Therapeutic strategy for treating copper-mediated pathologies

Abstract

The present invention is directed to a novel therapeutic strategy for treating a disease mediated by copper, by inhibiting the function of cellular prion protein (PrP).

Description

[0001] ADV-00758PTITWO

[0002] THERAPEUTIC STRATEGY FOR TREATING COPPER-MEDIATED

[0003] PATHOLOGIES

[0004] FIELD OF THE INVENTION

[0005] The present invention is directed to a novel therapeutic strategy for treating diseases mediated by copper dysregulation, through inhibition of the cellular prion protein (PrP).

[0006] BACKGROUND

[0007] Copper (Cu) is an indispensable micronutrient for the growth and replication of all eukaryotic organisms. By exploiting the ability of copper to switch between Cu+and Cu2+oxidation states, cuproenzymes drive vitally important metabolic processes including respiration, anti-oxidant defense, biosynthesis of neuropeptides, and components of connective tissue. However, excess copper represents a serious danger for cells and organisms, due to the ability of Cu to provoke extensive damage via activation of specific cell death mechanisms. Therefore, cells and organisms have evolved a finely tuned network of transporters and copper-binding proteins to provide a sufficient supply of the metal and to avoid toxicity.

[0008] A failure of this regulatory network to properly support Cu homeostasis manifests in serious life-threatening disorders.

[0009] Wilson disease (WD) is one of said disorders of dysregulation of copper homeostasis: WD is caused by mutations in the ATP7B gene, encoding a hepatic Cu transporter that drives excretion of excess Cu to the bile; loss of ATP7B function leads to Cu accumulation initially in the liver and subsequently in the brain, thereby causing serious hepatic and neurological abnormalities culminating in death.

[0010] Altered regulation of Cu homeostasis has also been pointed out in several cancers, with elevated Cu supply fueling different processes which support tumor growth: mounting observations have in fact connected copper signaling to cell proliferation (cuproplasia), tumor growth, angiogenesis and development of metastasis.

[0011] In particular, existing literature suggests that copper accumulates in hepatic tumors. Accordingly, an elevated risk of liver cancer is observed in subjects affected by Wilson disease (WD): clinical studies reported in fact that the frequency of liver cancer in WD patient cohorts may reach 7%, which is several orders higher than the overall frequency in the population. Similarly, Cu overload in WD animal models (LEC rat or Atp7b / _mouse) leads to the development of liver cancer and cholangiocarcinoma.

[0012] Cu homeostasis thus represents a therapeutic target for treating several diseases that are Cu- mediated, such as Wilson disease (for which approved treatments exist but have serious ADV-00758PTITWO drawbacks in a substantial cohort of patients that can still develop cirrhosis with fatal consequences), and Cu-mediated cancer, including liver cancer and cholangiocarcinoma.

[0013] The development of new therapeutic strategies targeting copper homeostasis is then of particular interest, but it has so far been hampered by the poor understanding of the molecular mechanisms that can be exploited to normalize Cu homeostasis.

[0014] BRIEF DESCRIPTION OF THE INVENTION

[0015] The inventors have, for the first time, underscored an important regulatory role of cellular prior protein (PrP) in WD pathogenesis and in hepatic Cu metabolism in general. In fact, the inventors uncovered a primary role of PrP in promoting Cu toxicity, by facilitating Cu uptake by ATP7B -deficient hepatic cells.

[0016] The role of PrP in Cu dyshomeostasis was previously uncharacterized: in fact, this protein has never been considered a relevant player in the pathogenesis of Cu-mediated diseases and in hepatic Cu metabolism in general. This oversight could be explained in part by the fact that PrP expression is high in the nervous system, but much lower in other tissues, including the liver. As a result, the Cu-binding properties / functions of PrP have been mainly explored in a neurocentric context linked to Prion Disease.

[0017] Surprisingly, the inventors have found that PrP suppression significantly ameliorates the phenotype of Atp7b / _mice, substantially reducing liver damage.

[0018] These findings have opened the way to a novel therapeutic strategy for Cu-mediated disorders, based on the inhibition of PrP function. In fact, the present results support a role of high PrP expression in promoting abnormal accumulation of Cu, which fuels numerous processes favouring malignant transformation of cells and tissues.

[0019] In agreement with this, it is observed that PrP is highly expressed in cholangiocarcinoma nodes in the liver of Atp7b / _mice, whereas PrP depletion almost completely prevents tumor growth. The present invention thus provides a novel therapeutic agent for use in the therapy of a Cu- mediated diseases, comprising, or consisting of, at least one inhibitor of the function of prion protein (PrP). Preferably, the Cu-mediated disease is selected from: Wilson Disease, a Cu- dependent cancer, or a combination thereof. Further diseases that can be treated by the therapeutic agent of the present invention include MEDNIK syndrome and KID AR syndrome. The present invention is also directed to a pharmaceutical compositions for use in the therapy of a Cu-mediated disease, comprising the therapeutic agent of the invention and pharmaceutically acceptable carriers, diluents, or excipients.

[0020] Moreover, the present invention is directed to a method for the treatment of a Cu-disease, comprising administration, in subjects in need thereof, of a therapeutic agent comprising, or ADV-00758PTITWO consisting of, at least one inhibitor of the function of PrP.

[0021] The features and advantages of the present invention will become apparent from the following detailed description, from the embodiments provided by way of illustrative and non-limiting examples, and from the attached figures.

[0022] BRIEF DESCRIPTION OF FIGURES

[0023] Fig. 1: A-B) Viability of WT and ATP7B-KO cells incubated with CuCh at indicated concentrations for 24h, evaluated by MTT assay (A) or by live / dead fluorescent assay (B): the results demonstrate the lower resistance of ATP7B-KO cells to increasing copper concentrations (two way ANOVA; n=3 experiments). C) Gene ontology (GO) enrichment analysis of hit genes reducing Cu toxicity in ATP7B-KO cells as screened by genome- wide shRNA screening; the plot shows top 20 biological process terms that are significantly enriched among hit genes, including GO categories related to transition metal homeostasis and transport (highlighted in pink). D) Viability of ATP7B-KO cells incubated with 0.5 mM CuCh for 24h after silencing by siRNAs of specific transition metal hit genes for 48h: the graph shows viability fold change evaluated by MTT assay for each siRNA treatment vs control (siControl) (** p<0.01, **** p<0.0001; one way ANOVA; n=3 experiments). E) Viability (MTT assay) of ATP7B-KO HepG2 cells incubated with control (siControl) or CTR1 -specific siRNAs (siCTRl) and exposed for 24h to CuCh at different concentrations: CTR1- silencing does not improve resistance to Cu. F) Further evaluation of siRNAs improving resistance to Cu using live-dead fluorescent assay: the graph shows fold increase of live cells analyzed using HCS Opera system for each siRNA treatment vs control (siControl) (** p<0.01, **** p<0.0001; one way ANOVA; n=3 experiments).

[0024] Fig. 2: A-B) Viability of ATP7B-KO cells incubated with control (siControl) or PRNP-specific siRNAs (siPRNP) and exposed to CuCh at different concentrations for 24h, as evaluated by live / dead assay (A) and MTT assay (B) (Live / dead assay: two way ANOVA; n=5 view fields; MTT assay: two way ANOVA; n=3 experiments). C) Quantification of apoptotic ATP7B-KO cells (%) incubated with control (siControl) or PRNP-specific siRNAs and exposed for 24h to CuCh at different concentrations: activity of caspases 3 and 7 in nuclei of apoptotic cells is assessed with CellEvent fluorescent reagent staining and representative micrograms are quantified (two way ANOVA; n=4 view fields). D) Quantification of fluorescent copper sensor CF4 signal in WT and ATP7B-KO cells incubated with control (siControl) or PRNP-specific siRNA (siPRNP) and exposed to 0.5mM CuCh for 24h; PRNP suppression reduces Cu accumulation in ATP7B-KO cells (*** p<0.001; one way ANOVA; n>300 cells). E) Cu levels in cells WT and ATP7B-KO treated with siControl or siPRNP and then subjected to ICP-MS ADV-00758PTITWO analysis (** p<0.01, *** p<0.001; one way ANOVA; n=3 experiments). F) MT1X expression evaluated by qRT-PCR in cells WT and ATP7B-KO treated with siControl or siPRNP (* p<0.05, *** p<0.001; one way ANOVA; n=3 experiments). G -H) evaluation in ATP7B-KO cells incubated with control (siControl) or siPRNP and exposed to 0.5 mM CuC12 for 24h of mitochondrial dysfunction and abnormalities, respectively evaluated by quantification of labelling with mitochondrial membrane potential dye TMRE (G: *** p<0.001, **** p<0.0001; two way ANOVA; n>300 cells), and by electron microscopy (H: **** p<0.0001; t-test; n>20 cells). I) Representative EM images of ATP7B-KO cells: arrows (left panel) indicate swelling of mitochondrial cristae in cells exposed to Cu (+Cu, left panel), but not in cells receiving siPRNP (+Cu +siPRNP, right panel); scale bars: 260 nm.

[0025] Fig. 3: A) Quantification of dead cells by live / dead fluorescence assay in primary hepatocytes isolated from the liver of Atp7b+ / “, Atp7b / _or Atp7b / :Prnp / “ mice exposed for 24h to CuCh at indicated concentrations. B) Quantification of apoptotic cells by CellEvent fluorescence in primary hepatocytes isolated from the liver of Atp7b / :Prnp / “ and Atp7b / _mice (*** p<0.001, **** p<0.0001; two way ANOVA; n=16 view fields).

[0026] Fig. 4: A) PRNP mRNA levels assessed by qRT-PCR in ATP7B-KO line with stable PRNP knockdown (ATP7B-KO: PRNP-KD) compared to parental ATP7B-KO HepG2 cells (** p<0.01, t-test; n=3 experiments). B) Viability of ATP7B-KO: PRNP-KD and ATP7B-KO cells incubated with CuCh at indicated concentrations for 24h, evaluated by MTT assay: the graph shows lower Cu toxicity in ATP7B-KO: PRNP-KD line (two way ANOVA; n=3 experiments). Fig. 5: A) Western Blot analysis (WB) of PrP levels in cells incubated with lOpM SM875, or 0.05 CuCh, or both, for 24h. B) Quantification of PrP levels by Western blot analysis (WB) in ATP7B-KO cells incubated for 24h with SM875 and / or with 0.5 mM CuCh (+Cu): PrP levels are reduced by SM875, especially in Cu-treated cells (** p<0.001, **** p<0.0001; one way ANOVA; n=3 experiments). C) Viability of cells incubated with medium containing lOpM SM875 (+SM875) or with control medium (-SM875) and then exposed to CuCh at different concentrations for 24h, assessed by MTT assay: reduction of Cu toxicity is obtained in SM875- treated cells (two way ANOVA; n=3 experiments). D) MT1X expression evaluated by qRT- PCR in ATP7B-KO cells treated with 0.5 mM CuCh alone or in combination with lOpM SM875: MT IX expression is significantly reduced by porphyrins and by SM875 (**** p<0.0001; one way ANOVA; n=3 experiments).

