Method for predicting the likelihood of ectopic pregnancy (EP), viable intrauterine pregnancy (VIUP), or non-viable intrauterine pregnancy (NVIUP).
Measuring specific microRNAs in biological samples accurately predicts the outcome of a pregnancy of unknown location, addressing the inadequacies of current hormone markers and enabling timely interventions for ectopic or non-viable pregnancies.
Patent Information
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- IMPERIAL COLLEGE INNVOATIONS LTD
- Filing Date
- 2020-02-12
- Publication Date
- 2026-07-16
AI Technical Summary
Current methods for predicting the outcome of a pregnancy of unknown location (PUL) are inaccurate, leading to a high risk of missed ectopic pregnancy diagnoses and potential complications, as serum hormone markers like hCG and progesterone levels fail to reliably distinguish between viable intrauterine pregnancy (VIUP), non-viable intrauterine pregnancy (NVIUP), and ectopic pregnancy (EP).
The use of specific microRNAs (miRNAs) such as hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, and hsa-miR-199a-3p+199b-3p as biomarkers to determine the likelihood of EP, NVIUP, or VIUP by measuring their expression levels in biological samples.
Provides accurate early prediction of pregnancy outcomes, enabling timely medical or surgical interventions, reducing the risk of complications and ensuring appropriate care for patients with PUL.
Smart Images

Figure 00000028_0000 
Figure 00000029_0000 
Figure 00000029_0001
Abstract
Description
Field of Invention The present invention relates to microRNAs (miRNAs) that are useful in predicting the likelihood of ectopic pregnancy (EP), viable intrauterine pregnancy (VIUP), or non-viable intrauterine pregnancy (NVIUP). The invention provides methods and kits for predicting the risk of any such complications in a subject with a pregnancy of unknown location (PUL), and for identifying pregnant subjects in need of interventions to treat EP or NVIUP. Background Pregnancy of unknown location (PUL) refers to a situation wherein the outcome of a pregnancy test is positive yet a transvaginal ultrasound (TVUS) shows no signs of either an intrauterine or extrauterine pregnancy within a subject. Despite gradual improvements in high resolution ultrasonography equipment since the turn of the century, PUL remains a relatively common clinical scenario, with a varying prevalence across women attending early pregnancy clinics of between 5 and 42% (Boyraz, 2013). Three critical outcomes of PUL have been recognised. A PUL can result in an intrauterine pregnancy (IUP) that can either be viable (VIUP), or non-viable NVIUP), or an ectopic pregnancy (EP). In a VIUP scenario, a visible foetal heartbeat of an embryo within a gestational sac can be identified, suggesting the pregnancy has been established correctly within the uterus of the mother. NVIUP refers to scenarios where, despite a pregnancy of a confirmed intrauterine location, the foetus has stopped growing and no heart beat can be identified. In contrast to the above, an EP refers to abnormal extrauterine growth in which the embryo has attached outside the uterus, most commonly within the Fallopian tube, where the embryo is unable to survive (Kirk et al., 2014). Establishing the likely outcome of PUL is of crucial importance. An ectopic pregnancy occurs in 1-2% of pregnancies and is generally regarded as the most feared outcome of PUL (Boyraz, 2013). If diagnosed early, it is possible to medically treat EP with pharmaceutical intervention, such as methotrexate or with surgical intervention. However, missing a diagnosis for EP can be highly detrimental to the mother; a possibility of rupture and intra-abdominal bleeding can bring significant risks of morbidity and mortality to the patient. Internal bleeding from such a rupture is the leading cause of death in the first trimester of the pregnancy (Christy, Kaczorowski & Garfunkel., 2007). One third of women with an ectopic pregnancy exhibit no medical signs and are therefore at high risk of complications, hence the critical need for an accurate early diagnosis (Kirk et al., 2014). Ascertaining the likely outcome of PUL would help to manage those patients at risk of an EP outcome and allow early intervention before any associated morbidities arise. At present there exists no accurate predictor of EP, VIUP or NVIUP. Currently, the serum hormone human chorionic gonadotropin (hCG) is most commonly measured in PUL patients, however its function as a predictor of outcome is highly imperfect. Instead of being used to predict EP, VIUP or NVIUP, the hormone only helps to determine whether its value falls above or below a so-called “discriminatory zone”, in which levels higher than the threshold indicate that an intrauterine gestational sac should be visible on an ultrasound (Pereira et al., 2019). In PUL cases where an hCG value is indeed above the discriminatory zone yet there is no visible intrauterine gestation, the result may be taken as a rough indication of an EP likelihood. However, this fails to take into account the possibility of a viable IUP in which levels of hCG would also be higher than the threshold. To further complicate matters, the values used to define the discriminatory zone often vary significantly across different practices without a unifying consensus. The approach is often combined with a test for foetal viability through measuring serum progesterone levels yet this does little to resolve the location of a PUL. In general, recorded progesterone levels of below 5 ng / mL are associated with nonviable pregnancies, whilst levels of above 20 ng / mL indicate viable lUPs. Given that a considerable