Biomarker comprising grin2a, gria3 or drd1 for diagnosis of cannabis oil exposure, and use thereof

A biomarker composition using specific mRNAs (Grin2a, Gria3, Drd1) diagnoses hemp oil exposure by measuring expression levels, addressing the gap in understanding cannabis's gene expression effects and providing diagnostic tools for THC exposure.

WO2026121507A1PCT designated stage Publication Date: 2026-06-11AJOU UNIV IND ACADEMIC COOP FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/014775
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-05
Filing Date
2025-09-22
Publication Date
2026-06-11

Smart Images

  • Figure KR2025014775_11062026_PF_FP_ABST
    Figure KR2025014775_11062026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a biomarker comprising Grin2a, Gria3, or Drd1 for diagnosis of cannabis oil exposure, and a use thereof. mRNAs whose expressions changes specifically in response to THC exposure were screened on a large scale by using next-generation sequencing technology, and mRNAs showing differential expression in a THC group two-fold or greater than that in a control group were selected, thereby verifying THC-specific differential expression. Therefore, it is determined that the mRNAs verified in the present invention can be used as biomarkers for prediction and diagnosis of THC exposure.
Need to check novelty before this filing date? Find Prior Art

Description

Biomarkers for diagnosing hemp oil exposure including Grin2a, Gria3, or Drd1 and their uses

[0001] The present invention relates to a biomarker for diagnosing hemp oil exposure comprising Grin2a, Gria3, or Drd1, and the use thereof.

[0002] Cannabis is primarily classified into hemp and marijuana based on the content of major extracted compounds. Hemp is industrial cannabis and generally contains 0.3% or less. 9 While hemp seeds and oil are rich in nutrients and used in food due to their tetrahydrocannabinol (THC) content, marijuana is a cannabis with a high THC content; because THC induces hallucinogenic effects, marijuana is primarily used for medicinal or recreational purposes. Following the recommendations of the World Health Organization (WHO), the UN Commission on Narcotic Drugs (CND) removed cannabis from the list of narcotics in December 2020, and the U.S. House of Representatives passed legislation legalizing cannabis. Consequently, the use of medical cannabis is permitted in over 50 countries worldwide, including Canada. Furthermore, in South Korea, the Ministry of Food and Drug Safety is pursuing the permission of the manufacture and import of cannabis-derived medicines starting in 2024, including policies to revitalize cannabis medicines, as part of the "100 Major Tasks for Food and Drug Regulatory Innovation." As such, with the legalization and commercialization of cannabis abroad and domestic policies allowing medical cannabis, entry barriers to domestic cannabis distribution have been lowered. Consequently, a large volume of cannabis-related products are flowing into the country through smuggling, leading to an increasing risk of illegal cannabis use and abuse.

[0003] Given that it is recently known that cannabis use can cause diseases such as brain damage, liver cancer, and lung cancer, there is insufficient clarification regarding the direct and indirect effects on gene expression of major components of cannabis used for medical purposes or those that can induce addiction and hallucinations. Vaping is the act of using electronic cigarettes, and cannabis oil vaping—which involves inserting cannabis oil cartridges into electronic cigarettes—has expanded rapidly over the past decade, with actual cases of organ damage and death being confirmed. According to data released by the U.S. Centers for Disease Control and Prevention (CDC), among 2,200 hospitalizations for vaping-related lung injury, 82% used liquid electronic cigarettes containing THC, 33% used products containing only THC, 57% used products containing nicotine, and 14% used products containing only nicotine. Given that cannabis use is known to cause diseases such as brain damage, liver cancer, and lung cancer, there is a lack of investigation into the direct and indirect effects on gene expression of major cannabis components—which are used for medical purposes or can induce addiction and hallucinations—through vaping cannabis oil. Although some transcriptome studies related to cannabis have been reported recently, most studies have focused on discovering genes related to tolerance to stress-inducing factors such as drought, salinity, and heavy metals during cannabis cultivation.

