHA-GST_PirB. The respective gene sequences and the amino acid sequences encoded from the gene sequences are shown in Table 9 below.
[0138] [Table 9]
[0139]
[0140]
[0141]
[0142] Comparative Example 8. Preparation of 10XHis-MBP-PirA / PirB recombinant protein
[0143] Recombinant E. coli strains were constructed in the same manner as in Example 1, except that expression vectors (pHis10-MBP_PirA and pHis10-MBP_PirB) designed to enable expression in which a histidine (10XHis)-tag and a maltose-binding protein (MBP) are sequentially added to the N-terminus of PirA or PirB were used, and 10XHis-MBP-PirA and 10XHis-MBP-PirB recombinant proteins were expressed and purified.
[0144] Expression vectors for the production of 10XHis-MBP-PirA and 10XHis-MBP-PirB recombinant proteins were specifically constructed as follows. Based on the pMAL-c6T vector in the same manner as in Example 1 above, the same BamHI and XhoI restriction enzyme cleavage sites were used to construct the vectors. However, the tags were modified to enable the expression of a fusion protein in which a histidine (10XHis)-tag, a maltose-binding protein (MBP), and PirA / PirB are sequentially bound from the N-terminus to the C-terminus. These vectors were named pHis10-MBP_PirA and pHis10-MBP_PirB. The respective gene sequences and the amino acid sequences encoded from the gene sequences are shown in Table 10 below.
[0145] [Table 10]
[0146]
[0147]
[0148]
[0149] Experimental Example 1. Evaluation of the stability of recombinant PirA / PirB proteins
[0150] SDS-PAGE analysis was performed on the four types of recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, 6XHis-PirB) produced in Example 1 to evaluate protein stability according to time / temperature / salinity.
[0151] Specifically, to artificially adjust the antigen feeding conditions, sea salt treatment conditions (20 ppt and 28 ppt) for shrimp were prepared and dispensed into 1.5 ml microtubes, and equal amounts of four types of recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, 6XHis-PirB) were added. A water bath was used to maintain the temperature at 28°C, and samples were collected up to day 7 to confirm protein stability after antigen feeding. More precisely, samples were collected and verified on the same day under untreated conditions (0h), immediately after treatment (28 ppt), and at 12, 72, and 168 hours (day 7) after treatment, as well as under high-temperature conditions (boil). The collected samples were treated with Sample Loading Buffer and boiled to break the protein folding (hydrogen bonds, disulfide bonds, etc.) and sampled to verify the results based on molecular weight. Subsequently, the prepared protein samples were subjected to electrophoresis on a 4-15% polyacrylamide gel. The results are shown in Figure 6.
[0152] Figure 6 shows the results of evaluating long-term storage stability, seawater salinity condition stability, and high temperature stability for four types of recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, 6XHis-PirB).
[0153] As a result, as shown in Figure 6, protein stability was maintained over time under sea salt treatment conditions (20 ppt and 28 ppt), and the protein remained stable even under high temperature conditions (boiling water, 5 min), and the difference with and without the inclusion of MBP was not significant. This means that the recombinant PirA / PirB protein can maintain stability when used as a shrimp feed additive.
[0154]
[0155] Experimental Example 2. Evaluation of Toxicity and Vaccine Efficacy of Recombinant PirA / PirB Proteins
[0156] 2.1. Evaluation based on recombinant antigen protein
[0157] For the four types of recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB, 6XHis-PirA, 6XHis-PirB) produced in Example 1, whether the corresponding antigen proteins affect the growth of shrimp and the preventive effect against shrimp AHPND were evaluated.
[0158] Specifically, 15 whiteleg shrimp (*Liopenaeus vannamei*) were prepared for each treatment group in a tank maintained at salinity and temperature conditions of 28 ppt (sea salt) and 28℃±1, with a DO of 5 ppm±0.5. As shown in Table 3 below, a total of four test vaccines were prepared: a low-concentration or high-concentration test vaccine prepared by mixing recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein in PBS (pH 7.4±0.1) at a weight ratio of 1:4 (1:1 molar ratio), and a low-concentration or high-concentration test vaccine prepared by mixing recombinant 6XHis-PirA protein and recombinant 6XHis-PirB protein in PBS (pH 7.4±0.1) at a weight ratio of 1:4 (1:1 molar ratio). The experimental group was antigen-fed with each test vaccine for 7 days, challenged with Vibrio parahaemolyticus strains (10^6 cfu / ml) that produce PirA and PirB toxins causing AHPND, and the shrimp mortality rate was checked after 96 hours. The control group was fed feed instead of the test vaccine for 7 days, and then challenged in the same manner as the experimental group to check the mortality rate. Antigen-fed or feed-fed was administered twice a day at 12-hour intervals at a rate of 2.5% of the individual body weight. The results are shown in Tables 11 and 12 and Figure 7 below.