portion of EPs may present with variable progesterone readings of between 5 and 20 ng / mL, recording progesterone levels may fail to rule out an EP (Pereira etal., 2019). Without the ability to reach any certainty through current predictive techniques, there remains a difficulty to prepare for an outcome of VIUP, NVIUP or EP. Without ascertaining a clear difference between a likely VIUP and EP, to go forwards with medical or surgical intervention on a theorised EP has the potential to terminate an otherwise healthy embryo. Similarly, the imperfect predictive power of current techniques increases the risk of missed EP diagnoses and a lack of prevention of associated health conditions, putting greater pressure on health care systems, medical professionals and patients around the world. Without any accurate biomarkers available for EP, VIUP or NVIUP, there exists a need for novel markers that may provide certainty in predicting the outcome of a subject with PUL. Such predictive markers will help to standardise patient care, ensure all patients are safe, and prevent EP from being missed. The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgment that the document is part of the state of the art or is common general knowledge. Summary of Invention This invention is based on the surprising discovery that the expression level of certain microRNAs (miRNAs) in a biological sample correlates strongly with outcomes of EP and NVIUP and can therefore be used as a predictive biomarker for early detection of EP, NVIUP or VIUP in a pregnant subject. The expression level of particular miRNA molecules can therefore be used to determine a likely outcome of a pregnancy of unknown location in a pregnant subject, helping to ensure the subject receives the correct therapeutic or surgical intervention, or follows the appropriate guidance for such an outcome. 2020428397 19 Jun 2026 In a first aspect, the invention provides a method for predicting the location and / or viability of an early pregnancy in a subject classified with a pregnancy of unknown location, the method comprising the step of determining the level of any one or more of the following miRNAs in a biological sample obtained from the subject: 5 hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p. 10 The invention also provides a method for predicting the location and / or viability of an early pregnancy in a subject classified with a pregnancy of unknown location, the method comprising the step of determining the level of hsa-miR-21-5p in a biological sample obtained from the subject and comparing the level of hsa-miR-21-5p in the biological sample with a control level to determine if there is a change 15 in the level, wherein the control level is determined in a biological sample obtained from a pregnant subject already determined or later determined to have had a viable intrauterine pregnancy, and wherein an increase in the level of hsa-miR-21-5p in the biological sample 20 compared to the control indicates an increased risk of ectopic pregnancy (EP) or non-viable intrauterine pregnancy (NVIUP) in the subject. In a second aspect, the invention provides a method for determining an appropriate medical management and / or treatment protocol for a pregnant subject, the method comprising the step of determining the level of any one or 25 more of the following miRNAs in a biological sample obtained from the subject: hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa miR 107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-30 miR-199a-3p+199b-3p. 2020428397 19 Jun 2026 In a third aspect, the invention provides a method of treating or managing a subject with a pregnancy of unknown location or viability, the method comprising the step of determining the level of one or more of the following miRNAs in a biological sample obtained from the subject: 5 hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa miR 107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p, and referring the subject for further medical examination 10 and diagnosis and / or medical intervention. In a fourth aspect, the invention provides a solid substrate comprising one or more probes that specifically hybridise to one or more of the following miRNA molecules: hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa miR 107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p. In a fifth aspect, the invention provides a kit for predicting the viability and / or location of a pregnancy in a subject following conception, the kit comprising means to detect the level of any one or more or all of the following miRNA molecules: hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa miR 107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p. In a sixth aspect, the invention provides the use of an abortifacient in the manufacture of a medicament for the treatment of ectopic pregnancy in a patient who has been identified to have an elevated level of one or more of hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1 285-5p, hsa-miR-19b-3p or hsa-miR-22-3p in a biological sample obtained from that patent, optionally wherein the abortifacient comprises a prostaglandin analogue and / or a progesterone receptor antagonist or antifolate. In a seventh aspect, the invention provides the use of an abortifacient in the manufacture of a medicament for the treatment of non-viable intrauterine pregnancy (NVIUP) in a patient who has been identified to have an elevated level of one or more of hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR- 130a-3p, hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p or hsa-miR-199a-3p+199b-3p in a biological sample obtained from that subject, optionally wherein the abortifacient comprises a prostaglandin analogue and / or a progesterone receptor antagonist or antifolate. Description of Figures The invention is illustrated with reference to the following drawings, in which: Figure 1 shows the results of significant differential expression between 62 different microRNAs in relation to expression levels in a VIUP scenario, in subjects with EP or NVIUP. 