Rnai insecticide materials and methods for spotted wing drosophila ( drosophila suzukii) control

Yeast-based iRNA delivery systems targeting female-specific lethal genes in Drosophila suzukii larvae address the inefficiencies of current control methods by producing predominantly male or female populations, enhancing control efficacy and reducing resistance.

WO2026102261A1PCT designated stage Publication Date: 2026-05-15THE TRUSTEES OF INDIANA UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/054573
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-08
Filing Date
2025-11-07
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Current methods for controlling Spotted Wing Drosophila (Drosophila suzukii) populations are inefficient and lead to the development of insecticide-resistant strains, necessitating improved techniques for selectively eliminating either male or female flies to produce sterile insect populations for effective control.

Method used

Development of yeast-based delivery systems that express interfering RNA (iRNA) molecules targeting female-specific lethal genes in Drosophila suzukii larvae, allowing for the production of predominantly male or female populations through RNA interference.

Benefits of technology

Achieves high mortality rates of female or male larvae, respectively, enabling the cost-effective production of sterile flies for release, thereby reducing the need for widespread insecticide use and minimizing environmental impact.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025054573_15052026_PF_FP_ABST
    Figure US2025054573_15052026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are methods for producing interfering RNA larvicides for Spotted Wing Drosophila, D. suzukii, such as microbial host organisms engineered to produce interfering RNA (iRNA) molecules which selectively undermine the survival of female D. suzukii larva, to produce a predominantly male population of adult SWD flies. Such iRNA molecules selectively inhibit the expression of a gene in female SWD larvae population by RNA interference. Also disclosed herein are polynucleotides, such as expression cassettes encoding iRNA molecules and facilitating integration, such as stable integration into the genome of a host cell. Further disclosed herein are compositions including the disclosed nucleotide sequences and host organisms, along with methods of using the same to generate a predominately male SWD population.
Need to check novelty before this filing date? Find Prior Art

Description

RNAT INSECTICIDE MATERIALS AND METHODS FOR SPOTTED WING DROSOPHILA (DROSOPHILA SUZUKI!) CONTROLFIELD OF THE INVENTION

[0001] This disclosure generally relates to biorational insecticide compositions, such as yeastbased delivery systems for interfering RNA, which can be deployed to selectively control Drosophila populations, particularly Drosophila suzukii. The disclosure further relates to methods of making and using the biorational insecticide compositions.BACKGROUND

[0002] Drosophila suzukii, commonly known as spotted wing Drosophila (SWD), are invasive vinegar flies of East Asian origin that have caused great damage to the small fruit industry in the United States and other countries worldwide. In locations where SWD is well established, weekly insecticide applications are necessary, resulting in increased economic costs, as well as unwanted environmental impacts resulting from loss of non-targeted organisms. With increased use of insecticides, populations that are resistant to these insecticides inevitably emerge and it is critical that new means of controlling these insects are identified.

[0003] One means of controlling SWD is the sterile insect technique, through the release of sterile males, into the environment. Wild female SWD who mate with the sterile male SWD results in loss of the next generation. However, the production of male flies en masse requires methods that enable selection of males while eliminating females. Improved methods to eliminate female SWD in the production of sterile male flies for use in SWD control are needed.

[0004] Conversely, in some instances, the production of female flies en masse are needed for an insect control approach. This also requires an improved method to eliminate one sex of SWD in the population - specifically, the elimination of male flies to produce a predominately female population.

[0005] Aspects of the invention disclosed herein address these needs.1DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMINCORPORATION BY REFERENCE

[0006] Each patent, publication, and non-patent literature cited in the application is hereby incorporated by reference in its entirety as if each was incorporated by reference individually, and as if each is fully set forth herein. However, where such reference is made, and whether to patents, publications, non-patent literature, or other sources of information, it is for the general purpose of providing context for discussing features of the invention. Accordingly, unless specifically stated otherwise, the reference is not to be construed as an admission that the document or underlying information, in any jurisdiction, is prior art, or forms part of the common general knowledge in the art.SUMMARY OF THE INVENTION

[0007] A first aspect of the invention includes interfering ribonucleic acid (iRNA) molecules, which are capable of inhibiting at least one female-specific lethal gene in a D. suzukii larvae population by RNA interference.

[0008] A second aspect of the invention includes expression cassettes for the expression of disclosed iRNA molecules.

[0009] A third aspect of the invention includes vectors for the expression of disclosed iRNA molecules and expression cassettes containing nucleotide sequences encoding the same.

[0010] A fourth aspect of the invention includes microbial cells, such as host organisms, including any of the disclosed iRNA molecules, expression cassettes, vectors, and combinations thereof.

[0011] A fifth aspect of the invention includes compositions containing any of the disclosed iRNA molecules, expression cassettes, vectors, microbial cells, and combinations thereof.

[0012] A sixth aspect of the invention includes methods involving any of the disclosed iRNA molecules, expression cassettes, vectors, microbial cells, compositions, and combinations thereof, in the production of a predominantly male Spotted Wing Drosophila, D. suzukii, population.

[0013] A seventh aspect of the invention includes a female-specific lethal larvicide for Spotted Wing Drosophila, D. suzukii.

[0014] A first embodiment is an interfering ribonucleic acid including a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly2DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMcomplementary to mRNA transcribed from aDNA sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9; and wherein the interfering RNA inhibits the expression of one or more female-specific lethal genes in Drosophila suzukii female larvae by RNA interference.

[0015] A second embodiment is an interfering ribonucleic acid where the interfering RNA is an RNA construct, a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.

[0016] A third embodiment is an interfering ribonucleic acid where the interfering RNA is an shRNA.

[0017] A fourth embodiment is an interfering ribonucleic acid where the interfering RNA is a dsRNA of greater than 300 nucleotides, wherein a portion of the dsRNA nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a DNA sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO: 5, or SEQ ID NO:9 ; and wherein the interfering RNA inhibits the expression of one or more female-specific lethal genes in Drosophila suzukii female larvae by RNA interference.

[0018] A fourth embodiment an interfering RNA including a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or the complement thereof.

[0019] A fifth embodiment is an interfering RNA including a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or the compliment thereof.

[0020] A sixth embodiment is an interfering RNA including a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or the compliment thereof.

[0021] A seventh embodiment is an interfering RNA including a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or the compliment thereof.

[0022] An eighth embodiment is an expression cassette including a regulatory sequence operably linked to a nucleotide sequence which encodes the interfering RNA molecule of any of the preceding embodiments.3DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0023] A eighth embodiment is an expression cassette including a regulatory sequence operably linked to a nucleotide sequence which encodes an interfering RNA molecule including a nucleotide sequence of 20 to 600 contiguous nucleotides, where the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:5 or SEQ ID NO:9, and where the interfering RNA inhibits the expression of one or more femalespecific lethal genes

[0024] A ninth embodiment is an expression cassette where the nucleotide sequence of the interfering RNA molecule includes 25 nucleotides which are partially or perfectly complementary to mRNA transcribed from a sequence represented by SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9.

[0025] A tenth embodiment is an expression cassette including a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NQ:10, SEQ ID NO:11, SEQ ID NO:12, or the complement thereof.

[0026] An eleventh embodiment is an expression cassette where the regulatory sequence includes a yeast promoter.

[0027] A twelfth embodiment is an expression cassette where the expression cassette is integrated into the genomic DNA of a yeast cell.

[0028] A thirteenth embodiment is a vector including the expression cassette of any one of the preceding embodiments.

[0029] A fourteenth embodiment is a microbial cell or plant cell including the expression cassette or the vector of any one of the preceding embodiments.

[0030] A fifteenth embodiment is a microbial cell, or plant cell, where the expression cassette is integrated into the genomic DNA of the microbial cell, or plant cell.

[0031] A sixteenth embodiment is a microbial cell of any preceding embodiments, where the microbe is Saccharomyces cerevisiae.

[0032] A seventeenth embodiment is a composition including the interfering RNA, the expression cassette, the vector, the microbial cell, or plant cell of any preceding embodiment, or a combination thereof.4DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0033] An eighteenth embodiment is a composition including an expression cassette including a promoter operably linked to a DNA sequence encoding an interfering RNA molecule which is partially or perfectly complementary to mRNA transcribed from a target gene, where the target gene encodes a female-specific lethal protein in a D. suzukii larvae and the interfering RNA specifically inhibits expression of the target gene.

[0034] A nineteenth embodiment is a composition where the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.

[0035] A twentieth embodiment is a composition, where the interfering RNA is a short hairpin RNA (shRNA).

[0036] A twenty-first embodiment is a composition, where the target gene includes a DNA sequence having at least about 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9, or the complement thereof.

[0037] A twenty-second embodiment is a composition, where the expression cassette includes a nucleotide sequence having at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, or the complement thereof.

[0038] A twenty-third embodiment is a composition, where the expression cassette includes the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12

[0039] A twenty-fourth embodiment is a composition, where the interfering RNA includes a nucleotide sequence of at least 25 contiguous nucleotides which are partially or perfectly complementary to mRNA transcribed from SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9, or the complement thereof; or a DNA sequence having at least about or 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, or the complement thereof; and where the interfering RNA is capable of inhibiting the expression of one or more female-specific lethal genes in D. suzukii female larvae by RNA interference.

[0040] A twenty-fifth embodiment is a composition, where the expression cassette is integrated into the genome of a yeast cell.5DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0041] A twenty-sixth embodiment is a composition, where the yeast cell is Saccharomyces cerevisiae.

[0042] A twenty-seventh embodiment is a composition where the yeast cell is spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium.

[0043] A twenty-eighth embodiment is a composition further including a sugar bait.

[0044] A twenty-eighth embodiment is a method for producing a male D. suzukii population, including contacting the D. suzukii larvae population with the interfering RNA, the expression cassette, the vector, the microbial cell, or plant cell, or the composition of any of the preceding embodiments, or a combination thereof, where contacting the D. suzukii larvae population includes a larvae stage insect in the D. suzukii population ingesting the interfering RNA, the expression cassette, the vector, the microbial cell, or plant cell, or the composition, thereby inhibiting development of female larvae in the D. suzukii population.

[0045] Atwenty-ninth embodiment is a method for controlling a female SWD larva population where the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.

[0046] A thirtieth embodiment is a method for controlling a female SWD larva population, where the interfering RNA is a short hairpin RNA (shRNA).BRIEF DESCRIPTION OF THE FIGURES

[0047] The accompanying drawings are included to provide a further understanding of the disclosure and are incorporated in and constitute a part of this specification, illustrate embodiments, and together with the description serve to explain the principles of the disclosure.

[0048] FIG. 1 is a bar graph showing percent mortality of D. suzukii larvae following consumption of yeast strains Dsuz.tra-A (sequences 19-20), Dsuz.dsx-A (sequences 25-26), Dsuz.tra2-A (sequences 13-14), which express shRNAs targeting the D. suzukii tra, dsx, and trci2 genes, respectively. ***=P<0.001 vs. control or wild type flies.

