Antisense oligonucleotides for the treatment of huntington's disease

Antisense oligonucleotides recruit endogenous ADAR enzymes to deaminate adenosines in the HTT transcript, addressing the non-specificity of current HD treatments by specifically altering the caspase-6 and caspase-1 cleavage sites, reducing proteolytic cleavage and aggregate formation in Huntington's disease.

AU2024402199A1Pending Publication Date: 2026-07-16PROQR THERAPEUTICS II BV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
AU · AU
Patent Type
Applications
Current Assignee / Owner
PROQR THERAPEUTICS II BV
Filing Date
2024-12-18
Publication Date
2026-07-16

AI Technical Summary

Technical Problem

Current therapeutic approaches to inhibit proteases involved in Huntington's disease (HD) are non-specific, leading to wide-ranging effects and unwanted side-effects due to the proteases' diverse targets in the human body, necessitating a more targeted strategy to inhibit the caspase-6 and caspase-1 cleavage sites in the HTT protein.

Method used

The use of antisense oligonucleotides (AONs) that recruit endogenous ADAR enzymes to specifically deaminate adenosines within the HTT transcript at the caspase-6 and caspase-1 cleavage sites, converting them to inosines, thereby altering the codons to reduce proteolytic cleavage and aggregate formation.

Benefits of technology

This approach effectively diminishes the proteolytic cleavage of the HTT protein at critical sites, potentially reducing disease symptoms and aggregate formation without affecting normal HTT function, using RNA editing technology to target specific adenosines in the HTT transcript.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000125_0000
    Figure 00000125_0000
  • Figure 00000125_0001
    Figure 00000125_0001
  • Figure 00000126_0000
    Figure 00000126_0000
Patent Text Reader

Abstract

The present invention relates to the field of biotechnology and the use of chemically modified antisense oligonucleotides (AONs) for the deamination of one or more target adenosines in the transcript of (mutant) human Huntingtin (HTT) for use in the treatment, prevention, or delay of Huntington's disease (HD). In particular, the target adenosines are in the GAU codon coding for aspartic acid at position 572 that is part of a caspase-1 proteolytic cleavage site in the human HTT protein, and / or in the GAC codon coding for aspartic acid at position 586 that is part of a caspase-6 proteolytic cleavage site in the human HTT protein.
Need to check novelty before this filing date? Find Prior Art

Description

Proteolytic processing is a major form of post-translational modification that occurs when a protease cleaves one or more bonds in a target protein to modify its activity. This processing may lead to activation, inhibition, alteration, or destruction of the protein’s activity. The protease may remove a peptide segment from either end of a target protein, but it may also cleave internal bonds in the protein that lead to major changes in the structure and function of the protein. Proteolytic cleavage may have various (desired) functions under normal circumstances. For instance, proteolysis of precursor proteins regulates many cellular processes including gene expression, embryogenesis, the cell cycle, programmed cell death (apoptosis), intracellular protein targeting, and endocrine / neural functions. In all these processes, proteolytic cleavage of precursor proteins is necessary. In the case of HTT, the general function is not completely understood but it is likely involved in axonal transport. The protein interacts with proteins involved in transcription, cell signaling, and intracellular transport. Studies in animal models have shown that it is required for embryogenesis, and it appears to play a part in preventing / regulating programmed cell death. It also appears to control the production of brain-derived neurotrophic factor, a protein that protects neurons and regulates their creation. The function of the cleavage of the N-terminus is not completely clear. The gain-of-function that appears to cause HD is related to the number of CAG repeats present in the HTT gene. The presence of 26 or fewer repeats is not associated with disease. The presence of 27-35 repeats also generally is not associated with symptoms and disease but may increase the risk of further expansions in the offspring. The presence of 36-39 repeats may cause symptoms, generally later in life, while 40 or more repeats is said to be related to HD, although symptoms may appear much later than the determination of the number of repeats has been made. Various strategies to inhibit proteases have been described in the art, related to a variety of different therapeutic applications. As outlined above, proteases are responsible for the cleavage of the HTT protein part that contains the TNR expansion, and for the treatment of HD it was envisioned that it may be beneficial to inhibit such proteases. However, a problem with the use of protease inhibitors is that proteases generally have a wide range of targets in the human body and associated therewith, a range of effects. Inhibiting a protease in the human body through the action of a protease inhibitor thus not only may inhibit the desired effect (prevention of HTT cleavage), but typically also has a range of unwanted side-effects. It is therefore much more desired to target the HTT gene specifically, or its transcribed pre-mRNA, its matured mRNA, or the encoded protein. One approach that was addressed earlier was through manipulation of the splicing machinery using specific antisense oligonucleotides that specifically target the HTT pre-mRNA through interactions with their specific complementary sequences and influence the maturation from pre-mRNA into mRNA. For the HTT gene - in view of what has been addressed above - it was realized that it is preferred that the caspase-6 proteolytic cleavage site encoded by exon 12 is absent in the HTT protein when the TNR expansion becomes too large, and HD occurs or is likely to occur (preferably when the number of CAG repeats is 36, 37, 38, 39, 40, or more). Partial exon 12 skipping (in fact resembling an isoform switch) occurs ‘in frame’, to allow incorporation of the normal downstream amino acid sequence into the mutant protein. The use of antisense oligonucleotides to stimulate this skipping of a part of exon 12 from the HTT pre-mRNA has been described in WO2012 / 018257 and WO2019 / 043027 (Evers etal. 2014. Nucleic Acid Res 24(1 ):4-12; Casaca-Carreira et al. 2016. Biomed Pharmacother 84:93-96), which was supported by the fact that different isoforms of Huntingtin were discovered, one of which lacks the part of exon 12 that comprises the caspase-6 cleavage site (Ruzo et al. 2015. PLoS One. 10(5):e0127686). Disclosed was the identification of HTT-A12 (also referred therein as △Exon12), which is the isoform that lacks a functional caspase-6 cleavage site. Another oligonucleotide-based approach that was taken was the use of gapmers to knockdown the expression of the HTT transcript (Imbert et al. 2019. Nucleic Acid Ther 29(5):256-265; Aslesh & Yokota. 2020. Methods Mol Biol. 2176:57-67; WO2017192664), whereas the use of siRNA and shRNA was also envisioned (Aguiar et al. 2017. Transl Neurodegener27:Q:30', Bennett etal. 2021. Annu Rev Pharmacol Toxicol 6:61:831-852). Yet another approach that was considered was gene therapy in which the HTT gene would be targeted in the genome, rather than targeting the pre-mRNA or mRNA transcribed therefrom. The highly conserved caspase-6 site that was identified in HTT to be involved in clipping of the N-terminal part of the protein is located at amino acid positions 583-590 having the 8 amino acid sequence IVLDGTDN, with the underlined part being a most optimal recognition site for caspase-6 (Thornberry NA et al. 1997. J Biol Chern. 272:17907-17911). The partial exon 12 skipping (135 nt) discussed above using exon-skipping inducing oligonucleotides yields a protein lacking the last 7 amino acids from this sequence, thereby removing the caspase-6 site almost in its entirety, but also an additional 38 amino acids downstream of the caspase-6 site. In another setting, it was shown that mutating the aspartic acid (Asp; D) at position 586 (the most N-terminal D in the caspase-6 sequence) in mice models provided protection from neuronal dysfunction and neurodegeneration in vivo, indicating the importance of the aspartic acid within the caspase-6 site (Graham RK et al. 2006. Cell 125:1179-1191). This also shows that the caspase-6 site is essential in the occurrence of disease symptoms when the HTT gene comprises the >40 CAG TNR as indicated above, and thereby showing the relevance of caspase-6 cleavage in the appearance of HD in humans. Activation of the proteolysis at the 586 caspase-6 site is an early marker of disease in HD, whereas the occurrence of the 586 aa HTT fragment that is the result of the cleavage is in fact in an activation loop triggering caspase-6 activation further, thereby promoting disease by itself (Graham RKeta / . 2010. J Neurosci. 30(45): 15019-15029; Graham RK et al. 2011. Trends Neurosci. 34:646-656; Ehrnhoefer DE et al. 2019. Cell Chern Biol. 26:1295-1305). More recently, the identification was described of a new caspase cleavage site at position D572 that is mediated by caspase-1. Inhibition of caspase-1 also appeared to decrease proteolysis at the D586 caspase-6 site, likely by blocking the downstream activation of caspase-6 through caspase-1. Inhibition of caspase cleavage at D572 significantly decreased mutant HTT aggregation and significantly increased the turnover of soluble mutant HTT (Martin DDO etal. 2019. FASEB J. 33:3190-3197). Even though splice modulation through partial exon 12 skipping (as outlined above) and downregulating HTT expression (for example through gapmers or siRNA) seem viable approaches to target mutant HTT, there remains a need for improvement and more efficient and effective therapeutic compounds that specifically target the caspase-6 cleavage site at D586 and / or the caspase-1 cleavage site at D572, ensuring that the HTT protein has a diminished ability to be cleaved at these positions, without affecting the normal function of the HTT protein. It was realized, and it is disclosed herein that it is possible to target the HTT transcript to modulate the D586 caspase-6 and D572 caspase-1 sites in the HTT protein, individually, or in combination, by applying a technology that is generally referred to as “RNA editing”. RNA editing is a natural process through which eukaryotic cells alter the sequence of their RNA molecules, often in a site-specific and precise way, thereby increasing the repertoire of genome encoded RNAs by several orders of magnitude. RNA editing enzymes have been described for eukaryotic species throughout the animal and plant kingdoms, and these processes play an important role in managing cellular homeostasis in metazoans from the simplest life forms (such as Caenorhabditis elegans) to humans. Examples of RNA editing are adenosine (A) to inosine (I) conversions and cytidine (C) to uridine (II) conversions, which occur through enzymes called Adenosine Deaminases acting on RNA (ADAR) and APOBEC / AID (cytidine deaminases that act on RNA), respectively. ADAR is a multi-domain protein, comprising a catalytic domain, and two to three double-stranded RNA recognition domains, depending on the enzyme in question. Each recognition domain recognizes a specific double stranded RNA (dsRNA) sequence and / or conformation. The catalytic domain does also play a role in recognizing and binding a part of the dsRNA helix, although the key function of the catalytic domain is to convert an A into I in a nearby, predefined, position in the target RNA, by deamination of the nucleobase. Inosine is read as guanosine by the translational machinery of the cell, meaning that, if an edited adenosine is in a coding region of an mRNA orpre-mRNA, it can recode the protein sequence. A-to-l conversions may also occur in 5’ non-coding sequences of a target mRNA, creating new translational start sites upstream of the original start site, which gives rise to N-terminally extended proteins, or in the 3’ UTR or other non-coding parts of the transcript, which may affect the processing and / or stability of the RNA. In addition, A-to-l conversions may take place in splice elements in introns or exons in pre-mRNAs, thereby altering the pattern of splicing. As a result, exons may be included or skipped. The enzymes catalyzing adenosine deamination are within an enzyme family of ADARs, which include human deaminases hADARI and hADAR2, as well as hADAR3. However, for hADAR3 no deaminase activity has been demonstrated. The use of oligonucleotides to edit a target RNA applying adenosine deaminase has been described (e.g., Woolf et al. 1995. Proc Natl Acad Sci USA 92:8298-8302; Montiel-Gonzalez et al. 2013. Proc Natl Acad Sci USA 110(45): 18285-18290; Vogel et al. 2014. Angewandte Chemie Int Ed 53:267-271). A disadvantage of the method described by Montiel-Gonzalez et al. (2013) is the need for a fusion protein consisting of the boxB recognition domain of bacteriophage lambda N-protein, genetically fused to the adenosine deaminase domain of a truncated natural ADAR protein. It requires target cells to be either transduced with the fusion protein, which is a major hurdle, or that target cells are transfected with a nucleic acid construct encoding the engineered adenosine deaminase fusion protein for expression. The system described by Vogel et al. (2014) suffers from similar drawbacks, in that it is not clear how to apply the system without having to genetically modify the ADAR first and subsequently transfect or transform the cells harboring the target RNA, to provide the cells with this genetically engineered protein. US 9,650,627 describes a similar system. The oligonucleotides of Woolf et al. (1995) that were 100% complementary to the target RNA sequences suffered from severe lack of specificity: nearly all adenosines in the target RNA strand that was complementary to the antisense oligonucleotide were edited. It is known that ADAR may act on any dsRNA. Through a process sometimes referred to as ‘promiscuous editing’, the enzyme will edit multiple A’s in the dsRNA. Hence, there was a need for methods and means that circumvent such promiscuous editing and only target specific adenosines in a target RNA molecule to become therapeutic applicable. Vogel et al. (2014) showed that such off-target editing can be suppressed by using 2’-O-methyl (2’-OMe) modified nucleosides in the oligonucleotide at positions opposite to adenosines that should not be edited and used a non-modified nucleoside directly opposite to the specifically targeted adenosine on the target RNA. However, the specific editing effect at the target nucleotide has not been shown to take place without the use of recombinant ADAR enzymes having covalent bonds with the antisense oligonucleotide (AON). Several publications have now shown that the recruitment of endogenous ADAR (hence without the need for an exogenous and / or recombinant source) is feasible while maintaining a specificity in which a single adenosine within a target RNA molecule can be targeted and deaminated to an inosine. WO2016 / 097212 discloses AONs for the targeted editing of RNA, wherein the AONs are characterized by a sequence that is complementary to a target RNA sequence (therein referred to as the ‘targeting portion’) and by the presence of a stem-loop I hairpin structure (therein referred to as the ‘recruitment portion’), which is preferably non-complementary to the target RNA. Such oligonucleotides are referred to as ‘self-looping AONs’. The recruitment portion acts in recruiting a natural ADAR enzyme present in the cell to the dsRNA formed by hybridization of the target sequence with the targeting portion. Due to the recruitment portion, there is no need for conjugated entities or presence of modified recombinant ADAR enzymes. WO2016 / 097212 describes the recruitment portion as being a stem-loop structure mimicking either a natural substrate (e.g., the GluB receptor) or a Z-DNA structure known to be recognized by the dsRNA binding domains, or Z-DNA binding domains, of ADAR enzymes. A stem-loop structure can be an intermolecular stem-loop structure, formed by two separate nucleic acid strands, or an intramolecular stem loop structure, formed within a single nucleic acid strand. The stem-loop structure of the recruitment portion as described is an intramolecular stem-loop structure, formed within the AON itself, and is thought to attract (endogenous) ADAR. Similar stem-loop structure-comprising systems for RNA editing have been described in WO2017 / 050306, WO2020 / 001793, WO2017 / 010556, WO2020 / 246560, and WO2022 / 078995. WO2017 / 220751 and WO2018 / 041973 describe a next generation type of AONs that do not comprise such a stem-loop structure but that are (almost fully) complementary to the targeted area. In one embodiment, one or more mismatching nucleotides, wobbles, or bulges exist between the oligonucleotide and the target sequence. A sole mismatch may be at the site of the nucleoside opposite the target adenosine, but in other embodiments AONs (or RNA editing oligonucleotides, often abbreviated to ‘EONs’) were described with multiple bulges and / or wobbles when attached to the target sequence area. It appeared possible to achieve in vitro, ex vivo and in vivo RNA editing with AONs lacking a stem-loop structure and with endogenous ADAR enzymes when the sequence of the AON was carefully selected such that it could attract / recruit ADAR. The ‘orphan nucleoside’, which is defined as the nucleoside in the AON that is positioned directly opposite the target adenosine in the target RNA molecule, did not carry a 2’-OMe modification. The orphan nucleoside can be a deoxyribonucleoside (DNA), wherein the remainder of the AON could still carry 2’-O-alkyl modifications at the sugar entity (such as 2’-OMe), or the nucleotides directly surrounding the orphan nucleoside contained chemical modifications (such as DNA in comparison to