[0159] Figure 7 shows the results of evaluating the survival rate after feeding whiteleg shrimp with recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein at low or high concentrations, or after feeding them with recombinant 6XHis-PirA protein and recombinant 6XHis-PirB protein at low or high concentrations, and then challenging them with a Vibrio parahaemolyticus strain that produces PirA and PirB toxins causing AHPND.
[0160] [Table 11]
[0161]
[0162] [Table 12]
[0163]
[0164] As a result, as shown in Table 12 and Figure 7 above, the mortality rate during the antigen feeding period was non-existent or very low, indicating that despite PirA and PirB being toxins, there was no significant effect on the growth of shrimp caused by each recombinant antigen protein. Meanwhile, after challenge inoculation, the cumulative mortality rate in the control group was 50%, whereas the cumulative mortality rate in the experimental group was low at 10–40%. In particular, the cumulative mortality rate in the His-MBP-PirA and His-MBP-PirB treatment groups was 10–17%, confirming that the vaccine efficacy was superior compared to the His-PirA and His-PirB treatment groups. Accordingly, His-MBP-PirA and His-MBP-PirB were selected as candidate substances, and subsequent experiments were conducted.
[0165]
[0166] 2.2. Evaluation based on dosage and duration of administration
[0167] For the two recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB) selected as candidate substances in Experimental Example 2.1 above, the preventive effect against shrimp AHPND according to the dosage and duration of administration was evaluated.
[0168] Specifically, 30 whiteleg shrimp (*Liopenaeus vannamei*) were prepared for each treatment group in a tank maintained at salinity and temperature conditions of 28 ppt (sea salt) and 28℃±1, with a DO of 5 ppm±0.5. As shown in Table 5 below, three types of test vaccines were prepared at different concentrations (0.5X, 1.0X, 5.0X) by mixing recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein in PBS (pH 7.4±0.1) at a weight ratio of 1:4 (molar ratio of 1:1). The experimental group was antigen-fed with each test vaccine for 1, 2, or 4 weeks, challenged with Vibrio parahaemolyticus strains (10^6 cfu / ml) that produce PirA and PirB toxins causing AHPND, and the shrimp mortality rate was checked after 96 hours. The control group was fed feed instead of the test vaccine for 1, 2, or 4 weeks, and then challenged in the same manner as the experimental group to check the mortality rate. Antigen-fed or feed-fed was administered twice a day at 12-hour intervals at a rate of 2.5% of the individual body weight. The results are shown in Tables 13 and 14 below, and Figures 8a to 10.
[0169] Figure 8a is a graph showing the results of evaluating the survival rate 96 hours after challenge with Vibrio parahaemolyticus strains that produce PirA and PirB toxins causing AHPND, following oral administration of recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein to whiteleg shrimp at different concentrations (0.5X, 1.0X, 5.0X) and antigen feeding periods (1 week, 2 weeks, or 4 weeks); Figure 8b is a table showing the results.
[0170] Figure 9 shows the results of the survival rate evaluation of Figure 8a according to antigen feed concentration.
[0171] Figure 10 shows the results of the survival rate evaluation of Figure 8a, categorized by antigen level and period.
[0172] [Table 13]
[0173]
[0174] [Table 14]
[0175]
[0176] As a result, as shown in Table 14 and Figures 8a to 10 above, the mortality rate during the antigen feeding period was non-existent or very low, indicating that despite PirA and PirB being toxins, there was no significant effect on the growth of shrimp caused by each recombinant antigen protein. Meanwhile, the cumulative survival rate was found to be higher than the control group, ranging from 48.3% to 78.3%, in the groups administered with the recombinant antigen at a concentration of 0.5X and 1.0X, whereas it was confirmed that the cumulative survival rate decreased to 25.0% to 35.0% in the group administered with the 5.0X concentration. In particular, the cumulative survival rate was highest at 78.3% in the group administered with the 0.5X concentration for one week, and lowest at 25.0% in the group administered with the 5.0X concentration for four weeks, confirming that the difference in survival rate was caused by the concentration rather than the duration of administration.