[0049] FIG. 2 is a bar graph showing percent mortality of D. suzukii larvae following consumption of yeast strains Dsuzmsl2A (sequences 33-34), Dsuzmsl2B (sequences 36-37), and Dsuzmsl2C (sequences 39-40), which express shRNAs trading the Males specific legal 2 gene. ***=P<0.001 vs. control or wild type flies.6DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMDETAILED DESCRIPTION

[0050] Most Drosophila flies are associated with rotten or over-ripened fruits and are nuisance pests. However, a few species of Drosophila such as the SWD can infest un-ripened fruits and are of economic significance. Dependent upon temperature, the entire life cycle (egg to egg-laying female) can be completed within 12 to 15 days. A single female can lay 1-60 eggs per day and around 20-600 eggs in her lifetime. Eggs are laid singly and are randomly distributed on fruits. Larval development through pupation occurs inside the fruit. Since its first detection within the continental United States in 2008, SWD has become a serious threat to fruit crops.

[0051] Major fruit crops susceptible to SWD damage include, Prunus spp. (sweet cherries, plums, peaches), Rubus spp. (blackberries, loganberries, raspberries), Vaccinium spp. (blueberry, cranberry), Ribes spp. (Currents), and Vitis vinifera (wine grapes). Additionally, other hard fruits may also be attacked if the skin is already broken, including pear, apple, tomato, figs, and persimmons.

[0052] Currently, management practices for SWD include monitoring adult fly populations before fruit begin ripening. This includes use of bucket-style traps baited with mixtures of yeast, sugar, and water; fruit purees, distillates from apple cider vinegar or wine; ethanol, acetic acid and phenylethanol in 1 :22:5 ratios. A small drop of dish soap as a surfactant or placement of sticky cards within the traps is used to increase the retention of the flies in the trap. Other methods of control include removal and destruction of damaged fruit and / or insecticidal sprays effective against other Drosophila flies.

[0053] An emerging strategy for control of SWD is through the release of sterile males into the environment. Wild female D. suzukii flies mating with these sterile male flies results in loss of the next generation. However, the production of sterile male flies en masse requires methods that enable selection of males while eliminating females. To address this issue, we have generated yeast strains to express interfering RNA pesticides targeting genes found in female flies. The use of yeast allows the RNA pesticide to be cost-effectively produced during yeast cultivation, after which time the yeast can be heat killed and then added to the larval rearing media, resulting in death of female larvae that eat the yeast. The majority of flies that emerge are from the living larva7DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMare male. The male flies can then be subjected to sterilization protocols prior to release in the SWD-infested area for mating.

[0054] In some examples, disclosed herein are female-specific lethal larvicides, iRNA biopesticides which are lethal to female SWD larvae but not male SWD larvae during development, thereby allowing for the production of a population of predominantly male flies.

[0055] Exemplary female-specific lethal genes in D. suzukii that may be targeted for female larvae mortality include transformer-2 (tra-2), TRA (tra), and double sex (dsx). Silencing of these genes through iRNA results in female-specific SWD mortality but does not significantly impact the health and / or development of male SWD flies.

[0056] In other strategies for control of SWD, a predominately female population is needed. The population of female SWD may be further subjected to genetic manipulation and / or sterilization processing prior to their use in biopesticide applications. In some examples, disclosed herein are male-specific lethal larvidices, iRNA biopesticides which are lethal to male SWD larvae but not female SWD larvae during development, thereby allowing for the production of a population of predominantly female flies.

[0057] One exemplary male-specific lethal gene in D. suzukii that may be targeted for male larvae mortality is E3 ubiquitin-protein ligase male specific lethal-2 (msl-2). Silencing of this gene through iRNA results in a male-specific SWD mortality but does not significantly impact the health and / or development of the female SWD flies.

[0058] Such yeast strains engineered to express insecticidal iRNA molecules may be interchangeably referred to as “yeast-based iRNA biopesticides,” “iRNA biopesticides,” “interfering RNA biopesticides,” and the like. “iRNA” biopesticides may interchangeably be referred to as “RNAi” biopesticides.

[0059] RNA interference (RNAi) is activated when an organism recognizes double-stranded RNA (dsRNA) molecules and hydrolyzes them. In addition to their use of Argonaute family proteins, a common thread among RNAi-related pathways is their dependence on sequencespecific binding between short interfering RNAs (approximately 20 to 30 nucleotides) and target sequences (Obbard et al., Philos. Trans. R. Soc. Lo d. B. Biol. Sci. 2009; 364:99-115). Exogenous RNA constructs, such as dsRNA and small or short hairpin RNA (shRNA), are usually processed into 20-30 nucleotide duplexes by the ribonuclease III enzyme DICER. See, e.g., Kim & Rossi, Biotechniqnes. 2008 Apr; 44(5): 613-616 and Sheng et al., Front Bi oeng Biotechnol. 2020 Aug8DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM7;8:940. These nucleotide duplexes are then incorporated into the RNA induced silencing complex (RISC) by the catalytic component Argonaute. The two strands of RNA are unwound, and one strand is used as a guide strand, which binds to complementary mRNAs. The RISC complex will cleave the mRNA when base pair matching is perfectly complementary, or the complex can bind to the intact mRNA and suppress translation when there are mismatched base pairs, thereby mediating degradation or suppression of the endogenous transcript. Degradation or suppression of transcripts that code for essential genes in the insect may result in decreased amounts of critical gene products, reduced fitness, and increased mortality. See, e.g., Zotti & Smagghe, Neotrop Entomol. 2015 Jun;44(3): 197-213 and Burand & Hunter, J Invertebr Pathol. 2013 Mar;112Suppl: S68-74.

[0060] Additionally longer dsRNA molecules may also be utilized in disclosed iRNA larvicides. Longer iRNA include molecules greater than 30 nucleotides, greater than 40 nucleotides, greater than 50 nucleotides, greater than 60 nucleotides, greater than 70 nucleotides, greater than 80 nucleotides, greater than 90 nucleotides, greater than 100 nucleotides, greater than110 nucleotides, greater than 120 nucleotides, greater than 150 nucleotides, greater than 180 nucleotides, greater than 200 nucleotides, greater than 220 nucleotides, greater than 240 nucleotides, greater than 260 nucleotides, greater than 280 nucleotides, greater than 300 nucleotides, greater than 320 nucleotides, greater than 340 nucleotides, greater than 360 nucleotides, greater than 380 nucleotides, greater than 400 nucleotides, greater than 450 nucleotides, greater than 500 nucleotides, greater than 550 nucleotides, or greater than 600 nucleotides in length.

[0061] Various strategies have been explored to deliver iRNA biopesticides to a desired target insect pest population. However, oral administration or absorption of iRNA, such as involving consumption or ingestion of the iRNA, in contrast to, e.g., injection, has clear advantages for delivery in the field. As examples, the feasibility of delivering iRNA to a target organism has been explored using naked double stranded RNA (dsRNA), dsRNA combined with a transfection reagent, and nucleic acid molecules mixed with an artificial diet. See, e.g., Taning et al., Journal of Ant Science April 2016;89:803-814.

[0062] Once the population of single sex SWD flies are produced, the flies may then be subjected en masse to sterilization techniques, for example irradiation, such as gamma rays or X- rays, or genetic manipulation, prior to release. These sterilization techniques, used in conjunction9DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMwith the disclosed methods for creating a single sex population of SWD flies, provide a speciesspecific, cost-effective, scalable, user-friendly, and sustainable iRNA biopesticides targeting SWD insects for control of a SWD population.

[0063] Producing a predominantly single sex population of SWD flies does not necessarily entail completely eliminating a every fly of the opposite sex in a population but may rather involves generating a population where at least 75%, 78%, 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%>, 98% of the generated fly population are of only one sex.

[0064] The term “iRNA” refers to ribonucleic acid (RNA) sequences and constructs that are able to operate within the RNA interference (RNAi) pathway by interfering with transcriptional or post-transcriptional gene expression resulting in reduced or inhibited expression of a specific gene. For purposes herein, the term “iRNA” refers to short interfering RNA (siRNA), short hairpin RNA (shRNA) and double stranded RNA (dsRNA) that operate within the RNAi pathway. In some instances, the iRNA is produced within a cell via a DNA construct that encodes said iRNA. The iRNA of the present invention are synthetic and can be expressed in a vector or host cell in which the iRNA is not normally expressed. For example, the siRNA may target an insect gene, e.g., a female-specific lethal SWD insect gene, and be expressed by an exogenous vector or expressed in a bacterial or yeast cell that does not naturally contain the target gene or target sequence to which the siRNA binds. The iRNA may be modified in a manner that facilitates exogenous expression by the host cell, e.g., the nucleic acid or the complementary sequence used to express the iRNA may be modified at its ends or incorporated into an exogenous sequence to allow for expression in the target host cell. In some embodiments, the nucleic acid encoding the iRNA is operably linked to an exogenous sequence that allows for its expression.

[0065] RNAi strategies typically employ a synthesized, non-naturally occurring “iRNA” or “iRNA molecule,” which typically comprises at least an RNA fragment against a target gene, a spacer sequence, and a second RNA fragment which is complementary to the first, so that a doublestranded RNA (dsRNA) structure can be formed. The introduced dsRNA takes advantage of the native RNAi pathways in the insect to trigger down-regulation of target genes that may lead to the cessation of feeding and / or growth, which may result in the death of the insect pest.

[0066] The target nucleotide sequence may be selected from any suitable region or nucleotide sequence of the target gene or RNA transcript thereof. For example, the target nucleotide sequence may be located within the 5'UTR or 3'UTR of the target gene or RNA transcript or within exonic10DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMor intronic regions of the gene. The skilled person will be aware of methods of identifying the most suitable target nucleotide sequences within the context of the full-length target gene. For example, multiple dsRNAs targeting different regions of the target gene can be synthesized and tested. Alternatively, digestion of the RNA transcript with enzymes such as RNAse H can be used to determine sites on the RNA that are in a conformation susceptible to gene silencing. Target sites may also be identified using in silico approaches, for example, the use of computer algorithms designed to predict the efficacy of gene silencing based on targeting different sites within the full- length gene.

[0067] The term “siRNA,” or “small interfering RNA,” refers to short interfering RNA or silencing RNA, which are short double-stranded RNA molecules of <30 base pairs in length, for example, about 19-30 base pairs in length that operate through the RNAi pathway. Each siRNA is unwound into two single-stranded RNAs (ssRNAs), one of which is incorporated into the RNA- induced silencing complex (RISC) leading to post-transcriptional gene silencing. siRNAs can be generated in several ways. In some cases, long dsRNA is introduced to a cell, either by a virus, endogenous RNA expression (i.e., microRNA), or exogenously delivered dsRNA. The enzyme DICER cleaves the long duplex RNAs into siRNAs. Another way to introduce siRNA into cells is to express small hairpin RNA (shRNA) from plasmid vectors. Alternatively, chemically synthesized siRNA duplexes, which mimic the structure of DICER-processed products, are commonly used in research for gene silencing. Chemically synthesized siRNAs simply bypass the DICER cleavage step. In some preferred embodiments, the siRNA is about 25 bp in length. While use of longer (300-400 bp) double stranded RNA (dsRNA) molecules is one approach for producing iRNA, the short length (21-25 bp) of custom small interfering RNAs (siRNAs) facilitates the design of highly specific iRNA.

[0068] The terms “short hairpin RNA” and “small hairpin RNA” are encompassed by the term “shRNA.” shRNAs are artificial RNAs having a secondary structure such that a portion of the RNA strand forms a hairpin loop. Expression of shRNA in cells is typically accomplished by delivery of a DNA construct to the cell, e.g., through a recombinant vector having an expression cassette facilitating transcription of the encoding DNA and production of the shRNA. shRNA is transcribed under the control of RNA Pol-II or Pol-III promoters, and folds into a structure resembling a siRNA duplex. shRNAs are then processed by DICER into siRNAs.11DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0069] The term “dsRNA” (double stranded RNA) refers to long double-stranded RNA molecules that are cleaved by the enzyme DICER into short double-stranded fragments of about 20-25 nucleotide siRNAs.