[0027] Fig. 6: A) Dynamics of serum ALT activity in Atp7b / _or Atp7b / -: Prnp / _mice (two way ANOVA; n=4 for each sex; p= 0.0092 in males; p=0.0362 in females). B) Probability of survival of Atp7b / -: Pmp / _mice compared to Atp7b / _mice (Log-rank Mantel-Cox test; n=10 ADV-00758PTITWO females, n=12 males; p= 0.0309 in males; p=0.0146 in females). C) Livers of Atp7b / _mice with multiple tumor nodes. D) Livers of Atp7b / -: Prnp / _animals exhibiting fairly normal morphology. E-F) Sections of liver from Atp7b / _(E) or Atp7b / -: Prnp / _(F) mice, stained with either hematoxylin and eosin (H&E), to evaluate overall morphology, or with Sirius Red (SR), to reveal fibrotic areas (visible in red color): arrowheads in E indicate abnormal giant hepatocytes; arrows in E and F show leukocyte infiltrations; empty arrows in E indicate fibrotic regions. G-H) Sections of liver from Atp7b / _mouse obtained from the same area of cholangiocarcinoma node (asterisk) containing proliferating biliary ducts: sections were either stained with hematoxylin and eosin (G) or immuno-HRP labelled with antibody against PrP (H), which reveals higher expression of PrP in the tumor (asterisk) compared to flanking parenchyma. I) Section of liver from Atp7b / -: Prnp / _immuno-HRP labelled with antibody against PrP, which do not reveal any PrP expression. Scale bars: 100 pm (E, F); 160pm (G-I). Fig. 7: A-F) Liver tissue from Atp7b / _mice embedded in paraffin, sectioned and stained with hematoxylin and eosin (A-C) or with bona fide cholangiocarcinoma marker cytokeratin 19 (E- F): A, D) Overall view of entire sections. B) Enlargement of boxl in panel A showing cholangiocarcinoma- like node with proliferating biliary ducts (arrows). C) Enlargement of box2 in panel A showing regenerative node with normal morphology (asterisk) flanking the cholangiocarcinoma area with biliary ducts (arrows). E) Enlargement of boxl in panel E showing cholangiocarcinoma-like node with multiple CK19-positive biliary ducts (arrows). F) Enlargement of box2 in panel D showing regenerative node with normal morphology (asterisk) containing few small CK19-positive biliary ducts. Scale bar: 480pm (A, D), 170pm (B, C), 100 pm (E,F).

[0028] Fig. 8: A-B) EM images of mitochondria in the liver tissue of Atp7b / _(A) or Atp7b / -: Prnp / _(B) mice: arrows and arrowheads in A indicate swollen cristae and intermembrane space, respectively; insets in A and B correspond to the dashed boxes and show accumulation of electron-dense particles in mitochondria (A) or lysosome (B); Scale bar: 260 nm (A, B). C-D) Cu concentrations quantified using ICP-OES and expressed as pg per g of wet tissue weight (ww) in livers from Atp7b / _or Atp7b / -: Prnp / _mice (C) and in Atp7b / _mice injected with Prnp-specific siRNAs for 4 weeks (D): Prnp-specific siRNA significantly reduced Cu levels in the liver of Atp7b / _animals (**** p<0.0001, t-test). E) Expression of genes encoding different Cu-transporting / binding proteins evaluated in the liver of Atp7b / _or Atp7b / -: Pmp / _mice by qRT-PCR: the graph shows changes in mRNA levels of these genes in Atp7b / -: Prnp / _mice compared to Atp7b / _mice (dash line) (*** p<0.001, * p<0.05 t-test). F) Cu levels in urine and feces measured in Atp7b- / or Atp7b / _: Prnp / _mice by ICP-OES: Atp7b / -: Prnp / _mice exhibit ADV-00758PTITWO higher Cu values in the urine (** p<0.01, t-test). Individual values for each analyzed animal are shown in each graph (C-F).

[0029] Fig. 9 Impact of SM875 (A) or other SM compounds (B) on cell viability (MTT assay) in ATP7B-KO HepG2 cells treated for 24h with increasing concentrations of CuC12. Dash line shows viability of untreated cells.

[0030] Fig. 10 A) Scheme of the experimental design for testing in vivo effects of SM875 in 2.5-month- old Atp7b / _mice (before disease onset). B) Western blot analysis of PrP levels in control (vehicle-injected) and SM875-treated mice. C) Serum ALT levels measured before the experiment and after 4 weeks of injections. Fold changes in ALT levels are shown

[0031] Fig. 11 A) Scheme of the experimental design for testing in vivo effects of SM875 in 4-month- old Atp7b- / - mice (after disease onset). B) Western blot analysis of PrP levels in control (vehicle-injected) and SM875-treated mice. C) Serum ALT levels measured before the experiment and after 4 weeks of injections. Fold changes in ALT levels are shown.

[0032] DETAILED DESCRIPTION OF THE INVENTION

[0033] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0034] It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.

[0035] The term “about” or “approximately” in relation to a numerical means indicates a range of values that fall within 10% greater than or less than the value. For example, “about x” means x ± (10% * x).

[0036] Within the present disclosure, the terms disease, disorder, pathology are used interchangeably and are to be intended in the broadest meaning of disease.

[0037] The terms "treatment", "treating", "treat" and the like, as well as “therapy” and the like, as used herein, refer to the administration of a compound, agent, composition or formulation of the invention to obtain a desired pharmacologic and / or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom(s) thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease or control of disease progression. “Prevention” refers to inhibiting the inception or decreasing the occurrence of a disease in a subject. Prevention may be complete or partial. Prevention also refers to a reduced susceptibility to a clinical condition and / or to consequences of a clinical conditions, including the onset or worsening of an associated disease. Control of disease progression is understood as the achievement of the beneficial or desired clinical results that include, but are not limited to, ADV-00758PTITWO reduction of the symptoms, reduction of the duration of the disease, stabilization of pathological states (specifically to avoid additional deterioration), delay of the progression of the disease, improvement in the pathological state, and remission (both partial and total). The control of progression of the disease also involves an extension of survival, compared with the expected survival if treatment is not applied.

[0038] In particular, in accordance with the present invention, the terms "treatment", "treating", "treat", “therapy”, and the like, as used herein, preferably refer to the administration of a therapeutic agent, according of the invention, to cure, prevent, delay and / or control the clinical manifestations of a pathology.

[0039] The term “effective amount” or “therapeutical amount” refers to a quantity of a therapeutic agent that can be sufficient to result in a desired activity upon introduction into a subject as disclosed herein. An effective amount of a therapeutic agent can be provided to a target organism and / or cell. In some embodiments, the “effective amount” or “therapeutically effective amount” is the amount of a therapeutic agent that is required to ameliorate the symptoms of a disease relative to an untreated patient.

[0040] The term “individual” or “subject” herein refers to a mammal, preferably human or non-human mammal, more preferably a human, or a mouse, rat, other rodents, rabbit, dog, cat, pig, cow, horse or primate. Those in need of treatment include those already inflicted as well as those in which prevention is desired (e.g., those with no symptoms but diagnosed with the disorder or displaying risk factors for the onset of a disease, etc.).

[0041] A “Cu-mediated disease” is a disease that is caused and / or associated to a dysregulation of Cu homeostasis; in particular, it is a disease associated to and / or caused by abnormally high levels of Cu, typically leading to Cu toxicity in cells, such as Wilson Disease, MEDNIK and KID AR syndromes, and Cu-dependent cancers, in particular liver cancer and cholangiocarcinoma, optionally associated to, or consequent to, Wilson Disease.

[0042] Therefore, the present invention is preferably directed to therapeutic agents for use in the therapy of a Cu-mediated disease, said disease being selected from: Wilson Disease, or Cu- dependent cancer, more preferably liver cancer or cholangiocarcinoma, or MEDNIK syndrome, or KID AR syndrome, or a combination thereof. A “combination” of Cu-mediated diseases is for example cholangiocarcinoma associated to Wilson Disease.

[0043] Preferably, the therapeutic agent of the invention is for use in the therapy of a disease which is not a neurodegenerative disorders, such as sporadic, inherited or acquired Prion Diseases, Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker (GSS) syndrome and fatal familial insomnia (FFI), Alzheimer's disease, Parkinson's diseases and other x- ADV-00758PTITWO synucleinopathies, a neuroinflammatory disorder or demyelinating disease, such as multiple sclerosis. Preferably, the therapeutic agent of the invention is for use in the therapy of a disease which is not glioblastoma, gastric cancer, breast cancer, or colon cancer.

[0044] According to the present invention, the therapeutic agent for use in the therapy of a Cu-mediated disease comprises, or consists of, an inhibitor of the function of PrP (also indicated herein as “PrP inhibitor”, for brevity).

[0045] PrP is a GPI-anchored cell surface glycoprotein, encoded by PRNP gene (GenBank: BC022532.1). No disease has been attributed to the loss of PrP expression in humans, and loss of one functional PRNP allele is compatible with life. Accordingly, Prnp knockout mice do not manifest any severe phenotype. PrP suppression is thus considered to be a safe therapeutic approach without undesired side effects.

[0046] A PrP inhibitor is an agent capable of, directly or indirectly, reducing or suppressing the expression or activity of PrP.

[0047] The term “expression” is used herein in its broadest meaning and comprises the production of RNA or of RNA and protein. With respect to RNA, the term “expression” or “translation” relates in particular to the production of peptides or proteins.

[0048] For example, an inhibitor in accordance with the present invention can be a molecule that, directly or indirectly, reduces or suppresses the transcription of the PRNP gene, or the translation of the same from its gene transcript (messenger RNA, mRNA).

[0049] A PrP inhibitor, in accordance with the present invention, can also be a chemical entity, such as a small molecule, capable of, directly or indirectly, reducing or suppressing the biological activity of PrP.