[0177] In addition, the survival rate of shrimp was evaluated after 10 days following antigen feeding and challenge inoculation in the same manner as above, and the results are shown in Figure 11.
[0178] Figure 11 shows the results of evaluating the survival rate after 10 days when whiteleg shrimp were orally administered recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein at different concentrations (0.5X, 1.0X, 5.0X) for different antigen feeding periods (1 week, 2 weeks, or 4 weeks), followed by challenge with Vibrio parahaemolyticus strains that produce PirA and PirB toxins causing AHPND.
[0179] As a result, as shown in Figure 11, a similar trend was observed as in Figures 8a to 10, and it was confirmed that the cumulative survival rate was highest at 58.23% in the group administered at a concentration of 0.5X or 1.0X for one week.
[0180]
[0181] Experimental Example 2. Evaluation of expression of genes related to the shrimp immune system
[0182] For the two recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB) selected as candidate substances in Experimental Example 2.1 above, the expression levels of three genes related to the shrimp immune system (LGBP, CRSTP, and PPAE2) were evaluated to see if they changed when challenged after feeding with the corresponding recombinant antigen.
[0183] Specifically, 30 whiteleg shrimp (Liopenaeus vannamei) were prepared in a tank maintained at salinity and temperature conditions of 28 ppt (sea salt) and 28℃±1, with DO maintained at 5 ppm±0.5. The test vaccines were prepared as three types of test vaccines at different concentrations (0.5X, 1.0X, 10.0X) by mixing recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein in PBS (pH 7.4±0.1) at a weight ratio of 1:4 (molar ratio of 1:1). The experimental group was antigen-fed with each test vaccine for one week, challenged (10^6 cfu / ml) with Vibrio parahaemolyticus strains that produce PirA and PirB toxins causing AHPND, and then sampled after one or three hours to determine the expression levels of key genes related to the shrimp immune system. The control group was fed feed instead of the test vaccine for one week, and then challenged in the same manner as the experimental group to determine the expression levels. Antigen-fed or feed-fed was administered twice a day at 12-hour intervals at a rate of 2.5% of the individual's body weight. The results are shown in Figure 12.
[0184] Figure 12 shows the results of evaluating the expression levels of LGBP, CRSTP, and PPAE2, which are major genes related to the shrimp immune system, after 1 or 3 hours following the oral administration of recombinant 6XHis-MBP-PirA protein and recombinant 6XHis-MBP-PirB protein at different concentrations (0.5X, 1.0X, 10.0X) to whiteleg shrimp for 1 week, and challenge with a Vibrio parahaemolyticus strain that produces PirA and PirB toxins causing AHPND.
[0185] As a result, as shown in Figure 12, it was confirmed that the expression levels of genes related to the shrimp immune system decreased during challenge in the group fed with two types of recombinant PirA / PirB proteins (6XHis-MBP-PirA, 6XHis-MBP-PirB) as antigens compared to the control group. This means that feeding with 6XHis-MBP-PirA and 6XHis-MBP-PirB recombinant proteins has the effect of reducing excessive immune responses during challenge.
[0186]
[0187] Experimental Example 3. Evaluation of expression rate, purification efficiency, and vaccine efficacy according to tag type and binding position
[0188] Experiments were conducted to evaluate the effects of tag combinations and binding positions at the N-terminus or C-terminus on recombinant PirA / PirB proteins.
[0189] First, to evaluate the protein expression rate and purification efficiency, IPGT induction was performed on the E. coli strains for producing recombinant PirA or PirB prepared in Example 1 and Comparative Examples 1 to 8 in the same manner as in Example 1.2.2, and the protein expression rate was checked, and the purification efficiency was checked in the same manner as in Example 1.2.3.
[0190] In addition, to evaluate vaccine efficacy, antigen feeding was performed on whiteleg shrimp (Liopenaeus vannamei) for 7 days using a test vaccine at a concentration of 1.0X, prepared by mixing each recombinant PirA protein and recombinant PirB protein produced in Example 1 and Comparative Examples 1 to 8 in PBS (pH 7.4±0.1) at a weight ratio of 1:4, in the same manner as in Experimental Example 2.1 above. Then, challenge inoculation (10^6 cfu / ml) was performed with a Vibrio parahaemolyticus strain that produces PirA and PirB toxins causing AHPND, and the survival rate of the shrimp was checked after 96 hours.
[0191] The results are shown in Table 15 below.