RNA) that further improved the RNA editing efficiency and / or increased the resistance against nucleases. Such effects could even be further improved by using sense oligonucleotides (SONs) that ‘protected’ the AONs against breakdown (described in WO2018 / 134301). The use of chemical modifications and particular structures in oligonucleotides that could be used in ADAR-mediated editing of specific adenosines in a target RNA have been the subject of numerous publications in the field, such as WO2019 / 111957, WO2019 / 158475, WO2020 / 165077, WO2020 / 201406, WO2020 / 211780, WO2021 / 008447, WO2021 / 020550, WO2021 / 060527, WO2021 / 117729, WO2021 / 136408, WO2021 / 182474, WO2021 / 216853, WO2021 / 242778, WO2021 / 242870, WO2021 / 242889, WO2022 / 007803, WO2022 / 018207, WO2022 / 026928,   and WO2022 / 124345. The use of specific sugar moieties has been disclosed in for instance WO2020 / 154342, WO2020 / 154343, WO2020 / 154344, WO2022 / 103839,   and WO2022 / 103852, whereas the use of stereo-defined linker moieties (in general for oligonucleotides that for instance can be used for exon skipping, in gapmers, in siRNA, or specifically for RNA-editing oligonucleotides, related to a wide variety of target sequences) has been described in WO2011 / 005761, WO2014 / 010250, WO2014 / 012081, WO2015 / 107425, WO2017 / 062862, WO2017 / 160741, WO2017 / 192664, WO2017 / 192679 (DMD), WO2017 / 198775, WO2017 / 210647, WO2018 / 067973, WO2018 / 098264, WO2018 / 223056 (PNPLA3), WO2018 / 223073 (APOC3), WO2018 / 223081 (PNPLA3), WO2018 / 237194,  WO2019 / 032607  (C9orf72), WO2019 / 055951,  WO2019 / 075357 (SMA / ALS), WO2019 / 200185 (DM1), WO2019 / 217784 (DM1), WO2019 / 219581, WO2020 / 118246 (DM1), WO2020 / 160336 (HTT), WO2020 / 191252, WO2020 / 196662, WO2020 / 219981 (USH2A), WO2020 / 219983 (RHO), WO2020 / 227691 (C9orf72), WO2021 / 071788 (C9orf72), WO2021 / 071858, WO2021 / 178237 (MAPT), WO2021 / 234459, WO2021 / 237223, and WO2022 / 099159. Next to these disclosures, an extensive number of publications relate to the targeting of specific RNA target molecules, or specific adenosines within such RNA target molecules, be it to repair a mutation that resulted in a premature stop codon, or other mutation causing disease. Examples of such disclosures in which adenosines are targeted within specified target RNA molecules are WO2020 / 157008 and WO2021 / 136404 (USH2A); WO2021 / 113270 (APP); WO2021 / 113390 (CMT1A); WO2021 / 209010 (IDUA, Hurler syndrome); WO2021 / 231673 and WO2021 / 242903 (LRRK2); WO2021 / 231675 (ASS1); WO2021 / 231679 (GJB2); WO2019 / 071274 and WO2021 / 231680 (MECP2); WO2021 / 231685 and WO2021 / 231692 (OTOF, autosomal recessive non-syndromic hearing loss); WO2021 / 231691 (XLRS); WO2021 / 231698 (argininosuccinate lyase deficiency); WO2021 / 130313 and WO2021 / 231830 (ABCA4); and WO2021 / 243023 (SERPINA1). Notably, using RNA editing to target the HTT transcript molecules is not an entirely new idea. WO2023 / 052317 discloses the use of RNA editing oligonucleotides to treat and / or prevent polyQ diseases, such as HD, by specifically binding to the CAG TN Rs, and trigger the deamination of the adenosines in the repeated CAG codons rather than targeting the caspase cleavage site-encoding transcript. The disclosure here provides one or more alternative and / or improved techniques, compounds and / or compositions, based on RNA editing, for use in the treatment of HD, by not targeting the CAG repeats in the HTT transcripts, but rather amend the transcripts to yield a protein with a diminished functionality in getting cleaved at the caspase-1 site and / or the caspase-6 site (as outlined in the detail above), which then should lead to a lowered degree of aggregates and the occurrence of HD. SUMMARY OF THE INVENTION The present disclosure provides an antisense oligonucleotide (AON) that is capable of forming a double-stranded complex with a region of a target RNA nucleic acid molecule in a human cell, wherein the double-stranded complex can recruit an endogenous ADAR enzyme in the cell, wherein the region comprises a target adenosine, wherein the nucleotide in the AON that is opposite the target adenosine is the orphan nucleotide, wherein the ADAR enzyme can deaminate the target adenosine into an inosine, wherein the target RNA nucleic acid molecule is a transcript molecule of the human HTT gene that encodes the HTT protein, and wherein the target adenosine is in a codon coding for an aspartic acid within a proteolytic cleavage site of the HTT protein. In one aspect, the target adenosine is in the GAC codon coding for aspartic acid (D; Asp) at position 586 that is part of a caspase-6 proteolytic cleavage site in the HTT protein. In one aspect, the target adenosine is in the GAU codon coding for aspartic acid (D; Asp) at position 572 that is part of a caspase-1 proteolytic cleavage site in the HTT protein. Preferably, the human cell is a brain cell, preferably a cell within the striatum. In one aspect, the HTTgene comprises a CAG TNR with 36-39 repeats, preferably 40 or more repeats. In one aspect, the deamination of the target adenosine results in a complete or reduced loss of a functional D586 caspase-6 proteolytic cleavage site. In one aspect, the deamination of the adenosine changes the amino acid at position 586 from an aspartic acid to a glycine (G, Gly) because of the resulting GIC (GGC) codon in the HTT sequence. In one aspect, the deamination of the target adenosine results in a complete or reduced loss of a functional D572 caspase-1 proteolytic cleavage site. In one aspect, the deamination of the adenosine changes the amino acid at position 572 from an aspartic acid to a glycine (G, Gly) because of the resulting GIU (GGU) codon in the HTT sequence. In one aspect, the orphan nucleotide is a deoxycytidine or a deoxyuridine. In one aspect, the orphan nucleotide is a cytidine analog such as a deoxynucleotide comprising a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase (also known as Benner’s base). In one aspect, the orphan nucleotide is a uridine analog such as a deoxynucleotide comprising an uracil nucleobase attached in such a way that it forms an “iso-uridine” (but still with a 2’-H moiety in the ribose). In one aspect the nucleotide numbering in the AON is such that the orphan nucleotide is number 0 and nucleotides are further positively (+) incremented towards the 5’-end and negatively (-) incremented towards the 3’-end, and the first nucleotide 3’ from the orphan nucleotide (-1) in the AON (which is positioned opposite the guanosine that is 5’ of the target adenosine in the target sequence) is a nucleotide analog that can induce a syn-conformation of the guanosine, preferably a modified purine nucleobase, more preferably wherein this modified purine nucleobase is selected from the group consisting of: 7-deaza-2’-deoxyadenosine (7-deaza dA); 7-deaza-2’-adenosine (7-deaza A); 7-deaza-2’-deoxy-2’-fluoroadenosine (7-deaza fA); 7-deaza-2’-deoxy-2’-ara-fluoroadenosine; 7-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-deoxyadenosine (3-deaza dA); 3-deaza-2’-adenosine (3-deaza A); 3-deaza-2’-deoxy-2’-fluoroadenosine (3-deaza fA); 3-deaza-2’-deoxy-2’-ara-fluoroadenosine; 3-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3,7-dideaza-2’-deoxyadenosine (3,7-dideaza dA); 3,7-dideaza-2’-adenosine (3,7-dideaza A); 3,7-dideaza-2’-deoxy-2’-fluoroadenosine (3,7-dideaza fA); 3,7-dideaza-2’-deoxy-2’-ara-fluoroadenosine; 3,7-dideaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-O-[2-(methoxy)ethyl] adenosine; 3-deaza-2’-O-[2-methylamino-2-oxoethyl] adenosine; 2’-deoxy-2’-fluoroguanosine; 2’-ara-fluoro guanosine (FANA G); 2’,2’-difluoro guanosine; 2’-deoxyinosine (dl); 2’-OH-inosine (rl); 2’-fluoroinosine (2’-F-l); 2‘-ara-fluoro inosine (FANA I); 2’,2’-difluoro inosine; 5-formylindole-2’-deoxyriboside; 5-formyl-2’-fluoro-2’-deoxyriboside; 5-formylindole-2’-ara-fluoro-2’-deoxyriboside; 5-formylindole-2’,2’-difluoro-2’-deoxyriboside; 5-formylindole-2’-O-methylriboside; 5-formylindole-2’-O-[2-(methoxy)ethyl]riboside;          5-formylindole-2’-O-[2-methylamino-2- oxoethyl]riboside; beta-(4-amidino-1 / - / -imidazol-1-yl) riboside; beta-(4-amidino-1 / - / -imidazol-1-yl) 2’-deoxyriboside; beta-(4-amidino-1 / - / -imidazol-1-yl) 2’-ara-fluoro-2’-deoxyriboside; and beta-(4-amidino-1 / - / -imidazol-1-yl) 2’,2’-difluoro-2’-deoxyriboside. In one aspect, the AON comprises one or more modifications in the linkage moiety, which is each independently selected from a phosphorothioate (PS), phosphonoacetate, phosphorodithioate, methylphosphonate (MP), sulfonylphosphoramidate, a PNdmi linkage, or a PNms linkage. In one aspect, the AON comprises one or more nucleotides comprising a mono- or disubstitution at the 2', 3' and / or 5' position of the ribose, each independently selected from the group consisting of: -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; -0-, S-, or N-alkyl; -0-, S-, or N-alkenyl; -0-, S-, or N-alkynyl; -0-, S-, or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylamino oxyethoxy; and -dimethylaminoethoxyethoxy. Provided herein is an AON, wherein the AON is used for the deamination of the adenosine at position 1757 in the human HTT mRNA sequence (c.1757A>G), and the AON comprises or consists of an AON selected from the group provided in SEQ ID NO:961 to 1920, 1936 to 1953, and 2008 to 2054. In one aspect, the orphan nucleotide in the AON of any of the AONs of SEQ ID NO:961 to 1920 (8d in Fig. 1) is replaced by a deoxycytidine (Cd), a deoxyuridine (lid), or a deoxynucleotide carrying a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase (Benner’s base Z; or Zd). In one aspect, the nucleotide at the -1 position in the AON of any of the AONs of SEQ ID NO:961 to 1920 (deoxycytidine; or Cd) is replaced by a nucleotide analog that can induce a syn-conformation of the guanosine, as outlined above. In one aspect, the orphan nucleotide in the AON of any of the AONs of SEQ ID NO:961 to 1920 is replaced by a deoxycytidine (Cd), a deoxyuridine (lid), or a deoxynucleotide carrying a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase (Benner’s base Z; or Zd) and the nucleotide at the -1 position in the AON of any of the AONs of SEQ ID NO:961 to 1920 (deoxycytidine; or Cd) is replaced by a nucleotide analog that can induce a syn-conformation of the opposite guanosine, as outlined above. Provided herein is an AON, wherein the AON is used for the deamination of the adenosine at position 1715 in the human HTT mRNA sequence (c.1715A>G), and the AON comprises or consists of an AON selected from the group provided in SEQ ID NO:1 to 960, 1930 to 1935, and 1964 to 2007. In one aspect, the orphan nucleotide in the AON of any of the AONs of SEQ ID NO:1 to 960 (8d in Fig. 1) is replaced by a deoxycytidine (Cd), a deoxyuridine (lid), or a deoxynucleotide carrying a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase (Benner’s base Z; or Zd). In one aspect, the nucleotide at the -1 position in the AON of any of the AONs of SEQ ID NO:1 to 960 (deoxycytidine; or Cd) is replaced by a nucleotide analog that can induce a syn-conformation of the guanosine, as outlined above. In one aspect, the orphan nucleotide in the AON of any of the AONs of SEQ ID NO:1 to 960 is replaced by a deoxycytidine (Cd), a deoxyuridine (lid), or a deoxynucleotide carrying a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase (Benner’s base Z; or Zd) and the nucleotide at the -1 position in the AON of any of the AONs of SEQ ID NO:1 to 960 (deoxycytidine; or Cd) is replaced by a nucleotide analog that can induce a syn-conformation of the opposite guanosine, as outlined above. Provided herein is also a vector, preferably a viral vector, more preferably an adeno-associated virus (AAV) vector, comprising a nucleic acid molecule encoding an AON as disclosed herein. Provided herein is also a nanoparticle delivery vehicle formulation that comprises an AON as disclosed herein. In a preferred aspect, the nanoparticle delivery vehicle is a Lipid Nanoparticle (LNP). Provided herein is also a pharmaceutical composition comprising an AON, a vector, or a nanoparticle delivery vehicle formulation, as disclosed herein, and a pharmaceutically acceptable carrier. In one aspect, the disclosure provides an AON, a vector, a nanoparticle delivery vehicle formulation, or a pharmaceutical composition, as disclosed herein, for use in the treatment of HD. In one aspect, the disclosure provides a use of an AON, a vector, a nanoparticle delivery vehicle formulation, or a pharmaceutical composition, as disclosed herein, in the manufacture of a medicament for the treatment of HD. In one aspect, the disclosure provides an in vitro, ex vivo, or in vivo method of editing a HTT transcript molecule, the method comprising contacting the HTT transcript molecule, or a part thereof, with an AON as disclosed herein, thereby allowing the formation of a doublestranded complex of the AON with the HTT transcript molecule, thereby enabling the recruitment of an ADAR1 or ADAR2 deamination enzyme that binds to the double-stranded complex, and therethrough allowing the specific editing of a target adenosine in the HTT transcript molecule, by the deamination enzyme, into an inosine, wherein the target adenosine is in the GAC codon coding for aspartic acid (D; Asp) at position 586 of the caspase-6 proteolytic cleavage site, or in the GAU codon coding for aspartic acid (D; Asp) at position 572 of the caspase-1 proteolytic cleavage site, in the human HTT protein. In one aspect, the disclosure provides a method of treating, preventing, slowing down, or ameliorating HD in a patient in need thereof, the method comprising contacting a HTT transcript molecule in a cell of the subject with an AON as disclosed herein, thereby treating the patient. In one aspect, the disclosure provides a method for the deamination of a target adenosine in an HTT transcript molecule in a cell, wherein the target adenosine is in the GAC codon coding for aspartic acid (D; Asp) at position 586 of the caspase-6 proteolytic cleavage site, and / or in the GAU codon coding for aspartic acid (D; Asp) at position 572 of the caspase-1 proteolytic cleavage site, in the human HTT protein, the method comprising the steps of: (i) providing the cell with an AON, a vector, or a nanoparticle delivery vehicle formulation, as disclosed herein; (ii) allowing uptake by the cell of the AON, the vector, or the nanoparticle delivery vehicle; (iii) allowing annealing of the AON to the HTTtranscript molecule; (iv) allowing an endogenous ADAR enzyme that is naturally present in the cell to deaminate the target adenosine in the HTT transcript molecule to an inosine; and optionally (v) identifying the presence of the inosine in the target RNA molecule, at the specified position. In a preferred aspect, the cell is a human cell, preferably a CNS cell, more preferably a brain cell, and wherein the deamination of the adenosine changes the amino acid to a glycine (G; Gly) because of the resulting GIO (GGC) codon at position 586 in the HTT amino acid sequence for the caspase-6 site, or wherein the deamination of the adenosine changes the amino acid to a glycine (G; Gly) because of the resulting GIU (GGU) codon at position 572 in the HTT amino acid sequence for the caspase-1 site. In a preferred aspect, step (v) of the method as disclosed herein comprises: a) sequencing the HTTpre-mRNA ormRNA molecule, ora cDNA derived thereof; b) assessing the presence of a 586Gly HTT protein variant, or assessing the presence of a 572Gly HTT protein variant as the case may be; or c) using a functional readout, such as determining the level of formed aggregates before and after the administration of the AON, vector, or nanoparticle delivery vehicle formulation, as disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS One or more embodiments of the invention will now be described, by way of example only, with reference to the accompanying drawings, in which: Fig. 1A shows the 5’ to 3’ sequence of part of the human HTT mRNA transcript in which the GAU codon coding for aspartic acid (D; Asp) at position 572 of the caspase-1 proteolytic cleavage site and the GAC codon coding for aspartic acid (D; Asp) at position 586 of the caspase-6 proteolytic cleavage site in the human HTT protein are in bold (SEQ ID NO: 1921). The underlined adenosines are the respective individual targets for RNA editing as disclosed herein, resulting in a codon coding for a glycine (G; Gly) residue (GIU / GGU) at the 572 position and resulting in a codon coding for a glycine (G; Gly) residue (GIC / GGC) at the 586 position after editing. The grey shaded area shows the coding sequence for the caspase-6 cleavage site in the protein. Fig. 1B shows the 5’ to 3’ sequences and modifications of 960 AONs (SEQ ID NO:1 to 960, as indicated) that were designed to target the target the adenosine in the GAU codon (for changing Asp572 to Gly572). Fig. 1C shows the 5’ to 3’ sequences and modifications of 960 AONs (SEQ ID NO:961 to 1920, as indicated) that were designed to target the adenosine in the GAC codon (for changing Asp586 to Gly586). The chemical modifications of the AONs are as follows: Um, Am, Gm, and Cm are 2’-OMe modified uridine, adenosine, guanosine, and cytidine, respectively; Ae and Ge 2’-MOE modified adenosine and guanosine, respectively; Gf, Cf, Af, and Uf are 2’-F modified guanosine, cytidine, adenosine, and uridine, respectively; Ad, Gd and Cd are deoxyadenosine, deoxyguanosine and deoxycytidine, respectively; 8d is a deoxynucleotide carrying an uracil base in an iso-uridine manner (= deoxyuridine analog); “I” refers to a PNdmi linkage; “A” refers to a MP linkage; “*” refers to a PS linkage; and all other linkages (no symbol) are phosphodiester linkages. Fig. 2 shows the 5’ to 3’ sequences and modifications of a further set of AONs, wherein RM 120560 to RM 120565 (SEQ ID NO: 1930 to 1935, respectively) were designed to target the adenosine in the GAU codon encoding aspartic acid at position 572 in the human HTT protein. RM120566 to RM120583 (SEQ ID NO:1936 to 1953, respectively) were designed to target the adenosine in the GAC codon