[0050] Therefore, the present invention is preferably directed to a therapeutic agent for use in the therapy of a Cu-mediated disease, said agent comprising, or consisting of at least one PrP inhibitor, said at least one inhibitor being a chemical entity, such as a small molecule, or being a genetic silencer targeting PrP, said inhibitor being capable of, directly or indirectly, reducing, or suppressing, the expression or activity of PrP.

[0051] According to some preferred embodiments, the therapeutic agent for use in the therapy of a Cu- mediated disease comprises, or consists of, at least one chemical entity capable of post- translationally decreasing the expression of PrP, such as the compounds described in WO2021191883 (the content of which is incorporated herein by reference), which promote the lysosomal degradation of the PrP polypeptide from the endoplasmic reticulum. More preferably, said at least one chemical entity capable of post-translationally decreasing the expression of PrP is a compound having one of the following formulas : ADV-00758PTITWO

[0052] EPl ADV-00758PTITWO

[0053] LC2 ADV-00758PTITWO

[0054] DG1 ADV-00758PTITWO

[0055] GC2 ADV-00758PTITWO

[0056] GC6 ADV-00758PTITWO

[0057] GC10 ADV-00758PTITWO

[0058] CP4 ADV-00758PTITWO

[0059] GI02 The compounds disclosed above may comprise one or more stereocenters, so that the above formulas include all the optical isomers, geometric isomers, and stereoisomers, as well as mixtures thereof, such as mixtures of enantiomers, racemates, and mixtures of diastereoisomers. Furthermore, the above formulas include all polymorphic forms thereof, including amorphous and crystalline forms, co-crystalline forms, as well as anhydrous, hydrated, and solvate forms, pharmaceutically acceptable salts, and mixtures thereof. ADV-00758PTITWO

[0060] According to particularly preferred embodiments, said chemical entity capable of post- translationally decreasing the expression of PrP is anyone of: and ADV-00758PTITWO or combinations thereof.

[0061] More preferably, said at least one chemical entity capable of post-translationally decreasing the expression of PrP is an isolated R-enantiomer of SM 875 compound of formula:

[0062] According to some preferred embodiments, the therapeutic agent for use in the therapy of a Cu- mediated disease comprises, or consists of, at least one genetic silencer of PrP.

[0063] A “genetic silencer” of PrP is a molecule capable of specifically targeting PRNP gene, or a transcript thereof, and of inhibiting, reducing or disrupting the expression of PRNP gene or of an allele of the target gene, or of inhibiting or reducing the translation of a transcript thereof. Preferably, a genetic silencer according to the invention reduces the amount or the activity of its target by no more than 90%, no more than 80%, no more than 70%, no more than 60%, or no more than 50%, compared to a non-inhibited target; more preferably, a genetic silencer according to the invention reduces the amount or the activity of its target by 10-70%, by 10- 60%, by 10-50%, compared to a non-inhibited target.

[0064] Preferably, the therapeutic agent comprises at least one genetic silencer being an RNA interfering (RNAi) molecule, such as a synthetic small interfering RNA (siRNA), a short hairpin RNAs (shRNAs), an artificial miRNAs (amiRNA), an antisense oligonucleotide, a gene editing molecule, an epigenetic editing molecule, or combinations thereof, said genetic silencer being capable of reducing, or suppressing, the expression or activity of PrP, more preferably by targeting PRNP gene or transcript thereof, inhibiting the same.

[0065] The genetic silencer according to the invention can be a RNAi molecule as such (i.e. a “mature” RNAi molecule), typically a single-stranded or double-stranded RNA molecule.

[0066] Moreover, the genetic silencer can be a “precursor” of the mature RNAi molecule: the precursor has two regions of self-complementarity that enables them to form a stem-loop -like structure, which is cleaved by enzymes called Dicer and Drosha in animals; the processed RNAi (mature RNAi molecule), that is the active molecule comprising or consisting of the targeting sequence, is typically a portion of the stem. ADV-00758PTITWO

[0067] Furthermore, the genetic silencer can be a “source” of an RNAi molecule or of a precursor thereof, that may be in the form of a DNA sequence comprising the sequence encoding the RNAi molecule, preferably extending at least 1 to 5 nucleotides of coding sequence upstream and / or downstream of the predicted sequence encoding the RNAi molecule. In some embodiments, RNAi source molecules have up to 1, 2, 3, 4, 5, 6, 7, or more contiguous nucleotides, or any range derivable therein, that flank the sequence encoding the predominant processed mature RNAi or precursor thereof, on one or both sides (5' and / or 3' end).

[0068] Equivalents of the RNAi molecule are also included in the invention.

[0069] The term “equivalent”, when referred to RNAi molecules, is meant to indicate a chemically modified RNAi molecule or a RNAi nucleotide analogue, maintaining the same activity of the RNAi molecule, or a RNAi molecule comprising a degenerated targeting sequences or a sequence with one or more additions, substitutions (generally conservative in nature) and / or deletions, or a sequence that has a high degree of sequence homology to the reference sequence, e.g., sequence homology of at least 80%, at least 85%, at least 90% homology to the targeting sequence of the RNAi molecule. The terms “% sequence identity”, “% identity” or “% sequence homology” refer to the percentage of nucleotides or amino acids of a candidate sequence that are identical to the nucleotides or amino acids in the sequence of reference, after aligning the sequences to achieve the maximum % sequence identity. In a preferred embodiment, sequence identity is calculated based on the full length of two given sequences or on part thereof. The % sequence identity can be determined by any methods or algorithms established in the art, such as the ALIGN, BLAST and BLAST 2.0 algorithms. Herein, the “% sequence identity”, “% identity” “or “% sequence homology” is calculated dividing the number of nucleotides or amino acids that are identical after aligning the sequence of reference and the candidate sequence, by the total number of nucleotides or amino acids in the sequence of reference and multiplying the result by 100. Preferably the equivalent’s sequence has greater than 90%, 95%, 99% sequence identity with the RNAi molecule’s sequence.

[0070] Several chemical modifications that are well known in the art, aimed at increasing stability or availability of the RNA oligonucleotides, may be made. Also, RNAi molecules of the invention specifically contemplate the use of nucleotides that are modified to enhance their activities. Such nucleotides include those that are at the 5' or 3' terminus of the RNAi molecule as well as those that are internal within the molecule. Modified nucleotides used in the complementary strands of a double strand RNAi molecule either block the 5 'OH or phosphate of the RNA or introduce internal sugar modifications that enhance uptake of the active strand of the RNAi molecule. Modifications for the RNAi molecules include internal sugar modifications that ADV-00758PTITWO enhance hybridization as well as stabilize the molecules in cells and terminal modifications that further stabilize the nucleic acids in cells. Equivalents of RNAi molecules according to the invention thus include RNAi molecules comprising modified nucleotides. Equivalents of RNAi molecules according to the invention also include RNAi molecules comprising modified nucleotides termed UNA (unlocked nucleic acid): UNA are acyclic analogues of RNA in which the bond between the C2' and C3' atoms has been cleaved, decreasing binding affinity towards a complementary strand, as described in WO2008 / 147824. UNA are compatible with RNase H recognition and RNA cleavage and improves siRNA mediated gene silencing.

[0071] Equivalents also include RNAi molecules according to the invention comprising morpholino nucleic acid analogues, which contain both uncharged and cationic inter-subunit linkages, as described in W02008 / 036127, Zip Nucleic Acids (ZNA), containing conjugating spermine derivatives as cationic moieties (Z units) to an oligonucleotide (W 0 / 2007 / 069092 and EP2075342). Additional teachings for RNAi equivalents are provided in U.S. Patent 5,728,525, which describes nucleoside analogues that are end-labelled, U.S. Patent 5,637,683, 6,251,666, which describe L-nucleotide substitutions, and U.S. Patent 5,480,980, which describes 7-deaza- 2'-deoxyguanosine nucleotides and nucleic acid analogues thereof. The use of other nucleotide analogues is specifically contemplated for use in the context of the present invention. They include, but are not limited to: ribose modifications (such as 2'F, 2' H2, 2'N3,4'thio, or 2' 0- CH3) and phosphate modifications (such as those found in phosphorothioates, methyl phosphonates, and phosphoroborates. Such analogues confer stability on RNAs by reducing or eliminating their capacity to be cleaved by ribonucleases. When these nucleotide analogues are present in RNAi molecules, they can have profoundly positive effects on the stability of the RNAi molecules in animals.

[0072] Equivalents also include equivalents of the RNAi molecule precursors or sources thereof, such as codon-optimized sequences and sequences comprising mutated or added nucleotides, e.g., for cloning needs.

[0073] The RNAi molecules according to the invention can be obtained from commercial RNA oligo synthesis suppliers. Alternatively, the RNAi molecules according to the invention can be expressed in cells by transfecting the cells with vectors containing a RNAi source, such as a transgene, for expressing the RNAi precursor under the control of a suitable promoter.

[0074] The at least one genetic silencer is preferably produced by recombinant methods for producing nucleic acids in a cell, that are well known to those of skill in the art. These include the use of vectors, plasmids, cosmids, and other vehicles for delivering a nucleic acid to a cell, which may be the target cell or simply a host cell (to produce large quantities of the desired molecule). ADV-00758PTITWO

[0075] Preferably, the therapeutic agent comprises at least one at least one genetic silencer of PrP being a RNAi molecule precursor in the form of a stem-loop polynucleotide, consisting of e.g., 50 to 80 nucleotides in length, or 50 to 70 nucleotides, or 50 to 65 nucleotides in length, that comprise the targeting sequence. Preferably, the RNAi precursor polynucleotide comprises (5’ to 3’) about 5 nucleotides flanking a targeting sequence, the targeting sequence, preferably of about 21 nucleotides, that corresponds to the mature RNAi molecule sequence, a loop sequence of 19-22 nucleotides, and the sense target sequence of 19-21 nucleotides optionally including a mismatch in respect of the targeting sequence; preferably the sense target sequence is the reverse complement of the targeting sequence with one, two, or three nucleotides being mismatched; for instance a sense target sequence in a RNAi precursor molecule can comprise nucleotides 1-8 of the reverse complement of a 21 nucleotides-long targeting sequence followed by nucleotides 11-21 of the reverse complement of said 21 nucleotides-long targeting sequence. Preferably the therapeutic agent comprises at least one genetic silencer of PrP being a source of a RNAi molecule, said source being a DNA molecule encoding the RNAi molecule or precursor thereof. The DNA molecule encoding the RNAi molecule or precursor thereof is preferably comprised in a vector. The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, lentivirus, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques, which are described in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby incorporated by reference.