[0004] Next-generation sequencing (NGS) is a highly versatile technology widely used in whole-genome sequencing, targeted DNA sequencing, and RNA sequencing, and it is increasingly being utilized to discover mechanisms and genes involved in pathogenesis in large quantities. Recently, some research has been conducted to investigate the effects on diseases such as Alzheimer's disease and post-traumatic stress disorder (PTSD) by screening genes regulated by cannabidiol (CBD) or THC, the major components of cannabis, as targets for these conditions. In addition, previous studies have shown that genes capable of inducing toxicity similar to tobacco smoke are expressed through transcriptome analysis after exposing human airway epithelial cell line Calu-3 cells to cannabis smoke.

[0005] The object of the present invention is to provide a biomarker composition for diagnosing hemp oil exposure comprising one or more mRNAs selected from the group consisting of Grin2a, Gria3, Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, Rapgef1, Drd1, Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3.

[0006] In addition, another objective of the present invention is to provide a composition for diagnosing hemp oil exposure comprising, as an active ingredient, a preparation capable of measuring the expression level of any one or more mRNAs selected from the group consisting of Grin2a, Gria3, Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, Rapgef1, Drd1, Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3.

[0007] In addition, another objective of the present invention is to provide a kit for diagnosing hemp oil exposure comprising the above composition.

[0008] In addition, another objective of the present invention is to provide a method for providing information necessary for diagnosing hemp oil exposure, comprising the step of measuring the expression level of one or more mRNAs selected from the group consisting of Grin2a, Gria3, Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, Rapgef1, Drd1, Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3.

[0009] To achieve the above objective, the present invention provides a biomarker composition for diagnosing hemp oil exposure comprising one or more mRNAs selected from the group consisting of Grin2a, Gria3, Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, Rapgef1, Drd1, Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3.

[0010] In addition, the present invention provides a composition for diagnosing hemp oil exposure comprising, as an active ingredient, a preparation capable of measuring the expression level of any one or more mRNAs selected from the group consisting of Grin2a, Gria3, Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, Rapgef1, Drd1, Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3.

[0011] In addition, the present invention provides a kit for diagnosing hemp oil exposure comprising the above composition.

[0012] In addition, the present invention provides a method for providing information necessary for diagnosing exposure to cannabis oil, comprising the steps of: (1) measuring the expression level of Grin2a mRNA from a separated sample; (2) comparing the expression level of Grin2a mRNA with a control sample; and (3) determining that the sample has been exposed to cannabis oil if the expression level of Grin2a mRNA is higher than that of the control sample.

[0013] In addition, the present invention provides a method for providing information necessary for diagnosing exposure to cannabis oil, comprising: (1) measuring the expression level of one or more mRNAs selected from the group consisting of Grin2a mRNA and Gria3, Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, and Rapgef1 from a separated sample; (2) comparing the expression level of the mRNA with a control sample; and (3) determining that the sample has been exposed to cannabis oil if the expression level of the mRNA is higher than that of the control sample.

[0014] In addition, the present invention provides a method for providing information necessary for diagnosing exposure to cannabis oil, comprising the steps of: (1) measuring the expression level of Drd1 mRNA from a separated sample; (2) comparing the expression level of the Drd1 mRNA with a control sample; and (3) determining that the person has been exposed to cannabis oil if the expression level of the Drd1 mRNA is lower than that of the control sample.

[0015] In addition, the present invention provides a method for providing information necessary for diagnosing exposure to cannabis oil, comprising: (1) measuring the expression level of one or more mRNAs selected from the group consisting of Drd1 mRNA and Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3 from a separated sample; (2) comparing the expression level of the mRNA with a control sample; and (3) determining that the sample has been exposed to cannabis oil if the expression level of the mRNA is lower than that of the control sample.

[0016] The present invention relates to a biomarker for diagnosing hemp oil exposure comprising Grin2a, Gria3, or Drd1 and the use thereof. Next-generation sequencing technology was utilized to large-scale screen mRNAs that undergo specific expression changes due to THC exposure, and mRNAs that show differential expression at more than twice the level in the THC group compared to the control group were selected to verify that they exhibit THC-specific differential expression. Therefore, it is determined that the mRNA verified in the present invention can be utilized as a predictive and diagnostic biomarker for THC exposure.

[0017] Figure 1 shows the results of discovering mRNA that was differentially expressed more than twice as much in the THC group compared to the control group.