encoding aspartic acid at position 586 in the human HTT protein. The chemical modifications of the AONs are as provided for Fig. 1, and wherein m5Ce is 2’-MOE modified 5-methyl-cytidine; m5Ue is 2’-MOE modified thymidine (nucleotide carrying a 5-methyluracil nucleobase (= thymine) with a 2’-MOE substitution in the ribose sugar moiety; elsewhere sometimes also referred to as ‘Te’); Zd (orphan nucleotide) is a deoxynucleotide carrying a Benner’s base; Id is a deoxynucleotide carrying a hypoxanthine nucleobase; 7Ad is a 7-deaza-2’-deoxyadenosine; “#” refers to a PNms linkage; and “°” refers to a PO linkage. Fig. 3A shows the A > G editing percentage in PHH cells of the adenosine in the GAU codon encoding aspartic acid at position 572 in the human HTT protein, in a ddPCR experiment, after transfection of the indicated AONs (RM numbers provided). Non-transfected cells (NT), a PBS control, a mock transfection (Mock), and two unrelated AONs (RM4266 and RM4777) served as negative controls. Fig. 3B shows the A > G editing percentage in PHH cells of the adenosine in the GAC codon encoding aspartic acid at position 586 in the human HTT protein, in a ddPCR experiment, after transfection of the indicated AONs (RM numbers provided). Non-transfected cells (NT), a PBS control, a mock transfection (Mock), and two unrelated AONs (RM4266 and RM4777) served as negative controls. Fig. 4A shows the A > G editing percentage of the adenosine in the GAU codon encoding aspartic acid at position 572 in the human HTT protein, in a ddPCR experiment, after transfection of the indicated AONs (RM numbers provided) in iPSC-derived forebrain neurons. Non-transfected cells (NT) served as a negative control. Fig. 4B shows the A > G editing percentage of the adenosine in the GAC codon encoding aspartic acid at position 586 in the human HTT protein, in a ddPCR experiment, after transfection of the indicated AONs (RM numbers provided) in iPSC-derived forebrain neurons. Non-transfected cells (NT) served as a negative control. Fig. 5 shows a set of in silico designed AONs based on the length and sequence of best editing-generating AONs in transfected cells, the predicted affinity to the target mRNA site (based on 2D-structure prediction), and the symmetry of the AON with respect to the orphan nucleotide. SEQ ID NO:1964 to 2007 represent AONs targeting the adenosine in the GAU codon for aspartic acid at position 572 in the human HTT protein. SEQ ID N0:2008 to 2054 represent AONs targeting the adenosine in the GAC codon for aspartic acid at position 586 in the human HTT protein. “Z” represents the orphan nucleotide carrying a Benner’s base. The other nucleotides in the provided sequences may comprise sugar moiety, linkage and nucleobase modifications as outlined in detail herein. DETAILED DESCRIPTION HD, a neurodegenerative disorder characterized by progressive deterioration of cognitive and motor functions is caused by an expansion of a trinucleotide (CAG) repeat encoding glutamine (polyQ) in the N-terminus of the HTT protein. PolyQ expansion results in selective loss of GABAergic medium spiny striatal neurons as well as glutamatergic cortical neurons that project to the stratum. A neuropathological hallmark in human HD and mouse models is the intracellular accumulation of N-terminal HTT fragments, suggesting that aberrant HTT proteolysis and / or dysfunctional clearance of HTT fragments may underlie the neuropathology in HD. Several proteases, including caspases, calpains, and aspartyl endopeptidases cleave HTT within the N-terminal region, and several studies have shown that expanded N-terminal HTT fragments have enhanced cytotoxicity. Proteolytic cleavage sites comprise the recognition sequence for the specific protease and the two amino acids between which the peptide linkage is cleaved by the protease. Whether or not a recognition site for a protease is used in nature depends not only on the presence of the recognition sequence itself, but also on the location of the site in the folded protein. An internally located recognition site is typically not used in nature. However, the proteolytic caspase-6 site in human HTT is used in nature. Multiple publications have disclosed that cleavage at position 586 (aspartic acid) in mutant HTT (with a disease-causing number of CAG repeats) influences caspase-6 activation in vivo (e.g., Graham et al. 2010). Furthermore, a novel proteolytic cleavage site for caspase-1 was identified around position 572 that regulates mutant HTT clearance. The inventors of the present disclosure realized that direct targeting and editing of the aspartic acid at position 572 and / or 586 and changing it to a glycine would result in nonfunctional cleavage sites, which would in turn result in less accumulation of the N-terminal repeats in patients with or being at risk of HD, and thereby enabling one to treat, prevent or ameliorate the disease. The inventors realized that this could be achieved in the transcripts of the HTT gene by using nucleotide-specific RNA editing of the adenosine in one or both adenosines in the codons for aspartic acid at position 572 and / or 586, using a technology generally referred to as RNA editing (as explained supra). Definitions Whenever reference is made to an oligonucleotide, oligo, ON, ASO, oligonucleotide composition, antisense oligonucleotide, AON, (RNA) editing oligonucleotide, EON, and RNA (antisense) oligonucleotide, both oligoribonucleotides and deoxyoligoribonucleotides are meant unless the context dictates otherwise. Potentially the oligonucleotide may completely lack RNA and DNA nucleotides (as they appear in nature) and may consist completely of modified nucleotides. Whenever reference is made to an ‘oligoribonucleotide’ or a ‘deoxyoligoribonucleotide’, the nucleotide may comprise the nucleobase adenine, guanine, uracil, cytosine, hypoxanthine, 6-amino-5-nitro-3-yl-2(1H)-pyridone, iso-uracil, thymine (= 5-methyluracil), or any other nucleobase known in the art. The nucleotide may also lack a base (= a-basic). An AON as disclosed herein may comprise a mix of ribonucleotides and deoxyribonucleotides. When a deoxyribonucleotide is used, hence without a modification at the 2’ position of the sugar, the nucleotide is often abbreviated to dA (or Ad), dC (or Cd), dG (or Gd) or m5Ud (or T) in which the ‘d’ represents the deoxy nature of the nucleoside, while a ribonucleoside that is either normal RNA or modified at the 2’ position is often abbreviated without the ‘d’, and often abbreviated with their respective modifications and as explained herein. The term ‘nucleoside’ refers to the nucleobase linked to the (deoxy)ribosyl sugar, without phosphate groups. A ‘nucleotide’ is composed of a nucleoside and one or more phosphate groups. The term ‘nucleotide’ thus refers to the respective nucleobase-(deoxy)ribosyl-phospholinker, as well as any chemical modifications of the ribose moiety or the phospho group. Thus, the term would include a nucleotide including a locked ribosyl moiety (comprising a 2’-4’ bridge, comprising a methylene group or any other group), an unlocked nucleic acid (UNA), a threose nucleic acid (TNA), a nucleotide including a linker comprising a phosphodiester, phosphonoacetate, phosphotriester, PS, phosphoro(di)thioate, MP (orMeP), methyl thiophosphonate, phosphoramidate linkages, PNdmi, and a linkage according to the structure of formula (I) as described herein. Sometimes the terms nucleobase, nucleoside and nucleotide are used interchangeably, unless the context clearly requires differently, for instance when a nucleoside is linked to a neighbouring nucleoside and the linkage between these nucleosides is modified. As stated herein, a nucleotide is a nucleoside plus one or more phosphate groups. The terms ‘ribonucleoside’ and ‘deoxyribonucleoside’, or ‘ribose’ and ‘deoxyribose’ are as used in the art. Sometimes the terms adenosine and adenine, guanosine and guanine, cytidine and cytosine, uracil and uridine, thymine and thymidine / uridine, inosine, and hypoxanthine, are used interchangeably to refer to the corresponding nucleobase on the one hand, and the nucleoside or nucleotide on the other. The nucleobase thymine (T) is also known as 5-methyluracil (sometimes referred to as m5U) and is an uracil (U) derivative; thymine and 5-methyluracil can be interchanged throughout the document text. Likewise, the nucleotide thymidine is also known as 5-methyluridine and is a uridine derivative; thymidine and 5-methyluridine can be interchanged throughout the document text. Whenever reference is made to nucleotides in the oligonucleotide, such as cytosine, 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-acetylcytosine, 5-hydroxycytosine, and p-D-glucosyl-5-hydroxymethylcytosine are included. Whenever reference is made to adenine, N6-methyladenine, 8-oxo-adenine, 2,6-diaminopurine and 7-methyladenine are included. Whenever reference is made to uracil, dihydrouraciI, isouracil, N3-glycosylated uracil, pseudouracil, 5-methyluracil, N1-methylpseudouracil, 4-thiouracil and 5-hydroxymethyluracil are included. Whenever reference is made to guanine, 1-methylguanine, 7-methylguanosine, N2,N2-dimethylguanosine, N2,N2,7-trimethylguanosine and N2,7-dimethylguanosine are included. Whenever reference is made to nucleosides or nucleotides, ribofuranose derivatives, such as 2’-deoxy, 2’-hydroxy, and 2’- O-substituted variants, such as 2’-O-methyl (2’-OMe), are included, as well as other modifications, including 2’-4’ bridged variants. Whenever reference is made to oligonucleotides, one or more linkages may be a naturally occurring phosphodieaster linkage, whereas the remaining linkages between two mononucleotides may be a modified linkage. Examples of such modified linkages are phosphonoacetate, phosphotriester, PS, phosphoro(di)thioate, MP, phosphoramidate linkages, phosphoryl guanidine, thiophosphoryl guanidine, sulfono phosphoramidate, PNdmi and the linkage structure according to formula (I), further outlined in detail below. The term ‘comprising’ encompasses ‘including’ as well as ‘consisting of’, e.g., a composition ‘comprising X’ may consist exclusively of X or may include something additional, e.g., X + Y. The term ‘about’ in relation to a numerical value x is optional and means, e.g., x+10%. The word ‘substantially’ does not exclude ‘completely’, e.g., a composition which is ‘substantially free from Y’ may be completely free from Y. Where relevant, the word ‘substantially’ may be omitted from the definition of the invention. The term ‘conducive to’ or ‘mediate’ can be used interchangeably with ‘capable of facilitating’. When used in the context of an AON that is conducive to ADAR editing (or can mediate ADAR editing), this means that the AON, after entry into the cell, interacts with the target RNA sequence, thereby forming a double stranded structure which is recognized by the ADAR enzyme, which can then deaminate the target adenosine into an inosine. Hence, the AON itself does not have the enzymatic function (the ADAR enzyme has), but it can trigger, induce, cause, organize, mediate, provide, give, produce, facilitate, result in RNA editing after binding to the target RNA molecule. The term ‘mismatch’ is used herein to refer to opposing nucleotides in a double stranded RNA complex which do not form perfect base pairs according to the Watson-Crick base pairing rules. In the historical sense, mismatched nucleotides are G-A, C-A, ll-C, A-A, G-G, C-C, Il-Il pairs. In some embodiments AONs as disclosed herein comprise fewer than four mismatches with the target sequence, for example 0, 1 or 2 mismatches. ‘Wobble’ base pairs are G-ll, l-ll, l-A, and l-C base pairs. When a II is placed opposite the target A, there is no mismatch, and the AON may be 100% complementary, although an iso-uridine (iso-U) opposite the target adenosine qualifies as a mismatch, since it does not pair according to the Watson-Crick rules of base pairing. When a C is placed opposite the target A, there is at least 1 mismatch between the AON and the target sequence. Although a G:G pairing would be considered a mismatch, that does not necessarily mean that the interaction is unstable, which means that the term ‘mismatch’ may be somewhat outdated based on the current disclosure where a Hoogsteen base-pairing may be seen as a mismatch based on the origin of the nucleotide but still be relatively stable. An isolated G:G pairing in duplex RNA can for instance be quite stable but will still be defined as a mismatch. Analysis of natural targets of ADAR enzymes has indicated that these generally include mismatches between the two strands that form the RNA helix edited by ADAR1 or 2. It has been suggested that these mismatches enhance the specificity of the editing reaction (Stefl et al. Structure 2006, 14(2):345-355; Tian et al. Nucleic Acids Res 2011, 39(13):5669-5681). Characterization of optimal patterns of paired / mismatched nucleotides between the AONs and the target RNA also appears important to the development of efficient ADAR-based AON therapy. The term ‘complementary’ as used herein refers to the fact that the AON hybridizes under physiological conditions to a second nucleic acid strand. Examples are (i) when the AON as a first nucleic acid strand (= guide oligonucleotide) forms a heteroduplex RNA editing oligonucleotide complex with second complementary nucleic acid strand {in vitro), or (ii) when it forms a double stranded complex with the target RNA molecule. The term does not necessarily mean that each nucleotide in a nucleic acid strand has a perfect pairing with its opposite nucleotide in the opposite sequence. In other words, while an AON may be complementary to a target sequence, there may be mismatches, wobbles and / or bulges between the AON and the target sequence, while under physiological conditions that AON still hybridizes to the target sequence such that the cellular RNA editing enzymes can deaminate the target adenosine to an inosine. The term ‘substantially complementary’ therefore also means that despite the presence of the mismatches, wobbles, and / or bulges, the AON has enough matching nucleotides with the target sequence that under physiological conditions the AON hybridizes to the target RNA molecule. As shown herein, an AON may be complementary, but may also comprise one or more mismatches, wobbles and / or bulges with the target sequence, if under physiological conditions the AON is able to hybridize to its target. ADARs are multidomain proteins with N-terminal double stranded RNA binding domains (dsRBDs) and C-terminal deaminase domains. Two ADAR genes encode catalytically active ADARs in humans {ADAR encoding ADAR1 proteins and ADARB1 encoding the ADAR2 protein). ADAR1 is expressed in two protein isoforms (p110 and p150) that differ in their N-terminal structures. Since the substrate for ADARs is an RNA duplex, the enzymes access the reactive adenosine using a base flipping mechanism (Stephens OM et al. Biochemistry. 2000, 39(40): 12243-12251). Also, because ADARs require duplex RNA for activity, their reaction can be directed to specific adenosines in different transcripts using complementary guide strands for duplex formation at the target sites. This approach is currently being pursued to develop therapeutic guide strands that recruit ADARs to correct disease-causing mutations in RNA (Qu Let al. Nat. Biotechnol. 2019, 37(9): 1059-1069; Merkle T et al. Nat. Biotechnol. 2019, 37(2):133-138; Katrekar D et al. Nat. Methods 2019, 16(3):239-242; Monian P et al. Nat. Biotechnol. 2022, DOI: 0.1038 / s41587-022-01225-1). This is also the subject of the present disclosure. While this approach is promising, ADARs have sequence preferences that make certain adenosines disfavored for reaction, limiting the current scope of this approach. For instance, the nearest neighbor nucleotide preferences for ADARs show a strong bias against reaction at adenosines in 5’-GA sites (Eggington JM etal. Nat. Commun. 