[0076] According to preferred embodiments, the DNA molecule encoding the RNAi molecule or precursor thereof is comprised in a viral vector for delivery in a cell and expression of the precursor in the cell.

[0077] According to preferred aspects of the invention, the RNAi molecule source comprises or consists of an expression cassette, or of a vector genome comprising an expression cassette, said expression cassette comprising a nucleic acid sequence encoding the RNAi molecule or precursor thereof, operably linked to regulatory sequences which direct expression of the nucleic acid sequence in the subject.

[0078] In preferred embodiments the therapeutic agent comprises at least one genetic silencer of PrP being a small interfering RNA (siRNA). siRNAs is a synthetic RNA duplex designed to specifically target a particular mRNA for degradation. siRNAs consist of two RNA strands, an ADV-00758PTITWO antisense (or guide) strand and a sense (or passenger) strand, which form a duplex, preferably of 19 to 25 bp in length with 3' dinucleotide overhangs.

[0079] More preferably, said genetic silencer of PrP is a siRNA comprising a sense strand having sequence, comprising, or consisting of, sequence SEQ ID NO: 27 or 29 and / or comprising an antisense strand having sequence, comprising, or consisting of, sequence SEQ ID NO: 28 or 30, or a precursor or source thereof, or an equivalent thereof.

[0080] In preferred embodiments, the therapeutic agent comprises at least one at least one genetic silencer of PrP being a short hairpin RNA (shRNA), having sequence comprising, or consisting of, SEQ ID NO: 79 or 80, or a precursor or source thereof, or an equivalent thereof.

[0081] Preferably, the therapeutic agent comprises at least one at least one genetic silencer of PrP being a short hairpin RNA (shRNA), having sequence targeting sequence SEQ ID NO: 81, or a precursor or source thereof, or an equivalent thereof.

[0082] Other suitable PrP inhibitors, in accordance with the present invention, include other small molecules, antibodies, peptide -based therapeutics, RNA-based therapeutics, gene therapy or gene editing therapeutic approaches, capable of inhibiting the function of PrP, i.e. capable of, directly or indirectly, reducing or suppressing the biological activity of the target molecule.

[0083] For instance, further PrP inhibitors in accordance with the present invention include:

[0084] - humanized anti-PrPcmonoclonal antibodies, such as PRN 100 (Mead, Simon et al. The Lancet Neurology, Volume 21, Issue 4, 342 - 354);

[0085] - antisense oligonucleotides, such as ION717, inhibiting the production of prion protein (see Raymond GJ, et al. Antisense oligonucleotides extend survival of prion-infected mice. JCI Insight. 2019 Jul 30;5 (16):el31175);

[0086] - Zinc Finger Repressors (ZF-R), such as the ZF-R developed by Sangamo (see WO2021067864, incorporated herein by reference);

[0087] - enzyme-free epigenetic editors, such as CHARM (see Edwin N. Neumann et al. Science384, ado7082(2024).

[0088] The therapeutic agent of the invention may be administered to a subject either alone or in the form of a pharmaceutical formulation comprising one or more physiologically acceptable carriers, diluents, or excipients. Therefore, the invention is further directed to a pharmaceutical formulation for use in the therapy of a Cu-mediated disease, comprising the therapeutic agent of the invention and pharmaceutically acceptable carriers, diluents, or excipients.

[0089] Pharmaceutically acceptable carriers, diluents, or excipients include a non-toxic solid, semisolid, or liquid filler, diluent, encapsulating material, or formulation auxiliary of any conventional type that may optionally be included in the compositions of the invention and that ADV-00758PTITWO causes no significant adverse toxicological effects to the patient.

[0090] A “pharmaceutically acceptable excipient" is essentially non-toxic to recipients at the employed dosages and concentrations and is compatible with other ingredients of the formulation. The number and the nature of the pharmaceutically acceptable excipients depend on the desired administration form. Pharmaceutically acceptable excipients are known and may be prepared by methods well known in the art.

[0091] A "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavouring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference).

[0092] Proper formulation is dependent upon the inhibitor to be administered and the route of administration. For example, small molecule inhibitors can be administered as solid formulations, while genetic silencers can be administered as liquid formulation comprising a suitable vehicle for delivering the genetic silencer. When the therapeutic agent comprises both small molecule inhibitors and genetic silencers, each of those is administered with a different formulation to a subject in need thereof.

[0093] Systemic formulations include those designed for administration by injection, e.g., subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal, inhalation, oral or pulmonary administration.

[0094] For injection, the therapeutic agent or pharmaceutical formulation of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer. The solution may contain formulating agents such as suspending, stabilizing and / or dispersing agents.

[0095] Alternatively, the therapeutic agent or pharmaceutical formulation may be in solid form or it can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0096] For oral administration, e.g., for administering a therapeutic agent comprising a small molecule inhibitor, the therapeutic agent or pharmaceutical formulation can be readily formulated by combining the molecules with pharmaceutically acceptable carriers well known in the art. Such carriers enable the nucleic acids of the invention to be formulated as tablets, pills, dragees, ADV-00758PTITWO capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. For oral solid formulations such as, for example, powders, capsules and tablets, suitable excipients include fillers such as sugars, e.g., lactose, sucrose, mannitol and sorbitol; cellulose preparations such as maize starch, wheat starch, rice starch, potato starch, gelatine, gum tragacanth, methyl cellulose, hydroxypropyl methyl-cellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone; granulating agents; and binding agents. If desired, disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. If desired, solid dosage forms may be sugar-coated or enteric- coated using standard techniques. For oral liquid preparations such as, for example, suspensions, elixirs and solutions, suitable carriers, excipients or diluents include water, glycols, oils, alcohols, etc. Additionally, flavouring agents, preservatives, collaring agents and the like may be added. For buccal administration, the therapeutic agent or pharmaceutical formulation may take the form of tablets, lozenges, etc. formulated in conventional manner.

[0097] For administration by inhalation, the therapeutic agent or pharmaceutical formulation for use according to the present invention is conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant. In addition to the formulations described previously, the therapeutic agent or pharmaceutical formulation for use according to the present invention may also be formulated as a depot preparation. Such long- acting preparations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.

[0098] The therapeutic agent or pharmaceutical formulation according to the present invention is preferably for subcutaneous administration or for oral administration.

[0099] Preferably, for administration to a human subject in need thereof of a therapeutic agent comprising a genetic silencer of PrP, the therapeutic agent comprises at least one vector for delivering the genetic silencer, more preferably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, e.g., in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8.

[0100] Preferably, the formulation may contain one or more permeation enhancers. Examples of suitable permeation enhancers may include, e.g., mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulphate, polyoxyethylene-9-laurel ether, or EDTA.

[0101] Preferably, the formulation may contain, in addition to a vector (e.g., a recombinant AAV) and ADV-00758PTITWO carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. The therapeutic agent comprising a vector for delivering a genetic silencer is administered in sufficient amounts to provide to a cell a sufficient level of the genetic silencer to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts. Dosages of a vector to be administered for delivering the genetic silencer according to the invention will depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and may thus vary among patients. For example, a therapeutically effective human dosage of viral vector is generally in the range of from about 25 to about 1000 microliters to about 100 mL of solution containing concentrations of from about 1 x 109to 1 x 1016genomes virus vector (to treat an average subject of 70 kg in body weight) including all integers or fractional amounts within the range.

[0102] The practitioner responsible for administration will, in any event, determine the concentration of PrP inhibitor in a composition and appropriate dose(s) for the individual subject.

[0103] The term “unit dosage form” or “unitary dose”, as used herein, refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of the compound, composition or formulation to be administered, calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for the unit dosage forms for use in the present invention depend on the particular compound employed and the effect to be achieved, the pharmacodynamics associated with each compound in the host, and the like.

[0104] Preferably, a unitary dose of a pharmaceutical formulations for administering the therapeutic agent may comprise, for example, at least about 0.1 wt.%, 1- 90 wt.%, 2-75 wt.% 25-60 wt.%, of the therapeutic agent, based on the weight of the unitary dose, and any range derivable therein.

[0105] In other non-limiting examples, a unitary dose may also comprise less than 1 pg / kg / body weight, or 1 pg / kg / body weight, from 5 pg / kg / body weight, 10 pg / kg / body weight, 50 pg / kg / body weight, 100 pg / kg / body weight, 200 pg / kg / body weight, 350 pg / kg / body weight, 500 pg / kg / body weight, 1 mg / kg / body weight, 5 mg / kg / body weight, 10 mg / kg / body weight, 50 mg / kg / body weight, 100 mg / kg / body weight, 200 mg / kg / body weight, 350 mg / kg / body weight, or 500 mg / kg / body weight, to 1000 mg / kg / body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of 5 mg / kg / body weight to 100 mg / kg / body weight, 5 pg / kg / body weight ADV-00758PTITWO to 500 mg / kg / body weight, etc., can be administered, based on the numbers described above. Preferably, a pharmaceutical formulation or therapeutic agent according to the invention comprising at least one small molecule inhibitor is administered in a daily unitary dose of 1- 300 mg, preferably at a daily dose of 5-250 mg, 10-200 mg, or 15-150 mg.

[0106] Therapeutically effective levels of the therapeutic agent may thus be achieved by administering multiple doses each day.

[0107] The amount of therapeutic agent administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician.

[0108] Preferably, a therapeutically effective dose of the molecules described herein will provide therapeutic benefit without causing substantial toxicity. Toxicity of the molecules described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the Maximal tolerated dose (Ann. Pharm, Fr, 2010, 291-300). The dose ratio between toxic and therapeutic effect is the therapeutic index. The data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in human.

[0109] It should be understood that all the possible combinations of the preferred aspects of the present invention are also described, and therefore similarly preferred.

[0110] Examples of preferred embodiments of the present invention and analyses of their efficacy are provided below for illustrative and non-limiting purposes. The results provided demonstrate that Cu accumulation in ATP7B -deficient hepatic cells stimulates the expression of PrP, which in turn drives endocytic Cu uptake leading to toxic Cu overload. PrP suppression significantly limits Cu accumulation and toxicity in ATP7B -deficient cells and reduces liver damage in a mouse model of Wilson disease. These findings underscore an important regulatory role of PrP in copper metabolism and demonstrate the therapeutic potential of PrP suppression in Cu- mediated diseases such as Wilson disease and copper-dependent cancer (cuproplasia), and in particular liver cancer and cholangiocarcinoma, optionally associated to, or consequence of, Wilson disease.

