RHAM probe-based loop-mediated isothermal amplification primer set for detecting mycoplasma pneumoniae and macrolide-resistant point mutations thereof, and detection method using same
The LAMP primer and probe set allows for rapid and accurate detection of Mycoplasma pneumoniae and macrolide resistance mutations using isothermal amplification and fluorescent probes, addressing the limitations of existing diagnostic methods.
Patent Information
- Application Number
- PCT/KR2025/017605
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-10-29
- Filing Date
- 2025-10-30
- Publication Date
- 2026-05-28
AI Technical Summary
Current methods for diagnosing Mycoplasma pneumoniae infection and macrolide resistance are slow, require complex equipment, and are not suitable for Point-of-Care Testing (POCT), necessitating a rapid and accurate diagnostic solution.
A set of Loop-mediated Isothermal Amplification (LAMP) primers and Ribonuclease HII (RNase HII)-cleavable probes targeting specific sequences of the 23S rRNA gene for simultaneous detection of Mycoplasma pneumoniae and macrolide-resistant mutations, utilizing isothermal amplification and fluorescent signal detection.
Enables rapid, accurate, and sensitive detection of Mycoplasma pneumoniae and macrolide resistance mutations within 30 minutes without specialized equipment, ensuring high specificity and sensitivity.
Smart Images

Figure KR2025017605_28052026_PF_FP_ABST
Abstract
Description
RHAM probe-based ring-mediated isothermal amplification primer set for detection of Mycoplasma pneumoniae and its macrolide-resistant point mutations and detection method using the same
[0001] The present invention relates to a composition and a method for rapidly and accurately diagnosing Mycoplasma pneumoniae.
[0002] Mycoplasma pneumoniae is a major causative agent of atypical pneumonia and an important respiratory infection pathogen accounting for approximately 10–30% of all community-acquired pneumonia cases. Since Mycoplasma pneumoniae lacks a cell wall and possesses natural resistance to beta-lactam antibiotics, macrolide antibiotics that inhibit protein synthesis are primarily used for treatment.
[0003] Macrolide antibiotics exert their antibacterial effects by binding to Domain V of 23S ribosomal RNA (rRNA), which constitutes the 50S ribosomal subunit of bacteria, thereby inhibiting protein synthesis. However, there has recently been a global surge in bacterial strains exhibiting high resistance to macrolides due to reduced drug binding affinity caused by point mutations occurring at specific sites in the 23S rRNA gene, particularly at sites A2063 and A2064. As a result, cases of treatment failure are increasing, making it clinically critical to rapidly identify antibiotic resistance along with the presence of infection.
[0004] Currently, standard methods for diagnosing Mycoplasma pneumoniae infection include culture methods, serological tests, and polymerase chain reaction (PCR)-based genetic testing (US Patent Publication US 2016-0237479 A1). However, culture methods are unsuitable for rapid diagnosis as they take several weeks, serological tests have low sensitivity and specificity, and PCR-based tests have limitations that make them difficult to apply in a Point-of-Care Testing (POCT) environment because they require expensive equipment and skilled personnel.
[0005] Therefore, there is an urgent need for the development of new diagnostic technologies capable of rapidly and accurately identifying the presence of Mycoplasma pneumoniae and the presence of major antibiotic resistance simultaneously on-site without complex equipment.
[0006] The technical problem that the present invention aims to solve is to provide a set of ring-mediated isothermal amplification (LAMP) primers and probes capable of simultaneously diagnosing the presence of Mycoplasma pneumoniae and major point mutations (A2063G, A2064G) related to macrolide resistance in a single reaction, and a detection method using the same. However, the technical problem that the present invention aims to solve is not limited to the problem mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below.
[0007] To solve the above problem, the present invention provides a set of LAMP (Loop-mediated isothermal amplification) primers and probes for detecting Mycoplasma pneumoniae, comprising a primer consisting of the nucleotide sequences of SEQ ID NOs. 1 to 6 and a probe consisting of the nucleotide sequences of SEQ ID NOs. 7 to 9.