12 miRNAs are expressed at a higher level in EP compared to VIUP, with a range of 3-14 fold increased expression in EP. In subjects with NVIUP, 11 miRNAs are expressed at a higher level than in VIUP, with a 1.5-8 fold increased expression level in NVIUP. The results were normalised to positive controls, before assessing the top 100 miRNAs. Figure 2 shows the fold change in expression level in comparison to VIUP levels for miR-21-5p and miR-199a+b-3p, showing an increased in expression level of the specific miRNAs in EP and NVIUP, respectively. The miRNAs were sourced from blood samples and validated using quantitative reverse transcriptase polymerase chain reaction (RT-qPCR). Figure 3 shows a process flow chart for miRNA extraction, purification and identification from plasma and serum samples of subjects with PUL from 4 weeks gestation, allowing for the assessment of miRNA differential expression between subjects with VIUP, NVIUP and EP. Detailed Description of the Invention This invention is predicated on the surprising discovery that the level of select miRNAs in a biological sample obtained from a pregnant female subject, in comparison to a control value, can be used to aid in predicting the likelihood of a pregnancy resulting in an ectopic pregnancy, non-viable intrauterine pregnancy, or viable intrauterine pregnancy. This group of miRNA molecules were found to be present in the maternal circulation and their concentration and relative levels correlated with outcomes of EP, NVIUP or VIUP. As such, measuring a profile of such certain miRNAs may be used as an additional biomarker to increase the accuracy in predicting an outcome of a PUL, helping to ensure that an appropriate protocol is followed for the care of the subject. Thus in a first aspect, the invention provides a method for predicting the location and / or viability of an early pregnancy in a subject classified with a pregnancy of unknown location, the method comprising the step of determining the level of any one or more of the following miRNAs in a biological sample obtained from the subject: hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p. The term ectopic pregnancy (EP) refers to scenarios in which abnormal extrauterine growth occurs wherein the embryo has attached outside of the uterus, most commonly within the Fallopian tube, in which the embryo is unable to survive. The term non-viable intrauterine pregnancy (NVIUP) refers to a scenario wherein, despite a pregnancy of a confirmed intrauterine location, the foetus has stopped growing and no heart beat can be identified. The term NVIUP may also be referred to as a miscarriage, and the two terms may herein be used interchangeably. The term viable intrauterine pregnancy (VIUP) refers to a scenario wherein the foetal heartbeat of an embryo within a gestational sac can be identified, in which the pregnancy has been established correctly within the uterus of the mother. The methods of the invention described herein are carried out ex vivo. For the avoidance of doubt, the term “ex vivo" has its usual meaning in the art, referring to methods that are carried out in or on a biological sample in an artificial environment outside the body of the patient from whom the biological sample has been obtained. It is envisaged that the “biological sample” will be a blood sample but may be any other biological sample that is suitable for detecting miRNA molecules. For example, the sample may be a sample of amniotic fluid or urine. As used herein, the term “blood sample” includes whole blood and blood components, including plasma and serum. In preferred embodiments, the one or more miRNA molecules are extracted from the plasma component of a whole blood sample or from the serum component of a whole blood sample. As used herein, “plasma” refers to the fluid portion of blood, excluding blood cells and platelets, but including dissolved proteins, glucose, clotting factors, electrolytes and hormones. As used herein, “serum” refers to blood plasma without clotting factors. The skilled person will be familiar with standard phlebotomy techniques which are suitable for obtaining a blood sample from a subject. The skilled person will also be familiar with routine techniques for obtaining plasma and / or serum from a whole blood sample, e.g. using centrifugation. The terms “microRNA” and “miRNA” are used interchangeably herein and refer to small non-coding RNA molecules. miRNAs are small, single-stranded, 19-25 nucleotide molecules that have emerged as important regulators of gene expression in almost all eukaryotes; a third of the protein encoding human genome is thought to be regulated by miRNAs. miRNAs are non-coding RNAs and function in a manner similar to small-interfering RNA to down-regulate gene expression at the post-transcriptional level. miRNA biogenesis involves a series of steps that lead to gene silencing. Briefly, miRNAs are transcribed in the nucleus as longer primary-miRNAs, which are cleaved to form hair-pin shaped precursor-miRNAs. These precursors are exported from the nucleus and further cleaved to form the mature miRNA which associates with the RNA induced silencing complex to target the 3’-untranslated region of specific mRNAs and inhibit their translation