[0070] RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) refers to the biological process in which RNA molecules interfere or inhibit the expression of specific genes with complementary nucleotide sequences to the iRNA (gene-specific suppression of gene expression). RNAi results in the degradation of mRNA after transcription, resulting in reduced translation and protein expression.

[0071] RNA interference techniques employ genetic constructs that encode iRNA molecules, such as dsRNA and shRNA. Typically, the RNA constructs comprise sense and anti-sense sequences which are placed in regions flanking an intron sequence in proper splicing orientation with donor and acceptor splicing sites. Alternatively, spacer sequences of various lengths can be employed to separate self-complementary regions of sequence in the construct. During processing of the gene construct transcript, intron sequences can be spliced-out, allowing sense and anti-sense sequences, as well as splice junction sequences, to bind forming double-stranded RNA. Alternatively, where secondary structure inhibits splicing machinery, the intron sequences are not spliced out and the dsRNA is supplied as a hairpin structure. When the dsRNA is expressed in a cell, ribonucleases bind to and cleave the double-stranded RNA, initiating a cascade of events leading to degradation of the target mRNA molecules, and thereby silencing such target genes. The phenomenon of RNA interference using shRNA is described in Sheng et al., Front Bioeng Biotechnol. 2020 Aug 7;8:940 and generally in Bass, Nature 411 : 428-29 (2001); Elbahir et al., Nature 411: 494-98 (2001); and Fire et al., Nature 391 : 806-11 (1998); and WO 01 / 75164, where methods of making interfering RNA also are discussed.

[0072] The iRNA can hybridize with the full-length mRNA encoded by the target gene or hybridize to a fragment of the target RNA or DNA (the target sequence). For example, to reduce expression of a target gene in a female SWD larva using RNAi, an expression cassette encoding an iRNA having the sequence of an mRNA transcribed from the target gene, or a substantially identical sequence (including those engineered not to translate the protein), or fragment thereof, is introduced into a yeast cell. The resulting yeast cell can then be fed to the SWD larva to determine its ability to inhibit expression of the target gene and / or inhibit growth of the female larva. Although the sequence of the iRNA used for RNAi need not be completely identical to mRNA12DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMtranscribed from the target sequence of the target gene, it is typically substantially identical, e.g., at least 70%, 80%, 90%, 95%, 98%, or more identical to mRNA transcribed from the target sequence. It is known in the art that dsRNA molecules that are not perfectly complementary to mRNA transcribed from the target sequence (for example, having only 95% identity to mRNA transcribed from the target sequence) are effective to control insect pests (see, for example, Narva et al., U.S. Pat. No. 9,012,722).

[0073] Target genes can be selected based on a number of criteria, including female specificity during larvae development and, preferably, female-specific lethality during larvae development when silenced.

[0074] Gene suppression” or “down-regulation of gene expression” or “inhibition or suppression of gene expression” are used interchangeably and refer to a measurable or observable reduction in gene expression or a complete abolition of detectable gene expression at the level of protein product (“gene silencing”), and / or mRNA product from the gene. In some embodiments, gene suppression results in gene silencing, referring to the ability of the iRNA to target mRNA for degradation, resulting in disrupted translation, which prevents protein expression. For example, the ability of the iRNA to suppress or down-regulate a female-specific lethal gene can lead to the suppression or inhibition of a female SWD larva’s growth and maturation or lead to the female larva’s death. The downregulation or inhibition may occur at the translational or post-translational stage of expression of the gene of interest by promoting transcript turnover, cleavage, or disruption of translation.

[0075] In addition to inhibiting gene expression the provided nucleic acids, host cells, such as microbial cells, compositions, and methods may additionally reduce the production of the protein product of a target gene. Methods of quantifying proteins, such as comparing the production of a specific protein, in a SWD larvae after exposure to a microbial cell engineered to produce disclosed iRNA targeting that specific protein compared to protein levels in a unexposed SWD larvae are known in the art and include, e.g., ELISA and Western blot analysis.

[0076] The term “gene” refers to a polynucleotide sequence that comprises control and coding sequences necessary for production of a polypeptide (protein). The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence. A gene includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The leader, the trailer as well as the introns13DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMinclude regulatory elements that are necessary during the transcription and the translation of a gene (e.g., promoters, enhancers, etc.). A gene may be an uninterrupted coding sequence or may include one or more introns contained between splice junctions. As used herein, a gene may include variants of the gene, which include, but are not limited to, modifications such as mutations, insertions, deletions, or substitutions of one or more nucleotides. A “target gene” is the gene targeted for down-regulation or suppression by the iRNA of the present technology, such as a gene encoding an ion channel protein. An “RNA target sequence,” alternatively referred to as a “target RNA sequence” can be transcribed from a target gene. Exemplary gene products of the target gene include potassium ion channel proteins and potassium voltage-gated ion channel proteins, including Shaker and orthologs thereof. A “gene product” can refer to either the mRNA or protein expressed from a particular gene.

[0077] The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” refer to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. The monomer is typically referred to as a nucleotide. Nucleic acids can include modified nucleotides that permit correct read through by a polymerase and do not significantly alter expression of a polypeptide encoded by that nucleic acid.

[0078] The phrase “nucleic acid sequence encoding” refers to a nucleic acid, such as DNA, which is the template for transcription of a specific RNA molecule, e.g., a shRNA, a dsRNA, or an mRNA that is translated into a protein. The nucleic acid sequences include both the full-length nucleic acid sequences as well as non-full-length sequences derived from the full-length sequences. A coding sequence can include degenerate codons (relative to the native sequence) or sequences that provide codon preference in a specific host cell.

[0079] The term “promoter” refers to regions or sequence located upstream and / or downstream from the start of transcription and which are involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A “yeast promoter” is a promoter capable of initiating transcription in yeast cells. A yeast promoter can be a nucleic acid sequence originally isolated from a yeast, but promoters not initially isolated from a yeast are also considered “yeast promoters” for the purposes of this disclosure.

[0080] An “expression cassette” refers to a nucleic acid construct, which when introduced into a host cell (e.g., a yeast cell), results in transcription of an RNA molecule (e.g., dsRNA or mRNA). An expression cassette typically includes a sequence to be expressed, and sequences necessary for14DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMexpression of the sequence to be expressed, such as a promoter operably linked to the sequence. Generally, an expression cassette is inserted into an expression vector to be introduced into a host cell.

[0081] The words “complementary” or “complementarity” refer to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second polynucleotide. For example, the sequence A-G-T is complementary to the sequence T-C-A. Complementarity can be partial, in which only some of the nucleic acids match according to base pairing, or complete, such as fully complementary or perfectly complementary, where all the nucleic acids match according to base pairing.

[0082] The terms “protein,” “peptide,” and “polypeptide” are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.

[0083] The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified.

[0084] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or proteins of the invention, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acids that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters, or by manual alignment and visual inspection. See e.g., the NCBI web site at ncbi.nlm.nih.gov / BLAST / . For example, the sequence of a dsRNA of the invention can be compared using the above techniques to the sequence of a target gene in an insect pest, taking into account the presence of uracil in the dsRNA and thymidine in the DNA. Sequences that have at least about 90% sequence identity using the methods described above are said to be “substantially identical.” This definition also refers to, and can be applied to, the compliment of a test sequence. The definition also includes sequences that have15DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMdeletions and / or additions, as well as those that have substitutions. Optimal alignment of such sequences can be carried out by any of the publicly available algorithms or programs for determining sequence identity and alignment, e.g., BLAST.

[0085] In some examples, downregulation or inhibition of gene expression in cells of a D. suzukii can be confirmed by phenotypic analysis of the cell or the whole SWD insect, for example death of larva (caterpillar), pupa, and adult SWD insects (which can be quantified, for example, as percent (%) mortality). Ingestion of the iRNA, including compositions thereof, provide a % mortality of at least about 50%, alternatively at least about 60%, alternatively at least about 70%, alternatively at least about 75%, alternatively at least about 80%, at least about 90%, alternatively at least about 95%, alternatively at least about 98%, alternatively at least about 100% of female SWD flies in a SWD population, wherein each range is inclusive and including any and all numerical values and ranges in between.

[0086] Other methods of confirming downregulation of the gene expression are known in the art, and include, but are not limited to, measurement of mRNA or protein expression using molecular techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (MA), other immunoassays, or fluorescence-activated cell analysis (FACS) and the like.

[0087] Suitably, the sequences and genes targeted by the present technology are specific to D. suzukii insects. Downregulation or inhibition of target gene expression is “specific” when downregulation or inhibition of the target gene occurs without resulting in any detrimental effects on other genes of the targeted organism or genes of other non-related organisms (e.g., humans, mammals, etc.). The targeted sequences selected were analyzed and determined to have little risk for targeting genes in humans. Methods of determining if sequences specifically target human genes are known in the art, and include, for example, assessing human risk empirically through toxicity testing on human cells in vitro and on animal models in vivo, and in silico methods to select only risk-reduced sequences for siRNA synthesis.

[0088] Interfering RNA (iRNA) and Other Nucleic Acid Molecules

[0089] In some aspects, provided herein are interfering RNA molecules (iRNA) effective to inhibit the expression of female-specific lethal genes in larvae of spotted wing Drosophila, such as by RNA interference. In additional aspects, provided are nucleic acid sequences, such as DNA16DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMsequences, encoding the disclosed iRNA molecules. Also provided are nucleic acid constructs comprising the iRNA molecules and nucleic acid sequences encoding the same. In further aspects, provided are microbial host cells, such as a yeast cell, bacterial cell, or plant cell comprising the disclosed iRNA and nucleic acid sequences encoding the same. Herein, the disclosed iRNA molecules may be referred to simply as “iRNA.”

[0090] Interfering RNA (iRNA)

[0091] In some aspects, provided is an iRNA molecule comprising at least one dsRNA, such as an shRNA, where the dsRNA is a region of double-stranded RNA comprising annealed strands that are either partially or fully complementary. In some embodiments, one strand of the dsRNA comprises a sequence of at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, or at least 300 contiguous nucleotides which is partially or fully complementary to a target nucleotide sequence within a£>. suzukii target gene, a sex-specific gene (i.e., female specific or male specific) necessary for SWD health and / or development of that sex.

[0092] In some embodiments, one strand of the dsRNA comprises a sequence of 15 to 30 contiguous nucleotides, 20 to 30 contiguous nucleotides, 25 to 35 contiguous nucleotides, 30 to 50 contiguous nucleotides, 45 to 75 contiguous nucleotides, 50 to 100 contiguous nucleotides, 65 to 125 contiguous nucleotides, 75 to 150 contiguous nucleotides, 85 to 120 contiguous nucleotides, 100 to 150 contiguous nucleotides, 125 to 175 contiguous nucleotides, 150 to 200 contiguous nucleotides, 300 to 600 contiguous nucleotides, 450 to 600 contiguous nucleotides, 500 to 650 contiguous nucleotides, or 550 to 750 contiguous nucleotides, wherein each range is inclusive, which is partially or fully complementary to a target nucleotide sequence within a D. suzukii target gene.