[0008] According to one side, the Mycoplasma pneumoniae may have a macrolide-resistant mutation.
[0009] According to one side, the probe of SEQ ID NO. 7 may target the wild-type sequence of the Mycoplasma pneumoniae 23S rRNA gene; the probe of SEQ ID NO. 8 may target the A2063G mutant sequence of the gene; and the probe of SEQ ID NO. 9 may target the A2064G mutant sequence of the gene.
[0010] According to one aspect, the probes of SEQ ID NOs 7 to 9 may contain ribonucleotides internally and may be cleavable by the RNase HII enzyme.
[0011] According to one aspect, the probe may have a fluorescent label attached to the 5' end and a quencher attached to the 3' end.
[0012] According to one aspect, the fluorescent label is one or more selected from the group consisting of FAM (6-carboxyfluorescein), Cy5 (Cyanine 5), and Texas Red, and
[0013] The above quenching material may be characterized as being one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (Black Hole Quencher 1), BHQ2, BHQ3, NFQ (non-fluorescent quencher), dabcyl, Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher, and Iowa Black.
[0014] According to another aspect of the present invention, a composition for detecting Mycoplasma pneumoniae and macrolide-resistant mutations thereof, comprising the primer and probe set, is provided.
[0015] According to another embodiment of the present invention, a kit for detecting Mycoplasma pneumoniae and macrolide-resistant mutations thereof comprising the above composition is provided.
[0016] According to another embodiment of the present invention,
[0017] (1) A step of isolating genomic DNA (gDNA) from a biological sample;
[0018] (2) A step of performing an isothermal amplification reaction using the above nucleic acid as a template and the primer and probe set of claim 1; and
[0019] (3) A step of detecting a fluorescent signal occurring during or after the above isothermal amplification reaction to determine the presence of Mycoplasma pneumoniae and the presence of macrolide resistance mutations; a method for providing information for diagnosing Mycoplasma pneumoniae infection is provided.
[0020] According to one side, the sample in step (1) above may be one or more selected from the group consisting of throat swab, sputum, bronchoalveolar lavage fluid, blood, serum, plasma and saliva.
[0021] According to the present invention, it is possible to rapidly detect Mycoplasma pneumoniae infection and major macrolide resistance mutations (A2063G and A2064G) simultaneously on-site without expensive PCR equipment or skilled professional personnel. In addition, the primer and probe set proposed in the present invention ensures high sensitivity and specificity for the corresponding strain, and unlike conventional PCR-based methods which typically take 2 to 4 hours or more, it can provide accurate diagnostic results within about 30 minutes.
[0022] Figure 1 is a schematic diagram showing the binding sites of the LAMP primer and RHAM probe according to the present invention to the 23S rRNA gene sequence of Mycoplasma pneumoniae.
[0023] Figure 2 is a graph showing the results of a detection sensitivity test at different concentrations of a wild-type plasmid using the primer and probe set of the present invention.
[0024] Figure 3 is a graph showing the results of a detection sensitivity test of A2063G mutant plasmid at different concentrations using the primer and probe set of the present invention.
[0025] Figure 4 is a graph showing the results of a detection sensitivity test of A2064G mutant plasmid at different concentrations using the primer and probe set of the present invention.
[0026] FIGS. 5a to 5d are graphs showing the detection results of the present invention for clinically positive specimens.
[0027] Figures 6a and 6b show the results of confirming the LAMP primer set of the present invention for 20 clinically negative samples.
[0028] Figures 7a to 7h show the sequencing results for clinically positive specimens.
[0029] The inventors of the present invention have completed the present invention after diligently researching to develop a technology for rapidly and accurately diagnosing Mycoplasma pneumoniae infection and macrolide resistance mutations in the field, and confirming that the above objective can be effectively achieved by combining a set of LAMP primers and a set of RHAM probes of specific sequences.