[0111] EXAMPLES

[0112] MATERIALS AND METHODS

[0113] Antibodies and Plasmids

[0114] The followed antibodies were used: mouse monoclonal anti-Prion 3F4 (Tapella, L. el al.

[0115] Biochemical Journal 454, 2013) (dilution: 1: 100 for IF), mouse monoclonal anti-Prion 6D12 ADV-00758PTITWO

[0116] (Wageningen University and Research, dilution: 1: 100 for IF), mouse monoclonal anti-Prion 12B2, 100B3, 94B4 (Wageningen University and Research, dilution: 1: 100 for IF, 1: 1,000 for WB, 1: 100 for Ventana); Alexa Fluor 568 Phalloidin (Thermo Fisher, A12380, dilution: 1:600 for IF ); mouse monoclonal anti-MRP2 (Enzo Lifescience, ALX-801-016-C250, dilution: 1:50 for IF ); mouse monoclonal anti-Prion SAF32 (Bertin Bioreagent, A03202, dilution: 1: 50 for IF), rabbit anti-Myc tag (Millipore, 06549, dilution 1: 100), mouse monoclonal anti-K / Na- ATPase (Abeam, ab7671, dilution 1: 100), mouse anti-GAPDH (Santa Cruz Biotechnology, sc- 32233, dilution 1: 1,000 for WB), rabbit monoclonal anti-ATP7B (Abeam, Ab 124973, dilution 1: 1,000 for WB) or mouse monoclonal anti-Vinculin (Sigma- Aldrich- Aldrich, V9264, dilution 1:5,000 for WB).

[0117] Cell culture and transfection

[0118] Parental or ATP7B -knockout (KO) HepG2 cells (Chandhok, G. et al. PLoS One 9, e98809, 2014) were grown in RPMI medium supplemented with 10% fetal calf serum (Euroclone), 1% L-glutamine (Euroclone), and 1% penicillin / streptomycin (Euroclone). The ATP7B-KO cell line with stable PRNP knockdown (ATP7B-KO:PRNP-KD) was generated by infecting ATP7B-KO cells with pLKOl-puro-CMV-tGFP shPRNP-lentiviral particles (Mission lentiviral transduction particles, Sigma Aldrich) and upon selection with puromycin.

[0119] Primary hepathocytes cells were isolated from livers of 6-week-old Atp7b / _, Prp / ;Atp7b / “ or control HZ Atp7b mice by a modified protocol based on Pronase / collagenase digestion. In brief, mouse livers were perfused through the inferior vena cava with EGTA solution followed by enzymatic digestion with Pronase (Sigma-Aldrich) and then collagenase type D (Roche Applied Science). Next, livers were harvested, and liver cells were disassociated by digestion with Pronase / collagenase solution and filtered through a nylon filter (Corning) to remove undigested tissues and debris. The resulting cell suspension was centrifuged and washed three times. The final cell suspension was plated in a 24 well plate on Bovine collagen substrate (Advanced BioMatrix) In Hepatozyme (Gibco) media supplemented with 1% Pen Strep, 5% ITS solutions (Thermofisher). The day after, dead cells were removed through medium washes prior being treated with different concentrations of CuCh to assess resistance to copper by Live / Dead or apoptotic assays (see below).

[0120] RNA interference

[0121] Small interfering RNAs (siRNAs) were custom designed and purchased from Sigma-Aldrich (Table 1). Scrambled ON-TARGETplus Non-targeting Control siRNAs was used as a control (Dharmacon). ADV-00758PTITWO ADV-00758PTITWO ADV-00758PTITWO

[0122] HepG2 cells were transfected with individual or pooled siRNAs using Darmafect4 (Dharmacon) according to the manufacturer’s instructions. Silencing efficiency was assayed using qRT-PCR. Efficiency of the target gene silencing was confirmed by qRT-PCR.

[0123] Drug treatments in vitro

[0124] Treatment with SM875 (10 pM; Spagnolli et al., 2021) was performed in ATP7B-KO cells for 24h followed by the addition of different concentrations of CuCh for 24 h. Cells were then analyzed with the MTT viability assay, the live / dead assay, or processed for protein or RNA isolation as described below.

[0125] Drug treatments in vivo

[0126] SM875 was administered at a concentration of 10 mg / kg via intraperitoneal (IP) injection in Atp7b- / - mice. Control animals received a vehicle solution containing 70% saline, 20% Tween, and 10% DMSO.

[0127] SM875 powder was reconstituted as a 50 mM stock solution in DMSO. For each 20 g mouse, 10 pL of the stock solution was diluted in a solution of 70% saline and 20% Tween, and 150 pL of the final solution was administered via IP injection.

[0128] SM875 efficacy was evaluated in two age groups. First, in 2.5-month-old mice (pre-disease onset), animals received IP injections three times per week for 4 weeks. Serum AFT levels were measured before and after the treatment period. At the end of treatment, mice were sacrificed, and PrP expression in liver tissue was assessed by Western blot.

[0129] SM875 was also tested in 4-month-old mice (post-disease onset) using the same experimental design. The only modification was a shorter treatment period of 2 weeks, to minimize animal loss due to the high mortality rate in Atp7b / _mice at this age.

[0130] MTT and live / dead viability assays

[0131] Cell viability after treatment was determined by measuring the ability to reduce the tetrazolium salt (MTT) (Life Technologies) to a formazan using a previously described procedure (Concilli, M. et al. Proc Natl Acad Sci USA 117, 32453-32463, 2020).

[0132] For the live / dead cytotoxicity assay, the cells were washed in PBS and incubated with the Live / Dead reagent (Life Technologies) for 45 min following the manufacturer’s instructions. Labelled cells were viewed and analyzed using the Opera High Content (HC) screening system (Perkin Elmer) with FITC and RFP filters to count live / dead cells in the treated and control ADV-00758PTITWO specimens. Quantification was done in at least 5 fields for each condition and the proportion of live cells was calculated as a percentage of total cells in the specimen.

[0133] Apoptotic assay

[0134] To analyze cell apoptosis, the cells were incubated with 6 mM Cell Event Caspase-3 / 7 Green Detection Reagent (Life Technologies) for 30 min, then fixed and labeled with DAPI to counterstain nuclei. After activation of Caspase-3 / 7, the apoptotic cell nuclei stain green due to the binding of the Cell Event dye to DNA. Images of labeled cells were acquired at Zeiss LSM700 confocal stage with a 20X objective, appropriate laser excitation lines and filter sets. Quantification of apoptotic cells was performed in 10 fields for each condition and the proportion of apoptotic cells was calculated as a percentage of total cells in the specimen.

[0135] Genome-wide shRNA screenings in ATP7B-KO cells

[0136] Cell transduction with a Lentiviral shRNA Screening Library and gDNA isolation.

[0137] Decode™ Pooled Lentiviral shRNA Screening Library (Cat. #RHS6083, Dharmacon) was used in ATP7B-KO cells. This library targets 18,205 human genes and contains 10 pools of 9,570 GIPZ short hairpin RNAs (shRNAs) packaged into high-titer lentiviral particles. Each target gene has 4-7 corresponding shRNAs distributed across the different pools.

[0138] Transduction of ATP7B-KO cells with each pool was performed according to the manufacturer’s instructions with a lentiviral MOI of 0.3 to ensure the integration of not more than one shRNA per cell. The number of cells seeded for transduction was calculated to have at least 1,000 copies for each shRNA in the transduced cell population. Viral particles diluted in 9 ml of transduction media (DMEM with no serum or antibiotics) and lOmg / ml polybrene were added to the cells, which were further propagated with 2 mg / ml of puromycin for 96 hours to select the population with stable shRNA integration. For each shRNA pool the transduced cells were expanded to at least ten 100 mm plates to maintain shRNA copy representation. The cells were then divided into reference group, which was not treated, and treated group, which was incubated with 0.5 mM CuCh for 24h. The cells from both reference and treated groups were collected in PBS and subjected to apoptotic cell removal with the Apoptotic Cell Isolation Kit (Novus Biologicals). Cells pellets obtained after the apoptotic cell removal were frozen until processing for genomic DNA (gDNA) isolation. gDNA was isolated from transduced cells using Quick-DNA Miniprep Plus kit (Zymo Research) according to the manufacturer’s procedure. For each library pool, 3 gDNA specimens from the reference group and 3 gDNA specimens from the treated group were collected for PCR amplification. Each specimen contained at least 6.6 pg of gDNA to maintain representation at 1000 copies per shRNA. ADV-00758PTITWO

[0139] PCR amplification. gDNA specimens were further PCR amplified with index primers recognizing bar codes, which allows each shRNA copy to be assigned to a specific specimen during the demultiplexing step of sequencing data analysis. Amplification was performed using the manufacturer’s protocols and Decode PCR primers (Darmacon) provided together with the shRNA library. For each specimen, eight technical replicates (each containing 825 ng of gDNA) were amplified with Decode PCR primers using 96-well plates. In each well, a 50 pl reaction mix contained 200 mM dNTP, 0.5 M betaine and 0.08 U / ml of Phusion Hot Start II DNA Polymerase (Sigma- Aldrich). Individual reactions from replicates belonging to the same specimen were pooled together and the presence of a 660 base pair amplicon for each specimen was confirmed by agarose gel electrophoresis. DNA amplicons were purified using the Quick DNA MiniPrep Plus kit (Zymo Research) and their yield and quality was evaluated using a Nanodrop 1000 spectrophotometer (Thermo Fisher).

[0140] Library preparation and next generation sequencing (NGS). For preparation of the library containing single samples, the manufacturer’s instructions were followed (Dharmacon). Purified DNA samples were validated and quantified by microfluidic analysis using the Bioanalyzer High Sensitivity DNA Assay kit (Agilent Technologies) and the 2100 Bioanalyzer with 2100 Expert Software. All samples were pooled with a 10% phiX spike-in. The library was sequenced using the Next Seq500 system performing single read (SR) runs covering at least 75 nt. (Illumina Inc., San Diego, CA, USA).