to protein. miRNAs are present in a cell free state in plasma and remain stable and easily measurable. Their potential utility as a biomarker of disease or response to treatment has consequently been widely acknowledged3. miRNAs are expressed in a tissue specific manner and have differential expression, both spatially and over time. They remain stable and are easily detectable in blood and are thus suitable to provide novel, non-invasive biomarkers for outcomes of EP, NVIUP or VIUP according to the present invention. Advantageously, expression levels of these miRNA molecules can be measured from blood samples which can be obtained from female subjects in the early stages of pregnancy (from approximately gestation week 3 onwards, yet in some cases earlier still), thereby providing a minimally-invasive means for the early prediction of an outcome of EP, VIUP or NVIUP. From the list of miRNAs according to the first aspect of the invention, an increased level of one or more of hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p or hsa-miR-22-3p compared to standard levels recorded in VIUP is associated with EP. Comparatively, from the list of miRNAs according to the first aspect of the invention, an increased level in one or more of hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p or hsa-miR-199a-3p+199b-3p compared to standard levels recorded in VIUP is associated with NVIUP. A lack of significant change or increase of the level of any of the miRNAs listed according to the first aspect of the invention may indicate that there is no increased risk of EP or NVIUP or that the pregnancy may result in a VIUP. In some embodiments of each of the methods of the invention, the level of hsa-miR-1246, hsa-miR-20a-5p+20b-5p and hsa-miR-21-5p is determined, in which an increase in the level of one or more of the miRNAs may indicate an increased risk of ER In another embodiment of each of the methods of the invention, the level of hsa-miR-130a-3p, hsa-miR-107, hsa-miR-29b-3p and hsa-miR-199a-3p+199b-3p is determined, in which an increase in the level of one or more of the miRNAs may indicate an increased risk of NVIUP. In a preferred embodiment of each of the methods of the invention, the level of hsa-miR-21-5p is determined, in which an increase in its level may indicate an increased risk of EP. In another preferred embodiment of each of the methods of the invention, the level of hsa-miR-199a-3p+199b-3p is determined, in which an increase in its level may indicate an increased risk of NVIUP. By predicting we include the meaning of aiding in diagnosing. Thus if the one or more miRNA molecule that is detected using the method according to this aspect of the invention is a molecule whose over-expression is associated with increased risk of EP, then an elevated expression level of said miRNA in the subject’s sample compared to the control value is indicative of a likely outcome of EP in said subject, and said subject may be diagnosed with EP. Similarly if the one or more miRNA molecule that is detected using any method according to the invention is a molecule whose over-expression is associated with increased risk of NVIUP, then an elevated expression level of said miRNA in the subject’s sample compared to the control value is indicative of a likely outcome of NVIUP in said subject, and said subject may be diagnosed with NVIUP. Similarly if the one or more miRNA molecule that is detected using any method according to the invention is a molecule whose level is not over-expressed above levels associated VIUP, then an expression level of said miRNA in the subject’s sample compared to the control value is indicative of a likely outcome of VIUP in said subject. As used herein, the term “control value” refers to a baseline level of the corresponding one or more miRNA molecules in a corresponding control sample. The corresponding control sample may be obtained from a cohort of pregnant female subjects at an appropriate stage of pregnancy who had an outcome of VIUP. The selection of appropriate control samples and parameters is well within the capability of the skilled person. In some embodiments, the control value is obtained from the same subject before pregnancy. In a preferred embodiment, the control value is determined in a biological sample obtained from a pregnant subject already determined to have had viable intrauterine pregnancy, optionally wherein the subject is determined to have had viable pregnancy through means such as ultrasound screening or as a result of a healthy birth. If the level of two or more miRNA molecules is determined in the methods of the invention, the corresponding control value is the combined baseline level of the corresponding miRNAs in a control sample. Preferably, for each of the methods of the invention, the cut-off value for determining whether the level of a given miRNA molecule is “different” (elevated or reduced) compared with a control value is 2-times the baseline level for the miRNA. Therefore if the level of a given miRNA (e.g. hsa-miR-1246) is determined and the value is found to be at least 2-fold greater than the baseline level for hsa-miR-1246 in a control sample, then it can be concluded that hsa-miR-1246 is elevated in the subject’s sample and a prediction of outcome can be made, in accordance with the methods of the invention. The term “level” is synonymous with “expression level” and is used broadly to include a genomic expression profile, e.g. an expression profile of miRNAs. The level of the one or more miRNA molecules in the patient’s sample and / or the control sample can be determined using any convenient means for determining a level of a nucleic acid