[0030] To solve the above problem, the present invention provides a set of LAMP (Loop-mediated isothermal amplification) primers and probes for detecting Mycoplasma pneumoniae, comprising a primer consisting of the nucleotide sequences of SEQ ID NOs. 1 to 6 and a probe consisting of the nucleotide sequences of SEQ ID NOs. 7 to 9.
[0031] In this specification, "Loop-mediated Isothermal Amplification (LAMP)" refers to a technique for amplifying target nucleic acids at a constant temperature (isothermal) using an enzyme having strand displacement activity, such as Bst DNA polymerase. It exhibits very high specificity and efficiency because it recognizes multiple regions of a target sequence using four to six specific primers. Unlike traditional PCR, the LAMP-based primer set of the present invention does not require temperature changes, allowing for the use of simple and lightweight amplification instruments and significantly reducing the time required for analysis.
[0032] According to one side, the Mycoplasma pneumoniae may have a macrolide-resistant mutation.
[0033] According to one side, the probe of SEQ ID NO. 7 may target the wild-type sequence of the Mycoplasma pneumoniae 23S rRNA gene; the probe of SEQ ID NO. 8 may target the A2063G mutant sequence of the gene; and the probe of SEQ ID NO. 9 may target the A2064G mutant sequence of the gene.
[0034] According to one aspect, the probes of SEQ ID NOs 7 to 9 may contain ribonucleotides internally and may be cleavable by the RNase HII enzyme. This may constitute an RHAM probe.
[0035] In this specification, "RHAM probe" refers to an oligonucleotide probe containing one or more ribonucleotides and having both ends labeled with a fluorescent agent and a quenching agent. The ribonucleotide site of this probe is cleaved by the RNase HII enzyme only when it binds perfectly complementarily to the target nucleic acid sequence. This cleaving causes the fluorescent agent and quenching agent to separate, generating a fluorescent signal; however, if a base mismatch is present, the probe is not cleaved and no signal is generated, allowing point mutations to be distinguished with very high specificity. In particular, it can simultaneously differentiate between A2063G and A2064G, which are 1 bp difference positions.
[0036] According to one aspect, the probe may have a fluorescent label attached to the 5' end and a quencher attached to the 3' end.
[0037] According to one aspect, the fluorescent label may be one or more selected from the group consisting of FAM (6-carboxyfluorescein), Cy5 (Cyanine 5), Texas Red, HEX, JOE, ROX, TET, and TAMRA.
[0038] According to another aspect of the present invention, a composition for detecting Mycoplasma pneumoniae and macrolide-resistant mutations thereof, comprising the primer and probe set, is provided.
[0039] According to another embodiment of the present invention, a kit for detecting Mycoplasma pneumoniae and macrolide-resistant mutations thereof comprising the above composition is provided.
[0040] According to another embodiment of the present invention,
[0041] (1) A step of isolating genomic DNA (gDNA) from a biological sample;
[0042] (2) A step of performing an isothermal amplification reaction using the above nucleic acid as a template and the primer and probe set of claim 1; and
[0043] (3) A step of detecting a fluorescent signal occurring during or after the above isothermal amplification reaction to determine the presence of Mycoplasma pneumoniae and the presence of macrolide resistance mutations; a method for providing information for diagnosing Mycoplasma pneumoniae infection is provided.
[0044] The detection method of the present invention can extract nucleic acids from a biological sample and, using this as a template, mix the primer and probe set with the enzyme and reagent required for the LAMP reaction and react under isothermal conditions of about 62°C. By measuring the signal of a fluorescent substance (e.g., FAM, Cy5, Texas Red) labeled on each probe in real time during the reaction time, the presence of Mycoplasma pneumoniae and the presence of A2063G and A2064G mutations can be simultaneously determined.
[0045] In the present invention, the biological sample may be isolated from a subject. The subject may be a mammal requiring diagnosis of pneumonia, but is not limited to, preferably a human. Additionally, in the present invention, the “biological sample” may be a smear sample, wash sample, etc., from a site where pneumonia bacteria may be detected in the body, but is not limited to, but is preferably one or more of sputum, bronchial aspiration and bronchial washing fluid, body fluid, saliva, urine, feces, dermal lesion swab, cerebrospinal fluid, blood, serum, plasmid, peripheral blood monocyte, peripheral blood leukocyte, cervical smears, and pharyngeal swab.