[0141] Data analysis. To analyze the NGS datasets, a demultiplexing step for the high-throughput sequencing output was first performed with the bcl2fastq tool (ver. 2.20.0.422) (https: / / scicrunch.org / resolver / SCR_015058), obtaining one FASTQ file for each sample. To measure the relative quantity of each shRNA in a sample, the NGS reads were aligned to the construct FASTA reference files, provided with the Dharmacon library, using Bowtie2 (ver. 2.4.2). The Bowtie2 output was converted into a single raw count matrix for subsequent analysis using the Python (ver. 2.7.18) script cpuntBowtie2Hits.py, which was provided by Dharmacon. Finally, raw counts were normalized into counts per million (CPM), computed the differential expression analysis between the two conditions of the experimental design, and annotated each shRNA with the corresponding gene. These steps were performed in R environment (ver. 4.2.3), using NOISeq package (ver. 2.42.0) for the normalization, and edgeR package (ver. 3.40.2) for the identification of shRNAs differentially represented in reference and treated cell populations. Hit gene selection. The gene hits were selected according to the following criteria. Each hit gene must have at least two corresponding shRNAs enriched in the treated specimen, with a statistically significant false discovery rate (FDR) < 0.05. These enriched shRNAs must belong ADV-00758PTITWO to different pools of the library, and at least one of them has to be enriched more than twice (LogFC>l). Finally, no significantly depleted shRNA should correspond to the hit gene.

[0142] Vinblastine screening. The genome-wide screen was repeated with the same pooled shRNA lentiviral library using the proapoptotic drug vinblastine (60 pM for 24h) instead of CuCh as a selective pressure treatment. The hit lists from the CuCh and vinblastine screens were compared and common hits were excluded from further analyses. This is because their suppression is likely to inhibit generic cell death mechanisms rather than specifically counteracting copper toxicity in ATP7B-KO cells.

[0143] Gene ontology enrichment analysis

[0144] The list of the hit genes was subjected to gene ontology (GO) enrichment analysis. The GO analysis was conducted using DAVID Bioinformatic Resources (Huang et al., 2009) and output was restricted to Biological Process Functional Annotation Terms (BP_FAT). The threshold for statistical significance of GO analysis was FDR < 0.1.

[0145] Validation of target genes in secondary screenings

[0146] ATP7B-KO cells were reverse transfected with siRNAs selected from the Human Druggable Genome siRNA Library (Dharmacon) using RNAiMax (Thermo Fisher) in 384-well plates. Each siRNA (at 50 uM concentration) was tested alone for 48h to evaluate toxicity and, in a parallel sets of plates, each siRNA was combined with 0.5 mM CuCh for a further 24h. The STAR-let liquid handling system (Hamilton, Reno, NV, USA) was used to prepare the assay plates. Wells containing scramble siRNAs were used as controls. After treatment the cell viability was evaluated using the MTT assay as described above. siRNAs that increased cell viability only in combination with CuCh were advanced to subsequent screening with the Live / Dead fluorescent reagent using the Opera HCS system (see above).

[0147] RNA extraction and Real time PCR

[0148] For gene expression analyses, total RNA was extracted from cells or liver tissues using Trizol and Tissue Lyser for 3 m in while for cells the RNeasy Plus Mini Kit (Qiagen) was used. Reverse transcription was performed using QuantiTect Rev Transcription Kit (Qiagen) from 1 mg of RNA according to the manufacturer’s protocol. qPCR reactions were performed using SYBR Green Master Mix and run on a LightCycler480 system (Roche). Data were analysed using Light Cycler 480 software, versionl.5 (Roche Applied Science).

[0149] Western Blot Analysis

[0150] For protein analysis, cells or pieces of liver tissue were washed in PBS and lysed in Lysis Buffer (20 mM Tris-HCl pH8, 1 mM NaCl, 0.5% NP40, 0.5% Triton-X-100, 10% glycerol) supplemented with a protease inhibitor cocktail (Sigma-Aldrich). Lysates were incubated for ADV-00758PTITWO

[0151] 30 min on ice and centrifuged for 20 min. Tissue samples were snap frozen and homogenized in Lysis Buffer with protease inhibitor using Tissue Lyser (Biorad) for 3 min. Supernatants were collected and protein content was determined using the BCA assay (Thermo Fisher Scientific). Protein samples were separated by SDS-PAGE using 4%-12% polyacrylamide gels (Bio-Rad). Primary antibody mouse anti-PrP 12B2 (Wageningen University and Research) and mouse anti-GAPDH (Santa Cruz Biotechnology; Cat#sc-32233), anti-rabbit ATP7B (Abeam) or anti-Vinculin (Sigma-Aldrich-Aldrich) were diluted in 5% milk in TBS-T (0.8% NaCl, 0.02% KC1, 0.3% Tris-base, 0.1% Tween20) (Bio-Rad). Proteins of interest were detected with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (GE Healthcare). Peroxidase substrate was provided using the ECL Western Blotting Substrate kit (Pierce).

[0152] TMRE labeling

[0153] To assess the impact of Cu on mitochondria, control and treated cells were incubated with 250 nM of the mitochondrial membrane potential dye TMRE (Thermo Fisher Scientific) for 30 min and then images were examined under a Zeiss LSM 700 confocal microscope. Images were captured using a 20x objective and appropriate excitation laser lines and filter sets. The mean intensity of the TMRE signal per cell was quantified in captured images using ImageJ software (National Institutes of Health). At least 200 cells were quantified for each condition.

[0154] Detection of copper with a fluorescent sensor

[0155] Fluorescent Copper Fluor-4 (CF4) sensor, which reveals bioavailable Cu+pools, was kindly provided by Prof. Christopher J. Chang (University of California, Berkeley). Treated and control cells grown in Lab-Tek™ II Chambered Coverglass (Nunc) were rinsed with PBS and then incubated in serum free media supplemented with 1.5 pM CF4 for 15 min. After incubation, cells were washed with PBS and left in warm serum free media for imaging at a Zeiss LSM700 confocal microscope. Image acquisition and quantification of CF4 signal was conducted as described above for TMRE.

[0156] Immunofluorescence and confocal microscopy

[0157] Immunofluorescent (IF) labeling of ATP7B-KO HepG2 cells was conducted as described. To investigate how the expression of PrP mutants impacted on Cu-mediated cell death, IF labelling of the mutant-expressing cells was combined with the Cell Event apoptotic assay. ATP7B-KO cells were transfected with PrP plasmids and after 48h treated with 0.5 mM CuCh (Sigma- Aldrich) for 24h. Before fixation, the cells were incubated with Cell Event reagent to identify apoptotic cells. Expression of transfected PrP plasmids in fixed cells was revealed with the 6D12 antibody (Wageningen University and Research). DAPI (Thermo Fisher) was used to ADV-00758PTITWO counterstain cell nuclei. Quantification of apoptotic cells in transfected and non-transfected cell populations was done as described above.

[0158] Electron Microscopy

[0159] In brief, after 24h incubation in 0.5 mM CuCh, control and PrP-depleted ATP7B-KO cells we fixed using 1% glutaraldehyde prepared in 0.2 M HEPES buffer for 30 min. Fixed cells were scraped, pelleted, post-fixed in OsC and uranyl acetate, dehydrated, embedded in Epon and polymerized at 60 °C for 72 h. For each sample, thin sections were cut using a Leica EM UC7 ultramicrotome (Leica Microsystems). EM images were acquired from thin sections using a FEI Tecnai-12 electron microscope (FEI) equipped with a VELETTA CCD digital camera (Soft Imaging Systems). Abnormal mitochondria were identified based on specific ultrastructural features. The proportion of abnormal mitochondria was quantified as a percentage of total mitochondria in each analyzed cell using iTEM software (Olympus).

[0160] Animal studies

[0161] Mouse procedures were carried out in accordance with the regulations and authorized by the Italian Ministry of Health (Authorization n° 913 / 2021-PR). Atp7b / _and PrP / _mouse strains were maintained on C57BL / 6 x 129S6 / SvEv and C57BL / 6 background, respectively. To achieve genetic suppression of the PrP protein in an Atp7b / _background, Atp7b / _and Pmp / _mice were crossed to generate a new Atp7b / :Prnp / _strain. All animals were housed at the TIGEM animal facility and received food and water ad libitum with Cu in diet at 8pg / kg concentration. For genotyping, DNA from toe clipping of littermate animals was extracted using a house-made Lysis buffer (0.1 M Tris-HCl pH 7.5, 0.1 M EDTA, 0.1 M NaCl, 1% SDS), and the PCR was performed and the products were analyzed on an agarose gel. Both male and female mice were used for experimental procedures. Blood was collected from the submandibular (facial) vein at 12, 18, 22, 28 weeks after birth. The serum was collected and stored at -80 °C until further analysis. Measurements of serum ALT levels were performed using Scil Vitro Vet system (Scilvet). Urine and feces of mice were collected from 28 weeks old animals using the metabolic cages for 24 h and subjected to Cu analysis using ICP-OES. The animals were sacrificed at 28 weeks of age to collect liver tissue for Western blot, qRT- PCR, histological analysis, immune-labelling, and ICP-OES analysis.

[0162] For acute in-vivo PrP silencing in Atp7b / _mice, the Invivofectamine 3.0 system (ThermoFisher) was used. The siRNA duplex solution was prepared and diluted to 2.4 mg / ml according to the manufacturer’s instructions. Preparation of the final injection solution was also in accordance with the Thermofisher protocol. Briefly, siRNA (PrP Ambion pre-designed siRNA #4457308, targeting exon 4 at location 2134 of mouse Prnp transcript variant 2, RefSeq ADV-00758PTITWO

[0163] NM_001278256.1, or exon 3 at location 593 of mouse Pmp transcript variant 1, RefSeq NM_011170.3) was mixed with the complexation buffer and then the Invivofectamine 3.0 reagent (#IVF3005, ThermoFisher). Upon vortexing, the solution was incubated at 50°C for 30 min and then diluted in PBS. Up to 200 pl was injected in the lateral caudal vein at a final concentration of 1 mg / kg weekly for a 6 weeks period. The animals were then sacrificed, and livers were collected for ICP-OES analysis while Prnp silencing was confirmed by qRT-PCR.

[0164] Liver histological staining and immunolabelling

[0165] Pieces of liver tissue from PBS-perfused mice (at least 5 animals per group) were fixed in 4% paraformaldehyde for 12h, stored in 70% ethanol, and embedded in paraffin blocks and sectioned using an RM2165 microtome (Leica Microsystems).

[0166] For assessment of tissue morphology, sections were stained with hematoxylin and eosin (H&E). To this end the sections were rehydrated and stained in Mayer’s hematoxylin (Bio-Optica) for 4 min. After two washes in tap water for 5 min, sections were incubated in a solution of 0.1% ammonia water (ImL ammonium hydroxide in 1 L distilled water) for Imin, washed again in tap water for 5 min, and counterstained in eosin y solution (Sigma- Aldrich) for 30s.