sequence, e.g. quantitative nucleic acid hybridisation of miRNA, labelled miRNA, and / or nucleic acid amplification techniques which are routinely use in the art and which the skilled person will be familiar with. Preferred techniques for determining the miRNA level include: real-time PCR (RT-PCR), a technique suitable for large scale / multiple analysis and useful for screening large populations; microarray, comprising a 2D array on a solid substrate; next generation sequencing platforms for example RNAseq, in which the advantages of next generation sequencing include its high throughput, speed and low cost per base; and In situ hybridisation. The present inventors have identified the listed miRNAs as being useful in the context of the present invention. In some embodiments of the methods of the invention, the level of one or more miRNAs selected from the list of miRNA molecules is determined. In a preferred embodiment of the methods of the invention, the level of all 19 miRNAs selected from the list of miRNA molecules is determined. In another preferred embodiment of the methods of the invention, the level of all of hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p and hsa-miR-22-3p is determined, in which an increase in the level of one or more of the miRNAs may indicate an increased risk of ectopic pregnancy. In yet another preferred embodiment of each of the methods of the invention, the level of all of hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p and hsa-miR-199a-3p+199b-3p is determined, in which an increase in the level of one or more of the miRNAs may indicate an increased risk of NVIUP. In yet a further preferred embodiment of each of the methods of the invention, the level of hsa-miR-1246, hsa-miR-20a-5p+20b-5p and hsa-miR-21-5p is determined, in which an increase in the level of one or more of the miRNAs may indicate an increased risk of EP. In yet another further preferred embodiment of each of the methods of the invention, the level of hsa-miR-130a-3p, hsa-miR-107 and hsa-miR-29b-3p is determined, in which an increase in the level of one or more of the miRNAs may indicate an increased risk of NVIUP. For the avoidance of doubt, “hsa-” refers to homo sapiens and is a standard abbreviation to differentiate the miRNAs from those of other species. The suffixes “3p” and “5p” denote 3 prime or 5 prime, respectively. These suffixes are used to distinguish two miRNAs originating from opposite arms of the same pre-miRNA. “let-7” refers to the lethal-7 gene, which is a miRNA precursor. All miRNAs are identified herein using standard nomenclature. Sequence information for each of the miRNAs listed in Tables 1 and 2 can be found on the miRBase database maintained by Manchester University (http: / / mirbase.org / search.shtml). It will be apparent to the person skilled that the methods of the invention disclosed herein can be used in conjunction with other methods for screening for EP and predicting viability of a pregnancy that are well known in the art. The terms “patient” and “subject” are used interchangeably herein and refer to any female animal (e.g. mammal), including, but not limited to, humans, nonhuman primates, canines, felines, rodents and the like. Thus in some embodiments the subject is any female animal. In a preferred embodiment, the subject is a human female. The biological sample according to any method of the invention can be taken from the mother at any stage during pregnancy. In some embodiments the sample may be taken during the first trimester. In a preferred embodiment the sample may be taken at any stage until 10 weeks gestation. In a more preferred embodiment, the sample may be taken between at any stage until 9 weeks gestation. In a most preferred embodiment, the sample may be taken between 4 and 9 weeks gestation, or between 0 and 4 weeks gestation. If, as a result of carrying out the method of the invention, the patient is identified as having a likely outcome of EP, then further diagnostic testing or monitoring can be carried out and / or the patient can be treated with therapeutic or surgical interventions, which aim to prevent the continuing growth of an ectopic pregnancy. Such interventions would be known within the art and may include the administering of an abortifacient. In some embodiments the abortifacient may comprise a prostaglandin analogue and / or a progesterone receptor antagonist or antifolate. In a preferred embodiment the prostaglandin analogue may be misorprostol or gemepost. In a further preferred embodiment the progesterone receptor antagonist may be mifepristone. In yet another further preferred embodiment the antifolate may be methotrexate (MXT), administered by injection to stop cell growth and breakdown existing cells. In other embodiments it is envisaged that surgical interventions may take place, in which the subject is treated with laparoscopic surgery. Laparoscopic surgery refers to a procedure wherein a small incision is made in the abdomen, near or in the navel of the subject. A thin tube equipped with a camera lens and light, referred to as a laparoscope, is used to view the tubal area, before the ectopic pregnancy is removed and the tube is either repaired (salpingostomy) or removed (salpingectomy). If, as a result of carrying out the method of the invention, the patient is identified as having a likely outcome of NVIUP, then similarly further diagnostic testing or monitoring can be carried out and / or the patient can be treated with therapeutic or surgical interventions, which aim to remove the non-viable foetus from the subject before complications arise. It would be well understood to the skilled person that