[0046] In the present invention, "primer" refers to a single-stranded oligonucleotide that can act as a starting point for template-directed DNA synthesis under appropriate conditions in a suitable buffer solution (e.g., four different nucleoside triphosphates and a polymerizer such as DNA, RNA polymerase, or reverse transcriptase) and at a suitable temperature. The appropriate length of the primer may vary depending on the intended use, but is typically 15 to 30 nucleotides. Shorter primer molecules generally require lower temperatures to form a stable hybrid with the template. The primer sequence does not need to be perfectly complementary to the template, but must be sufficiently complementary to hybridize with the template.
[0047] The primers of the present invention can be chemically synthesized using methods known in the art, such as the phosphoramidite solid support method. Additionally, they can be modified by methylation, capping, etc., using known methods. Furthermore, if necessary, the primers of the present invention may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of labels include enzymes (e.g., horseradish peroxidase, alkaline phosphatase), radioisotopes (e.g., 32P), fluorescent molecules, chemical groups (e.g., biotin).
[0048] In the present invention, “inner primer” refers to a single-stranded oligonucleotide that binds to template DNA and can act as a starting point for the synthesis of a new DNA chain.
[0049] In the present invention, the “outer primer” refers to a single-stranded oligonucleotide that binds to the template DNA at a location further outside than where the inner primer binds to the template DNA. After the DNA chain is elongated by the binding of the inner primer to the template DNA, strand displacement occurs due to the binding of the outer primer to the template DNA, causing the previously formed chain to detach.
[0050] In the present invention, “loop primer” refers to a single-stranded oligonucleotide that can act as a starting point for nucleotide synthesis, wherein the initial stem loop structure chain formed by binding the inner primer and the outer primer to the template DNA increases the number of times the loop structure is generated, thereby accelerating the overall reaction.
[0051] In the present invention, “quencher” refers to a substance that normally absorbs the fluorescence of a fluorescent labeling substance of a probe, but when the probe is degraded, the fluorescent labeling substance and the quencher separate from each other, allowing the fluorescent labeling substance to emit fluorescence. Preferred examples may be selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher, and Iowa Black.
[0052]
[0053] Hereinafter, embodiments are described in detail with reference to the attached drawings. However, various modifications may be made to the embodiments, and thus the scope of the patent application is not limited or restricted by these embodiments. It should be understood that all modifications, equivalents, and substitutions to the embodiments are included within the scope of the rights.
[0054]
[0055] The terms used in the embodiments are for illustrative purposes only and should not be interpreted as intended to be limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprising" or "having" are intended to indicate the existence of the features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, and should be understood as not precluding the existence or addition of one or more other features, numbers, steps, actions, components, parts, or combinations thereof.
[0056]
[0057] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by those skilled in the art to which the embodiments pertain. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and should not be interpreted in an ideal or overly formal sense unless explicitly defined in this application.
[0058]
[0059] In addition, when describing with reference to the attached drawings, identical components are assigned the same reference numeral regardless of drawing symbols, and redundant descriptions thereof are omitted. In describing the embodiments, if it is determined that a detailed description of related prior art could unnecessarily obscure the essence of the embodiments, such detailed description is omitted.
[0060]
[0061] Example 1. Design of LAMP Primer Set
[0062] LAMP primers and RHAM probes were designed based on the 23S rRNA gene sequence of Mycoplasma pneumoniae, and their sequences are shown in Table 1 below. The positional information of the target sequence is shown in Figure 1.