[0093] In some embodiments, disclosed iRNA has at least 60% complementarity, at least 65% complementarity, at least 70% complementarity, at least 75% complementarity, at least 80% complementarity, at least 85% complementarity, at least 86% complementarity, at least 87% complementarity, at least 88% complementarity, at least 89% complementarity, at least 90%17DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMcomplementarity, at least 91% complementarity, at least 92% complementarity, at least 93% complementarity, at least 94% complementarity, at least 95% complementarity, at least 96% complementarity, at least 97% complementarity, at least 98% complementarity, at least 99% complementarity, or 100% complementarity to a messenger RNA (mRNA) transcript that has been transcribed from a target nucleotide sequence within a D. suzukii target gene.

[0094] In some embodiments, the disclosed percent identity is to at least a 19, at least a 20, at least a 21, at least a 22, at least a 23, at least a 24, at least a 25, at least a 26, at least a 27, at least a 28, at least a 29, at least a 30, at least a 35, at least a 40, at least a 45, at least a 50, at least a 55, at least a 60, at least a 65, at least a 70, at least a 75, at least a 80, at least a 85, at least a 90, at least a 95, at least a 100, at least a 110, at least a 120, at least a 130, at least a 140, at least a 150, at least a 160, at least a 170, at least a 180, at least a 190, at least a 200, at least a 210, at least a 220, at least a 230, at least a 240, at least a 250, at least a 260, at least a 270, at least a 280, at least a 290, or at least a 300 contiguous nucleotide fragment of a target D. suzukii gene.

[0095] In some embodiments, the iRNA effective to inhibit the expression of a gene in a SWD is a small interfering RNA (siRNA), a short hairpin RNA (shRNA), double stranded RNA (dsRNA), or RNA construct. In some embodiments, the siRNA, shRNA, dsRNA, or RNA construct is encoded by a DNA construct, such as a recombinant vector comprising an expression

[0096] In some embodiments, the target gene includes a DNA sequence that is at least 80%, 84%, 88%, 90%, 92%, or 96% identical to any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9. In some embodiments, the target gene includes a DNA sequence having about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9. In some embodiments, the target SWD gene comprises a DNA target sequence represented by any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9.

[0097] In some embodiments, a disclosed iRNA molecule effective to inhibit the expression of a female-specific lethal gene in D. suzukii is partially complementary to mRNA transcribed from any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9. In some embodiments, an iRNA molecule effective to inhibit the expression of a female-specific lethal gene in D. suzukii is fully complementary to mRNA transcribed from any one of SEQ ID18DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMNO:1, SEQ ID NO:5, or SEQ ID NO:9, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9.

[0098] In some embodiments, a disclosed iRNA molecule effective to inhibit the expression of a female-specific lethal gene in D. suzukii comprises a sequence of 20-30, 21-29, 22-28, 23-27, or 24-26 contiguous nucleotides that is complementary to mRNA transcribed from a target gene sequence, wherein each range is inclusive. In some embodiments, the iRNA molecule effective to inhibit the expression of a gene in a SWD comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 contiguous nucleotides that are partially or perfectly complementary to mRNA transcribed from a target gene in a SWD. The target gene may include a DNA sequence represented by SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9.

[0099] In some embodiments, the iRNA is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% complementary to a portion of mRNA transcribed from the target gene. In some embodiments, the iRNA is about 70% to 99%, 75% to 95%, 80% to 90%, or 85% to 90% complementary to a portion of mRNA transcribed from the target gene, wherein each range is inclusive. In some embodiments, the iRNA is at least or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to a portion of mRNA transcribed from the target gene. In some embodiments, the iRNA is perfectly complementary to a portion of mRNA transcribed from the target gene. The target gene may include a DNA sequence represented by SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9.

[0100] In some embodiments, the target gene includes a DNA sequence that is at least 80%, 84%, 88%, 90%, 92%, or 96% identical to SEQ ID NO:31. In some embodiments, the target gene includes a DNA sequence having about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:31. In some embodiments, the target SWD gene comprises a DNA target sequence represented by SEQ ID NO:31.

[0101] In some embodiments, a disclosed iRNA molecule effective to inhibit the expression of a female-specific lethal gene in D. suzukii is partially complementary to mRNA transcribed from SEQ ID NO:31, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity19DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMto SEQ TD NO:31 In some embodiments, an iRNA molecule effective to inhibit the expression of a female-specific lethal gene in D. suzukii is fully complementary to mRNA transcribed from SEQ ID NO:31, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:31

[0102] In some embodiments, a disclosed iRNA molecule effective to inhibit the expression of a male-specific lethal gene in D. suzukii comprises a sequence of 20-30, 21-29, 22-28, 23-27, or 24-26 contiguous nucleotides that is complementary to mRNA transcribed from a target gene sequence, wherein each range is inclusive. In some embodiments, the iRNA molecule effective to inhibit the expression of a gene in a SWD comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 contiguous nucleotides that are partially or perfectly complementary to mRNA transcribed from a target gene in a SWD. The target gene may include a DNA sequence represented by SEQ ID NO:31, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:31.

[0103] In some embodiments, the iRNA is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% complementary to a portion of mRNA transcribed from the target gene. In some embodiments, the iRNA is about 70% to 99%, 75% to 95%, 80% to 90%, or 85% to 90% complementary to a portion of mRNA transcribed from the target gene, wherein each range is inclusive. In some embodiments, the iRNA is at least or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to a portion of mRNA transcribed from the target gene. In some embodiments, the iRNA is perfectly complementary to a portion of mRNA transcribed from the target gene. The target gene may include a DNA sequence represented by SEQ ID NO:31, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:31.

[0104] In some embodiments, the iRNA is an RNA construct, a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide. In preferred embodiments, the iRNA is an shRNA.

[0105] Nucleic Acid Sequences Encoding iRNA

[0106] In some aspects, provided herein are nucleic acid sequences, such as DNA sequences, encoding iRNA effective to inhibit the expression of a target gene in a SWD. In some embodiments, an expression vector comprises the DNA sequence encoding iRNA effective to inhibit the expression of a gene in a SWD. In some embodiments, a microbial cell, such as a yeast20DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMcell, comprises the expression vector. Herein, the term “expression vector” may be used interchangeably with “recombinant vector.”

[0107] Suitable DNA constructs will depend on the type of cell in which to express the RNA. In some embodiments, the DNA construct is a linear or a closed circular plasmid or expression vector. In some embodiments, the DNA constructs will be integrated into the host cell genome, for example, integrated into the genome of a microbial cell or plant cell.

[0108] In some embodiments, the DNA construct is a suitable expression vector. Sequences that encode the iRNA of the present technology can be inserted into a vector under the control of a suitable promoter that functions in one or more microbial hosts to drive expression of a linked coding sequence or other DNA sequence. Suitable vectors are known in the art and selecting the appropriate vector will depend on the size of the nucleic acid to be inserted into the vector and the particular host cell to be transformed with the vector. Vectors may include one, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more selectable marker genes, terminators, enhancers and / or a constitutive or inducible promoter allowing expression of exogenous DNA. Vectors can also include viral vectors and the like.

[0109] Host cells, such as yeast cells, can be engineered to include such vectors, e.g., Saccharomyces cerevisiae. Suitable promoters for expression in yeast are well known and include, for example, the bacteriophage T7 promoter, promoters from GALI (which is induced by the presence of galactose), ADH1, the TEF1 promoter and the AOX promoter (a methanol inducible promoter), and the like. Various methods are available to transform S. cerevisiae cells with exogenous DNA and producing recombinant products. For example, transformed cells are selected by phenotype determined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine).

[0110] In some embodiments, auxotrophic yeast strains are transformed with exogenous DNA encoding disclosed iRNA. Use of these strains relies on marker genes that encode key enzymes in various essential metabolic pathways. Examples include the URA, HIS3, LEU2, TRP1, and MET 15 marker genes, which encode essential enzymes for de novo synthesis of pyrimidines, 1- histidine, 1-leucine, 1 -tryptophan, and 1-methionine, respectively. Yeast strains are auxotrophic for the nutrient in question due to the absence of a functional chromosomal copy of the marker gene. The auxotrophic yeast strains can thus be propagated only in media that contain the21DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMappropriate nutrients. Synthetic auxotrophs may also be engineered to require particular compounds.

[0111] In some embodiments, more than one iRNA may be expressed by a single recombinant vector introduced into a host cell. In some embodiments, more than one iRNA may be expressed by multiple recombinant vectors introduced into a host cell. In some embodiments, the recombinant vector comprises multiple expression sites, each site able to drive the expression of a different nucleotide sequence. By this method, multiple iRNAs can be expressed in a single cell, where the multiple iRNA can either target multiple sites on a single gene or target multiple genes within female D. suzukii. The host cell can be a microbial cell or a plant cell.

[0112] In some embodiments the vector is a plasmid. Other vectors include artificial chromosomes and linear nucleic acid molecules that are distinct from linearized plasmids. In some embodiments the vector is an integrating vector. In some embodiments the vector comprises an expression control element operably linked to a nucleic acid to be transcribed, e.g., DNA encoding disclosed iRNA. Three well known plasmid systems used for recombinant expression and replication in yeast cells include integrative plasmids, low-copy-number ARS-CEN plasmids, and high-copy-number 2p plasmids. See, e.g., Christianson et al., Gene. 1992;110: 119-22; Sikorski, "Extrachromosomal cloning vectors of Saccharomyces cerevisiae", in Plasmid, A Practical Approach, Ed. K. G. Hardy, IRL Press, 1993; Parent, S.A., and Bostian, K.A., Recombinant DNA technology: yeast vectors, p. 121-178. In Wheals, A.E., et al. (eds.) The yeasts, vol. 6. Yeast genetics. Academic Press, Longon, UK (1995).

[0113] An example of integrating plasmids of use in budding yeast are Yip plasmids, which are maintained at one copy per haploid genome and inherited in Mendelian fashion. Such a plasmid, containing a nucleic acid of interest, a bacterial origin of replication and a selectable gene (typically an antibiotic- resistance marker), is typically produced in bacteria. The purified vector may be linearized and used to transform competent yeast cells. YCp plasmids, which contain the autonomous replicating sequence (ARS1) and a centromeric sequence (CEN4), are examples of low-copy- number ARS-CEN plasmids. These plasmids are usually present at 1-2 copies per cell. An example of the high-copy-number 2p plasmids are YEp plasmids, which contain a sequence approximately 1 kb in length (named the 2p sequence). The 2p sequence acts as a yeast replicon giving rise to higher plasmid copy number. These plasmids may require selection for maintenance.22DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0114] In some embodiments, the recombinant vector comprises an expression cassette comprising a promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits expression of a target gene in a female SWD larva, such as a gene encoding tra-2, tra, or dsx. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a yeast promoter.

[0115] Yeast vectors, e.g., plasmids, described herein may also contain expression control sequences, e g., promoter sequences. A "promoter" is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and transcription factors, to initiate the transcription of a nucleic acid sequence. The phrase "operably linked" indicates that an expression control element, e g., a promoter, is in an appropriate location and / or orientation in relation to a nucleic acid to control transcriptional initiation and / or expression of the nucleic acid.