such therapeutic interventions for a subject with NVIUP may include administering to the subject a prostaglandin E analogue in order to induce a miscarriage through dilation of the cervix. In some embodiments the prostaglandin E analogue used may be misoprostol, gemeprost and / or mifepristone. In a preferred embodiment the prostaglandin E analogue used may be both misoprostol and mifepristone in combination. It would also be appreciated by the skilled person that if, as a result of carrying out the method of the invention, the subject is identified as having a likely outcome of VIUP, then alongside further diagnostic testing or monitoring, the patient may be encouraged to follow normal procedural guidance for an uncomplicated pregnancy. It is envisaged that such normal procedural guidance may refer to official national or local guidelines for normal pregnancy established across a particular area or within a particular hospital or clinic. Such guidelines may comprise attending appropriate prenatal care and undergoing suitable medical check-ups and screening tests. Such check-ups may typically occur once each month between 4 and 28 weeks gestation, twice a month for weeks 28 to 36, and weekly for weeks 36 to birth. It is also envisaged that the subject may be instructed to follow certain lifestyle and dietary protocols, such as limiting smoking and alcohol consumption, and increasing folic acid intake. Thus, in some embodiments of the present invention wherein the subject is identified as having a likely outcome of VIUP, the subject may be instructed to follow procedural guidance for an uncomplicated pregnancy. In a preferred embodiment, the subject may be instructed to follow procedural guidance for an uncomplicated pregnancy, wherein said guidance comprises attending suitable medical check-ups and screening tests, and / or following certain lifestyle and dietary protocols, such as limiting smoking and alcohol consumption, and increasing folic acid intake. The term pregnancy of unknown location (PUL) refers to a situation wherein the outcome of a pregnancy test is positive yet a transvaginal ultrasound (TVUS) shows no signs of either an intrauterine or extrauterine pregnancy within a subject. In some embodiments the method for predicting EP, VIUP or NVIUP according to the present invention may be carried out on any pregnant female subject. In a preferred embodiment, the method may be carried out on a subject with PUL. In a second aspect, the invention provides a method for determining an appropriate medical management and / or treatment protocol for a pregnant subject, the method comprising the step of determining the level of any one or more of the following miRNAs in a biological sample obtained from the subject: hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa miR 107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p. An increased level of one or more of hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa miR 107, hsa miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p or hsa-miR-199a-3p+199b 3p compared to the control value indicates that the subject has a likely outcome of EP and thus may be referred for further medical examination and diagnosis and / or medical intervention, optionally wherein the medical intervention comprises administration of an abortifacient and / or surgery. An increased level of one or more of hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa miR 107, hsa miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p or hsa-miR-199a-3p+199b 3p compared to the control value indicates that the subject has a likely outcome of NVIUP and thus may also be referred for further medical examination and diagnosis and / or medical intervention, optionally wherein the medical intervention comprises administration of an abortifacient and / or surgery. A lack of significant change or increase of the level of any of the miRNAs listed according to the first aspect of the invention may indicate that there is no increased risk of EP or NVIUP or that the pregnancy may result in a VIUP. In a third aspect of the invention, there is provided a method of treating or managing a subject with a pregnancy of unknown location or viability, the method comprising the steps of: (i) determining the level of one or more of the following miRNAs in a biological sample obtained from the subject: hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p; and (ii) referring the subject for further medical examination and diagnosis and / or medical intervention, optionally wherein the medical intervention comprises administration of an abortifacient and / or surgery. In a fourth aspect, the invention provides a support material, which is a solid substrate, such as a biochip, comprising one or more probes that specifically hybridise to one or more of the following miRNA molecules: hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa miR 107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p. The probes may be attached thereto or immobilised thereon the solid substrate. In a preferred embodiment, the support material comprises probes specific for each of the 19 miRNA molecules identified in the above list and optionally only probes for those 19 miRNA and no other probes for any other miRNAs. As used herein, the term “probe” refers to an oligonucleotide capable of binding to a target nucleic acid (i.e. a miRNA molecule) of complimentary sequence. Probes may bind to targets lacking complete complementarity with the probe sequence, depending upon the stringency of the hybridisation conditions. Probes may be directly labelled or indirectly labelled, such as with biotin to which a