[0192] [Table 15]
[0193]
[0194] As a result, as shown in Table 15, the expression rate and purification efficiency of the recombinant protein were the same for both the PirA and PirB proteins; specifically, it was found that the expression rate and purification efficiency of the recombinant protein were generally superior when the tag was attached to the N-terminus rather than the C-terminus of the PirA / PirB proteins. In addition, even when located at the N-terminus, the highest survival rate of 90% was confirmed in the combination of histidine-tag and maltose-binding protein, specifically in Example 1, where 6XHis-MBP was sequentially attached to the N-terminus of the PirA / PirB proteins.
[0195]
[0196] Experimental Example 4. Evaluation of vaccine efficacy according to the mixing ratio of recombinant PirA / PirB proteins
[0197] We intended to evaluate vaccine efficacy according to the mixing ratio of recombinant PirA protein and recombinant PirB protein. A test vaccine with a concentration of 1.0X was prepared by mixing the 6XHis-MBP-PirA and 6XHis-MBP-PirB recombinant proteins produced in Example 1 into PBS (pH 7.4±0.1) in the weight ratios shown in Table 8 below. In the same manner as in Experimental Example 2.1, antigen feeding was performed on whiteleg shrimp (Liopenaeus vannamei) with each test vaccine for 7 days, challenged with Vibrio parahaemolyticus strains (10^6 cfu / ml) that produce PirA and PirB toxins causing AHPND, and then the survival rate of the shrimp was checked after 96 hours.
[0198] The results are shown in Table 16 below.
[0199] [Table 16]
[0200]
[0201] As a result, as shown in Table 16, it was found that the survival rate of shrimp was high when recombinant PirA protein and recombinant PirB protein were mixed in a weight ratio of 1:2 to 10, confirming that the vaccine efficacy is excellent at this weight ratio.
[0202]
[0203] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.
Claims
1. PirA (Photorhabdus insect-related toxin A) or PirB (Photorhabdus insect-related toxin B), toxin proteins of Vibrio parahaemolyticus; Maltose-binding protein (MBP); and Recombinant antigen protein containing a histidine tag.
2. The recombinant antigen protein of claim 1, wherein the histidine-tag is connected to the N-terminus of PirA or PirB.
3. The recombinant antigen protein of claim 1, wherein the MBP is connected to the N-terminus of PirA or PirB.
4. The recombinant antigen protein of claim 1, wherein the histidine-tag is connected to the N-terminus of the MBP.
5. A recombinant antigen protein according to claim 1, wherein the histidine-tag is 3 to 10 polyhistidine-tags.
6. Polynucleotide sequence encoding PirA or PirB, the toxin protein of Vibrio parahaemolyticus; A polynucleotide sequence encoding a maltose-binding protein (MBP); and A recombinant expression vector comprising a polynucleotide sequence encoding a histidine-tag.
7. Host cells transformed with a recombinant expression vector according to claim 6.
8. The host cell of claim 7, wherein the host cell is one selected from the group consisting of Escherichia coli, Pseudomonas, Bacillus, Streptomyces, fungi, and yeast.
9. A vaccine composition for preventing acute hepatopancreatic necrosis disease (AHPND) in shrimp comprising a recombinant PirA protein according to Claim 1, a recombinant PirB protein according to Claim 1, or a combination thereof.
10. A vaccine composition according to claim 9, wherein the composition comprises 0.5 μg to 30 μg of the recombinant PirA protein based on 1 g by weight.
11. A vaccine composition according to claim 9, wherein the composition comprises 2 μg to 120 μg of the recombinant PirB protein based on 1 g by weight.
12. A vaccine composition according to claim 9, wherein the weight ratio of the recombinant PirA protein and the recombinant PirB protein is 1:1 to 20.
13. A shrimp feed additive comprising the vaccine composition of any one of claims 9 to 12.
14. Use of a composition comprising a recombinant PirA protein according to claim 1, a recombinant PirB protein according to claim 1, or a combination thereof, for the preparation of a vaccine composition for preventing acute hepatopancreatic necrosis disease (AHPND) in shrimp.
15. Use of a composition comprising recombinant PirA protein according to claim 1, recombinant PirB protein according to claim 1, or a combination thereof, for the manufacture of a feed additive for preventing acute hepatopancreatic necrosis disease (AHPND) in shrimp.
16. A method for preventing acute hepatopancreatic necrosis disease (AHPND) in shrimp, comprising the step of administering an effective amount of a composition comprising a recombinant PirA protein according to claim 1, a recombinant PirB protein according to claim 1, or a combination thereof, to an individual in need thereof.