[0167] To evaluate the extent of fibrosis, liver sections were rehydrated and stained for 1 h in picro Sirius red solution (0.1% Sirius red in saturated aqueous solution of picric acid).

[0168] For immunoperoxidase labelling of PrP in the liver, paraffin sections were rehydrated and permeabilized in PBS / 0.2%-Triton (Sigma-Aldrich) for 20 min. Antigen unmasking was performed in 0.01 M citrate buffer in a microwave oven. Endogenous peroxidase activity was blocked by incubating sections in methanol / 1.5% H2O2 (Sigma-Aldrich) for 30 min and incubated with blocking solution (3% BSA [Sigma- Aldrich], 5% donkey serum [Millipore], 1.5% horse serum [Vector Laboratories] 20 mM MgCh, 0.3% Triton [Sigma-Aldrich] in PBS) for Ih. Sections were incubated with mouse anti-PrP antibody (100B3, Wageningen University and Research) overnight at 4°C and then with biotinylated horse anti-mouse / rabbit IgG (Vector Laboratories) for Ih. Biotin / avidin-HRP signal amplification was achieved using the ABCE lite Kit (Vector Laboratories) according to the manufacturer’s instructions. 3, 30 -diaminobenzidine (Vector Laboratories) was used as the peroxidase substrate. Mayer’s hematoxylin (Bio-Optica) was used for counter-staining. Sections were de-hydrated and mounted in Vectashield (Vector Laboratories). Image capture from sections stained with H&E, Sirius Red or anti-PrP was performed using AxioScan.Zl slide scanner system (Zeiss). The whole digital slides were viewed by ZEISS’ s Zen Blue software.

[0169] For colocalization experiments, immuno-labelling of liver sections from Atp7b / _mice was performed in paraffin sections using the VENTANA BenchMark Ultra automated staining ADV-00758PTITWO instrument (Ventana Medical Systems, Roche). Sections were deparaffinized using EZ Prep solution (950-102) for 16 min at 72°C. Epitope retrieval was accomplished with CC1 solution (950-224) at a high temperature (95°C) for a period that is suitable for liver tissue. Antibodies against PrP (100B3, Wageningen University and Research) and K / Na-ATPase (Abeam) were titered with a blocking solution into user-fillable dispensers for use on the automated Stainer. For fluorescent detection of primary antibodies, slides were developed using the DISCOVERY FAM Kit (760-243) for 8 min. Slides were then counterstained with DISCOVERY QD DAPI (760-4196) for 8 min. To assess coincidence of PrP and K / Na-ATPase staining, the sections were visualized on a Zeiss LSM800 confocal microscope using a 63X oil immersion objective, appropriate laser excitation lines and filter sets. Obtained images were analyzed using ZEIS S’ s Zen Blue software.

[0170] Copper measurement

[0171] Copper levels in tissue homogenates, feces, urine or in cell lysates were analyzed by ICP-OES (Ciros Vision, SPECTRO Analytical Instruments GmbH) after treatment of samples with 65% nitric acid (Merck) as previously described3’48. The concentration of copper in different samples was expressed as follows: in tissue homogenates, as pg / g wet weight; in feces, as pg / g dry weight; in urine, as pg / L; and in cells, as ng / pg protein.

[0172] Statistical analyses

[0173] Statistical analyses were performed using GraphPad Prism software (Version 10). Statistical significance was determined using t-test for pairwise comparison or using one-way or two-way ANOVA for multiple comparisons followed by Sidak's test. The same software was used to generate survival curves, whose statistical comparison was conducted using Log-Rank (Mantel Cox) test. Experimental group sizes (n) and p value significance levels are reported in the figures. Data are shown as average ± SD, and a p values less than 0.05 were considered to be statistically significant.

[0174] Data availability statement

[0175] Sequencing data were deposited to Gene Expression Omnibus (GEO repository) with GSE260454 accession number.

[0176] EXAMPLE 1 Screening of genes that promote copper toxicity in a cell model of Wilson disease

[0177] A genome- wide shRNA screening was carried out in ATP7B-KO HepG2 cells using a lentiviral library targeting 18,205 human genes, containing 10 pools, with 4-7 shRNAs for each gene ADV-00758PTITWO distributed across the different pools. ATP7B-KO HepG2 cells are a bona fide WD cell model, exhibiting elevated sensitivity to copper, as assessed by viability assays (Fig. 1 A, B).

[0178] ATP7B-KO cells were transduced with different shRNA library pools and either left untreated (control) or treated with 0.5 mM CuCh for 24h. Genomic DNA was then isolated from the cells and read-counts for each shRNA were obtained by deep sequencing to determine the abundance of each shRNA in the Cu-treated cells compared to controls. Subsequent analysis identified enriched shRNAs corresponding to genes whose downregulation promoted survival of ATP7B- KO cells upon Cu overload. To exclude that survival of ATP7B-KO cells occurred by suppression of generic cell death genes, the same screen was run with the proapoptotic drug vinblastine instead of CuCh. Genes corresponding to shRNAs conferring resistance to both vinblastine and copper were discarded.

[0179] Gene ontology (GO) analysis of the hits revealed an enrichment in genes associated with transition metal transport / homeostasis (Fig. 1C). Each of said genes was silenced with specific siRNAs and the resistance of silenced ATP7B-KO cells to Cu was evaluated by the MTT viability assay (Fig. ID).

[0180] Surprisingly, only some of the genes encoding known Cu importers significantly improved resistance to Cu once silenced, such as the divalent metal transporter DMT1 (also known as SLC11A2); however, other Cu transporters, such as the high-affinity copper transporter CTR1 (SLC31A1), did not appear among the hits.

[0181] Moreover, further suppression of CTR1 did not alter the susceptibility of ATP7B-KO cells to Cu (Fig. 1 E), failing to provide any additional defense against Cu in ATP7B-KO cells.

[0182] Neither CD44, which is involved in CD44-mediated copper uptake mechanisms having role in cancer, was in the hit list. Finally, among recently reported genes promoting cell death via Cu- specific cuproptosis pathway, LIPT1 and a member of the pyruvate dehydrogenase family, PDHX, were present in the list of enriched shRNAs, but none of the LIPT1- specific shRNAs was enriched at least 2-fold and so did not qualify as a hit. Confirmed hits were further validated using live / dead staining combined with automated high content imaging (Fig. 1).

[0183] The PRNP gene encoding the prion protein (PrP) emerged as one of the strongest hits whose suppression was very effective in protecting ATP7B-KO cells from Cu (shRNA RHS6083 V3LHS_403049 4, SEQ ID NO: 79,

[0184] TGCTGTTGACAGTGAGCGCTTGCATGTTCTTGTTTTGTTATAGTGAAGCCACAGATGTATAACAAAACAAGAACA TGCAAATGCCTACTGCCTCGGA; ADV-00758PTITWO shRNA RHS6083 V2LHS_92299 10, SEQ ID NO: 80,

[0185] TGCTGTTGACAGTGAGCGCGGACATATTCACAGTGAACATTAGTGAAGCCACAGATGTAATGTTCACTGTGAATA TGTCCTTGCCTACTGCCTCGGA) .

[0186] EXAMPLE 2 Suppression of PrP improves resistance of ATP7B -deficient cells to Cu

[0187] As PrP inhibition does not raise safety concerns, the role of PrP was further explored by doseresponse experiments. PRNP was silenced in ATP7B-KO cells and the resistance to different concentrations of Cu was evaluated. Both live / dead and MTT assays indicated that PRNP silencing improved resistance of ATP7B -deficient cells to Cu (Fig. 2 A, B). In parallel, a fluorescent sensor of caspase 3 / 7 activity showed that PRNP silencing significantly reduced the number of apoptotic cells upon exposure to Cu (Fig. 2 C). Moreover, PrP depletion in ATP7B- KO cells led to a decrease in Cu levels as shown using the fluorescent CF4 copper sensor and by ICP-OES (Fig. 2 D-E). In addition, PrP suppression reduced Cu-mediated transactivation of MT1X (Fig. 2F), which has been recently proposed as a transcriptional reporter for Cu. Finally, considering that mitochondria emerged as the most sensitive organelle to Cu toxicity in Wilson disease, the impact of PrP suppression on mitochondrial function was investigated. Labelling with the membrane potential dye TMRE revealed that PRNP silencing prevented Cu-induced mitochondrial dysfunction in ATP7B-KO cells (Fig. 2G). These observations were further supported by electron microscopy (EM), which showed reduced mitochondrial damage in PR / VP- silenced ATP7B-KO cells treated with Cu (Fig. 2 H,I).

[0188] The role of PrP in promoting copper toxicity was further demonstrated in primary hepatocytes obtained from mice with either single (Azp7Z?) or double (Alp7b and Prnp) knockout. Live / dead staining indicated that Prnp knockout reduced the mortality of Azp / / ^-deficient hepatocytes in response to Cu (Fig. 3 A). This observation was further supported by a decrease in the percentage of apoptotic cells mAtp7b' / ':Prnp' / ' hepatocyte populations compared to hepatocytes isolated from Alp7b~ / ~ mice (Fig. 3 B).

[0189] Furthermore, ATP7B-KO HepG2 cells were generated in which PrP expression was permanently knocked down via stable transfection of shRNA (PRNP target sequence: TCAGTGGAACAAGCCGAGTAA, SEQ ID NO: 81) (Fig. 4 A). These cells exhibit higher resistance to Cu compared to the parental ATP7B-KO cell line (Fig. 4 B).

[0190] EXAMPLE 3 Pharmacological suppression of PrP improves tolerance to Cu in ATP7B- KO cells

[0191] Pharmacological suppression of PrP in ATP7B-KO cells was tested using small molecules that reduce PrP expression. ADV-00758PTITWO

[0192] PrP expression was suppressed with SM875 (WO2021191883), according to preferred embodiments of the invention: SM875 reduced PrP levels and improved the resistance of ATP7B-KO cells to Cu (Fig. 5 E-G). Notably, the ability of chemical PrP degraders to counteract Cu toxicity in ATP7B-KO cells was paralleled by a decrease in bioavailable Cu levels as shown by the reduction in Cu-induced MT IX expression (Fig. 5 D).