[0018] Figure 2 shows the GO enrichment of mRNA that was differentially expressed more than twice in the THC group compared to the control group (*,p<0.05; **,p<0.01; ***,p<0.001).

[0019] Figure 3 shows the KEGG pathway of mRNA that was differentially expressed more than twice as much in the THC group compared to the control group (*,p<0.05; **,p<0.01; ***,p<0.001).

[0020] Figure 4 shows the verification results of mRNA expression increased in the THC group compared to the control group (*,p<0.05; **,p<0.01; ***,p<0.001).

[0021] Figure 5 shows the verification results of mRNA expression reduced in the THC group compared to the control group (*,p<0.05; **,p<0.01; ***,p<0.001).

[0022] The present invention provides a biomarker composition for diagnosing hemp oil exposure comprising Grin2a mRNA.

[0023] Preferably, the composition may further comprise one or more mRNAs selected from Gria3 and Drd1, and more preferably, the composition may further comprise one or more mRNAs selected from the group consisting of Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, Rapgef1, Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3, but is not limited thereto.

[0024] Preferably, the hemp oil is △ 9 -Tetrahydrocannabinol(△ 9 -Tetrahydrocannabinol (THC) may be included, but is not limited thereto.

[0025]

[0026] In addition, the present invention provides a composition for diagnosing hemp oil exposure comprising a preparation capable of measuring the expression level of Grin2a mRNA as an active ingredient.

[0027] Preferably, the composition may further include a preparation capable of measuring the expression level of one or more mRNAs selected from Gria3 and Drd1, and more preferably, the composition may further include a preparation capable of measuring the expression level of one or more mRNAs selected from the group consisting of Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, Rapgef1, Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3, but is not limited thereto.

[0028] Preferably, the hemp oil is △ 9 -Tetrahydrocannabinol(△ 9 -Tetrahydrocannabinol (THC) may be included, but is not limited thereto.

[0029] Preferably, the agent capable of measuring the expression level of the mRNA may be a primer or probe that specifically binds to the mRNA, but is not limited thereto.

[0030]

[0031] In addition, the present invention provides a kit for diagnosing hemp oil exposure comprising the above composition.

[0032] In this specification, the term “primer” refers to a short nucleic acid sequence having a short free 3’ hydroxyl group, capable of forming base pairs with a complementary template, and acting as a starting point for template strand replication. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer solution and temperature. PCR conditions and the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.

[0033] In this specification, the term "probe" refers to a nucleic acid fragment, such as RNA or DNA, ranging from a few bases to several hundred bases in length, capable of specifically binding to mRNA. It is labeled to confirm the presence or absence and expression level of a specific mRNA. Probes may be constructed in the form of oligonucleotide probes, single-strand DNA probes, double-strand DNA probes, RNA probes, etc. The selection of appropriate probes and hybridization conditions may be appropriately selected according to techniques known in the art.

[0034]

[0035] In addition, the present invention provides a method for providing information necessary for diagnosing exposure to cannabis oil, comprising the steps of: (1) measuring the expression level of Grin2a mRNA from a separated sample; (2) comparing the expression level of Grin2a mRNA with a control sample; and (3) determining that the sample has been exposed to cannabis oil if the expression level of Grin2a mRNA is higher than that of the control sample.

[0036] In addition, the present invention comprises the step of (1) measuring the expression level of Grin2a mRNA from a separated sample and one or more mRNAs selected from the group consisting of Gria3, Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21 and Rapgef1;

[0037] (2) a step of comparing the expression level of the mRNA with a control sample; and

[0038] (3) A method for providing information necessary for diagnosing exposure to cannabis oil is provided, which includes the step of determining that the expression level of the mRNA is higher than that of the control sample.

[0039] In addition, the present invention provides a method for providing information necessary for diagnosing exposure to cannabis oil, comprising the steps of: (1) measuring the expression level of Drd1 mRNA from a separated sample; (2) comparing the expression level of the Drd1 mRNA with a control sample; and (3) determining that the person has been exposed to cannabis oil if the expression level of the Drd1 mRNA is lower than that of the control sample.

[0040] In addition, the present invention provides a method for providing information necessary for diagnosing exposure to cannabis oil, comprising: (1) measuring the expression level of one or more mRNAs selected from the group consisting of Drd1 mRNA and Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3 from a separated sample; (2) comparing the expression level of the mRNA with a control sample; and (3) determining that the sample has been exposed to cannabis oil if the expression level of the mRNA is lower than that of the control sample.