[0116] A promoter may be one that is naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment. Alternatively, a promoter may be a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid segment in its natural environment. Such promoters may include promoters of other genes and promoters that are not naturally occurring. An expression control element may be derived from a yeast of the species or strain in which RNAi is to be used or in which the RNAi pathway is to be engineered. For example, if RNAi is to be used in 5. cerevisiae, it may be desirable to use a S. cerevisiae promoter to direct expression of a dsRNA. However, any expression control element capable of directing transcription in the cell of interest may be used.

[0117] The promoters employed may be either constitutive or inducible. For example, various yeast-specific promoters may be employed to regulate the expression in yeast cells. Examples of inducible yeast promoters include GALI- 10, GALI, GALL, GALS, TET, CUP1, VP16 and VP16-ER. Examples of repressible yeast promoters include Met25. Examples of constitutive yeast promoters include glyceraldehyde 3 -phosphate dehydrogenase promoter (GPD), phosphoglycerate kinase (PGK), alcohol dehydrogenase promoter (ADH), translation- elongation factor- 1 -alpha promoter (TEF), cytochrome c-oxidase promoter (CYC1), and MRP7. Promoters containing23DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMsteroid response elements (e.g., glucocorticoid response element) inducible by glucocorticoid or other steroid hormones can also direct expression in yeast. Yet other yeast constitutive or inducible promoters such as those of the genes for alpha factor, phosphate pathway genes (e.g., PH05), or alcohol oxidase may be used. In some embodiments, the vector comprises an expression control element known as an upstream activating sequence (UAS).

[0118] Additional yeast promoters which may be used in accordance with the present disclosure include RNA polymerase III promoters, e.g., SNR52 and the like. Further exemplary yeast promoters include pADHl, pTEFl, ScRNR2, pTEFl, pADHl, pTPIl, pHXT7, pTDH3, pPGKl, pPYKl, pHXT7, pGALl, and pGALlO. Such promoters are described, e.g., by Waterham et al., Gene. 1997 Feb 20;186(l):37-44, Partow et al., Yeast. 2010 Nov;27(l l):955-64, Microb Cell Fact. 2013 Sep 23: 12:82, Zha et al., PLoS One. 2013 Jul 2;8(7):e68317, Hector et al., N Biotechnol. 2019 Nov 25:53: 16-23, Sun et al., Biotechnol Bioeng. 2012 Aug;109(8):2082-92, and Silva & Srikrishnan, FEMS Yeast Res. 2012 Mar; 12(2): 197-214.

[0119] Such elements, which are considered functional equivalents of metazoan enhancers, can activate gene transcription from remote positions, e.g., up to about 1,000 - 1,200 bp from the promoter. See, e.g., Petrascheck, M, et al., Nucleic Acids Res., 33(12): 3743-3750, 2005, for discussion. The level of expression achieved using an inducible promoter can be regulated, e.g., by controlling the amount of inducing agent or the length of exposure. Further, mutant promoters that result in lower expression levels than a wild type promoter can be used. In some embodiments, an expression control element originates from a species in which the expression control element is to be used to direct expression while in other embodiments the expression control element originates from a different species.

[0120] In some embodiments, the recombinant vector is a plasmid, such as an integrating plasmid. In some embodiments, the plasmid is a pRS plasmid (e.g., pRS3O3, pRS304, pRS305 or pRS306 or other integrative plasmids). In some embodiments, the plasmid is an extrachromosomal plasmid (e.g., pRS313, pRS314, pRS315, pRS316, pRS413, pRS414, pRS415, pRS416, pRS423, pRS424, pRS425, pRS426). In some embodiments the plasmid is a member of the YES™ Vector Collection, e.g., pYES (Invitrogen, Carlsbad, CA). In some embodiments, the plasmid is a Gateway plasmid. See, e.g., Geiser. Biotechniques, 38:378-382 (2005); Van Mullem V, et al., Construction of a set of Saccharomyces cerevisiae vectors designed for recombinational cloning.24DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMSee, e.g., Alberti et al., Yeast, 2007;24(10):913-9. Such vectors are described in, e.g., W02011031319A8.

[0121] In some embodiments, the recombinant vector comprises an expression cassette comprising a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits female-specific lethal genes in D. suzukii larvae.

[0122] In some embodiments, the expression cassette comprises a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule, where the iRNA molecule is partially or perfectly complementary to mRNA transcribed from a DNA sequence represented by SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9 or SEQ ID NO:31, or a sequence having at least about 80%, 84%, 88%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9 or SEQ ID NO:31. In some embodiments, the expression cassette comprises a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule, where the DNA sequence is represented by SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO: 32, SEQ ID NO:35, or SEQ ID NO: 38 or a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, or 95% sequence identity to any of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO: 32, SEQ ID NO:35, or SEQ ID NO: 38 or the complement thereof. In some embodiments, the yeast promoter is a GPD promoter, alternatively referred to as a GAP, GADPH, or TDH3 promoter. The GPD promoter is a strong constitutive yeast expression promoter from glyceraldehyde 3-phosphage dehydrogenase.

[0123] In some embodiments, the DNA sequence encoding disclosed iRNA includes a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO: 32, SEQ ID NO:35, or SEQ ID NO: 38 or the complement thereof. In some embodiments, the DNA sequence encoding disclosed iRNA has about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO: 32, SEQ ID NO:35, or SEQ ID NO: 38 or the complement thereof. In some embodiments, the DNA sequence encoding disclosed iRNA includes a sequence that is 100% identical to the entire length of any of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID25DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMNO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO: 12 In some embodiments, a DNA construct comprising DNA encoding disclosed iRNA has double stranded DNA that is identical (100% identity) to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO:35, or SEQ ID NO: 38

[0124] Alternatively, techniques available to one of skill in the art may be used to achieve stable integration of the disclosed expression cassettes, such as stable transformation and expression into a host organism, e.g., Saccharomyces cerevisiae. Exemplary methods and techniques include transposon systems, e.g., PiggyBac, CRISPR, lithium acetate (LiAc)-based methodologies, electroporation, gene gun transformation, and protoplast transformation. Such methods are described in, e.g., Uetake & Niki, In Vitro Cell Dev Biol Anim. 2011 Dec;47(10):689- 94, Kildegaard et al., Yeast. 2019 May; 36(5): 237-247.

[0125] In some embodiments, the iRNA is produced by a host cell which can express the iRNA from a DNA construct or expression vector comprising an expression cassette comprising DNA encoding the iRNA. Suitable cells include, but are not limited to, a bacterial or yeast cell engineered to produce or express the iRNA from the encoding DNA sequence. Other suitable host cells, e.g., microorganism cells or plant cells, are known in the art. In some embodiments, the host cell expresses at least two unique iRNA molecules, alternatively at least three unique iRNA molecules, alternatively at least four unique iRNA molecules. In some embodiments, the host cell expresses from 1 to 10 unique iRNA molecules.

[0126] Host Cells Containing iRNA and Nucleic Acid Sequences Encoding the Same

[0127] In some aspects, provided herein are host cells comprising iRNA effective to inhibit the expression of a female specific gene in a larvae of SWD. In some embodiments, the host cell comprises an expression vector comprising nucleic acid sequences, such as DNA sequences, encoding iRNA effective to inhibit the expression of a gene in a female SWD larvae. In some embodiments, the host cell is a yeast cell, bacterial cell or plant cell. In some embodiments, the host cell is alive. In some embodiments, the host cell is dead.

[0128] In some embodiments, the host cell expresses at least one iRNA which targets a gene of interest for inhibition. In some embodiments, the host cell expresses at least two, three, four, or five iRNA molecules which target a gene of interest for inhibition. In some embodiments, the26DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMmicrobial host cell expresses any of from 1 to 15, 1 to 10, or 1 to 5 iRNA which target a gene of interest for inhibition. The iRNA molecules can be identical or distinct.

[0129] In some embodiments, the host cell expresses at least two unique iRNA that target a single gene, alternatively at least three unique iRNA that target a single gene, alternatively at least four RNA that target a single gene. In some embodiments, the host cell expresses at least two unique iRNA that target two different genes, alternatively at least three unique iRNA that target at least two different genes, alternatively at least three unique iRNA that target at least two different genes, alternatively at least three unique iRNA that target at least two different genes.

[0130] In one representative example, a microbial cell, such as a yeast cell, expresses at least two unique iRNA molecules that target female-specific genes tra-2, tra, dsx, and / or orthologs thereof. In some embodiments, a host cell expresses at least three unique iRNA molecules that the female-specific genes tra-2, tra, dsx and / or orthologs thereof. In some embodiments, a host cell expresses at least three unique iRNA molecules that target female-specific genes tra-2, tra, dsx and / or orthologs thereof. In some embodiments, a microbial cell expresses at least four unique iRNA molecules that target female-specific genes tra-2, tra, dsx and / or orthologs thereof.

[0131] In some embodiments, the host cells are stably transformed with nucleic acid sequences encoding iRNA. In some embodiments, a disclosed expression cassette is integrated into the genomic DNA of the microbial host cell, such as Saccharomyces cerevisiae. In some embodiments, DNA encoding disclosed iRNA is integrated into the genomic DNA of the microbial host cell, such as Saccharomyces cerevisiae. Stable transformants may be produced by incorporating a DNA construct comprising a nucleotide sequence encoding iRNA into the host cell genome. Methods of forming stable transformants of host cells are known in the art and include, e.g., transformation of integrative plasmids.

[0132] In some embodiments, a yeast cell comprises iRNA effective to inhibit the expression of a target gene in a SWD. In some embodiments, a bacterial cell comprises iRNA effective to inhibit the expression of a target gene in a SWD larvae. In some embodiments, the bacterial cell is Escherichia coll, Bacillus thuringiensis israelensis, or Lactobacillus spp., among others. In some embodiments, a plant cell comprises iRNA effective to inhibit the expression of a target gene in a female SWD larvae.

[0133] In some embodiments, a yeast cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a target gene in a SWD. In some embodiments, a bacterial27DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMcell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a target gene in a SWD. In some embodiments, the bacterial cell is Escherichia coli. In some embodiments, a plant cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a target gene in a female SWD larvae.

[0134] In some embodiments, a yeast cell comprises iRNA effective to inhibit the expression of a target gene in a SWD. In some embodiments, the yeast cell is a species of Saccharomyces . In some embodiments, the yeast cell is Saccharomyces cerevisiae. In some embodiments, a Saccharomyces cerevisiae cell comprises iRNA effective to inhibit the expression of a target gene in a female SWD larvae. Other suitable host cells will be evident to one of skill in the art. The host cell may be alive or dead. In some embodiments, the host cell is spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium.

[0135] In some embodiments, a host cell includes a DNA sequence encoding iRNA effective to inhibit the expression of female-specific lethal gene or orthologs thereof, in a SWD larvae. In some embodiments, the target gene includes a DNA sequence represented by any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9

[0136] In some embodiments, a host cell contains an expression vector including a DNA sequence encoding iRNA effective to inhibit the expression of a female-specific lethal gene or ortholog thereof, in a SWD. In some embodiments, the expression vector encodes at least one iRNA molecule that is partially or completely complementary to mRNA transcribed from SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9

[0137] In some embodiments, the host cell contains an expression vector that includes an expression cassette containing a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of any one of S SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO: 12, or the complement thereof operably linked to a promoter. In some embodiments, the expression vector contains an expression cassette including a DNA sequence represented by the entire length of any of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID28DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMNO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, operably linked to a promoter. In some embodiments, the expression vector comprises double stranded DNA that is identical (100% identity) to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO: 12

[0138] In some embodiments, a host cell includes a DNA sequence encoding iRNA effective to inhibit the expression of female-specific lethal gene or orthologs thereof, in a SWD larvae. In some embodiments, the target gene includes a DNA sequence represented by any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9

[0139] In some embodiments, a host cell contains an expression vector including a DNA sequence encoding iRNA effective to inhibit the expression of a male-specific lethal gene or ortholog thereof, in a SWD. In some embodiments, the expression vector encodes at least one iRNA molecule that is partially or completely complementary to mRNA transcribed from SEQ ID NO:31, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of SEQ ID NO:31.