[0063] SEQ ID NO:NameSequence (5'-3')Target gene1Mycoplasma pneumoniae LAMP primers and RHAM probesMP_F3TCTCTTGACTGTCTCGGCT23s rRNA2MP_B3CCGTTACCTTTTAGGAGGCG3MP_FIPGCATCGATTGCTCCTACC CTCGGTGAAATCCAGGTACG4MP_BIPGGACTTGTTGATGCGAAAGGACTGCCCACCTAACACTGT5MP_FLPACGGGGTCTTTCCGTCCCGTT6MP_BLPTGGAATACTACCCTTGGTTGTGTGC7MP _RHAM_WT_Probe[FAM]-ACGGGGTCT / rU / TCCGTCCCGTT-BHQ18MP_RHAM_2063G_Probe[Cy5]-ACGGGGTCTT / rC / CCGTCCCGTT-BHQ29MP_RHAM_2064G_Probe[Texas Red]-ACGGGGTCT / rC / TCCGTCCCGTT-BHQ1
[0064] The above / rU / and / rC / represent ribouridine and ribocytidine, respectively.
[0065] LAMP primer mixtures and RHAM probe mixtures were prepared using the above oligonucleotides, and the composition of the LAMP primer mixture is shown in Table 2, and the composition of the RHAM probe mixture is shown in Table 3. In addition, the PCR compositions and reaction conditions are shown in Tables 4 and 5, respectively.
[0066] Mycoplasma pneumoniae LAMP primer setVol(ul)MP_F34MP_B34MP_FIP32MP_BIP32MP_FLP10MP_BLP10DW8TOTAL100
[0067] Mycoplasma pneumoniae LAMP RHAM probe mixVol(ul)MP_RHAM_WT_Probe10MP_RHAM_2063G_Probe10MP_RHAM_2064G_Probe10DW70TOTAL100
[0068] Division VolumeRM12.5PRIMER MIX1Mycoplasma pneumoniae LAMP RHAM probe mix1RNase HII1DW6.5Template3TOTAL25
[0069] Experiment 1. One-step LAMP Detection Experiment Temperature Reaction Time 62 ℃ 1 min 30 Cycles Total Reaction Time 30 min
[0070] Example 2. Sensitivity Test
[0071] Plasmids containing the wild-type, A2063G mutant, and A2064G mutant sequences of the Mycoplasma pneumoniae 23S rRNA gene were constructed, respectively. Each plasmid was sequentially diluted tenfold from 10^5 copies / μL to 10^0 copies / μL and used as a template, and a RHAM-LAMP reaction was performed under the conditions of Example 1.
[0072] As a result, as shown in FIGS. 2 to 4 and Tables 6 to 8, the primer and probe set of the present invention exhibited high sensitivity, stably detecting wild-type, A2063G mutant, and A2064G mutant plasmids up to a concentration of 10^3 copies / μL. In addition, each probe specifically reacted only with its own target sequence to generate a fluorescent signal and did not show a cross-reaction with other sequences, so each genotype could be clearly distinguished.
[0073] MP wild-type plasmidcopy / μLwt probe2063G probe2064G probeCtRFUCtRFUCtRFU10^514.35 ± 0.074441.00N / A-16.70N / A-11.5010^416.65 ± 0.534483.00N / A-8.86N / A3.3610^320.82± 2.973783.50N / A33.55N / A18.3010^2N / A5.53N / A4.67N / A0.7010^1N / A6.57N / A6.90N / A0.8110^0N / A26.42N / A8.17N / A1.88D.WN / A5.86N / A6.89N / A0.58
[0074] MP 2063G mutant plasmidcopy / μLwt probe2063G probe2064G probeCtRFUCtRFUCtRFU10^513.20 ± 0.043047.5013.83 ± 0.018602.00N / A6.9210^414.93 ± 0.522980.5015.47 ± 0.387725.00N / A-4.8610^317.10±0.142984.0017.22± 0.048295.50N / A-16.1010^2N / A3.02N / A7.19N / A0.9810^1N / A2.33N / A4.48N / A0.1710^0N / A4.16N / A1.83N / A-0.79DWN / A4.06N / A5.00N / A1.15
[0075] MP 2064G mutant plasmidcopy / μLwt probe2063G probe2064G probeCtRFUCtRFUCtRFU10^513.44 ± 0.072968.50N / A-35.8514.75 ± 0.324629.0010^414.88 ± 0.812912.00N / A-19.8516.14 ± 0.714628.0010^318.43 ± 1.812741.00N / A34.7519.68 ± 1.613724.5010^2N / A4.21N / A5.29N / A0.9910^1N / A1.94N / A3.74N / A0.4010^0N / A2.15N / A5.24N / A0.82D.WN / A1.59N / A6.69N / A4.68
[0076] Example 3. Evaluation using clinical specimens
[0077] The performance of the diagnostic method of the present invention was evaluated on 44 clinical specimens (24 positive, 20 negative) collected from patients suspected of having Mycoplasma pneumoniae infection. For all specimens, the results were compared by combining the RHAM-LAMP analysis of the present invention with the standard test method, Sanger sequencing.