[0041] Preferably, the hemp oil is △ 9 -Tetrahydrocannabinol(△ 9-Tetrahydrocannabinol (THC) may be included, but is not limited thereto.

[0042] Preferably, the method for measuring the expression level of the mRNA uses RT-PCR, Competitive RT-PCR, Real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chips, but is not limited thereto.

[0043]

[0044] In this specification, the term “isolated sample” may include a sample such as tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine that differs from the control group in the expression level of the mRNA, which is the biomarker of the present invention, and preferably may be a sample derived from hippocampal tissue, but is not limited thereto.

[0045] Hereinafter, the present invention will be described in detail with reference to examples to aid in understanding. However, the following examples are merely illustrative of the content of the present invention and the scope of the present invention is not limited to the following examples. The examples of the present invention are provided to more completely explain the present invention to those with average knowledge in the art.

[0046]

[0047] <Experimental Example>

[0048] The following experimental examples are intended to provide experimental examples that are commonly applied to each embodiment according to the present invention.

[0049]

[0050] 1. Experimental animals

[0051] In this study, experiments were conducted on 10 male 8-week-old ICR mice. The experimental animals were purchased from KOATECH (Pyeongtaek, Gyeonggi-do, South Korea) and underwent a one-week acclimatization period. All experimental animals were housed individually in transparent plastic cases within individual ventilation systems maintaining a relative humidity of 55±10% and a temperature of 22±2℃. The mice were housed in an environment where they could freely consume food and water, and the environment of the housing room was managed by alternating light and dark cycles every 12 hours (light hours: 08:00–18:00, dark hours: 18:00–08:00). Mice that reached 8 weeks of age were randomly divided into a control group (n=5) and a THC exposure group (THC group, n=5) for use in the experiment. All experimental procedures were performed with the approval of the Institutional Animal Care and Use Committee (IACUC, Approval No.: GNU-231204-M0218).

[0052]

[0053] 2. The Vaping Process

[0054] Vaping experiments were conducted on a control group (n=5) and a THC group (n=5). The base oil of the solution used for vaping was a mixture of propylene glycol (PG) and vegetable glycerin (VG). The THC solution (solvent: ethanol, Lipomed) was mixed with the PG and VG mixture in a 7:1 ratio. For the control group, a solution was used in which pure ethanol was mixed in the same ratio (PG and VG mixture: ethanol = 7:1). Mice in both groups were placed in specially designed vaping chambers to expose them to the vaporized mixtures. During the exposure process, the mixture of the THC group or the control group was vaporized and sprayed into the chamber for 2 seconds, followed by the mice inhaling the remaining gas inside the chamber for 10 seconds. This process was repeated a total of 20 times over 4 minutes, after which forced ventilation was performed using an air pump for 6 minutes to remove the vaporized solution from the vaping chamber. The above exposure process was repeated to perform vaping until the experimental solution completely disappeared.

[0055]

[0056] 3. Library Construction and Sequencing

[0057] Total RNA was extracted from the hippocampi of the control group (VG and PG exposure groups, 5 animals) and the THC group (5 animals). Briefly describing the total RNA extraction process, hippocampal tissue was dissolved in Trizol (Thermo Fisher Scientific). 200 µl of chloroform was added to 1 ml of tissue containing Trizol, and the supernatant was obtained by centrifugation; an equal amount of isopropanol was then added to precipitate and harvest the total RNA. The total RNA was washed with ethanol and dissolved in distilled water treated with diethyl pyrocarbonate (DEPC) to measure the total RNA concentration. The quality of the total RNA was evaluated using an Agilent 4200 TapeStation system (Agilent Technologies). After removing unnecessary rRNA using the RiboCop rRNA Depletion kit (LEXOGEN Inc.), a library was prepared using the NEBNext Ultra II Directional RNA Library Prep kit (New England BioLabs Inc.) according to the manufacturer's instructions. After enriching the library using PCR, the average size of the library was measured using an Agilent 2100 bioanalyzer. The final prepared library was sequenced using the NovaSeq 6000 system (Illumina).