[0140] In some embodiments, the host cell contains an expression vector that includes an expression cassette containing a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of any one of SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40, or the complement thereof operably linked to a promoter. In some embodiments, the expression vector contains an expression cassette including a DNA sequence represented by the entire length of any of SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40, operably linked to a promoter. In some embodiments, the expression vector comprises double stranded DNA that is identical (100% identity) to the entire length of SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40

[0141] Host cells are preferably killed or inactivated in a manner that maintains the ability of the host cell to act as a food source and larvicide, i.e., the inactivation does not disrupt the iRNA molecules contained within said host cell. In some embodiments, the iRNA can be purified from29DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMthe host cell before incorporating into the compositions. Suitable methods of killing or inactivating the host cell are known in the art, and include, but are not limited to, heat-inactivation, high pressure, plasma treatment at atmospheric pressure, sonication, low-amperage electric treatment, or dense phase carbon dioxide processing.

[0142] Compositions

[0143] In some aspects, provided herein are compositions comprising iRNA effective to inhibit the expression of a gene in female SWD larvae. In additional aspects, provided are compositions comprising nucleic acid sequences, such as DNA sequences, encoding iRNA effective to inhibit the expression of a gene in female SWD larvae. In further aspects, provided are compositions comprising microbial cells comprising disclosed iRNA and nucleic acid sequences encoding the same. Also provided are compositions further comprising an insect larvae food media, including Drosophila fly food media, such as semi-defined food (https: / / bdsc.indiana.edu / information / recipes / germanfood.html) in addition to the disclosed iRNA, nucleic acid sequences encoding the iRNA, and microbial host cells comprising the same. In some instances, the yeast in the food recipe can be replaced by iRNA yeast. In other instances, the yeast could be added to this food or a comparable fly food media. In other aspects, the iRNA is incorporated into the larvae food media as naked ds RNA molecules. In further aspects, the iRNA bound to or encapsulated by nanoparticles prior to incorporation into the larvae food media.

[0144] In some embodiments, a disclosed composition comprises two or more unique iRNA molecules, wherein the two or more iRNA molecules are present on, such as encoded by, the same nucleic acid construct, on different nucleic acid constructs, or any combination thereof. In some embodiments, a disclosed composition comprises two or more nucleic acid sequences, such as DNA sequences, wherein the two or more nucleic acid sequences each encode a different interfering RNA molecule. In some embodiments, the naked dsRNA could be added to the food directly.

[0145] In some embodiments, a disclosed composition comprises bacterial cells, yeast cells or a combination thereof. In some embodiments, a disclosed composition comprises nanoparticles, e.g., chitosan nanoparticles. In some embodiments, a disclosed composition is suitable for incorporation into Drosophila media. Thus, compositions may include the necessary components to deliver the iRNA to insects, such as D. suzukii. For example, compositions may comprise nanoparticles, bacterial cells, yeast cells, and the like that contain or express the iRNA.30DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0146] Microbial Host Cell Compositions

[0147] In some aspects, provided are compositions comprising a microbial cell containing an expression cassette comprising a promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits expression of a target gene in a SWD. In some embodiments, the microbial cell is a yeast cell, a bacterial cell, or a plant cell. In preferred embodiments, the microbial cell is a yeast cell.

[0148] In some embodiments, the composition comprises a yeast cell engineered to produce iRNA effective to inhibit expression of a target gene in a SWD. In some embodiments, the composition comprises a bacterial cell engineered to produce iRNA effective to inhibit expression of a target gene in a SWD. In some embodiments, the composition comprises a plant cell engineered to produce iRNA effective to inhibit expression of a target gene in a SWD, where the target gene encodes a sex-specific lethal gene or an ortholog thereof.

[0149] In some embodiments, a target sequence is represented by any one of SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9 or SEQ ID NO:31, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9, or SEQ ID NO:31.

[0150] In some embodiments, any of the yeast, bacterial or plant cell are alive. In other embodiments, any of the yeast, bacterial, or plant cell are dead. In additional embodiments, any of the yeast, bacterial, or plant cell is killed by heat, such as heat-killed, and / or lyophilized. In some embodiments, any of the yeast, bacterial, or plant cell is synthesized into a ready -to use dry formulation.

[0151] In some embodiments, disclosed compositions comprise Saccharomyces cerevisiae comprising an expression vector comprising DNA sequences encoding iRNA effective to inhibit the expression of a target gene in female D. suzukii larvae. In some embodiments, the target gene includes a DNA sequence represented by any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9

[0152] In some embodiments, disclosed compositions comprise Saccharomyces cerevisiae comprising an expression vector comprising DNA sequences encoding iRNA effective to inhibit the expression of a target gene in male D. suzukii larvae. In some embodiments, the target gene31DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMincludes a DNA sequence represented by SEQ TD NO:31, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of SEQ ID NO:31.[001531 In some embodiments, disclosed compositions comprise Saccharomyces cerevisiae comprising an expression vector which includes an expression cassette comprising a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40, or the complement thereof operably linked to a promoter. In some embodiments, the expression vector comprises an expression cassette comprising SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40, or the complement thereof operably linked to a promoter. In some embodiments, the recombinant vector is an extrachromosomal plasmid, such as a pRS426 GPD vector. In some embodiments, the extrachromosomal plasmid has a GPD promoter. In some embodiments, the 5. cerevisiae cell is heat-killed and / or lyophilized.

[0154] In some embodiments, disclosed compositions further comprise at least one suitable carrier, excipient, or diluent, such as an agriculturally acceptable carrier, excipient, or diluent. In some embodiments, disclosed compositions further comprise an attractant, phagostimulant, or an insecticide. In preferred embodiments, disclosed compositions further comprise an attractant, e.g., a sugar bait, such as an attractive sugar targeted bait.

[0155] In some embodiments, disclosed compositions are larvicidal. In some embodiments, upon contact with a female SWD larvae, the disclosed compositions result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 100% mortality in female larvae, including any and all numerical values and ranges in between.

[0156] In some embodiments, disclosed compositions are larvicidal. In some embodiments, upon contact with a male SWD larvae, the disclosed compositions result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about32DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM80%, at least about 90%, at least about 95%, at least about 98%, or at least about 100% mortality in male larvae, including any and all numerical values and ranges in between.

[0157] Attractants, Phagostimulants, and Insecticides

[0158] In some embodiments, the disclosed compositions are effective to inhibit expression of a target gene in a female SWD larvae by RNA interference (RNAi). In some embodiments, the compositions comprise any of disclosed iRNA, nucleic acid sequences encoding said iRNA, constructs comprising the iRNA and nucleic acid sequences encoding the same, expression vectors comprising the nucleic acid sequences, expression cassette comprising the nucleic acid sequences operably linked to a promoter, and microbial cells containing the preceding in any combination. In some embodiments, a disclosed composition further comprises an attractant, Drosophila larva nutrition medium and / or feeding medium or a combination thereof.

[0159] In some embodiments, the compositions further comprising an attractant, Drosophila larva nutrition medium and / or feeding medium or a combination thereof are larvicidal to female larva. In some embodiments, upon contact with an female SWD larva having a target gene, the disclosed compositions result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 100% mortality of female larva, including any and all numerical values and ranges in between.

[0160] Methods

[0161] In some aspects, provided herein are methods of using a disclosed polynucleotide, expression cassette, host organism, such as an interfering RNA biopesticide composition, or a combination thereof, in the control of female SWD populations. In some embodiments, disclosed methods involve contacting a SWD with a disclosed polynucleotide, expression cassette, host organism, composition, or a combination thereof, such that contacting the SWD leads to consumption by the SWD larva. The terms “control,” “controlling,” and the like, refer to, e.g., preventing proliferation and / or survival of female SWD larva populations. In some embodiments, the method comprises contacting the SWD larva with a microbial cell comprising the nucleic acid sequence that is or is capable of producing an iRNA effective to inhibit expression of a target gene in the female SWD larva.

[0162] In some aspects, provided herein are methods of using a disclosed polynucleotide, expression cassette, host organism, such as an interfering RNA biopesticide composition, or a33DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMcombination thereof, in the control of male SWD populations. In some embodiments, disclosed methods involve contacting a SWD with a disclosed polynucleotide, expression cassette, host organism, composition, or a combination thereof, such that contacting the SWD leads to consumption by the SWD larva. The terms “control,” “controlling,” and the like, refer to, e.g., preventing proliferation and / or survival of male SWD larva populations. In some embodiments, the method comprises contacting the SWD larva with a microbial cell comprising the nucleic acid sequence that is or is capable of producing an iRNA effective to inhibit expression of a target gene in the male SWD larva.

[0163] In some aspects provided herein are methods of using a disclosed polynucleotide, expression cassette, host organism, such as an interfering RNA biopesticide composition, or a combination thereof, in the control of male SWD populations through transfer of the interfering RNA to the egg through contact of the iRNA to the female SWD prior to egg production. The transfer of the iRNA through the female results in a reduced number of male adult progeny. Sexspecific selection was transferred through the mother SWD to her progeny.

[0164] Herein, reference to a / J. siizukii generally includes reference to different stages of life, such as egg, larva (caterpillar), pupa, and adult phases thereof. However, in specific embodiments, disclosed methods involve contacting larva (caterpillar) with a disclosed polynucleotide, expression cassette, host organism, composition, or a combination thereof. Additionally, herein, contacting a SWD larva can encompass consumption of the disclosed polynucleotide, expression cassette, host organism, composition, or a combination thereof by the SWD larva or feeding of the same to the SWD larva.

[0165] In some embodiments, the disclosed methods comprise contacting the SWD with a microbial cell comprising a nucleic acid sequence that is or is capable of producing an iRNA effective to inhibit expression of a target gene in the female SWD larva. In some embodiments, the microbial cell is a yeast cell, a bacterial cell, or a plant cell. In preferred embodiments, the microbial cell is a yeast cell.

[0166] In some embodiments, the disclosed methods comprise contacting a SWD larva with a yeast cell engineered to produce iRNA effective to inhibit expression of a target gene in a female SWD larva. In some embodiments, the disclosed methods comprise contacting a SWD with a bacterial cell engineered to produce iRNA effective to inhibit expression of a target gene in a female SWD larva. In some embodiments, the disclosed methods comprise contacting a SWD with34DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMa plant cell engineered to produce iRNA effective to inhibit expression of a target gene in a female SWD larva.