streptavidin complex may later bind. The probes may be capable of hybridising to a target miRNA sequence under stringent hybridisation conditions. The probes may be attached at spatially defined locations on the substrate. The solid substrate may be a material that may be modified to contain discrete individual sites appropriate for the attachment or association of the probes and is amenable to at least one detection method. Examples of suitable substrates include glass and modified or functionalised glass, plastics, polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials, carbon and metals. The substrate may allow optical detection without appreciably fluorescing. The substrate may be planar, although other configurations of substrates may be used as well. For example, probes may be positioned on the inside surface of a tube. The support material and the probe may be derivatised with a chemical functional group, such that the probe may be attached using the functional group directly or indirectly using a linker. Alternatively, the probe may be attached to the solid support non-covalently, for example using biotinylated oligonucleotides. Alternatively the probe may be synthesised on the surface of the solid support using techniques such as photopolymerisation and photolithography. Preferably, the support material comprises oligonucleotide sequences specific to each of the one or more miRNA molecules. The support material can be used in a method according to any of the first, second or third aspects of the invention. The invention also provides the use of a solid substrate according to the invention in a method according to the invention. In a fifth aspect, the invention provides a kit for predicting the viability and / or location of a pregnancy in a subject following conception, the kit comprising means to detect the level of any one or more or all of the following miRNA molecules: hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa miR 107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p. Preferably the kit comprises means to detect only the above listed miRNAs. The means may be a probe as set out herein. Such a kit may comprise one or more probes specific for one or more of the miRNA molecules listed in the corresponding descriptions. In addition, the kit may comprise any or all of the following: assay reagents, buffers, probes and / or primers, sterile saline or another pharmaceutically-acceptable emulsion and suspension base. In addition still, the kits may include instructions for use for the practice of the methods described herein. In some embodiments, the kit may comprise means to detect the level of all 19 miRNA molecules. In a preferred embodiment, the kit may comprise means to detect the level of all of hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p and hsa-miR-22-3p only. In yet another preferred embodiment, the kit may comprise means to detect the level of all of hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p and hsa-miR-199a-3p+199b-3p only. In some embodiments, the kit may be used to carry out any of the methods described herein. In a sixth aspect, the invention provides the use of an abortifacient in the manufacture of a medicament for the treatment of ectopic pregnancy in a patient who has been identified to have an elevated level of one or more of hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p or hsa-miR-22-3p in a biological sample obtained from that patent, optionally wherein the abortifacient comprises a prostaglandin analogue and / or a progesterone receptor antagonist or antifolate. In a seventh aspect, the invention provides the use of an abortifacient in the manufacture of a medicament for the treatment of non-viable intrauterine pregnancy (NVIUP) in a patient who has been identified to have an elevated level of one or more of hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p or hsa-miR-199a-3p+199b-3p in a biological sample obtained from that subject, optionally wherein the abortifacient comprises a prostaglandin analogue and / or a progesterone receptor antagonist or antifolate. Sequences The following table comprises the sequences listed within the present application and each corresponding SEQ ID No: miRNA SEQ ID NO Sequence hsa-miR-1246 SEQ ID NO: 1 AAUGGAUUUUUGGAGCAGG hsa-miR-320e SEQ ID NO: 2 AAAGCUGGGUUGAGAAGG hsa-miR-30d-5p SEQ ID NO: 3 UGUAAACAUCCCCGACUGGAAG hsa-miR-130a-3p SEQ ID NO: 4 CAG UGCAAUG U U AAAAGGGCAU hsa-miR-222-3p SEQ ID NO: 5 AGCUACAUCUGGCUACUGGGU hsa-miR-20a-5p SEQ ID NO: 6 UAAAGUGCUUAUAGUGCAGGUAG hsa-miR-20b-5p SEQ ID NO: 7 CAAAGUGCUCAUAGUGCAGGUAG hsa-miR-21-5p SEQ ID NO: 8 UAGCUUAUCAGACUGAUGUUGA hsa-miR-185-5p SEQ ID NO: 9 UGGAGAGAAAGGCAGUUCCUGA hsa-miR-148a-3p SEQ ID NO: 10 UCAGUGCACUACAGAACUUUGU hsa-miR-1285-5p SEQ ID NO: 11 GAUCUCACUUUGUUGCCCAGG hsa-miR-19b-3p SEQ ID NO: 12 UGUGCAAAUCCAUGCAAAACUGA hsa-miR-22-3p SEQ ID NO: 13 AAGCUGCCAGUUGAAGAACUGU hsa-miR-107 SEQ ID NO: 14 AGCAGCAUUGUACAGGGCUAUCA hsa-miR-223-3p SEQ ID NO: 15 UGUCAGUUUGUCAAAUACCCCA hsa-let-7d-5p SEQ ID NO: 16 AGAGGUAGUAGGUUGCAUAGUU hsa-miR-191-5p SEQ ID NO: 17 CAACGGAAUCCCAAAAGCAGCUG hsa-miR-29b-3p SEQ ID NO: 18 UAGCACCAUUUGAAAUCAGUGUU hsa-miR-374a-5p SEQ ID NO: 19 UUAUAAUACAACCUGAUAAGUG hsa-miR-199a-3p SEQ ID NO: 20 ACAGUAGUCUGCACAUUGGUUA hsa-miR-199b-3p SEQ ID NO: 21 ACAGUAGUCUGCACAUUGGUUA The invention will be further described with reference to the following non-limiting examples. The contents of any document mentioned herein are hereby incorporated by 5 reference in its entirety. Examples The level of expression of an array of Homo sapiens miRNA molecules was measured to show significant differential expression across subjects