[0193] EXAMPLE 4 PrP suppression ameliorates the phenotype of Atp7b knockout mice

[0194] Atp7b / _mice recapitulate the main features of WD including accumulation of copper in the liver and extensive liver damage, which also manifest in hepatitis, fibrosis, and the formation of cholangiocarcinoma.

[0195] Atp7b / _mice were crossed with Pmp / _mice and the degree of liver damage was analyzed in the resulting double knockout strain (Atp7b / :Prnp / ). Analysis of ALT (alanine aminotransferase, a serum marker of liver damage) revealed a strong increase in Atp7b / _mice, while Atp7b / :Prnp / _animals exhibited significantly lower ALT values (Fig. 6A). This correlated with better survival of Atp7b / :Pmp / “ mice compared to single Atp7b knockout animals (Fig. 6B).

[0196] The animals were sacrificed at 28 weeks of age and the degree of liver damage was assessed by histopathology. The liver of Atp7b / _mice showed severe alterations, even at the macroscopic level, with numerous abnormal nodes (Fig. 6C), while the liver of Atp7b / :Prnp / “ animals appeared fairly regular with no nodes detected (Fig. 6D). Histological examination of the liver from Atp7b / _mice revealed several WD-associated features, including the presence of giant cells, massive leukocyte infiltration, and extensive fibrosis (Fig. 6E). In contrast, the liver from Atp7b / :Prnp / _animals appeared fairly normal with only a few areas of leukocyte infiltration (Fig. 6F).

[0197] Further histopathological analysis revealed that the livers of Atp7b / _mice contained extensive areas of proliferating biliary ducts forming tumor-like nodes (Fig. 6G; Fig.7 A-C). These nodes were strongly stained with the cholangiocarcinoma marker CK19 (Fig. 7 D-F). Notably, immunolabeling showed the elevated PrP expression in these cholangiocarcinoma-like areas of Atp7b / _mice (Fig. 6 H), while no PrP signal was detected in Atp7b / :Pmp / “ animals, as expected (Fig. 6 I). These observations suggest that cells in these cholangiocarcinoma-like nodes may upregulate PrP expression to meet the elevated Cu requirements essential for tumor development and proliferation.

[0198] Further, the ultrastructure of hepatic mitochondria was analyzed in Atp7b / _and Atp7b / :Prnp / “ animals. Mitochondria in Atp7b / _mice exhibited several aberrations typical of WD, including an electron-dense matrix, significant swelling of cristae, and expansion of the intermembrane ADV-00758PTITWO space (Fig. 8 A). Moreover, these mitochondria contained patchy electron-dense particles (Fig. 8 A; inset), which correlate with mitochondrial Cu accumulation. In contrast, these alterations were absent in Atp7b / :Pmp / “ animals, and the ultrastructure of their mitochondria appeared relatively normal (Fig. 8 B).

[0199] Collectively, analyses of ALT levels, liver morphology, and mitochondrial ultrastructure show that Pmp knockout significantly reduces liver damage in Atp7b / _mice.

[0200] This aligns with in vitro findings, which show lower Cu toxicity in primary Atp7b / :Pmp / “ hepatocytes (Fig. 3).

[0201] Unexpectedly, ICP-OES analysis did not detect a significant decrease in hepatic Cu levels in Atp7b / :Pmp / “ mice, despite the notable improvement in phenotype (Fig. 8 C), suggesting that, in the chronic absence of PrP-mediated uptake, Cu still finds alternative pathways to enter A tp7B -deficient cells. However, these pathways result in lower toxicity, allowing cells to modulate compartmentalization and sequestration of excess Cu in a timely manner. Indeed, electron-dense particles in Atp7b / :Prnp / “ animals accumulated inside endo-lysosomal organelles rather than mitochondria (Fig. 8 B; inset), suggesting entrapment of endocytosed Cu within the endo-lysosomal compartment. Furthermore, investigation of Cu- transporting / binding proteins revealed changes in the expression of metallothioneins (Mtl / 2) and Steapl (Fig. 8 E). Elevated Mtl / 2 levels in Atp7b / :Prnp / _animals should facilitate better Cu sequestration and detoxification. A decrease in Steapl expression may not favor Cu2+reduction for subsequent transmembrane transport from endocytic organelles to the cytoplasm. As a result, some of the endocytosed copper may remain trapped in the endo-lysosomal system, while the rest might recycle back into systemic circulation and be eliminated through urinary excretion. Indeed, higher urinary copper levels was found in Atp7b / :Prnp / “ animals compared to Atp7b / _mice (Fig. 8 F).

[0202] In summary, the in vivo studies indicate that suppression of PrP reduces Cu toxicity. EXAMPLE 5 Effect of different small molecule compounds on copper toxicity

[0203] The protective potential of different PrP inhibiting compounds against copper-induced toxicity was evaluated in ATP7B-KO HepG2 cells.

[0204] The compounds tested were SM875, SM231, SM844 and SM885, whose formulas are shown hereafter. ADV-00758PTITWO

[0205] Cells were pre-incubated with each compound at a final concentration of 10 pM, followed by exposure to CuCh for 24 h. Cell viability was assessed using the MTT assay (see Methods).

[0206] SM875 provided the strongest protective effect. It significantly increased cell survival across the entire copper dose range and allowed a substantial proportion of cells to remain viable even at the highest concentration tested (1 mM Cu; Fig. 9A). SM884 and SM231 improved viability at intermediate copper concentrations (0.5-0.75 mM) but did not prevent toxicity at 1 mM Cu (Fig. 9B). SM885 exhibited minimal protective capacity, with only a slight increase in viability at 0.75 mM Cu (Fig. 9B).

[0207] Collectively, these results identify SM875 as the most effective compound in counteracting copper toxicity.

[0208] EXAMPLE 6 SM875 reduces liver damage in Atp7b^' mice

[0209] Based on the protective effects of SM875 in ATP7B-KO cells, this compound was tested in Atp7b' ' mice, a well-established model of Wilson disease. This mouse strain recapitulates key features observed in patients, including severe liver damage, which can be assessed by measuring serum ALT levels: in Alp7b' / ' animals, ALT levels sharply increase starting at 3 months of age and reach a maximum at 4-5 months, a period during which approximately half of the mice die from acute liver failure. ADV-00758PTITWO

[0210] A dose of 10 mg / kg of SM875 was selected since it produces the strongest reduction in PrP expression in the liver, it is well-tolerated, and demonstrates good tissue penetration with standard IP injections.

[0211] In a first experiment, SM875 was administered intraperitoneally (IP) before disease onset (at 2.5 months of age) for a total of 4 weeks (Fig. 10A). The main objectives of these experiments were to determine whether SM875prevents the typical increase in ALT levels observed in this mouse model.

[0212] Western blot analysis confirmed a clear reduction in PrP expression in SM875-treated mice compared to vehicle-treated Atp7b' ' controls (Fig. 10B).

[0213] ALT levels were measured before the start of treatment and after the 4-week period: while the control group showed nearly a two-fold increase in ALT levels (Fig. 10C), indicating progressive liver damage, this increase was not observed in SM875-treated animals. SM875 prevented the ALT increase observed in untreated (control) animals, in which ALT levels nearly doubled.

[0214] In a second experiment, SM875 was administered to 4-month-old Alp7b~ / ~ mice, which already exhibited full disease onset and elevated ALT levels. To minimize potential animal loss during the study, treatment duration was reduced to 2 weeks (Fig. 11 A).

[0215] The primary objective was to assess whether SM875 could reduce existing liver damage. Similar to the first experiment, SM875 treatment decreased hepatic PrP levels (Fig. 1 IB), which was accompanied by a reduction in ALT levels, indicating that even short-term treatment effectively attenuated liver injury (Fig. 11C).

[0216] In summary, these experiments demonstrate that administration of SM875 can prevent or reduce copper-mediated liver damage in a mouse model of Wilson disease.

Claims

ADV-00758PTITWOCLAIMS1. A therapeutic agent for use in the therapy of a Cu-mediated disease, comprising, or consisting of, at least one inhibitor of the function of prion protein (PrP), said Cu-mediated disease being associated to and / or caused by abnormally high levels of Cu.

2. The therapeutic agent for use of claim 1, wherein the Cu-mediated disease is selected from: Wilson Disease, a Cu-dependent cancer, MEDNIK syndrome, KID AR syndrome or a combination thereof.

3. The therapeutic agent for use of claim 1, wherein the Cu-mediated disease is Wilson Disease.

4. The therapeutic agent for use of claim 1, wherein the Cu-mediated disease is a liver cancer or cholangiocarcinoma.

5. The therapeutic agent for use of anyone of claims 1-4, wherein the at least one inhibitor of the function of PrP is at least one chemical entity.

6. The therapeutic agent for use of claim 5, wherein said chemical entity is a compound capable of post-translationally decreasing the expression of PrP.

7. The therapeutic agent for use of claim 5, wherein said chemical entity is a compound promoting the lysosomal degradation of the PrP polypeptide from the endoplasmic reticulum.

8. The therapeutic agent for use of anyone of claims 1-7 wherein the at least one inhibitor of the function of PrP is at least one compound having one of the following formulas:ADV-00758PTITWOEPlADV-00758PTITWOADV-00758PTITWODG1ADV-00758PTITWOGC2ADV-00758PTITWOADV-00758PTITWOGC10ADV-00758PTITWOCP4ADV-00758PTITWOGI029. The therapeutic agent for use of anyone of claims 1-8, wherein the at least one inhibitor of the function of PrP is the isolated R-enantiomer of SM875 compound of formula:ADV-00758PTITWO10. The therapeutic agent for use of anyone of claims 1-4, wherein the at least one inhibitor of the function of PrP is a genetic silencer.

11. The therapeutic agent for use of claim 10 wherein the genetic silencer is a siRNA comprising a sense strand having sequence, comprising, or consisting of, sequence SEQID NO: 27 or 29 and / or comprising an antisense strand having sequence, comprising, or consisting of, sequence SEQ ID NO: 28 or 30, or a precursor or source thereof, or an equivalent thereof.

12. The therapeutic agent for use of claim 10 wherein the genetic silencer is a shRNA having sequence comprising, or consisting of, SEQ ID NO: 79 or 80, or having sequence targeting sequence SEQ ID NO: 81, or a precursor or source thereof, or an equivalent thereof.

13. A pharmaceutical compositions for use in the therapy of a Cu-mediated disease, comprising the therapeutic agent according to anyone of claims 1-12 and pharmaceutically acceptable carriers, diluents, or excipients.

Images