[0167] In some embodiments, the target gene includes a DNA sequence represented by any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9

[0168] In some embodiments, disclosed methods comprise contacting a SWD larva with a yeast cell comprising an expression cassette comprising a nucleotide sequence encoding iRNA. In some embodiments, the iRNA is perfectly or partially complementary to a portion of mRNA sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9. In some embodiments, the iRNA is perfectly or partially complementary to a portion of mRNA represented by any one of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9

[0169] In some embodiments, the disclosed methods comprise contacting a SWD larva with a yeast cell comprising an expression cassette comprising a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or the complement thereof, operably linked to a promoter. In some embodiments, the disclosed methods comprise contacting a SWD larva with a yeast cell comprising an expression cassette comprising SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, or the complement thereof operably linked to a promoter. In some embodiments, the expression cassette is integrated into the genome of the yeast cell. In some embodiments, the expression cassette is included in a recombinant vector, e.g., a pRS426 vector. The recombinant vector can include a GPD promoter.

[0170] In some embodiments, the disclosed methods comprise contacting a SWD larva with a yeast cell engineered to produce iRNA effective to inhibit expression of a target gene in a male SWD larva. In some embodiments, the disclosed methods comprise contacting a SWD with a bacterial cell engineered to produce iRNA effective to inhibit expression of a target gene in a male SWD larva. In some embodiments, the disclosed methods comprise contacting a SWD with a plant35DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMcell engineered to produce iRNA effective to inhibit expression of a target gene in a male SWD larva.

[0171] In some embodiments, the target gene includes a DNA sequence represented by SEQ ID NO:31, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of SEQ ID NO:31.

[0172] In some embodiments, disclosed methods comprise contacting a SWD larva with a yeast cell comprising an expression cassette comprising a nucleotide sequence encoding iRNA. In some embodiments, the iRNA is perfectly or partially complementary to a portion of mRNA sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of SEQ ID NO:31. In some embodiments, the iRNA is perfectly or partially complementary to a portion of mRNA represented by SEQ ID NO:31.

[0173] In some embodiments, the disclosed methods comprise contacting a SWD larva with a yeast cell comprising an expression cassette comprising a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO: 39, or SEQ ID NO: 40, or the complement thereof, operably linked to a promoter. In some embodiments, the disclosed methods comprise contacting a SWD larva with a yeast cell comprising an expression cassette comprising SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40, or the complement thereof operably linked to a promoter. In some embodiments, the expression cassette is integrated into the genome of the yeast cell. In some embodiments, the expression cassette is included in a recombinant vector, e.g., a pRS426 vector. The recombinant vector can include a GPD promoter.

[0174] In some embodiments, the disclosed methods comprise contacting a SWD, such that contacting the D. suzukii insect involves consumption or ingestion by the D. suzukii larva (caterpillar) with a dead microbial host cell as disclosed herein, as a microbial host that has been spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium. In some embodiments, contacting the SWD comprises consumption by mouth of the microbial host cell the by the SWD. In some embodiments, it is preferred that the microbial host cell is heat inactivated to reduce or eliminate the ability of the microbial host cell to grow once released into Drosophila incubation area.36DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0175] In some embodiments, the disclosed methods further comprise contacting the SWD larva with Drosophila media that includes a bait, such as a sugar bait, to enhance consumption of the larva food containing the sequences and / or host of the present invention. In some embodiments, the attractant comprises any of an attractive microbe, such as an attractive symbiont microbe, sugar, or a combination thereof.

[0176] In some embodiments, the disclosed methods result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 100% mortality of a single sex of larvae in a D. suzukii population, including any and all numerical values and ranges in between.EXAMPLES

[0177] Example 1: Female-Specific Lethal Gene

[0178] Target Site selection: Exemplary female-specific lethal genes in D. suzukii were identified. Putative selections were evaluated through BLAST to assess the conservation of female-specific genes in D. suzukii with known lethality in other insect species, such as mosquito species, and shRNA expression cassettes were designed on the basis of the BLAST studies. Exemplary target sites and shRNA expression cassette sequences include the following.

[0179] SEQ ID NO:2 - Dsuztra2 A Target Site:5’ - CTGCTTCATCTACTTTGAGAATCTC-3’

[0180] Dsuztra2_A Hairpin expression cassette

[0181] SEQ ID NO: 13 - Forward strand:5’-GATCCCTGCTTCATCTACTTTGAGAATCTCTTCAAGAGAGAGATTCTCAAAGTAGATGAAGCAGTTTTTTC - 3’

[0182] SEQ ID NO: 14 - Reverse strand:5’-TCGAGAAAAAACTGCTTCATCTACTTTGAGAATCTCTCTCTTGAAGAGATTCTCAAAGTAGATGAAGCAGG - 3’37DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0183] SEQ ID NO:3 - Dsuztra2 B Target Site:5 CATTGGAGTCTTTGGTCTGAACACC -3’

[0184] Dsuztra2_B Hairpin expression cassette

[0185] SEQ ID NO: 15 - Forward strand:5’GATCCCATTGGAGTCTTTGGTCTGAACACCTTCAAGAGAGGTGTTCAGACCAAAGACTCCAATGTTTTTTC - 3’

[0186] SEQ ID NO: 16 - Reverse strand:5’TCGAGAAAAAACATTGGAGTCTTTGGTCTGAACACCTCTCTTGAAGGTGTTCAGACCAAAGACTCCAATGG - 3’

[0187] SEQ ID NO:4 - Dsuztra2 C Target Site:5’ - GGAATCGAACCCTTAAAGATGTCCT -3’

[0188] Dsuztra2_C Hairpin expression cassette

[0189] SEQ ID NO: 17 - Forward strand:5’ -GATCCGGAATCGAACCCTTAAAGATGTCCTTTCAAGAGAAGGACATCTTTAAGGGTTCGATTCCTTTTTTC - 3’

[0190] SEQ ID NO: 18 - Reverse strand:5’ -TCGAGAAAAAAGGAATCGAACCCTTAAAGATGTCCTTCTCTTGAAAGGACATCTTTAAGGGTTCGATTCCG - 3 ’

[0191] SEQ ID NO: 6 - Dsuztra_A Target Site:5’ - GAAGCTAAGTAACATTTTTCAACCC - 3’

[0192] Dsuztra A Hairpin expression cassette

[0193] SEQ ID NO: 19 - Forward strand:5: -GATCCGAAGCTAAGTAACATTTTTCAACCCTTCAAGAGAGGGTTGAAAAATGTTACTTAGCTTCTTTTTTC 3’

[0194] SEQ ID NO: 20 - Reverse strand:38DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM5’ - TCGAGAAAAAAGAAGCTAAGTAACATTTTTCAACCCTCTCTTGAAGGGTTGAAAAATGTTACTTAGCTTCG- 3’

[0195] SEQ ID NO: 7 - Dsuztra_B Target Site:5’ - TTGTGAAGAAACTGAAGCTAAGTAA- 3’

[0196] Dsuztra B Hairpin expression cassette

[0197] SEQ ID NO: 21 - Forward strand:5: -GATCCTTGTGAAGAAACTGAAGCTAAGTAATTCAAGAGATTACTTAGCTTCAGTTTCTTCACAATTTTTTC 3’

[0198] SEQ ID NO: 22 - Reverse strand:5’ -TCGAGAAAAAATTGTGAAGAAACTGAAGCTAAGTAATCTCTTGAATTACTTAGCTTCAGTTTCTTCACAAG - 3’

[0199] SEQ ID NO: 8 - Dsuztra_C Target Site:5’ - CAGGATTTCTACGTTAGTAAATTAC- 3’

[0200] Dsuztra C Hairpin expression cassette

[0201] SEQ ID NO: 23 - Forward strand:5: -GATCCCAGGATTTCTACGTTAGTAAATTACTTCAAGAGAGTAATTTACTAACGTAGAAATCCTGTTTTTTC - 3’

[0202] SEQ ID NO: 24 - Reverse strand:5’ -TCGAGAAAAAACAGGATTTCTACGTTAGTAAATTACTCTCTTGAAGTAATTTACTAACGTAGAAATCCTGGG - 3’

[0203] SEQ ID NO: 10 - Dsuzdsx A Target Site:5’ - GCAAGTTCCGCTACTGCACTTGCGA- 3’

[0204] Dsuzdsx A Hairpin expression cassette

[0205] SEQ ID NO: 25 - Forward strand:39DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM5: -GATCCGCAAGTTCCGCTACTGCACTTGCGATTCAAGAGATCGCAAGTGCAGTAGCGGAACTTGCTTTTTTC - 3’

[0206] SEQ ID NO: 26 - Reverse strand:5’ -TCGAGAAAAAAGCAAGTTCCGCTACTGCACTTGCGATCTCTTGAATCGCAAGTGCAGTAGCGGAACTTGCG - 3’

[0207] SEQ ID NO: 11 - Dsuzdsx B Target Site: 5’ - CAAGAATCTTACATATATCGATCGA- 3’

[0208] Dsuzdsx B Hairpin expression cassette

[0209] SEQ ID NO: 27 - Forward strand:5: -GATCCCAAGAATCTTACATATATCGATCGATTCAAGAGATCGATCGATATATGTAAGATTCTTGTTTTTTC - 3’

[0210] SEQ ID NO: 28 - Reverse strand:5’ -TCGAGAAAAAACAAGAATCTTACATATATCGATCGATCTCTTGAATCGATCGATATATGTAAGATTCTTGG - 3 ’

[0211] SEQ ID NO: 12 - Dsuzdsx C Target Site:5’ - GTGACGACTATTCATTGATATTTAA- 3’

[0212] Dsuzdsx C Hairpin expression cassette

[0213] SEQ ID NO: 29 - Forward strand: 5: -GATCCGTGACGACTATTCATTGATATTTAATTCAAGAGATTAAATATCAATGAATAGTCGTCACTTTTTTC - 3’

[0214] SEQ ID NO: 30 - Reverse strand:5’ -TCGAGAAAAAAGTGACGACTATTCATTGATATTTAATCTCTTGAATTAAATATCAATGAATAGTCGTCACG 3’

[0215] Example 2: Yeast iRNA biopesticide strains induce mortality in the female D. suzukii larva40DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0216] Exemplary heat-killed iRNA biopesticides were evaluated in D. suzukii for their effects on larval survival. Exemplary D. suzukii ingested disclosed iRNA biopesticides and effects on larval mortality were monitored.

[0217] Yeast preparation: The shRNA expression cassettes were cloned into the pRS426 GPD vector, and yeast was prepared as described (Mysore et al., Methods Mol Biol. 2019: 1858:213- 231). I In summary, custom-synthesized DNA oligonucleotides were obtained from Invitrogen Life Technologies (Carlsbad, CA, USA). The oligonucleotides were then cloned into the nonintegrating pRS426 GPD yeast shuttle vector (Mumberg et al., Gene. 1995 Apr 14; 156(1): 119-22) downstream of a GPD promoter. The sequence of the hairpin expression cassette was confirmed by sequencing, and S. cerevisiae strain CEN.PK yeast (genotype MATa / a ura3-52 / ura3-52 trpl- 289 / trpl-289 leu2-3_l 12 / leu2-3_l 12 his3 Al / his3 Al MAL2-8C / MAL2-8C SUC2 / SUC2; van Dijken et al., 2000) was transformed with the URA3+ marked plasmid, with transformants selected through growth on uracil-deficient minimal media. The S. cerevisiae strain CEN.PK yeast has been described, e.g., by van Dijken et al., Enzyme Microb TechnoL 2000;26(9-10):706-14. Following strain construction, the yeasts were cultured and heat-killed as described (Mysore et al., Methods Mol Biol. 2019: 1858:213-231), and pelleted yeast was then lyophilized using a Labconco FreeZone 6 L Console Freeze Dryer (Labconco, Kansas City, MO, USA). Control yeast from a previously constructed strain (Hapairai et al., Sci Rep. 2017 Oct 16;7(1): 13223) was prepared in a similar manner. The lyophilized yeasts were utilized in insecticide assays following the procedure described below.