with EP or NVIUP in comparison to VIUP. 24 subjects with a pregnancy of unknown location (PUL) were selected in a discovery study from a prospective single centre, and plasma and serum samples were collected. These subjects were recruited to a Research Ethics Committee (REC)-approved observational 2020428397 16 Mar 2026 using Nanostring™ cell-free profiling. Nanostring™ cell-free profiling uses molecular barcode technology, with capture and reporter probes specific to each microRNA in order to perform fluorescence scanning. Said samples were profiled against 798 possible miRNAs. The number of counts of each miRNA from VIUP, NVIUP and EP cohort was assessed for differential expression, producing expression results of 62 miRNAs (Fig. 1). Nanostring™ nSolver version 4.0 was used for this analysis. The statistical platform allowed simultaneous analysis of all count data: count data was normalised with positive control code sets and a two-tailed t-test between the means of log transformed normalized data was then used to assess the fold change significance (documented as having a p value of less than 0.05). In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word “comprise” or variations such as “comprises” or “comprising” is used in an inclusive sense, i.e. to specify the presence of the stated features 5 but not to preclude the presence or addition of further features in various embodiments of the invention. It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art, in Australia or any other country. 22502963_1 (GHMatters) P119604.AU
Claims
1. A method for predicting the location and / or viability of an early pregnancy in a subject classified with a pregnancy of unknown location, the method comprising the step of determining the level of hsa-miR-21-5p in a biological sample obtained from the subject and comparing the level of hsa-miR-21-5p in the biological sample with a control level to determine if there is a change in the level,wherein the control level is determined in a biological sample obtained from a pregnant subject already determined or later determined to have had a viable intrauterine pregnancy, andwherein an increase in the level of hsa-miR-21-5p in the biological sample compared to the control indicates an increased risk of ectopic pregnancy (EP) or non-viable intrauterine pregnancy (NVIUP) in the subject.
2. The method of claim 1, wherein the method further comprises the step of determining the level of one or more of the following miRNAs in the biological sample obtained from the subject: hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3p.
3. The method of claim 1, wherein the method is for predicting the likelihood of ectopic pregnancy (EP) or non-viable intrauterine pregnancy (NVIUP) in the subject.
4. The method of any one of claims 1 to 3, wherein an increase in the level of hsa-miR-21-5p and one or more of hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p or hsa-miR-22-3p in the biological sample indicates an increased risk of ectopic pregnancy (EP).
5. The method of any one of the preceding claims, wherein no significant change or increase in the level of hsa-miR-21-5p compared with the control 22502963_1 (GHMatters) P119604.AU2020428397 16 Mar 2026indicates that there is no increased risk of EP or NVIUP or that the pregnancy may result in a viable intrauterine pregnancy (VIUP).
6. The method of any one of the preceding claims, wherein the pregnant subject for determining the control level is determined to have had viable 5 pregnancy through means including ultrasound screening or a healthy birth.
7. The method of any one of the previous claims, wherein the biological sample is a blood or plasma sample.
8. The method of any one of the previous claims, wherein the method is carried out on a biological sample obtained from the subject at between 4 to 9 10 weeks gestation.
9. The method of any one of claims 1 to 7, wherein the biological sample is obtained from the subject at any stage until 10 weeks gestation, or at between 4 and 9 weeks gestation, or at between 0 and 4 weeks gestation.
10. The method of any one of the preceding claims, wherein the level of the one or more miRNA molecules is determined using nucleic acid hybridisation and / or nucleic acid amplification.
11. The method of claim 10, wherein the level of hsa-miR-21-5p or the level of the one or more further miRNA molecules is determined using real-time quantitative PCR, microarray, Next generation sequencing platforms, or in situ hybridisation.
12. The method of claim 2, wherein the level of all of the miRNA molecules described is determined, and wherein all 19 expression levels are compared to a control value.
13. The method of claim 1, wherein the level of hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, , hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p and hsa-miR-22-3p are determined and compared to a control value, and wherein an increase in the level of hsa-miR-21-5p and one or more of the miRNAs above the control value indicates an increased risk of ectopic pregnancy.2020428397 19 Jun 202614. Use of a solid substrate comprising probes that specifically hybridise to each of the following miRNA molecules:hsa-miR-1246, hsa-miR-320e, hsa-miR-30d-5p, hsa-miR-130a-3p, 5 hsa-miR-222-3p, hsa-miR-20a-5p+20b-5p, hsa-miR-21-5p, hsa-miR-185-5p, hsa-miR-148a-3p, hsa-miR-1285-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-107, hsa-miR-223-3p, hsa-miR-let-7d-5p, hsa-miR-191-5p, hsa-miR-29b-3p, hsa-miR-374a-5p, hsa-miR-199a-3p+199b-3pin a method according to any one of claims 1 to 13.10 15. The use of claim 14, wherein the probes are immobilised on the surface of the substrate.