2011, 2(319):DOI:10.1038 / ncomms1324). This preference is explained by structural studies of ADAR2 bound to transition state analog-containing RNA that suggest a clash between the 2-amino group of the 5’-G and G489 of the ADAR2 loop involved in stabilizing the flipped-out conformation required for the adenosine deamination reaction (Matthews et al. Nat Struct Mol Biol 2016, 23(5):426-433). Earlier work with fusion proteins bearing ADAR deaminase domains indicated that editing efficiency at 5’-GA sites could be improved with a G-A or G-G pair at the 5’ nearest neighbor (Schneider MF et al. Nucleic Acids Res. 2014, 42(10):p.e87). However, the basis for this effect has not been reported nor has this effect been established for full length ADARs bearing native dsRBD RNA binding domains. In WO2024 / 013361 it is shown that G-A and G-G pairs on the 5’ side of an editing site improve editing efficiency compared to a 5’ G-C pair for full length ADAR2 and ADAR1 p110. Using X-ray crystallography, the structure of an active fragment of human ADAR2 bound to duplex RNA bearing a G:G pair adjacent to an editing site was determined. In the present disclosure, related to editing of adenosines in the HTT transcript, both target A’s (so in the GAU site for the caspase-1 site at 572 as well as in the GAC site for the caspase-6 site at 586) have a 5’-G in the target sequence. WO2024 / 013361 discloses that the ADAR enzyme prefers the Gsyn:Ganti pairing since the 2-amino group of the 5’-G in the syn conformation does not clash with the minor groove of the enzyme. It was shown that the use of nucleosides capable of stable pairing with the 5’-G in the syn conformation enables more efficient editing within 5’-GA target sites, providing a solution to the problem in deaminating these unfavored editing sites. In the present disclosure, both target sites have a 5’-G from the target A. This means that the design rules as outlined in WO2024 / 013361 also apply here. Hence, it is preferred that the nucleotide at position -1 in the AON is a nucleotide analog that can induce a syn conformation of the 5’-G in the target sequence, preferably a modified purine nucleobase, more preferably wherein this modified purine nucleobase is selected from the group consisting of: 7-deaza-2’-deoxyadenosine (7-deaza dA); 7-deaza-2’-adenosine (7-deaza A); 7-deaza-2’-deoxy-2’-fluoroadenosine (7-deaza fA); 7-deaza-2’-deoxy-2’-ara-fluoroadenosine; 7-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-deoxyadenosine (3-deaza dA); 3-deaza-2’-adenosine (3-deaza A); 3-deaza-2’-deoxy-2’-fluoroadenosine (3-deaza fA); 3-deaza-2’-deoxy-2’-ara-fluoroadenosine; 3-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3,7-dideaza-2’-deoxyadenosine (3,7-dideaza dA); 3,7-dideaza-2’-adenosine (3,7-dideaza A); 3,7-dideaza-2’-deoxy-2’-fluoroadenosine (3,7-dideaza fA); 3,7-dideaza-2’-deoxy-2’-ara-fluoroadenosine; 3,7-dideaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-O-[2-(methoxy)ethyl] adenosine; 3-deaza-2’-O-[2-methylamino-2-oxoethyl] adenosine; 2’-deoxy-2’-fluoroguanosine; 2’-ara-fluoro guanosine (FANA G); 2’,2’-difluoro guanosine; 2’-deoxyinosine (dl); 2’-OH-inosine (rl); 2’-fluoroinosine (2’-F-l); 2‘-ara-fluoro inosine (FANA I); 2’,2’-difluoro inosine; 5-formylindole-2’-deoxyriboside; 5-formyl-2’-fluoro-2’-deoxyriboside; 5-formylindole-2’-ara-fluoro-2’-deoxyriboside; 5-formylindole-2’,2’-difluoro-2’-deoxyriboside; 5-formylindole-2’-O-methylriboside; 5-formylindole-2’-O-[2-(methoxy)ethyl]riboside;          5-formylindole-2’-O-[2-methylamino-2- oxoethyl]riboside; beta-(4-amidino-1 / - / -imidazol-1-yl) riboside; beta-(4-amidino-1 / - / -imidazol-1-yl) 2’-deoxyriboside; beta-(4-amidino-1 / - / -imidazol-1-yl) 2’-ara-fluoro-2’-deoxyriboside; and beta-(4-amidino-1 / 7-imidazol-1-yl) 2’,2’-difluoro-2’-deoxyriboside. The term ‘orphan nucleotide’ relates to the nucleotide in the AON that is directly opposite the target adenosine, which is the adenosine that is deaminated by the deaminating enzyme. The orphan nucleotide may be a natural cytidine, a deoxycytidine, a uridine, or a deoxyuridine. It may also be a chemically modified nucleotide, as further described in detail below, or a known or chemically modified analog of a natural (deoxy)cytidine, such as a nucleotide carrying a Benner’s base, or a known or chemically modified analog of a natural (deoxy)uridine, such as iso-uridine, as further outlined herein. A ‘nucleotide analog’ refers to an analog of a nucleic acid nucleotide. The nucleotide analog is an analog of adenosine, guanosine, cytidine, thymidine, uridine, deoxyadenosine, deoxyguanosine, deoxycytidine, deoxythymidine or deoxyuridine. The term ‘downstream’ in relation to a nucleic acid sequence means further along the sequence in the 3' direction; the term ‘upstream’ means the converse. Thus, in any sequence encoding a polypeptide, the start codon is upstream of the stop codon in the sense strand but is downstream of the stop codon in the antisense strand. The same holds true for the AONs as disclosed herein. Nucleotides that are upstream of the orphan nucleotide in the antisense oligonucleotide are located towards the 5’ terminus, and nucleotides that are downstream of the orphan nucleotide are located towards the 3’ terminus. The nucleotide ‘numbering’ in an AON as disclosed herein is such that the orphan nucleotide is number 0 and the nucleotide 5’ from the orphan nucleotide is number +1. Counting is further positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, wherein the first nucleotide 3’ from the orphan nucleotide is number -1. The internucleoside linkage numbering in the AON is such that linkage number 0 is the linkage 5’ from the orphan nucleotide, and the linkage positions in the oligonucleotide are positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end. References to ‘hybridisation’ typically refer to specific hybridisation and exclude non-specific hybridisation. Specific hybridisation can occur under experimental conditions chosen, using techniques well known in the art, to ensure that most stable interactions between probe and target are where the probe and target have at least 70%, preferably at least 80%, more preferably at least 90% sequence identity. The term ‘splice mutation’ relates to a mutation in a gene that encodes fora pre-mRNA, wherein the splicing machinery is dysfunctional in the sense that splicing of introns from exons is disturbed and due to the aberrant splicing, the subsequent translation is out of frame resulting in premature termination of the encoded protein. Often such shortened proteins are degraded rapidly and do not have any functional activity. Whenever a ‘naked’ form in relation to the AON as disclosed herein is referred to, it means that the AON is manufactured in a laboratory or manufacturing facility, through which it is generally chemically modified to prevent it from rapid degradation after it enters the mammalian body or a tissue, or cell, upon administration. A naked form of an AON is therefore different from a form in which the AON is encoded (and delivered) by a viral genome or within a plasmid vector. When such viral vectors or plasmid vectors are administered, the encoded AON is expressed from the viral vector genome or from the plasmid in the cell to which the viral vector or plasmid vector is delivered. Consequently, the AON is then not chemically modified and comprises solely naturally occurring RNA nucleotides. An AON that is ‘packaged’ in a delivery vehicle, such as a lipid nanoparticle (LNP), is still considered ‘naked’, as it is not transcribed from a coding sequence, but manufactured in a manufacturing facility. After such manufacturing, the chemically modified AON can then be further processed to be encapsulated by a delivery vehicle such as an LNP. LNP’s that can be used to deliver AONs as disclosed herein can be any type of LNP known in the art. The length of the AON as disclosed herein, and when delivered in a naked form is preferably 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides in length. However, when the AON as disclosed herein is to be delivered through the expression of a viral vector, then the AON may be longer, such as 70, 80, 90, 100, 150, or 200 or more nucleotides in length. The term ‘HEON’ refers to a heteroduplex double-stranded complex molecule wherein an AON as disclosed herein is hybridized to a partially or fully complementary, partially of fully overlapping sense oligonucleotide. Because the AON as disclosed herein often has specified chemical modifications that are different from the chemical modifications in the sense strand, the two strands form such a heteroduplex RNA editing oligonucleotide complex. The sense strand may be chemically modified almost in its entirety, similar or different to what is performed in the AON as disclosed herein, for example by providing nucleotides with a ribose sugar moiety carrying a 2’-OMe substitution, a 2’-F substitution, or a 2’-MOE substitution. It is to be understood that the sense strand present in the HEON is a different entity in comparison to the target RNA molecule in the cell. The sense strand in an HEON is preferably 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides in length. The HEON is often generated in vitro and used as a delivery tool to protect the AON from degradation when administered to the cell. In other words, the HEON is preferably formed before the AON is administered to the cell. Preferred aspects of HEONs that may be used for AONs as disclosed herein are discussed in WO2024 / 084048. Embodiments Disclosed herein is an AON that is capable of forming a double-stranded complex with a region of a target RNA nucleic acid molecule in a human cell, wherein the double-stranded complex binds to an ADAR enzyme that is naturally present in the cell (i.e., endogenous ADAR enzyme), wherein the region comprises a target adenosine, wherein the nucleotide in the AON that is opposite the target adenosine is the orphan nucleotide, wherein the ADAR enzyme can deaminate the target adenosine into an inosine, wherein the target RNA nucleic acid molecule is a transcript molecule of the human HTT gene that encodes the HTT protein, and wherein the target adenosine is in a codon coding for an aspartic acid within a proteolytic cleavage site of the HTT protein. In one aspect, the target adenosine is in the GAU codon coding for aspartic acid (D; Asp) at position 572 that is part of a caspase-1 proteolytic cleavage site in the HTT protein. In this embodiment, the deamination of the adenosine changes the amino acid to a glycine (G; Gly) because of the resulting GIU (GGU) codon at position 572 in the HTT amino acid sequence within the caspase-1 site. In one aspect, the target adenosine is in the GAC codon coding for aspartic acid at position 586 that is part of a caspase-6 proteolytic cleavage site in the HTT protein. In this embodiment, the deamination of the adenosine changes the amino acid also to a glycine because of the resulting GIG (GGC) codon at position 586 in the HTT amino acid sequence within the caspase-6 site. In one aspect, the human cell in which the deamination of the target adenosine is taking place is a brain cell, preferably a cell within the striatum: a cluster of cells in the subcortical basal ganglia of the forebrain. In one aspect, the HTT gene comprises a GAG trinucleotide repeat (TNR) with 36-39 repeats, preferably 40 or more repeats. In one aspect, the orphan nucleotide is a deoxycytidine or a deoxyuridine. In one aspect, the orphan nucleotide is a cytidine analog, preferably a deoxynucleotide comprising a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase. In one aspect, the orphan nucleotide is a deoxyuridine analog such as a deoxynucleotide comprising an uracil nucleobase attached such that it forms an iso-uridine. In one aspect, the nucleotide numbering in the AON is such that the orphan nucleotide is number 0 and nucleotides are further positively (+) incremented towards the 5’-end and negatively (-) incremented towards the 3’-end, and the first nucleotide 3’ from the orphan nucleotide (-1) in the AON is positioned opposite a guanosine that is 5’ of the target adenosine in the target sequence, wherein the nucleotide at position -1 is a nucleotide analog that can induce a syn-conformation of the guanosine, preferably a modified purine nucleobase, more preferably wherein this modified purine nucleobase is selected from the group consisting of: 7-deaza-2’-deoxyadenosine (7-deaza dA); 7-deaza-2’-adenosine (7-deaza A); 7-deaza-2’-deoxy-2’-fluoroadenosine (7-deaza fA); 7-deaza-2’-deoxy-2’-ara-fluoroadenosine; 7-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-deoxyadenosine (3-deaza dA); 3-deaza-2’-adenosine (3-deaza A); 3-deaza-2’-deoxy-2’-fluoroadenosine (3-deaza fA); 3-deaza-2’-deoxy-2’-ara-fluoroadenosine; 3-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3,7-dideaza-2’-deoxyadenosine (3,7-dideaza dA); 3,7-dideaza-2’-adenosine (3,7-dideaza A); 3,7-dideaza-2’-deoxy-2’-fluoroadenosine (3,7-dideaza fA); 3,7-dideaza-2’-deoxy-2’-ara-fluoroadenosine; 3,7-dideaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-O-[2-(methoxy)ethyl] adenosine; 3-deaza-2’-O-[2-methylamino-2-oxoethyl] adenosine; 2’-deoxy-2’-fluoroguanosine; 2’-ara-fluoro guanosine (FANA G); 2’,2’-difluoro guanosine; 2’-deoxyinosine (dl); 2’-OH-inosine (rl); 2’-fluoroinosine (2’-F-l); 2‘-ara-fluoro inosine (FANA I); 2’,2’-difluoro inosine; 5-formylindole-2’-deoxyriboside;      5-formyl-2’-fluoro-2’-deoxyriboside; 5-formylindole-2’-ara-fluoro-2’- deoxyriboside;      5-formylindole-2’,2’-difluoro-2’-deoxyriboside; 5-formylindole-2’-O- methylriboside; 5-formylindole-2’-O-[2-(methoxy)ethyl]riboside; 5-formylindole-2’-O-[2-methylamino-2-oxoethyl]riboside; beta-(4-amidino-1 / - / -imidazol-1-yl) riboside; beta-(4-amidino-1 / - / -imidazol-1-yl) 2’-deoxyriboside; beta-(4-amidino-1 / - / -imidazol-1-yl) 2’-ara-fluoro-2’-deoxyriboside; and beta-(4-amidino-1 / - / -imidazol-1-yl) 2’,2’-difluoro-2’-deoxyriboside. In one aspect, the AON comprises one or more modifications in the linkage moiety, which is each independently selected from a PS, phosphonoacetate, phosphorodithioate, MP, sulfonylphosphoramidate, a PNdmi and a PNms linkage. In one aspect, the AON comprises one or more nucleotides comprising a mono- or disubstitution at the 2', 3' and / or 5' position of the ribose, each independently selected from the group consisting of: -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; -0-, S-, or N-alkyl; -0-, S-, or N-alkenyl; -0-, S-, or N-alkynyl; -0-, S-, or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylamino oxyethoxy; and -dimethylaminoethoxyethoxy. In one aspect, the target adenosine is in the GAU codon coding for aspartic acid at position 572 that is part of a caspase-1 proteolytic cleavage site in the HTT protein, wherein the AON is selected from the group consisting of SEQ ID N0:1 to 960, 1930 to 1935, and 1964 to 2007. In a preferred aspect, the AON is selected from the group consisting of SEQ ID NO: 1932, 1933, and 1934. In one aspect, the target adenosine is in the GAC codon coding for aspartic acid at position 586 that is part of a caspase-6 proteolytic cleavage site in the HTT protein, wherein the AON is selected from the group consisting of SEQ ID NO:961 to 1920, 1936 to 1953, and 2008 to 2054. In a preferred aspect, the AON is selected from the group consisting of SEQ ID NO: 1942, 1945, and 1947. In one aspect, the orphan nucleotide as shown in the sequences of SEQ ID NO:1 to 1920 is replaced by a deoxynucleotide carrying: a cytosine, a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase, or an uracil nucleobase. In one aspect, the nucleotide at the -1 position in any one of the AONs as disclosed in SEQ ID NO:1 to 1920 is replaced by a nucleotide analog that can induce a syn-conformation of the opposite guanosine as outlined herein. Disclosed herein is also a nanoparticle delivery vehicle formulation comprising an AON as disclosed herein. In one aspect, the nanoparticle delivery vehicle is an LNP. Disclosed herein is also a delivery vehicle that comprises a nucleic acid molecule comprising a part that encodes an AON sequence as disclosed herein. A preferred delivery vehicle in that sense is a viral vector, preferably an AAV vector. The viral vector encodes the AON without the chemical modifications as outlined herein. Disclosed herein is also an AON as disclosed herein that is conjugated to a targeting / delivery ligand that allows the transport over the Blood Brain Barrier (BBB) after systemic or intranasal administration. Examples of such targeting / delivery ligands are moieties that target the transferrin receptor, known to the person skilled in the art. Disclosed herein is also a pharmaceutical composition comprising an AON or a nanoparticle delivery vehicle formulation as disclosed herein, and a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers and solvents are known in the art. Preferred pharmaceutical compositions are those that can be administered intranasally and that comprise AONs as disclosed herein, which are conjugated to targeting / delivery ligands that enable the transfer across the BBB. Disclosed herein is also an AON, a nanoparticle delivery vehicle, or a viral delivery vehicle, as disclosed herein for use in the treatment of HD. In one aspect, the disclosure relates to a use of an AON, a nanoparticle delivery vehicle, or a viral delivery vehicle, as disclosed herein in the manufacture of a medicament for the treatment of HD. Disclosed herein is also an in vitro, ex vivo, or in vivo method of editing a human HTT transcript molecule in a cell, the method comprising contacting the HTT transcript molecule, or a part thereof, with an AON as disclosed herein, thereby allowing the formation of a doublestranded complex of the AON with the HTT transcript molecule, thereby enabling the recruitment of an ADAR1 or ADAR2 deamination enzyme, which is naturally present (endogenous) in the cell and that recognizes and binds to the double-stranded complex, and therethrough allowing the specific editing of a target adenosine in the HTTtranscript molecule, by the deamination enzyme, into an inosine, wherein the target adenosine is in the GAU codon coding for aspartic acid at position 572 of the caspase-1 proteolytic cleavage site, and / or in the GAC codon coding for aspartic acid at position 586 of the caspase-6 proteolytic cleavage site, in the human HTT protein. In one aspect, the target adenosines at position 1715 (middle nucleotide of the GAU codon) in the mRNA and at position 1757 (middle nucleotide of the GAC codon) are deaminated through the action of two separate AONs, each being designed for their specific target sites. However, RNA editing can also occur in a promiscuous way, in which multiple adenosines are deaminated through a single targeting oligonucleotide that hybridizes to the target sequence that then comprises both 1715 and 1757 positioned adenosines. The AON in that case overlaps with a sequence at both sites. This does not necessarily mean that the AON also is complementary to the entire sequence between the two target adenosines as such does not need to be required for editing of both adenosine targets. So, in one aspect, an AON is used for targeting the adenosine in the GAU codon coding for aspartic acid at position 572 of the caspase-1 proteolytic cleavage site. In another aspect, an AON is used for targeting the adenosine in the GAC codon coding for aspartic acid at position 586 of the caspase-6 proteolytic cleavage site. In another aspect, both AONs are combined in a single or separate formulation (or composition) that may be administered consecutively, together (in one formulation) or in parallel (in two separate formulations). In another aspect, one single AON is generated, based on the teaching as outlined herein, that is complementary to a sequence comprising both target adenosines, wherein the AON is 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,62, 63, 64, 65, 66, 67, 68, 69, or 70 nucleotides in length, with an equal or non-equal complementary part 5’ and 3’ of the target adenosines in the target sequence. In yet another aspect, one single AON is generated, based on the teaching as outlined herein, that is complementary to a sequence including each of the target adenosines, but that has a sequence leaving a non-complementary ‘gap’ in the