[0218] Preparation of yeast-food mixture: Bottles with fly media (Bronnec and Alexeyev, 2022) were prepared for this experiment. Using autoclaved tooth-picks, 8-10 holes ~5 mm deep were punched in the food bottles. For each treatment, 40 mg of control or insecticidal yeast was added to a 1.5 ml plastic tube. To this, 100 pl of 10% sucrose solution containing 4.5% of red dye (ASB-Attractive Sugar Bait)was added and mixed well using a toothpick. Using a 200 pl pipette, this solution was added onto the holes in the food bottles. For the wildtype control, 100 pl of ASB was used. The bottles were allowed to stand for 10-15 min to let the solution settle.

[0219] Laboratory Insecticide Trial Methodologies: Drosophila suzukii were obtained from Michigan State University. The insects were housed in a 26o C incubator. To the prepared bottles, unmated males and females in the ratio of 1:2.5 (20 males and 50 females) were added following anesthetization using ice. The bottles were kept in a horizontal position until all the flies recovered.41DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMOnce the flies were recovered, they were kept in their enclosures and allowed to mate and lay eggs for 5 days. After five days, the flies were transferred onto a new set of food bottles as prepared above (2-6), and they were permitted to lay eggs for five more days. Both sets of bottles were monitored for adult emergence for up to 24 days (from the time when adults were added) and were sexed as they emerged. At the end of the experiment, sex ratios were calculated using the method described in Mysore et al. (2022).

[0220] Larvicide Trials: FIG. 1 shows the mortality rates resulting from D. suzukii consumption of yeast strains Dsuz.tra-A, Dsuz.dsx-A, Dsuz.tra2-A, which express shRNAs targeting the D. suzukii tra, dsx, and tra2 genes, respectively vs. control treatment. Oral consumption of the three insecticides resulted in significant loss of D. suzukii female larvae Consumption of the yeast was confirmed through presence of the red dye marker in the abdomen of the larvae.

[0221] Example 3: Male Specific Lethal-2 Gene

[0222] Using the methods described above, yeast strains were prepared containing a hairpin expression cassette for msl-2A (SEQ ID NO:33 and SEQ ID NO:34), msl-2B (SEQ ID NO:36-37) or msl-2C (SEQ ID NO: 39-40).

[0223] Three to four day old Drosophila suzukii individuals were starved for 4-5 hours in an empty bottle. 40 mg of control and treatment yeast was mixed with attractive sugar bait (ASB) containing 100 pL of a pre-made 10% sucrose solution with 4.5% red food dye in 1.5 ml tubes. ~25 pl drops of yeast+ASB mixture was dispensed onto a 150 mm petri dish. To this, 20 females and males were added, and the dish was covered. They were allowed to recover and feed overnight at room temperature (~21±1°C). The next morning, once feeding was confirmed by checking individual abdomens for red color, flies were anaesthetized using ice and carefully transferred into bottles / vials containing fly food. They were allowed to mate and lay eggs for 4 days, after which the adults were removed from the bottle. Eggs in both sets of bottles were kept in an incubator or insect room with constant temperature of 26°C with a 12 h light / dark cycle. As the eggs develop and adults emerged, they were sexed.42DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0224] As shown in FIG. 2, significantly higher female:male sex ratios were observed in the three treatments with respect to the control RNAi yeast. These result suggest that parental RNAi had occurred, and that msl-2 is required for female survival.EQUIVALENTS AND SCOPE

[0225] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present invention is not intended to be limited to the above, but rather is as set forth in the appended claims.

[0226] In the claims articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[0227] Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses and descriptive terms, from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim.

[0228] Where elements are presented as lists, e.g., in Markush group format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where the invention, or aspects of the invention is / are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the term “comprising” is intended to be open and permits the inclusion of additional elements or steps.43DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

[0229] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranged can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0230] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of the ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5% or up to 1% of a given value. Alternatively, the term can mean within an order of magnitude, for example within 5-fold, or within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0231] In addition, it is to be understood that any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the method of the invention can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.

[0232] Sequence Table44DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM45DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM46DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM47DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM48DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM49DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM50DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM51DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMDMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM

Claims

CLAIMSI claimClaim 1. An interfering ribonucleic acid comprising a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a DNA sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9; and wherein the interfering RNA inhibits the expression of one or more female-specific lethal genes in 1). suzukii female larvae by RNA interference.Claim 2. The interfering RNA of claim 1, wherein the interfering RNA is an RNA construct, a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.Claim 3. The interfering RNA of claim 1 or claim 2, wherein the interfering RNA is an shRNA.Claim 4. The interfering RNA of claim 1 or 2, comprising a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or the complement thereofClaim 5. An expression cassette comprising a regulatory sequence operably linked to a nucleotide sequence which encodes an interfering RNA molecule comprising a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9, and wherein the interfering RNA inhibits the expression of one or more female-specific lethal genes in D. suzukii female larvae by RNA interference.53DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMClaim 6. The expression cassette of claim 5, wherein the nucleotide sequence of the interfering RNA molecule comprises 25 nucleotides which are partially or perfectly complementary to mRNA transcribed from a sequence represented by SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9.Claim 7. The expression cassette of claim 5 or claim 6, comprising a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, or the complement thereofClaim 8. The expression cassette of any one of claims 5 to 7, wherein the regulatory sequence comprises a yeast promoter.Claim 9. The expression cassette of any one of claims 5 to 8, wherein the expression cassette is integrated into the genomic DNA of a yeast cell.Claim 10. A vector comprising the expression cassette of any one of claims 5 to 9.Claim 11. A microbial cell or plant cell comprising the expression cassette or the vector of any one of claims 5 to 10.Claim 12. The microbial cell or plant cell of claim 11, wherein the expression cassette is integrated into the genomic DNA of the microbial cell or plant cell.Claim 13. The microbial cell of claim 11 or claim 12, wherein the microbe is Saccharomyces cerevisiae or Escherichia coli.Claim 14. A composition comprising the interfering RNA of any one of claims 1 to 4, the expression cassette of any one of claims 5 to 9, the vector of claim 10, the microbial cell or plant cell of any one of claims 11 to 13, or a combination thereof.54DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMClaim 15. A composition comprising an interfering RNA molecule which is partially or perfectly complementary to mRNA transcribed from a target gene, wherein the target gene encodes a female-specific lethal protein in a. J). suzukii larvae and the interfering RNA specifically inhibits expression of the target gene.Claim 16. The composition of claim 15, wherein the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an antisense oligonucleotide.Claim 17. The composition of claim 15 or claim 16, wherein the interfering RNA is a short hairpin RNA (shRNA).Claim 18. The composition of claims 15 to 17 wherein the interfering RNAmolecule is incorporated in an expression cassette comprising a promoter operably linked to a DNA sequence encoding the interfering RNA molecule.Claim 19. The composition of claim 15 to 17 wherein the interfering RNA molecule is bound to a nanoparticle.Claim 20. The composition of any one of claims 15 to 19, wherein the target gene comprises a sequence having at least about 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9, or the complement thereof.Claim 21. The composition of any one of claims 15 to 20, wherein the interfering RNA comprises a nucleotide sequence having at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, or the complement thereof.55DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMClaim 22. The composition of any one of claims 15 to 21, wherein the interfering RNA comprises the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6,SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12Claim 23. The composition of any one of claims 15 to 22, wherein the interfering RNA comprises a nucleotide sequence of at least 25 contiguous nucleotides which are partially or perfectly complementary to mRNA transcribed from SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9, or the complement thereof; or a DNA sequence having at least about or 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or the complement thereof; and wherein the interfering RNA is capable of inhibiting the expression of one or more female-specific lethal genes in D. suzukii female larvae by RNA interference.Claim 24. The composition of any one of claims 15 to 21, wherein the interfering RNA is integrated into the genome of a yeast cell.Claim 25. The composition of claim 22, wherein the yeast cell is Saccharomyces cerevisiae.Claim 26. The composition of claim 24 or claim 25, wherein the yeast cell is spray-dried, heat-killed, lyophilized, or suspended in larval food media.Claim 26. A method for producing a male D. suzukii population, comprising contacting the D. suzukii larvae population with interfering RNA of any one of claims 1 to 4, the expression cassette of any one of claims 5 to 9, the vector of claim 10, the microbial cell or plant cell of any one of claims 11 to 13, or the composition of any one of claims 15 to 25, wherein contacting the D. suzukii larvae population comprises one or more D. suzukii larvae in the population ingesting the interfering RNA, the expression cassette, the vector, the microbial cell or plant cell, or the composition, thereby inhibiting development of female larvae in the D. suzukii population.56DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMClaim 27. The method of claim 26, wherein the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.Claim 28. The method of claim 26 or 27, wherein the interfering RNA is a short hairpin RNA (shRNA).Claim 29. An interfering ribonucleic acid where the interfering RNA is a dsRNA of greater than 300 nucleotides, wherein a portion of the dsRNA nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a DNA sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:5, or SEQ ID NO:9 ; and wherein the interfering RNA inhibits the expression of one or more femalespecific lethal genes in Drosophila suzukii female larvae by RNA interference.Claim 30. The interfering RNA of claim 29, comprising a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or the complement thereofClaim 31. An interfering ribonucleic acid comprising a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a DNA sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:3; and wherein the interfering RNA inhibits the expression of one or more male-specific lethal genes in D. suzukii female larvae by RNA interference.Claim 32. The interfering RNA of claim 31, wherein the interfering RNA is an RNA construct, a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.57DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMClaim 33. The interfering RNA of claim 31 or claim 32, wherein the interfering RNA is an shRNA.Claim 34. The interfering RNA of claim 31 or 32, comprising a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40, or the complement thereof.Claim 35. An expression cassette comprising a regulatory sequence operably linked to a nucleotide sequence which encodes an interfering RNA molecule comprising a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:31, and wherein the interfering RNA inhibits the expression of one or more male-specific lethal genes in D. suzukii male larvae by RNA interference.Claim 36. The expression cassette of claim35, wherein the nucleotide sequence of the interfering RNA molecule comprises 25 nucleotides which are partially or perfectly complementary to mRNA transcribed from a sequence represented by SEQ ID NO:31.Claim 37. The expression cassette of claim 35 or claim 36, comprising a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40, or the complement thereof.Claim 38. The expression cassette of any one of claims 35 to 37, wherein the regulatory sequence comprises a yeast promoter.58DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PMClaim 39. The expression cassette of any one of claims 35 to 38, wherein the expression cassette is integrated into the genomic DNA of a yeast cell.Claim 40. A vector comprising the expression cassette of any one of claims 35 to 39.Claim 41. A microbial cell or plant cell comprising the expression cassette or the vector of any one of claims 35 to 40.Claim 42. The microbial cell or plant cell of claim 41, wherein the expression cassette is integrated into the genomic DNA of the microbial cell or plant cell.Claim 43. The microbial cell of claim 41 or claim 42, wherein the microbe is Saccharomyces cerevisiae or Escherichia coli.59DMS_US.374341340.1 - 1 1 / 7 / 2025 2:54:44 PM