[0058]

[0059] 4. Discovery of Differentially Expressed mRNA

[0060] Quality control of raw sequencing data was performed using FastQC, and adapters and low-quality reads <Q20)는 FASTX_Trimmer 및 BBMap을 이용하여 제거하였다. 그리고 정돈한(trimmed) 리드를 TopHat을 이용하여 reference genome에 맵핑하였다. Cufflinks의 Fragments Per kb per Million reads(FPKM) 값을 사용하여 유전자, 동형체(isoforms), mRNA의 발현 수준을 예측하였고, 확보된 FPKM 값은 edgeR을 사용한 Quantile normalization 방법을 기반으로 normalization화 하였다. 대조군 대비 THC군에서 2배 이상 차별 발현하는 mRNA를 선별하였다. ExDEGA(Ebiogen Inc.)를 이용하여 차별 발현된 mRNA 세트의 계층적 군집 분석(hierarchical clustering analysis)을 수행하였다. 또한, 차별 발현된 mRNA들에 대해 통계적 유의성(significance)과 발현 변화를 동시에 시각화하기 위해 volcano plot을 작성하였다. 차별 발현된 mRNA들의 functional annotation 및 네트워크 분석은 DAVID Bioinformatics Resources(https: / david.ncifcrf.gov / )를 이용하여 수행하였다.

[0061]

[0062] 5. Real-time RT-PCR

[0063] From large-scale data of mRNAs with differential expression of more than twofold, 23 mRNAs showing increased or decreased expression were selected and verified using real-time RT-PCR. The following procedures were performed for the cDNA synthesis and real-time PCR of total RNA. Hippocampal tissues from 5 control animals and 5 THC group animals were lysed in Trizol (Thermo Fisher Scientific). 200 µl of chloroform was added to 1 ml of tissue containing Trizol, and the supernatant was obtained by centrifugation; an equal volume of isopropanol was then added to precipitate and harvest the total RNA. The total RNA was washed with ethanol and dissolved in distilled water treated with diethyl pyrocarbonate (DEPC) to measure the total RNA concentration. Then, PrimeScript TM cDNA of long non-coding RNA was synthesized using Reverse Transcriptase (TaKaRa) and Random Primer (TaKaRa). After mixing the synthesized cDNA with TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa) and the primer sets for each mRNA (see Table 1), the mRNA expression levels in the THC group were measured relative to the control group. Specifically, the real-time PCR procedure for expression level measurement involved the above-mentioned mixed samples using QuantStudio TM 3. In a Real-Time PCR (Thermo Fisher Scientific) system, denaturation was performed at 95°C for 10 minutes (1 cycle), followed by annealing at 90°C for 15 seconds and 60°C for 1 minute for amplification, and then denaturation at 95°C for 15 seconds and treatment at 60°C for 1 minute for the final melting curve. Data 2 - ΔΔCT It was analyzed using the method. The housekeeping gene used to analyze mRNA expression levels is Gapdh.