target sequence, for example being not complementary to 28 or less nucleotides that are located between position 1715 and 1757 in the human HTT mRNA. Without being bound by theory, if such an AON is applied, the non-complementary sequence in the target human HTT (pre-) mRNA ‘loops out’, which does not necessarily hamper double RNA editing. Based on the teaching as provided by the present disclosure, the skilled person can generate AONs with a variety of lengths (with or without being fully complementary to the sequence encompassing both target adenosines) to have double deamination: both at the adenosine in the GAU codon coding for aspartic acid at position 572 of the caspase-1 proteolytic cleavage site, as well as in the GAC codon coding for aspartic acid at position 586 of the caspase-6 proteolytic cleavage site. It is envisioned that editing and thereby rendering both caspase sites non-functional in the human HTT protein increases the change of lower accumulation of detrimental N-terminal parts of the HTT protein when the encoding gene comprises 36, 37, 38, 39, 40, or more CAG repeats, although it cannot be excluded that editing either site is sufficient to reach the same result. The disclosure relates to a method of treating, preventing, slowing down, or ameliorating HD in a patient in need thereof, the method comprising contacting a HTT transcript molecule in a cell of the subject with an AON as disclosed herein, thereby treating the patient. The disclosure also relates to a method of treating, preventing, slowing down, or ameliorating HD in a patient in need thereof, the method comprising administering to said patient an AON as disclosed herein, wherein said administration is by intrathecal (IT) or intracerebroventricular (ICV) injection, allowing the AON to hybridize to a HTT transcript molecule in a brain cell of the subject, preferably a brain cell in the striatum, thereby allowing the production of a HTT protein with a diminished ability to be cleaved by caspase 1 and / or caspase 6, thereby treating the patient. In one aspect, disclosed is a method for the deamination of a target adenosine in a human HTT transcript molecule in a cell, wherein the target adenosine is in the GAU codon coding for aspartic acid at position 572 of the caspase-1 proteolytic cleavage site, and / or in the GAC codon coding for aspartic acid at position 586 of the caspase-6 proteolytic cleavage site, in the human HTT protein, the method comprising the steps of: (i) providing the cell with an AON, a nanoparticle delivery vehicle or a viral vector as disclosed herein; (ii) allowing uptake of the AON, the nanoparticle delivery vehicle, or the viral vector as disclosed herein, by the cell; (iii) allowing annealing of the AON to the HTT transcript molecule; (iv) allowing an ADAR enzyme that is naturally present in the cell to deaminate the target adenosine in the HTT transcript molecule to an inosine; and optionally (v) identifying the presence of the inosine in the target RNA molecule. In one aspect, the in vivo method as disclosed herein comprises a step of assessing the amount of accumulated N-terminal peptides in the striatum of a patient suffering from, or being at risk of suffering from HD, before and after treatment with an AON as disclosed herein. In another setting, the effect may be determined in pre-clinical settings in which HD-related manifestations are monitored before and after AON treatment, such as motor deficiencies or addressing cognitive aspects, for instance in animal models. In one aspect, the AON as disclosed herein is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,62, 63, 64, 65, 66, 67, 68, 69, or 70 nucleotides in length. In one aspect, an AON as disclosed herein is in a naked form. In one aspect, an AON as disclosed herein is in a circular format. In one aspect, an AON as disclosed herein is not in a naked form but is expressed from an expression vector such as a plasmid. In one aspect, the linkage between the most terminal two nucleotides on the 5’ and / or 3’ terminus of the AON as disclosed herein is a PNdmi linkage. In one aspect, the linkage at linkage position -2 in the AON is an MP or a PNms linkage. Chemical modifications Various chemistries and modifications are known in the field of oligonucleotides that can be readily used in accordance with the invention. All chemical modifications listed herein that may be used in the AON as disclosed herein may also be used for a sense strand that is complementary to the AON, when the AON and the complementary strand form a HEON complex, such as described in WO2024 / 084048, except that the opposite sense strand does not have an orphan nucleotide. Hence, the modification related to the orphan nucleotide relate only to the AON as disclosed herein, but all other modifications relate to the AON as disclosed herein and any (protecting) sense oligonucleotide that may be used together with the AON in a pharmaceutical product. This includes the use of hydrophobic moieties (such as tocopherol and cholesterol) and cell-specific ligands, that have also been described herein, and in detail in WO2024 / 084048, which may either be bound to the AON or its opposite strand, or both. The skilled person knows that an oligonucleotide, such as an AON as outlined herein, generally consists of repeating monomers. Such a monomer is most often a nucleotide or a chemically modified nucleotide. The most common naturally occurring nucleotides in RNA are adenosine monophosphate (A), cytidine monophosphate (C), guanosine monophosphate (G), and uridine monophosphate (II). These consist of a pentose sugar, a ribose, a 5’-linked phosphate group which is linked via a phosphate ester, and a T-linked base. The sugar connects the base and the phosphate and is therefore often referred to as the “scaffold” of the nucleotide. A modification in the pentose sugar is therefore often referred to as a ‘scaffold modification’. The original pentose sugar may be replaced in its entirety by another moiety that similarly connects the base and the phosphate. It is therefore understood that while a pentose sugar is often a scaffold, a scaffold is not necessarily a pentose sugar. Examples of scaffold modifications that may be applied in the monomers of the AON as disclosed herein are disclosed in WO2020 / 154342, WO2020 / 154343, and WO2020 / 154344. A nucleoside in the AON as disclosed herein may be a natural nucleoside (deoxyribonucleoside or ribonucleoside) or a non-natural nucleoside. It is noted that for RNA editing, in which double-stranded RNA is generally the substrate for enzymes with deamination activity (such as ADARs), ribonucleosides are considered ‘natural’, while deoxyribonucleosides may then be, for the sake of argument, considered as non-natural, or considered as modified, simply because DNA is not present in the RNA-RNA double stranded (natural) substrate configurations. The skilled person appreciates that when the nucleotide has a natural ribose moiety, it may still be non-naturally modified in the base and / or the linkage. It is recognized in the art that common limiting factors in oligonucleotide-based therapies are the oligonucleotide’s ability to be taken up by the cell, when delivered per se, or ‘naked’ (= without applying a viral vector or plasmid), the biodistribution and the resistance to nuclease-mediated breakdown. The skilled person is aware, and it has been described in detail in the art, that a variety of chemical modifications can assist in overcoming such limitations. Examples of such now commonly used chemical modifications are the 2’-OMe, 2’-F, 2’,2’-diF, and 2’-MOE modifications of the sugar and the use of PS linkages between nucleosides, as described herein. Scaffold modifications (ribose) The ribose 2’ groups in all nucleotides of the AON as disclosed herein, except for the ribose sugar moiety of the orphan nucleotide that has certain limitations in respect of compatibility with RNA editing, can be independently selected from 2’-H (i.e., DNA), 2’-OH (i.e., RNA), 2’-OMe, 2’-MOE, 2’-F, or 2’-4’-linked (for instance a locked nucleic acid (LNA)), or other ribosyl T-substitutions, 2’ substitutions, 3’ substitutions, 4’ substitutions or 5’ substitutions. The orphan nucleotide in the AON that comprises no other chemical modifications to the ribose sugar, the base, or the linkage preferably does not carry a 2’-OMe or 2’-MOE substitution when the nucleobase is a naturally occurring cytosine, but may carry a 2’-F, a 2’,2’-difluoro (diF), or 2’-ara-F (FANA) substitution or may be DNA. WO2024 / 013360 describes the modification of the 2’ position of the ribose sugar moiety of the orphan nucleotide by a 2’,2’-disubstituted substitution such as diF, which is also applicable to what is disclosed here. The 2’-4’ linkage can be selected from many linkers known in the art such as a methylene linker, amide linker, or constrained ethyl linker (cEt). An AON as disclosed herein may comprise one or more nucleotides carrying a 2’-MOE ribose modification. Also, an AON as disclosed herein may comprise one or more nucleotides not carrying a 2’-MOE ribose modification, or wherein the 2’-MOE ribose modifications are at positions that do not prevent the enzyme with adenosine deaminase activity from deaminating the target adenosine. An AON as disclosed herein may comprise a 2’-OMe ribose modification at a position that does not comprise a 2’-MOE ribose modification. An AON as disclosed herein may comprise deoxynucleotides at positions that do not comprise a 2’-MOE or a 2’-OMe ribose modification, or other 2’ ribose substitution. An AON as disclosed herein may comprise one or more nucleotides comprising a 2’ substitution comprising a 2’-MOE, 2’-OMe, 2’-OH, 2’-deoxy, TNA, 2’-fluoro (2’-F), 2’,2’-difluoro (diF) modification, 2’-fluoro-2’-C-methyl modification, or a 2’-4’-linkage (i.e., a bridged nucleic acid such as a locked nucleic acid (LNA or examples mentioned in e.g. WO2018 / 007475)). Other nucleic acid monomers that may be used in an AON as disclosed herein are arabinonucleic acids and 2’-deoxy-2’-fluoroarabinonucleic acid (FANA), for instance for improved affinity purposes. The 2’-4’ linkage can be selected from linkers known in the art, such as a methylene linker or constrained ethyl linker. A wide variety of 2’ modifications that may present in an AON as disclosed herein are known in the art, including but not limited to the modifications outlined in detail in WO2016 / 097212, WO2017 / 220751, WO2018 / 041973, WO2018 / 134301, WO2019 / 219581, WO2019 / 158475, and WO2022 / 099159. In all cases, the modifications should be compatible with RNA editing such that the AON fulfils its role as an oligonucleotide that can form a double stranded complex with the target RNA and by generating this double-stranded nucleic acid complex, recruit a deaminating enzyme, which can subsequently deaminate the target adenosine. Where a monomer in an AON as disclosed herein comprises an unlocked nucleic acid (UNA) ribose modification, that monomer can have a 2’ position comprising the same modifications discussed above, such as a 2’-MOE, a 2’-OMe, a 2’-OH, a 2’-deoxy, a 2’-F, a 2’,2’-diF, a 2’-fluoro-2’-C-methyl, an arabinonucleic acid, a FANA, or a 2’-4’-linkage (i.e., a bridged nucleic acids such as a locked nucleic acid (LNA)). In one aspect, the AON as disclosed herein comprises at least one nucleotide comprising a threose nucleic acid (TNA) ribose modification. In one aspect, the AON as disclosed herein comprises at least one nucleotide with a sugar moiety that comprises a 2’-fluoro (2’-F) modification. A preferred position for the nucleotide that carries a 2’-F modification is position -3 in the AON (as exemplified by many of the AONs in Fig. 1 and Fig. 3), which may be present together with an identical 2’ modification in the orphan nucleotide as discussed above. Base modifications A base, sometimes called a nucleobase, is generally adenine, cytosine, guanine, thymine or uracil, or a derivative thereof. A nucleobase is defined as a moiety that can bond to another nucleobase through H-bonds, polarized bonds (such as through CF moieties) or aromatic electronic interactions. Cytosine, thymine, and uracil are pyrimidine bases, and are generally linked to the scaffold through their 1-nitrogen. Adenine and guanine are purine bases and are generally linked to the scaffold through their 9-nitrogen. The terms ‘adenine’, ‘guanine’, ‘cytosine’, ‘thymine’, ‘uracil’ and ‘hypoxanthine’ as used herein refer to the nucleobases as such. The terms ‘adenosine’, ‘guanosine’, ‘cytidine’, ‘thymidine’, ‘uridine’ and ‘inosine’ refer to the nucleobases linked to the (deoxy)ribosyl sugar. The nucleobases in an AON as disclosed herein can be adenine, cytosine, guanine, thymine, or uracil or any other moiety able to interact with another nucleobase through H-bonds, polarized bonds (such as CF) or aromatic electronic interactions. The nucleobases at any position in the AON as disclosed herein can be a modified form of adenine, cytosine, guanine, or uracil, such as hypoxanthine (the nucleobase in inosine), pseudouracil, pseudocytosine, isouracil, N3-glycosylated uracil, 1-methylpseudouracil, orotic acid, agmatidine, lysidine, 2-thiouracil, 2-thiothymine, 5-substituted pyrimidine (e.g., 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-formyluracil, 5-aminomethylcytosine, 5-formylcytosine), 5-hydroxymethylcytosine, 7-deazaguanine, 7-deazaadenine, 7-deaza-2,6-diaminopurine, 8- aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, 8-oxo-adenine, 3-deazapurine (such as a 3-deaza-adenosine), pseudoisocytosine, N4-ethylcytosine, N2-cyclopentylguanine, N2-cyclopentyl-2-aminopurine, N2-propyl-2-aminopurine, 2,6-diaminopurine, 2-aminopurine, G-clamp and its derivatives, Super A, Super T, Super G, amino-modified nucleobases or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene, or absent like abasic sites {e.g. 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose, azaribose). Modified bases comprise synthetic and natural bases such as inosine, xanthine, hypoxanthine and other-aza, deaza, -hydroxy, -halo, -thio, thiol, -alkyl, -alkenyl, -alkynyl, thioalkyl derivatives of pyrimidine and purine bases that are or will be known in the art. Purine nucleobases and / or pyrimidine nucleobases may be modified to alter their properties, for example by amination or deamination of the heterocyclic rings. The exact chemistries and formats may vary from oligonucleotide construct to oligonucleotide construct and from application to application, and may be worked out in accordance with the wishes and preferences of those of skill in the art. A scaffold modification indicates the presence of a modified version of the ribosyl moiety as naturally occurring in RNA (i.e., the pentose moiety), such as bicyclic sugars, tetrahydropyrans, hexoses, morpholinos, 2’-modified sugars, 4’-modified sugar, 5’-modified sugars and 4’-substituted sugars. Examples of suitable modifications include, but are not limited to 2’-O-modified RNA monomers, such as 2’-O-alkyl or 2’-0-(substituted)alkyl such as 2’-OMe, 2’-O-(2-cyanoethyl), 2’-MOE, 2’-O-(2-thiomethyl)ethyl, 2’-0-butyryl, 2’-O-propargyl, 2’-O-allyl, 2’-O-(2-aminopropyl), 2’-O-(2-(dimethylamino)propyl), 2’-O-(2-amino)ethyl, 2’-O-(2-(dimethylamino)ethyl); 2’-deoxy (DNA); 2’-O-(haloalkyl)methyl such as 2’-O-(2-chloroethoxy)methyl (MCEM), 2’-O-(2,2-dichloroethoxy)methyl (DCEM); 2’-O-alkoxycarbonyl such as 2’-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2’-O-[2- / V-methylcarbamoyl)ethyl] (MCE), 2’-O-[2-( / V, / V-dimethylcarbamoyl)ethyl] (DCME); 2’-halo e.g. 2’-F, FANA; 2'-O-[2-(methylamino)-2-oxoethyl] (NMA); a bicyclic or bridged nucleic acid (BNA) scaffold modification such as a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a xy / o-LNA monomer, an a-LNA monomer, an a-l-LNA monomer, a p-d-LNA monomer, a 2’-amino-LNA monomer, a 2’-(alkylamino)-LNA monomer, a 2’-(acylamino)-LNA monomer, a 2’- / V-substituted 2’-amino-LNA monomer, a 2’-thio-LNA monomer, a (2’-O,4’-C) constrained ethyl (cEt) BNA monomer, a (2’-O,4’-C) constrained methoxyethyl (cMOE) BNA monomer, a 2’,4’-BNAnc(NH) monomer, a 2’,4’-BNANC(NMe) monomer, a 2’,4’-BNANC(NBn) monomer, an ethylene-bridged nucleic acid (ENA) monomer, a carba-LNA (cLNA) monomer, a 3,4-dihydro-2 / - / -pyran nucleic acid (DpNA) monomer, a 2’-C-bridged bicyclic nucleotide (CBBN) monomer, an oxo-CBBN monomer, a heterocyclic-bridged BNA monomer (such as triazolyl or tetrazolyl-linked), an amido-bridged BNA monomer (such as AmNA), an urea-bridged BNA monomer, a sulfonamide-bridged BNA monomer, a bicyclic carbocyclic nucleotide monomer, a TriNA monomer, an a-l-TriNA monomer, a bicyclo DNA (bcDNA) monomer, an F-bcDNA monomer, a tricyclo DNA (tcDNA) monomer, an F-tcDNA monomer, an alpha anomeric bicyclo DNA (abcDNA) monomer, an oxetane nucleotide monomer, a locked PMO monomer derived from 2’-amino LNA, a guanidine-bridged nucleic acid (GuNA) monomer, a spirocyclopropylene-bridged nucleic acid (scpBNA) monomer, and derivatives thereof; cyclohexenyl nucleic acid (CeNA) monomer, altriol nucleic acid (ANA) monomer, hexitol nucleic acid (HNA) monomer, fluorinated HNA (F-HNA) monomer, pyranosyl-RNA (p-RNA) monomer, 3’-deoxypyranosyl DNA (p-DNA), unlocked nucleic acid UNA); an inverted version of any of the monomers above. All these modifications are known to the person skilled in the art. The orphan nucleotide Mutagenesis studies of human ADAR2 revealed that a single mutation at residue 488 from glutamate to glutamine (E488Q), gave an increase in the rate constant of deamination by 60-fold when compared to the wild-type enzyme (Kuttan and Bass. 2012. Proc Natl Acad Sci USA 109(48):3295-3304). During the deamination reaction, ADAR flips the edited base out of its RNA duplex, and into the enzyme active site (Matthews et al. 2016). When ADAR2 edits adenosines in the preferred context (an A:C mismatch) the nucleotide opposite the target adenosine is often referred to as the ‘orphan nucleotide’ (or ‘orphan cytidine’ as the case may be), as indicated above. The crystal structure of ADAR2 E488Q bound to double stranded RNA (dsRNA) revealed that the glutamine (Gin; Q) side