[0078] As a result, as shown in Figs. 5a to 5d and Table 9, the method of the present invention demonstrated 100% sensitivity by detecting all 24 samples determined to be positive in the DNA sequence analysis as positive (Table 9, Figs. 5a to 5d and Figs. 7a to 7h). In addition, it accurately matched the results determined by DNA sequence analysis as 4 wild types and 20 A2063G mutants with 100% accuracy (Table 10, Figs. 6a and 6b).
[0079] Sample Sequencing Results MPwt(FAM), 2063G(Cy5), 2064G(TexasRed) Mutation Type(Wild-Type / 2063G Mutant / 2064G Mutant) wt probe 2063G probe 2064G probe CtRFUCtRFUCtRFU No. 38 2063G Positive Sample 2063G Mutant 16.22384517.197982N / A5.2539 2063G Positive Sample 2063G Mutant 12.12470213.188523N / A16.641 2063G Positive Sample 2063G Mutant 11.35473612.448870N / A18.344 2063G Positive Sample 2063G Mutant 11.4943341 2.428777N / A17.947 2063G Positive Specimen 2063G Mutant 11.08487512.139098N / A19.848 WT Positive Specimen Wild-type 11.037347N / A-14.4N / A4 7.954 WT Positive Specimen Wild-type 11.006843N / A-10.4N / A6.7756 WT Positive Specimen Wild-type 13.025315N / A-12.8N / A3 2.958 2063G Positive Specimen 2063G Mutant 10.44487911.448989N / A20.160 2063G Positive Specimen 2063G Mutant 14.3505415.78683N / A5.6961 2063G positive specimen 2063G Mutant 12.56434913.668172N / A14.166 WT positive specimen Wild-type 11.778195N / A-19.6N / A8670 2063G positive specimen 2063G Mutant 10.55515111.549233N / A19.971 2063G positive specimen 2063G Mutant 10.18527111.199077N / A1676 2063G positive specimen 2063G Mutant 11.18499212.159355N / A20.478 2063G positive Sample 2063G Mutant 10.9466011.887744N / A 12.680 2063G Positive Sample 2063G Mutant 11.85416012.828481N / A1688 2063G Positive Specimen 2063G Mutant 12.12426813.098578N / A15.492 2063G Positive Specimen 2063G Mutant 10.22448111.218839N / A18.696 2063G Positive Specimen 2063G Mutant 14.44415115.457605N / A15107 2063G Positive Specimen 2063G Mutant 13.07451414.079033N / A13.9132 2063G Positive Specimen 2063G Mutant 9.45488610.439091N / A16.2148 2063G Positive Specimen 2063G Mutant 10.38564011.899358N / A 19.2151 2063G Positive Specimen 2063G Mutant 13.28472614.398706N / A 10.7.