[0064] 유전자Transcript IDForward(5'-3')Reverse(5'-3')Amplicon size(bp)GapdhNM_008084.1AGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA123Grin2aXM_006521795.5ACGTGACAGAACGCGAACTTTCAGTGCGGTTCATCAATAACG100Gria3NM_001281929.2ACCATCAGCATAGGTGGACTTACGTGGTAGTTCAAATGGAAGG128Camk2gNM_178597.5ACCGACGACTACCAGCTTTTCGCAGCATATTCCTGCGTAGATG95Erc2XM_006518940.3ATGTACGGGAGCGCAAGAACGGCTGCATTAAGGGACTGGATA165Egr3NM_001289925.2CCGGTGACCATGAGCAGTTTTAATGGGCTACCGAGTCGCT110Golga2NM_001362697.2GACTACAGTCCTCCCGACAGCGCTCTTTGGTTAGGTCCTTGT109Rab3gap1XM_006529407.4CCCGAGTCCGAAGTGTTTGAGTTCCCAGAGAGGGTCCAATCA118Zhx2XM_011245688.4ATGGCAAGCAAACGGAAATCTTCCTTTGTCACATCGGACTGT134Dzip1XM_006519391.4AGGTCAAGGGGATGTTTATGAGGGGGGACACGGAAGATGGTC165Cdk16NM_001411707.1AGATAAGACCAATGGTGTCCCTCACTCTCCCCATCAGATCCCA185Arhgap21XM_006497541.4GCTCAGTGAGAATTTGGGAACAGTCTTAAAGGCTGTGGCGTCT173Rapgef1XM_030246487.1AAAGCAGACTCTCAGCGTTCTTCTCAGGAATCTTCGACACCTC130Drd1NM_001291801.1TTTTGGCCCTTTGGGTCCTTGTCCACGCTGATCACACAGA96Drd2NM_010077.3ACCTGTCCTGGTACGATGATGGCATGGCATAGTAGTTGTAGTGG105GnalNM_010307.3GCCAACAAAAAGATCGAGAAGCGTTGAAGCCATTGACGTGCAG144Adcy5NM_001012765.6AACGCCAAGCAGGAGGATATGCC CCGAGGATCTTAATCCGTAA208PenkNM_001348209.1GAGAGCACCAACAATGACGAATCTTCTGGTAGTCCATCCACC166Tac1NM_009311.3TTTCTCGTTTCCACTCAACTGTTGTCTTCGGGCGATTCTCTGC145Rgs9N M_011268.2TTCCCCGAGTCGCTTCATCCTGGGGTCTTGAGTGGTCT178Adora2aNM_001331095.1GCCATCCCATTCGCCATCAGCAATAGCCAAGAGGCTGAAGA122Pde10aNM_011866.2AGGATACGAATATGCAGG GAGTCCGTCGGCTTTTGTGGCTAT133Pde7bNM_001347366.1AAGGCACATGCTCTCCAAAAGTGTTACCAGACTGTTCCCATTTGT84Six3XM_017317367.2GCTCCCGGCTTCTCTTACCCGGCGAAGTTTGGCAACAAG97.

[0065]

[0066] <Example 1> Profiling of Changed mRNA Expression

[0067] mRNAs showing a difference in expression of more than twofold between the control group and the THC group were profiled. As a result of applying hierarchical clustering using a heatmap based on the similarity between the profiled genes and the total samples, similarity in mRNA expression among the samples was observed for each group. Compared to the control group, 929 mRNAs (366 increased; 563 decreased) in the THC group showed a significant change in expression of more than twofold (Fig. 1).

[0068]

[0069] <Example 2> GO enrichment and KEGG pathway analysis of differentially expressed mRNA

[0070] GO enrichment and the KEGG pathway were performed on mRNAs whose expression changed significantly by more than twofold in the THC group compared to the control group. The genes with increased expression were the top 20 significant BPs listed based on the significance level (p<0.05) in the biological process (BP) category within the GO category, including glutamatergic synaptic transmission, modulation of synaptic transmission, and excitatory postsynaptic potential (Fig. 2A), and the genes with decreased expression were the top 20 significant BPs listed based on the significance level (p<0.05) in the BP category, including dendrite morphogenesis, brain development, chemical synaptic transmission, and neuromuscular synaptic transmission (Fig. 2B).

[0071] Meanwhile, KEGG pathway analysis of the genes with increased expression revealed that they were associated with the insulin signaling pathway, glutamatergic synapse, and amphetamine addiction (Fig. 3A). Genes with decreased expression were identified as being associated with the dopaminergic synapse, morphine addiction, cocaine addiction, and axon guidance (Fig. 3B).

[0072]

[0073] <Example 3> Verification of changes in mRNA expression

[0074] After selecting some of the genes obtained based on GO enrichment analysis and KEGG pathway analysis, differential expression was verified using real-time RT-PCR. Among the genes that showed a significant increase in expression of more than twofold in the THC group compared to the control group, genes involved in glutamatergic synaptic transmission (Grin2a, Gria3, Camk2g), neuromuscular synaptic transmission (Erc2, Egr3), axonogenesis (Golga2), excitatory postsynaptic potential (Rab3gap1), cell differentiation (Zhx2, Dzip1, Cdk16), regulation of endocytosis (Arhgap21), and insulin signaling pathway (Rapgef1) were verified. All verified genes, excluding Egr3 (p=0.0768) and Cdk16 (p=0.0856) genes which showed a tendency for increased expression in the THC group compared to the control group, showed a significant increase in the THC group (Fig. 4).