chain at position 488 can donate an H-bond to the N3 position of the orphan cytidine, which leads to the increased catalytic rate of ADAR2 E488Q. In the wild-type enzyme, wherein a glutamate (or glutamic acid; Glu; E) is present at position 488 instead of a glutamine (Gin) the amide group of the glutamine is absent and is instead a carboxylic acid. To obtain the same contact of the orphan cytidine with the E488Q mutant would then, for the wild-type situation, require protonation for this contact to occur. To make use of endogenously expressed ADAR2 to correct disease relevant mutations, it is essential to maximize the editing efficiency of the wild type ADAR2 enzyme present in the cell. WO2020 / 252376 discloses the use of AONs with modified RNA bases, especially at the position of the orphan cytidine to mimic the hydrogen-bonding pattern observed by the E488Q ADAR2 mutant. By replacing the nucleotide opposite the target adenosine in the AON with cytidine analogs that serve as H-bond donors at N3, it was envisioned that it would be possible to stabilize the same contact that is believed to provide the increase in catalytic rate for the mutant enzyme. Two cytidine analogs were of particular interest: pseudoisocytidine (also referred to as ‘piC’; Lu et al. 2009. J Org Chern 74(21):8021-8030; Burchenal et al. 1976) Cancer Res 36:1520-1523) and Benner’s base Z (also referred to as ‘dZ’ or ‘Zd’ when the ribose comprises a 2’-H; Yang et al. 2006. Nucl Acid Res 34(21):6095-6101) that were initially selected because they offer hydrogen-bond donation at N3 with minimal perturbation to the shape of the nucleobase. Benner’s base is also referred to with its chemical name 6-amino-5-nitro-3-yI-2(1 H)-pyridone. The presence of the cytidine analog in the AON may exist in addition to modifications to the ribose 2’ group. The ribose 2’ groups in the orphan nucleotide can be independently selected from 2’-H (i.e., DNA), 2’-OH (i.e., RNA), 2’-0Me, 2’-MOE, 2’-F, or 2’-4’-linked (i.e., a bridged nucleic acid such as a locked nucleic acid (LNA)), or other 2’ substitutions. The 2’-4’ linkage can be selected from linkers known in the art, such as a methylene linker or constrained ethyl linker. The orphan nucleotide in the AON as disclosed herein is preferably a cytidine or analog thereof (such as a nucleotide carrying a Benner’s base) or a uridine or analog thereof (such as iso-uridine). The orphan nucleotide, whether it is a cytidine or analog thereof, or a uridine or analog thereof, preferably comprises a deoxyribose (2’-H; = DNA) but may also comprise a diF modification at the 2’ position of the sugar. In one aspect at least one and in another aspect both the neighbouring (directly adjacent) nucleotides flanking the orphan nucleotide do not comprise a 2’-OMe modification. Complete modification wherein all nucleotides of the oligonucleotide hold a 2’-OMe modification (including the orphan nucleotide), with natural bases, results in a non-functional oligonucleotide as far as RNA editing goes (known in the art), presumably because it hinders the ADAR activity at the targeted position. In general, an adenosine in a target RNA can be protected from editing by providing an opposing nucleotide with a 2'-OMe group (at least when there are no other chemical substitutions or modifications within the nucleotide), or by providing a guanine or adenine as opposing base, as these two nucleobases are also able to reduce editing of the opposing adenosine. Linkage modifications A nucleoside is generally connected to neighboring nucleosides through condensation of its 5’-phosphate moiety to the 3’-hydroxyl moiety of the neighboring nucleotide monomer. Similarly, its 3’-hydroxyl moiety is generally connected to the 5’-phosphate of a neighboring nucleotide monomer. This forms phosphodiester bonds. The phosphodiesters and the scaffold form an alternating copolymer. The bases are grafted on this copolymer, namely to the scaffold moieties. Because of this characteristic, the alternating copolymer formed by linked scaffolds of an oligonucleotide is often called the ‘backbone’ of the oligonucleotide. Because phosphodiester bonds connect neighboring monomers together, they are often referred to as “backbone linkages”. It is understood that when a phosphate group is modified so that it is instead an analogous moiety such as a phosphorothioate, such a moiety is still referred to as the backbone linkage of the monomer. This is referred to as a “backbone linkage modification”. In general terms, the backbone of an oligonucleotide comprises alternating scaffolds and backbone linkages. As outlined in detail herein, naked AONs as disclosed herein comprise at least one, preferably multiple linkage modifications. It is generally more preferred that the AON as disclosed herein comprises linkage modifications at most, and potentially all positions if the AON is capable of mediating RNA editing through the deamination enzyme when the AON is bound to the target RNA nucleic acid molecule. A linkage modification can be, but is not limited to, a modified version of the phosphodiester present in RNA, such as PS, chirally pure PS, (R / -PS, (S / -PS, MP (also sometimes referred to as MeP), chirally pure MP, (R / -MP, (S / -MP, phosphoryl guanidine (such as PNdmi), chirally pure phosphoryl guanidine, ( / ^-phosphoryl guanidine, (S)-phosphoryl guanidine, phosphorodithioate (PS2), phosphonacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, methyl phosphorohioate, methyl thiophosphonate, PS prodrug, alkylated PS, H-phosphonate, ethyl phosphate, ethyl PS, boranophosphate, borano PS, metyl boranophosphate, methyl borano PS, methyl boranophosphonate, methyl boranophosphothioate, phosphate, phosphotriester, aminoalkylphosphotriester, and their derivatives. Another modification includes phosphoramidite, phosphoramidate, N3’->P5’ phosphoramidate, phosphorodiamidate, phosphorothiodiamidate, sulfamate, diethylenesulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, formacetyl, alkenyl, methylenehydrazino, sulfonamide, triazole, oxalyl, carbamate, methyleneimino (MMI), and thioacetamide nucleic acid (TANA); and their derivatives. Various salts, mixed salts, deprotonated, protonated, tautomeric, and free acid forms are also included, as well as 3’^3’ and 2’->5’ linkages. An AON as disclosed herein may also comprise one or more linkage modifications according to the structure of formula (I) JVW O       O I         H        II X^=P--N--S--R O       O JUXAT               (|) wherein: X = O or S; and R = an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a Ci-Ce alkoxy, a substituted Ci-Ce alkoxy, a C1-C20 alkyl, a substituted C1-C20 alkyl, a Ci-Ce alkenyl, a Ci-Ce substituted alkenyl, a Ci-Ce alkynyl, a substituted Ci-Ce alkynyl, or a conjugate group. In a preferred embodiment, X = O and R = methyl and the linkage modification is referred to as mesyl phosphoramidate, MsPA or PNms. In a preferred aspect, the AON as disclosed herein comprises an internucleoside linkage of the structure of formula (I), wherein X = O and R = CH3, which linkage is generally referred to herein as a PNms linkage (mesyl phosphoramidate). In other preferred aspects, R equals one of the following structures (a), (b), (c), (d), (e), (f), (g), (h), or (i): Disclosed herein is also an AON that is able to mediate adenosine deamination by recruitment of a deaminating enzyme in a cell after the AON has formed a double-stranded complex with a region of a target RNA nucleic acid molecule in a cell, wherein the region 10 comprises a target adenosine, wherein the deaminating enzyme can deaminate the target adenosine into an inosine, and wherein the AON comprises a moiety with a structure according to formula (II): Y        O I         H        II X^=P--N--S--R O       O (H) 15 wherein: X = O or S; Y = O' or S'; and R = an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a Ci-Ce alkoxy, a substituted Ci-Ce alkoxy, a C1-C20 alkyl, a substituted C1-C20 alkyl, a Ci-Ce alkenyl, a Ci-Ce substituted alkenyl, a Ci-Ce alkynyl, a substituted Ci-Ce alkynyl, or a conjugate group. In a preferred embodiment, X = O and R = methyl. An AON as disclosed herein may comprise a substitution of one of the non-bridging oxygens in the phosphodiester linkage. This modification slightly destabilizes base pairing but adds significant resistance to nuclease degradation. A preferred nucleotide analogue or equivalent comprises PS, phosphonoacetate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, H-phosphonate, methyl and other alkyl phosphonate including 3'-alkylene phosphonate, 5'-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate including 3'-amino phosphoramidate and aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate or boranophosphate. Particularly preferred are internucleoside linkages that are modified to contain a PS. Particularly preferred are internucleoside linkages that are modified to contain a PNms. Particularly preferred are internucleoside linkages that are modified to contain a PNdmi. The regular internucleosidic linkages between the nucleotides may be altered by mono- or di-thioation of the phosphodiester bonds to yield PS esters or phosphorodithioate esters, respectively. Other modifications of the internucleosidic linkages are possible, including amidation and peptide linkers. The skilled person can determine for what target RNA nucleic acid molecule the AON comprises a certain linkage modification at each linkage position of the AON as disclosed herein to generate the most effective and most stable oligonucleotide compound. Many of the non-naturally occurring modifications of the linkage, such as PS, are chiral. This means that there are Rp and Sp configurations, known to the person skilled in the art. In one embodiment, the chirality of the PS linkages is controlled, which means that each of the linkages is either in the Rp or in the Sp configuration, whichever is preferred. The choice of an Rp or Sp configuration at a specified linkage position may depend on the target sequence and the efficiency of binding and induction of causing RNA editing of the target adenosine. However, if such is not specifically desired, a composition may comprise AONs as active compounds with both Rp and Sp configurations at a certain specified linkage position. Mixtures of such AONs are also feasible, wherein certain positions preferably have either one of the configurations, while for other positions such does not matter. In one aspect, the AON as disclosed herein comprises one or more (chirally pure or chirally mixed) PS linkages. In one aspect, the AON as disclosed herein comprises one of more (chirally pure or chirally mixed) phosphoramidate (PN) linkages. In one aspect, the AON as disclosed herein comprises one or more (chirally pure or chirally mixed) PNms linkages. In one aspect, a PN linkage connects the terminal two nucleotides on each end of the AON. AONs as disclosed herein may also comprise linkage modifications at all positions that are not chirally controlled. The AON as disclosed herein may also comprise one or more naturally occurring internucleoside linkages. The choice and number of modified linkages may depend on the specific target, the sequence, the length, and the stability of the AON observed in a particular cell type of interest, which can be assessed by methods known to the person skilled in the art. In one aspect, at least one, at least two, at least three, or at least four internucleoside linkages between the 5’ and / or the 3’ terminal two, three, four, or five nucleosides respectively of the AON as disclosed herein are modified internucleoside linkages. In one aspect, the AON as disclosed herein comprises at least one MP internucleoside linkage according to the structure of formula (III): o O     ' f1      CUI. ' 0 '' (III) As was noted in the art, a preferred position for an MP linkage in an AON is linkage position -2, thereby connecting the nucleoside at position -1 with the nucleoside at position -2. In one aspect, this position, in an AON as disclosed herein, comprises a linkage modification according to the structure of formula (I), instead of an MP linkage. WO2020 / 201406 discloses the use of MP linkage modifications at certain positions surrounding the orphan nucleotide in the first nucleic acid strand. Although the presence of MP linkages is compatible with RNA editing by human ADAR enzymes, introducing MP linkages during the manufacturing of oligonucleotides is challenging in view of additional manufacturing (purification) steps in the coupling and decoupling process. In one aspect, the AON does not comprise an MP linkage. In one aspect, the AON as disclosed herein comprises at least one PNdmi linkage, preferably linking the most terminal two nucleosides at the 5’ and / or 3’ end of the AON. A PNdmi linkage as preferably used in the AONs as disclosed herein has the structure of formula (IV) ''o i K N-P=O N— (   .N-— ' PNdmi linkage (IV) In one aspect, at either end or both termini of an AON as disclosed herein, inverted deoxyT or dideoxyT nucleotides are incorporated. Other internucleoside linkages that may be used in the AONs as disclosed herein are those that are disclosed in WO2023 / 278589. In one aspect, the AON as disclosed herein comprises at least one phosphonoacetate and / or at least one phosphonoacetamide internucleoside linkage. Conjugate chemistries In one aspect, the AON as disclosed herein, or the sense strand to which it may be annealed before entering a target cell (in an HEON as disclosed herein), is bound to a hydrophobic moiety, such as palmityl or an analog thereof, cholesterol or analog thereof, or tocopherol or analog thereof. It is preferably bound to the 5’ terminus. In case a hydrophobic moiety is bound to the 5’ terminus as well as to the 3’ terminus, such hydrophobic moieties may the same or different. The hydrophobic moiety bound to the oligonucleotide may be bound directly, or indirectly mediated by another substance. When the hydrophobic moiety is bound directly, it is sufficient if the moiety is bound via a covalent bond, an ionic bond, a hydrogen bond, or the like. When the hydrophobic moiety is bound indirectly, it may be bound via a linking group (a linker). The linker may be a cleavable or an uncleavable linker. A cleavable linker refers to a linker that can be cleaved under physiological conditions, for example, in a cell or an animal body (e.g., a human body). A cleavable linker is selectively cleaved by an endogenous enzyme such as a nuclease, or by physiological circumstances specific to parts of the body or cell, such as pH or reducing environment (such as glutathione concentrations). Examples of a cleavable linker comprise, but is not limited to, an amide, an ester, one or both esters of a phosphodiester, a phosphoester, a carbamate, and a disulfide bond, as well as a natural DNA linker. Cleavable linkers also include self-immolative linkers. An uncleavable linker refers to a linker that is not cleaved under physiological conditions, or very slowly compared to a cleavable linker, for example, in a PS linkage, modified or unmodified deoxyribonucleosides linked by a PS linkage, a spacer connected through a PS bond and a linker consisting of modified or unmodified ribonucleosides. There is no restriction on the chain length, when a linker is a nucleic acid such as DNA, or an oligonucleotide. However, it may be usually from 2 to 20 bases in length, from 3 to 10 bases in length, or from 4 to 6 bases in length. There is no restriction on the length or composition of a spacer that is connects the ligand and the oligonucleotide, and may include for example ethylene glycol, triethylene glycol (TEG), HEG, alkyl chains, propyl, 6-aminohexyl, or dodecyl. One or more other types of molecules may be bound to the AON through one or more linkers, including peptides, sugars, vitamins, polymers, aptamers, (fragments of) antibodies, small molecules, and the like. Non-limiting examples of conjugates that may also be conjugated to an AON of the present disclosure are transferrin receptor-targeting moieties, such as (modified) proteins (e.g., transferrin), peptides (e.g., TF12), aptamers, and / or (fragments of) antibodies that potentially allow for uptake of editing oligonucleotide over the BBB after systemic administration. Compositions containing the (modified) AON as disclosed herein that allow for intranasal administration to reach the brain are also of particular interest. General In addition to the specific preferred chemical modifications at certain positions in compounds as disclosed herein, AONs as disclosed herein may comprise one or more (additional) modifications to the nucleobase, scaffold and / or backbone linkage, which may or may not be present in the same monomer, for instance at the 3’ and / or 5’ position. In one aspect, the AON as disclosed herein comprises at least one internucleoside linkage according to the structure of formula (I), (II), (III), and / or (IV), and / or the AON further comprises at least one nucleotide with a sugar moiety that comprises a 2’-OMe modification, and / or the AON comprises at least one nucleotide with a sugar moiety that comprises a 2’-MOE modification, and / or the AON comprises at least one nucleotide with a sugar moiety that comprises a 2’-F modification, and / or the AON comprises an orphan nucleotide that carries a 2’-H in the sugar moiety and is therefore referred to as a DNA nucleotide, even though additional modifications may exist in its base and / or linkage to its neighbouring nucleosides. In one aspect, the orphan nucleotide carries a 2’-F in the sugar moiety. In one aspect, the orphan nucleotide carries a diF substitution in the sugar moiety. In one aspect, the orphan nucleotide carries a 2’-F and a 2’-C-methyl in the sugar moiety. In one aspect, the orphan nucleotide comprises a 2’-F in the arabinose configuration (FANA) in the sugar moiety. In one aspect, the AON is an antisense oligonucleotide that can form a double stranded nucleic acid complex with a target RNA molecule, wherein the double stranded nucleic acid complex can recruit an adenosine deaminating enzyme for deamination of a