[0080] SampleMP wt(FAM), 2063G(Cy5), 2064G(TexasRed)wt probe2063G probe2064G probeCtRFUCtRFUCtRFU Sample 1 Negative N / A 7.89 N / A 1.59 N / A 1.50 Sample 4 Negative N / A 9.53 N / A 1.52 N / A 0.22 Sample 7 Negative N / A 7.52 N / A 0.36 N / A 1.47 Sample 8 Negative N / A 8.96 N / A -0.07 N / A -0.98 Sample 9 Negative N / A 12.60 N / A 0.90 N / A 1.13 Sample 17 Negative N / A 10.20 N / A 2.06 N / A 0.51 Sample 18 Negative Sample N / A9.43N / A0.45N / A1.2722 Negative Sample N / A18.00N / A5.82N / A0.9423 Negative Sample N / A2.30N / A-0.61N / A0.4625 Negative Sample N / A4.44N / A0.77N / A0.9927 Negative Sample N / A8.83N / A1.32N / A1.0128 Negative Sample N / A2.44N / A2.45N / A0.1232 Negative Sample N / A2.78N / A0.35N / A0.4936 Negative Sample N / A3.53N / A0.84N / A1.2537 Negative Sample N / A1.92N / A-1.88N / A-0.5338 Negative Sample N / A3.35 N / A2.08 N / A-0.2645 Negative Sample N / A8.44 N / A12.80 N / A-3.0348 Negative Sample N / A5.67 N / A1.71 N / A0.7054 Negative Sample N / A2.94 N / A1.00 N / A0.6061 Negative Sample N / A17.40 N / A2.05 N / A1.75
[0081] Although the embodiments have been described above with reference to the limited drawings, those skilled in the art can apply various technical modifications and variations based on the above. For example, suitable results may be achieved even if the described techniques are performed in a different order than described, and / or if the components of the described system, structure, device, circuit, etc. are combined or assembled in a form different from described, or replaced or substituted by other components or equivalents.
[0082] Therefore, other implementations, other embodiments, and equivalents to the claims also fall within the scope of the claims set forth below.
Claims
1. A set of LAMP (Loop-mediated isothermal amplification) primers and probes for detecting Mycoplasma pneumoniae, comprising primers composed of the nucleotide sequences of SEQ ID NOs 1 to 6 and probes composed of the nucleotide sequences of SEQ ID NOs 7 to 9.
2. In Paragraph 1, The above Mycoplasma pneumoniae is a primer and probe set having a macrolide-resistant mutation.
3. In Paragraph 1, A primer and probe set characterized in that the probe of SEQ ID NO. 7 targets the wild-type sequence of the Mycoplasma pneumoniae 23S rRNA gene; the probe of SEQ ID NO. 8 targets the A2063G mutant sequence of the gene; and the probe of SEQ ID NO. 9 targets the A2064G mutant sequence of the gene.
4. In Paragraph 1, A primer and probe set characterized in that the probes of SEQ ID NOs 7 to 9 contain ribonucleotides internally and are capable of being cleaved by RNase HII enzyme.
5. In Paragraph 4, A primer and probe set characterized in that the probe has a fluorescent label attached to the 5' end and a quencher attached to the 3' end.
6. In claim 5, the fluorescent labeling material is one or more selected from the group consisting of FAM (6-carboxyfluorescein), Cy5 (Cyanine 5), and Texas Red, and A primer and probe set characterized in that the above-mentioned quenching material is one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (Black Hole Quencher 1), BHQ2, BHQ3, NFQ (non-fluorescent quencher), dabcyl, Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher, and Iowa Black.
7. A composition for detecting Mycoplasma pneumoniae and macrolide-resistant mutations thereof, comprising the primer and probe set of claim 1.
8. A kit for detecting Mycoplasma pneumoniae and macrolide-resistant mutations thereof, comprising the composition of claim 7. 9.(1) A step of isolating genomic DNA (gDNA) of a biological sample; (2) A step of performing an isothermal amplification reaction using the above nucleic acid as a template and the primer and probe set of claim 1; and (3) a step of detecting a fluorescence signal occurring during or after the above isothermal amplification reaction to determine the presence of Mycoplasma pneumoniae and the presence of macrolide resistance mutations; comprising a method for providing information for diagnosing Mycoplasma pneumoniae infection.
10. In Paragraph 9, A method characterized in that the sample in step (1) above is one or more selected from the group consisting of throat swab, sputum, bronchoalveolar lavage fluid, blood, serum, plasma, and saliva.