[0075] Meanwhile, among the genes that were significantly reduced in the THC group based on RNA-Seq results, genes involved in dopaminergic synapse (Drd1,Drd2,Gnal,Adcy5), chemical synatic transmission and sensory perception of pain (Penk,Tac1), cAMP signaling pathway (Adora2a, Pde10a), cocaine addiction (Rgs9), morphine addiction (Pde7b), and brain development (Six3) were examined. All 11 genes were significantly reduced in the THC group, with the exception of the Pde7b gene, which showed a decreasing trend (p=0.06) associated with morphine addiction (Fig. 5).

[0076]

[0077] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A biomarker composition for diagnosing hemp oil exposure containing Grin2a mRNA.

2. A biomarker composition according to claim 1, characterized in that the composition further comprises one or more mRNAs selected from Gria3 and Drd1.

3. A biomarker composition according to claim 2, characterized in that the composition further comprises one or more mRNAs selected from the group consisting of Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, Rapgef1, Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3.

4. In any one of paragraphs 1 to 3, the hemp oil is △ 9 -Tetrahydrocannabinol(△ 9 A biomarker composition characterized by containing tetrahydrocannabinol (THC).

5. A composition for diagnosing hemp oil exposure comprising a preparation capable of measuring the expression level of Grin2a mRNA as an active ingredient.

6. A composition according to claim 5, characterized in that the composition further comprises a preparation capable of measuring the expression level of one or more mRNAs selected from Gria3 and Drd1.

7. The composition according to claim 6, further comprising a preparation capable of measuring the expression level of one or more mRNAs selected from the group consisting of Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21, Rapgef1, Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b, and Six3.

8. In any one of paragraphs 5 through 7, the hemp oil is △ 9 -Tetrahydrocannabinol(△ 9 A composition characterized by containing tetrahydrocannabinol (THC).

9. A composition characterized in that, in any one of claims 5 to 7, the preparation capable of measuring the expression level of the mRNA is a primer or probe that specifically binds to the mRNA.

10. A kit for diagnosing hemp oil exposure comprising the composition of any one of claims 5 to 7. 11.(1) A step of measuring the expression level of Grin2a mRNA from isolated samples; (2) a step of comparing the expression level of the Grin2a mRNA with a control sample; and (3) A method for providing information necessary for diagnosing whether there is exposure to cannabis oil, including the step of determining that there is exposure to cannabis oil if the expression level of the Grin2a mRNA is higher than that of the control sample.

12. (1) A step of measuring the expression level of Grin2a mRNA from isolated samples; and one or more mRNAs selected from the group consisting of Gria3, Camk2g, Erc2, Egr3, Golga2, Rab3gap1, Zhx2, Dzip1, Cdk16, Arhgap21 and Rapgef1; (2) a step of comparing the expression level of the mRNA with a control sample; and (3) A method for providing information necessary for diagnosing exposure to cannabis oil, including the step of determining that the expression level of the mRNA is higher than that of the control sample. 13.(1) A step of measuring the expression level of Drd1 mRNA from isolated samples; (2) a step of comparing the expression level of the above Drd1 mRNA with a control sample; and (3) A method for providing information necessary for diagnosing exposure to cannabis oil, including the step of determining that the expression level of the above Drd1 mRNA is lower than that of the control sample.

14. (1) A step of measuring the expression level of Drd1 mRNA from isolated samples; and one or more mRNAs selected from the group consisting of Drd2, Gnal, Adcy5, Penk, Tac1, Rgs9, Adora2a, Pde10a, Pde7b and Six3; (2) a step of comparing the expression level of the mRNA with a control sample; and (3) A method for providing information necessary for diagnosing exposure to cannabis oil, including the step of determining that the expression level of the mRNA is lower than that of the control sample.

15. A method according to any one of claims 11 to 14, wherein the separated sample is a sample derived from hippocampal tissue.

16. In any one of paragraphs 11 to 14, the hemp oil is △ 9 -Tetrahydrocannabinol(△ 9 A method characterized by containing -tetrahydrocannabinol (THC).