target adenosine in the target RNA molecule, wherein the nucleotide in the AON that is opposite the target adenosine is the orphan nucleotide, and wherein the orphan nucleotide has the structure of formula (V): O R2 r4 (V) wherein: X is O, NH, OCH2, CH2, Se, or S; B is a nitrogenous base selected from the group consisting of: cytosine, uracil, isouracil, N3-glycosylated uracil, pseudoisocytosine, 8-oxo- adenine, and 6-amino-5-nitro-3-yl-2(1H)-pyridone; Ri and R2 are both selected, independently, from H, OH, F or CH3; R3 is the part of the AON that is 5’ of the orphan nucleotide, consisting of 7 to 30 nucleotides; and R4 is the part of the AON that is 3’ of the orphan nucleotide, consisting of 4 to 25 nucleotides. The nucleotide 3’ and / or 5’ from the orphan nucleotide may be DNA, more preferably the nucleotide at the 3’ (position -1). Other chemical modifications of the AON as disclosed herein include the substitution of one or more than one of any of the hydrogen atoms with deuterium or tritium, examples of which can be found in e.g., WO2014 / 022566 or WO2015 / 011694. Again, in all cases, the modifications should be compatible with editing such that the AON fulfils its role as an oligonucleotide that can, after binding to its target sequence, recruit an adenosine deaminase enzyme because of the double-stranded nucleic acid entity that arises. In all aspects of the disclosure, the enzyme with adenosine deaminase activity is preferably ADAR1, ADAR2, or ADAT. AONs as disclosed herein preferably do not include a 5’-terminal O6-benzylguanosine or a 5’-terminal amino modification and preferably are not covalently linked to a SNAP-tag domain (an engineered O6-alkylguanosine-DNA-alkyl transferase). An AON as disclosed herein preferably does not comprise a boxB RNA hairpin sequence. In one aspect, an AON as disclosed herein comprises 0, 1,2 or 3 wobble base pairs with the target sequence, and / or 0, 1,2, 3, 4, 5, 6, 7, or 8 mismatching base pairs with the target RNA sequence. No mismatch exists when the orphan nucleotide is uridine, which may be defined differently when the orphan nucleotide is a uridine analog or derivative. One alternative for uridine is positioning an isouridine opposite the target adenosine, which likely does not pair like G pairs with II. Preferably, the target adenosine in the target sequence forms a mismatch base pair with the nucleoside in the AON that is directly opposite the target adenosine. As outlined above, an AON as disclosed herein makes use of specific nucleotide modifications at predefined spots to ensure stability as well as proper ADAR binding and activity. These changes may vary and may include modifications in the backbone of the AON, in the sugar moiety of the nucleotides as well as in the nucleobases or the phosphodiester linkages, as outlined in detail herein. They may also be variably distributed throughout the sequence of the AON. Specific modifications may be needed to support interactions of different amino acid residues within the RNA-binding domains of ADAR enzymes, as well as those in the deaminase domain. For example, PS linkages between nucleotides or 2’-OMe or 2’-MOE modifications may be tolerated in some parts of the AON, while in other parts they should be avoided so as not to disrupt crucial interactions of the enzyme with the phosphate and 2’-OH groups. Specific nucleotide modifications may also be necessary to enhance the editing activity on substrate RNAs where the target sequence is not optimal for ADAR editing. Previous work has established that certain sequence contexts are more amenable to editing. For example, a target sequence 5’-UAG-3’ (with the target A in the middle) contains the most preferred nearest-neighbor nucleotides for ADAR2, whereas a 5’-CAA-3’ target sequence is disfavored (Schneider et al. 2014. Nucleic Acids Res 42(10):e87). The structural analysis of ADAR2 deaminase domain hints at the possibility of enhancing editing by careful selection of the nucleotides that are opposite to the target trinucleotide. For example, the 5’-CAA-3’ target sequence, paired to a 3’-GCU-5’ sequence on the opposing strand (with the A-C mismatch formed in the middle), is disfavored because the guanosine base sterically clashes with an amino acid side chain of ADAR2. The guanosine opposite the C in such circumstances is preferably replaced by an inosine (hence, at the -1 position within the AON), more preferably a deoxyinosine. The AON as disclosed herein, in contrast to what has been described for siRNA, or gapmers and their relation towards RNase breakdown and the use of such gapmers in doublestranded complexes (see for instance EP 3954395 A1), does not comprise a stretch of DNA nucleotides which would make a target sequence (or a sense nucleic acid strand) a target for RNase-mediated breakdown. It is not desired that the target transcript molecule is degraded through the binding of the AON to the transcript molecule. In one embodiment, the AON does not comprise four or more consecutive DNA nucleotides anywhere within its sequence. In an embodiment, the AON is composed of as much (chemically) modified nucleotides as possible to enhance the resistance towards RNase-mediated breakdown, while at the same time being as efficient as possible in producing an RNA editing effect. This means that the orphan nucleotide and several other nucleotides within the AON may be DNA, but also that there is no stretch of four or more consecutive DNA nucleotides within the AON. Hence, the AON as disclosed herein is not a gapmer. A gapmer reduces the expression of a target transcript but does not produce RNA editing of a specified adenosine within the target transcript. A gapmer is in principle a single-stranded nucleic acid consisting of a central region (DNA gap region with at least four consecutive deoxyribonucleotides) and wing regions positioned directly at the 5’ end (5’ wing region) and the 3’ end (3’ wing region) thereof. In contrast, the AON as disclosed herein may be any oligonucleotide that produces an RNA editing effect in which a target adenosine in a target RNA molecule is deaminated to an inosine, and accordingly is resistant to RNase-mediated breakdown as much as possible to yield this effect and to allow the mRNA transcript being translated into a protein. The AONs as disclosed herein may also be administered in the context of aids that will increase the entry of the AON into the target cell and / or its endosomal escape as soon as it is in the cell. Moieties that can be applied for such applications are for example a set of chemical compounds (generally purified from nature) referred to as saponins or triterpene glycosides, as outlined infra. A saponin that can be used in the methods as disclosed herein is AG1856, disclosed in WO2021 / 122998 and further described for use with RNA editing producing oligonucleotides in WO2024 / 153801. Such saponin may be administered separately from the AON, or together, but may also be conjugated to the AON to for example the 5’ or 3’ terminus, using a suitable linker if needed. Disclosed herein is also a pharmaceutical composition comprising the AON as disclosed herein, and further comprising a pharmaceutically acceptable carrier, solvent, diluent, and / or other additive (such as a saponin or triterpene glycoside like AG1856 (as discussed above), which in fact may also be administered separately from the AON) and may be dissolved in a pharmaceutically acceptable organic solvent, or the like. Dosage forms in which the AON or the pharmaceutical composition are administered may depend on the disorder to be treated and the tissue that needs to be targeted and can be selected according to common procedures in the art. The pharmaceutical compositions may be administered by a single-dose administration or by multiple dose administration. It may be administered daily or at appropriate time intervals, which may be determined using common general knowledge in the field and may be adjusted based on the disorder, the severity thereof, and the efficacy of the active ingredient. Although in a preferred embodiment, the AON as disclosed herein is a single-stranded oligonucleotide comprising an orphan nucleotide opposite the target adenosine, wherein the orphan nucleotide is chemically modified as disclosed herein, and wherein the remainder of the oligonucleotide is chemically modified to prevent it from nuclease breakdown also as disclosed herein, in another embodiment, disclosed is any kind of oligonucleotide or heteroduplex oligonucleotide complex, that may or may not be bound to hairpin structures (internally or at the terminal end(s)), that may be bound to ADAR or catalytic domains thereof, or wherein the oligonucleotide is in a circular format. In a preferred aspect, the AON as disclosed herein is a ‘naked’ oligonucleotide, comprising a variety of chemical modifications in the ribose sugar and / or the base of one or more of the nucleotides within the sequence, that preferably comprises at least one linkage according to the structure of formula (I) as disclosed herein, that can hybridize to the target transcript or a part thereof that includes the target adenosine, and can recruit endogenous (naturally present) ADAR in the target cell for the deamination of the target adenosine. In another aspect, the AON as disclosed herein, that is delivered in a ‘naked’ form, does not comprise a stem-loop structure for recruitment of the deaminating enzyme, which allows for a shorter AON and improved cellular delivery and trafficking. Notably, when the AON comprises chemical modifications, as detailed herein, it may still be delivered through the means of a delivery vehicle. Suitable delivery vehicles are nanoparticle delivery vehicles such as polymeric nanoparticles, dendrimers, inorganic nanoparticles and nanocrystals, organic nanocrystals, and liposomes. Preferred nanoparticles are Lipid Nanoparticles (LNP’s) that are nano-sized lipid vesicles that carry the AON of the present invention and aid to the delivery of target cells. In the event that an LNP is applied or any other similar type of carrier, the AON is still considered naked because it is not transcribed from an encoding polynucleotide (such as in the case of a plasmid or a vector, in which the AON is not regarded as ‘naked’). So, even though a chemically modified AON is encapsulated by a carrier, preferably an LNP, it is still seen as naked, as it has been manufactured as such in a laboratory setting (manufacturing facility) and encapsulated thereafter in the carrier using methods known to the person skilled in the art. The disclosure also relates to a delivery vehicle, preferably an LNP, which comprises a ‘naked’ and chemically modified AON as disclosed herein, even more preferably as disclosed in any one of SEQ ID NO:1 to 1920 and 1930 to 1953. It is known in the art that RNA editing entities (such as human ADAR enzymes) edit dsRNA structures with varying specificity, depending on several factors. One important factor is the degree of complementarity of the two strands making up the dsRNA sequence. Perfect complementarity of the two strands usually causes the catalytic domain of human ADAR to deaminate adenosines in a non-discriminative manner, reacting with any adenosine it encounters. The specificity of hADARI and 2 can be increased by introducing chemical modifications and / or ensuring several mismatches in the dsRNA, which - while not being bound by theory - presumably helps to position the dsRNA binding domains in a way that has not been clearly defined yet. Additionally, the deamination reaction itself can be enhanced by providing an oligonucleotide that comprises a mismatch opposite the adenosine to be edited. Following the instructions in the present application, those skilled in the art will be capable of designing the complementary portion of the oligonucleotide according to their needs. It will be understood by a person having ordinary skill in the art that the extent to which the editing enzymes inside the cell are redirected to other target sites may be regulated by varying the affinity of the first nucleic acid strand for the recognition domain of the editing enzyme. The exact modification may be determined through some trial and error and / or through computational methods based on structural interactions between the AON and the recognition domain of the editing enzyme. In addition, or alternatively, the degree of recruiting and redirecting the editing enzyme resident in the cell may be regulated by the dosing and the dosing regimen of the AON. This is something to be determined by the experimenter (in vitro) or the clinician, usually in phase I and / or II clinical trials. Disclosed herein is the site-specific editing of target adenosines in RNA sequences in eukaryotic, preferably metazoan, more preferably mammalian, more preferably human cells, more preferably human brain cells, more preferably cells in the striatum (or derived from the striatum). The target cell can be located in vitro, ex vivo or in vivo. One advantage of the AON as disclosed herein is that it can be used with cells in situ in a living organism, but it can also be used with cells in culture. In some embodiments cells are treated ex vivo and are then introduced into a living organism (e.g., re-introduced into an organism from whom they were originally derived). The AON as disclosed herein can also be used to edit target RNA sequences in cells from a transplant or within a so-called organoid, e.g., a brain tissue organoid. Organoids can be thought of as three-dimensional in vitro-denved tissues but are driven using specific conditions to generate individual, isolated tissues. Without wishing to be bound by theory, the RNA editing through human ADAR2 for example is thought to take place on primary transcripts in the nucleus, during transcription or splicing, or in the cytoplasm, where e.g., mature mRNA, miRNA or ncRNA can be edited. Generally spoken, RNA editing may be used to create RNA sequences with different properties. Such properties may be coding properties (creating proteins with different sequences or length, leading to altered protein properties or functions), or binding properties (causing inhibition or over-expression of the RNA itself or a target or binding partner; entire expression pathways may be altered by recoding miRNAs or their cognate sequences on target RNAs). Protein function or localization may be changed at will, by functional domains or recognition motifs, including but not limited to signal sequences, targeting or localization signals, recognition sites for proteolytic cleavage or co- or post-translational modification, catalytic sites of enzymes, binding sites for binding partners, signals for degradation or activation and so on. These and other forms of RNA and protein “engineering”, whether to prevent, delay or treat disease or for any other purpose, in medicine or biotechnology, as diagnostic, prophylactic, therapeutic, research tool or otherwise, are encompassed by the present disclosure. The amount of AON to be administered, the dosage and the dosing regimen can vary from cell type to cell type, the disease to be treated, age, weight, gender, the target population, the mode of administration {e.g., systemic versus local), the severity of disease, and in the current case by the number of CAG repeats in the HTT gene, and the acceptable level of side activity, but these can and should be assessed by trial and error during in vitro research, in pre-clinical and clinical trials. The trials are particularly straightforward when the modified sequence leads to an easily detected phenotypic change, or a change in (the level of, or activity of) a specified biomarker. It is possible that higher doses of AONs could compete for binding to an ADAR enzyme within a cell, thereby depleting the amount of the enzyme, which is free to take part in RNA editing, but routine dosing trials will reveal any such effects for a given AON and a given target. One suitable trial technique involves delivering the AON to cell lines, or a test organism and then taking biopsy samples at various time points thereafter. The sequence of the target RNA can be assessed in the biopsy sample and the proportion of cells having the modification can easily be followed. A method as disclosed herein can include a step of identifying the presence of the desired change in the cell’s target RNA sequence, thereby verifying that the target RNA sequence has been modified. This step will typically involve sequencing of the relevant part of the target RNA, or a cDNA copy thereof (or a cDNA copy of a splicing product thereof, in case the target RNA is a pre-mRNA), as discussed above, and the sequence change can thus be easily verified. Alternatively, as indicated above, the change may be assessed on the function of the protein before, during, and / or after treatment or assessing any other potential marker, which measurements are preferably performed in vitro on samples obtained from the treated subject. After RNA editing has occurred in a cell, the modified RNA can become diluted over time, for example due to cell division, limited half-life of the edited RNAs, etc. Thus, in practical therapeutic terms a method as disclosed herein may involve repeated delivery of an AON until enough target RNAs have been modified to provide a tangible benefit to the patient and / or to maintain the benefits over time. AONs as disclosed herein are particularly suitable for therapeutic use, and so disclosed is also a pharmaceutical composition comprising an AON as disclosed herein and a pharmaceutically acceptable carrier, solvent, or diluent. In some embodiments the pharmaceutically acceptable carrier can simply be a saline solution. This can usefully be isotonic or hypotonic, particularly for pulmonary delivery. The AON as disclosed herein is suitably administrated in aqueous solution, e.g. saline, or in suspension, optionally comprising additives, excipients and other ingredients, compatible with pharmaceutical use, at concentrations ranging from 1 ng / ml to 1 g / ml, preferably from 10 ng / ml to 500 mg / ml, more preferably from 100 ng / ml to 100 mg / ml. Dosage may suitably range from between about 1 pg / kg to about 100 mg / kg, preferably from about 10 pg / kg to about 10 mg / kg, more preferably from about 100 pg / kg to about 1 mg / kg. As outlined above, the AONs of the present disclosure may also be delivered through a delivery vehicle such as an LNP. Amounts of LNP carrying AONs as disclosed herein can and will also be determined in (pre-) clinical phases. Administration may be by injection or infusion, intracranially, intrathecally, intranasally, orally, intravenously, subcutaneously, intradermally, intramuscularly, intra-tracheally, intraperitoneally, intrarectally, intra-cisterna magna, parenterally, and the like. Administration may be in solid form, in the form of a powder, a pill, a gel, a solution, a slow-release formulation, or in any other form compatible with pharmaceutical use in humans. In one embodiment, depending on the ultimate deamination effect of A-to-l conversion, the identification step of whether the editing has taken place, comprises the following steps: sequencing the target RNA; assessing the presence or absence of a non-, or less-functional protein; assessing whether splicing of the pre-mRNA was altered by the deamination; assessing the concentration and / or presence / absence of a biomarker; or using a functional read-out. A functional assessment will generally be according to methods known to the skilled person. A suitable manner to identify the presence of an inosine after deamination of the target adenosine is of course dPCR or even sequencing, using methods that are well-known to the person skilled in the art. However, the person skilled in the art of diseases such as HD will preferably apply tests to determine the rate of N-terminal peptide accumulation in striatum cells due to the presence of CAG repeats in the human HTT gene, before and after administering an AON as disclosed herein. In one embodiment, a method as disclosed herein comprises the steps of administering to the subject an AON, a nanoparticle delivery vehicle formulation as disclosed herein, or a pharmaceutical composition as disclosed herein, allowing the formation of a double stranded nucleic acid complex of the AON with its specific complementary target nucleic acid molecule in a cell in the subject; allowing the engagement of an endogenous present adenosine deaminating enzyme, such as ADAR 1 or ADAR2; and allowing the enzyme to deaminate the target adenosine in the target nucleic target molecule to an inosine, thereby alleviating, treating, ameliorating, or slowing down progression of HD. RNA editing molecules present in the cell will usually be proteinaceous in nature, such as the ADAR enzymes found in metazoans, including mammals. The ones of most interest are the human ADARs, hADARI and hADAR2, including any isoforms thereof. RNA editing enzymes known in the art, for which oligonucleotide constructs as disclosed herein may conveniently be designed, include the adenosine deaminases acting on RNA (ADARs), such as hADARI and hADAR2 in humans or human cells and cytidine deaminases. It is known that hADARI exists in two isoforms; a long 150 kDa interferon inducible version and a shorter, 110 kDa version, that is produced through alternative splicing from a common pre-mRNA. Consequently, the level of the 150 kDa isoform available in the cell may be influenced by interferon, particularly interferon-gamma (IFN-y). hADARI is also inducible by TNF-a. This provides an opportunity to develop combination therapy, whereby IFN-y or TNF-a and AONs as disclosed herein are administered to a patient either as a combination product, or as separate products, either simultaneously or subsequently, in any order. Certain disease conditions may already coincide with increased IFN-y or TNF-a levels in certain tissues of a patient, creating further opportunities to make editing more specific for diseased tissues. It will be understood by a person having ordinary skill in the art that the extent to which the editing entities inside the cell are redirected to other target sites may be regulated by varying the affinity of the first nucleic acid strand for the recognition domain of the editing molecule. An AON as disclosed herein can utilise endogenous cellular pathways and naturally available ADAR enzymes to specifically edit a target adenosine in the target RNA sequence. An AON as disclosed herein is capable of recruiting ADAR and complex with it and then facilitates the deamination of a (single) specific target adenosine nucleotide in a target RNA sequence to which it is bound. In one aspect, only one adenosine is deaminated, but as outlined herein, it is not excluded that two adenosines in a single target transcript molecule are deaminated since the adenosine at position 1715 and 1757 are near one another in the human HTT transcript. An AON as disclosed herein, especially when it is in a naked form, is normally longer than 10 nucleotides, preferably more than 11, 12, 13, 14, 15, 16, still more preferably more 5 than 17 nucleotides. In one aspect the AON as disclosed herein is longer than 20 nucleotides. The AON as disclosed herein is preferably shorter than 100 nucleotides, still more preferably shorter than 60 nucleotides, still more preferably shorter than 50 nucleotides. In a preferred aspect, the AON as disclosed herein comprises 18 to 70 nucleotides, more preferably comprises 18 to 60 nucleotides, and even more preferably comprises 18 to 50 nucleotides, 10 depending also on whether a single adenosine or two adenosines are targeted. Hence, in a particularly preferred aspect, the AON as disclosed herein comprises 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,62, 63, 64, 65, 66, 67, 68, 69, or 70 nucleotides. EXAMPLES Example 1. RNA editing of the human HTT transcript using a variety of AONs. An initial set of 960 AONs (SEQ ID NO: 1-960) was designed to target the adenosine in the GAU codon encoding aspartic acid at position 572 in the human HTT protein (Fig. 1B). Also, an initial set of 960 AONs (SEQ ID NO:961-1920) was designed to target the adenosine in the GAC codon encoding aspartic acid at position 586 in the human HTT protein (Fig. 1C). Part of the human HTT target transcript molecule is provided in Fig. 1A (SEQ ID NO:1921), which displays both target adenosines and their surrounding sequences. For the initial screen of the AONs with SEQ ID NQ:1-960 and SEQ ID NQ:961-1920, the following was performed. On day 0, Primary Human Hepatocytes (PHH’s; 5.0x104 cells / well) were transfected with 100 nM AONs, in triplicates, using Lipofectamine®RNAiMAX Reagent at the same time of seeding, following the protocol of the manufacturer. The plates containing cells, medium and AON were held at 37°C, 5% CO2, and the medium was refreshed 24 hrs after transfection / plating. On day 3 (72 hrs post transfection / plating) the supernatants were discarded, and subsequent analysis was performed as follows. Cells were collected and used for RNA isolation using a RNeasy 96 Kit (Qiagen-74182) according to the manufacturer’s instructions. Extracted RNA was treated with DNase I (ThermoFisher-EN0521) according to manufacturer’s protocol. Samples were incubated at 37°C for 30 min and then 1 pL 50 mM EDTA was added and further incubated at 60°C for 2 min. The total RNAs were then reverse-transcribed using the Maxima Reverse Transcriptase (Thermo-EP0742) kit with oligo-dT primer, random Hexamer Primer, and dNTP Mix (10 mM each). A quantitative PCR was then performed with the Digital PCR System (Bio-Rad, QX200) in 22 pl aliquots of reaction mixtures containing cDNA, appropriate pairs of primers and ddPCR Supermix for Probes (no dUTP) (Bio-Rad-1863024). The primers given in Table 1 (separate primers and probes for the two targets, as indicated) were used with a PCR program that was as follows: 10 min at 95°C; 40 cycles for 30 sec at 94°C and 60 sec at 63°C, 10 min at 98°C and a hold step at 4°C. Then the plate was placed into the droplet QX200 reader to measure the number of positive droplets. The editing percentage was calculated by pooling the three replicates for each transfection for all A and G counts and then scored according to the formula: score = SUM(G) / (SUM(A+G) * 100. The p-value (p=0.05) represents the probability of 3 treated replicates to be different from the 3 non-treated replicates. For control purposes, total target RNA and total RNA of a reference gene (LAP3) is measured. Editing scores of the AONs are ranked from the highest editing percentage to the lowest. In respect of the D572G target (caspase-1 cleavage site) from the 960 AONs that were tested, 227 AONs scored above 0 % editing. These editing percentages are provided in Table 2. The other 733 AONs (giving 0% editing) are not listed in Table 2. The best scoring AONs were RM116502, RM116493, RM116496, RM116556, RM 116483, RM 116538, RM 116288, RM 115687, RM 116494, RM 116593, RM 116476, RM116554, RM116518, and RM116503. 5 Table 1. Primers and probes for the ddPCR after HTT editing. The “+” symbol represents a Locked Nucleic Acid (LNA) at the 3’ side of the symbol. Primers and probes Sequence (5’-3’) human HTT_D572G FW primer CATCAGCGACAGCTCCCAG (SEQ ID NO:1922) human HTT_D572G REV primer TCCAATCTGCAGGCCCAAAT (SEQ ID NO:1923) HTT_D572G probe target A HEX AGGGC+CT+G+A+TTCAGCTGTTAC (SEQ ID NO:1924) HTT_D572G probe target G FAM AGGGCCT+G+G+TTCAGCTGTTA (SEQ ID NO: 1925) human HTT_D586G FW primer TGATTCAGCTGTTACCCCTTCAG (SEQ ID NO:1926) human HTT_D586G REV primer GGAAGAATACCTGTGGCTTCCT (SEQ ID NO:1927) HTT_D586G probe target A HEX TTGTGTTA+G+A+CGGTACCGACAACC (SEQ ID NO:1928) HTT_D586G probe target G FAM TTGTGTTA+G+G+CGGTACCGACAA (SEQ ID NO:1929) Table 2. Editing percentages of 227 AONs (in a high throughput screen using 960 AONs) that provide D572G editing above 0% in human HTT transcripts in PHH’s, after transfection. RM numbers are given 10 with the editing percentage next to the RM name. RM116502 12,00 RM116492 3,05 RM115967 1,67 RM116493 11,83 RM115761 2,92 RM116405 1,58 RM116496 10,91 RM116418 2,88 RM115971 1,52 RM116556 7,42 RM116561 2,77 RM116544 1,42 RM116483 7,28 RM116017 2,71 RM116422 1,40 RM116538 7,24 RM116231 2,66 RM116378 1,34 RM116288 7,23 RM115693 2,65 RM116560 1,29 RM115687 6,97 RM116511 2,63 RM115857 1,29 RM116494 5,95 RM116590 2,50 RM116566 1,28 RM116593 5,58 RM115788 2,37 RM116430 1,21 RM116476 5,40 RM116419 2,35 RM116564 1,12 RM116554 5,33 RM115968 2,24 RM116353 1,08 RM116518 4,24 RM116184 2,23 RM116557 1,07 RM116503 4,22 RM116116 2,13 RM116464 1,07 RM116179 3,99 RM115694 1,97 RM115945 1,05 RM115686 3,82 RM115958 1,94 RM116540 1,04 RM116484 3,80 RM116523 1,89 RM116604 1,03 RM115889 3,58 RM115952 1,77 RM116030 1,02 RM115685 3,41 RM116490 1,77 RM116504 0,99 RM116510 3,23 RM116586 1,70 RM115703 0,97 RM115939 0,95 RM116548 0,55 RM116442 0,36 RM116232 0,94 RM116316 0,53 RM116286 0,35 RM116546 0,92 RM116048 0,53 RM116364 0,35 RM115696 0,92 RM116040 0,53 RM116481 0,34 RM116338 0,89 RM116191 0,53 RM116500 0,34 RM116598 0,89 RM116488 0,52 RM116180 0,34 RM116549 0,87 RM116406 0,52 RM116130 0,34 RM116530 0,86 RM116314 0,49 RM116537 0,34 RM116470 0,84 RM115802 0,49 RM116094 0,33 RM116217 0,83 RM116327 0,49 RM115964 0,33 RM116259 0,83 RM116212 0,49 RM115797 0,32 RM115707 0,81 RM116100 0,48 RM115871 0,32 RM116528 0,79 RM116150 0,48 RM116175 0,32 RM116155 0,79 RM116351 0,47 RM116326 0,31 RM116185 0,77 RM116457 0,47 RM115667 0,31 RM115706 0,77 RM115671 0,46 RM115724 0,31 RM116149 0,77 RM115803 0,46 RM116458 0,30 RM115732 0,77 RM116249 0,45 RM116219 0,30 RM115689 0,76 RM116265 0,45 RM115933 0,30 RM116355 0,75 RM115956 0,45 RM116340 0,30 RM115731 0,74 RM116421 0,45 RM116456 0,30 RM116571 0,73 RM115680 0,45 RM116233 0,30 RM116394 0,73 RM116479 0,45 RM116244 0,29 RM116313 0,71 RM116028 0,45 RM115730 0,29 RM116416 0,71 RM116033 0,44 RM115962 0,29 RM116248 0,70 RM116451 0,44 RM116414 0,29 RM116608 0,67 RM116499 0,44 RM116573 0,29 RM116024 0,67 RM116192 0,41 RM116052 0,28 RM116092 0,67 RM116284 0,41 RM116491 0,28 RM116134 0,66 RM116268 0,41 RM115932 0,28 RM116459 0,65 RM116032 0,40 RM116467 0,28 RM116472 0,64 RM116153 0,39 RM116218 0,28 RM115854 0,63 RM116243 0,39 RM115980 0,28 RM115948 0,59 RM115872 0,39 RM116489 0,28 RM116151 0,59 RM116171 0,38 RM115701 0,28 RM116027 0,59 RM115768 0,38 RM116547 0,28 RM116354 0,58 RM116190 0,38 RM115987 0,27 RM115683 0,56 RM116173 0,37 RM116236 0,26 RM116117 0,55 RM116211 0,36 RM116452 0,26 RM116046 0,55 RM116434 0,36 RM116330 0,25 RM116558 0,25 RM116186 0,22 RM116321 0,13 RM116245 0,25 RM116572 0,21 RM116203 0,13 RM116370 0,24 RM115666 0,21 RM115740 0,11 RM116435 0,24 RM116031 0,20 RM115741 0,11 RM116237 0,24 RM116310 0,20 RM116204 0,09 RM115925 0,24 RM115673 0,20 RM116202 0,09 RM115991 0,24 RM116093 0,19 RM116198 0,08 RM116432 0,24 RM116133 0,19 RM116390 0,24 RM116389 0,19 RM116529 0,24 RM116238 0,18 RM116132 0,23 RM116042 0,18 RM115770 0,23 RM116193 0,18 RM116402 0,23 RM115926 0,17 RM116343 0,23 RM116001 0,16 RM116299 0,23 RM115946 0,16 RM116200 0,22 RM116366 0,14 RM116395 0,22 RM116168 0,14 RM116368 0,22 RM116429 0,14 RM115800 0,22 RM116246 0,13 RM116428 0,22 RM116229 0,13 In respect of the D586G target (caspase-6 cleavage site) from the 960 AONs that were tested, 43 AONs scored above 0 % editing. These editing percentages are provided in Table 3. The other 917 AONs (giving 0% editing) are not listed in Table 3. The best scoring AONs 5 were RM111745, RM111703, RM111794, RM111691, RM111594, RM111696, and RM111024. Table 3. Editing percentages of 43 AONs (in a high throughput screen using 960 AONs) that provide D586G editing above 0% in human HTT transcripts in PHH’s, after transfection. RM numbers are given 10 with the editing percentage next to the RM name. RM111745 7,81 RM111672 0,26 RM111776 0,12 RM111703 3,23 RM111610 0,24 RM111065 0,12 RM111794 2,05 RM111349 0,24 RM111064 0,11 RM111691 1,96 RM111328 0,23 RM111778 0,11 RM111594 1,21 RM111241 0,23 RM111282 0,11 RM111696 1,15 RM111492 0,21 RM111785 0,10 RM111024 1,03 RM111735 0,21 RM111218 0,10 RM111792 0,56 RM111734 0,21 RM111077 0,10 RM111429 0,51 RM111752 0,20 RM111507 0,09 RM111340 0,42 RM111692 0,18 RM110978 0,08 RM111572 0,42 RM111787 0,16 RM110967 0,08 RM111744 0,31 RM111345 0,14 RM110977 0,08 RM111728 0,29 RM111411 0,13 RM111444 0,07 RM111320 0,26 RM111488 0,13 | RM111689     Q,26   | RM111244     043   || Example 2. RNA editing of the human HTT transcript in primary human hepatocytes and forebrain neurons using a variety of AONs. Subsequently, a new set of AONs was designed, see SEQ ID NO:1930 to 1953 in Fig. 2. RM 120560 to RM 120565 (SEQ ID NO: 1930 to 1935, respectively) were designed to target the adenosine in the GAU codon encoding aspartic acid at position 572 in the human HTT protein. RM120566 to RM120583 (SEQ ID NO:1936 to 1953, respectively) were designed to target the adenosine in the GAC codon encoding aspartic acid at position 586 in the human HTT protein. The AONs were tested in both PHH’s and iPSC-derived forebrain neurons. On day 0, PHH’s) 5.0x104 cells / well for 96 wells plate or 35x104 cells / well for 24 wells plate) were seeded. On day 1, cells were transfected with 100 nM AONs, in duplicate or triplicate, using Lipofectamine® RNAiMAX Reagent, following the protocol of the manufacturer. The plates containing cells, medium and AON were held at 37°C, 5% CO2, and the medium was refreshed 24 hrs after transfection / plating. On day 2 (48 hrs post transfection / plating) the supernatants were discarded, and subsequent analysis was performed as follows. Cells were collected and used for RNA isolation using a ReliaPrep RNA Cell Miniprep kit (Promega-Z6012) according to the manufacturer’s instructions. Isolated RNA was then reverse-transcribed using the Maxima Reverse Transcriptase (Thermo-EP0742) kit with oligo-dT primer, and / or random Hexamer Primer, and dNTP Mix (10 mM each). A quantitative PCR was then performed with the QIAcuity Digital PCR System (QIAGEN, QIAcuity Four)) in 12 pl aliquots of reaction mixtures containing cDNA, appropriate pairs of primers and probes, as well as the dPCR 4x Mastermix of the QIAcuity Probe PCR kit (QIAGEN- 250102). The primers given in Table 1 and Table 4 (separate primers and probes for each target, as indicated) were used with a PCR program that was as follows: 2 min at 95°C; 40 cycles for 15 sec at95°C and 30 sec at 61-63°C. The plate was placed in the system where partitioning PCR and imaging is performed automatically. Thereafter the copy / pL values were retrieved from the instrument. The editing percentage was calculated per replicate according to the formula: score = SUM(G) / (SUM(A+G) * 100. The p-value (p=0.05) represents the probability of 3 treated replicates to be different from the 3 non-treated replicates. For control purposes, total target RNA and total RNA of a reference gene (LAP3) is measured. The editing percentage results in PHH cells with the indicated AONs using the 100nM transfections are shown in Fig. 3A for the D572G target and Fig. 3B for the D586G target. Editing up to 7% was obtained for the D572G target in PHH cells, in which RM 120563 (SEQ ID NO: 1933) performed best. In respect of the D586G target (caspase-6 cleavage site), editing up to 6% was obtained in which RM120575 (SEQ ID NO: 1945) performed best. Additionally, the following procedure was performed for the follow up screen in iPSC-derived forebrain neurons. Differentiated neurons were treated gymnotically on day 0 with 5 pM of indicated AONs (n=1). During differentiation and treatment, the plates containing cells, medium (and AON) were held at 37°C, 5% CO2. After AON addition, a washout regimen wat applied exchanging half of the media every 2-3 days during a timeframe of 14 days. On day 14 the supernatants were discarded, and cells were harvested. RNA was isolated employing the mirVana kit (Thermo Fisher Scientific AM 1560) according to the manufacturer’s instructions. Isolated RNA was then reverse-transcribed using the Maxima Reverse Transcriptase (Thermo-EP0742) kit with oligo-dT primer, and / or random Hexamer Primer, and dNTP Mix (10 mM each). A quantitative PCR was then performed with the QIAcuity Digital PCR System (QIAGEN, QIAcuity Four)) in 12 pl aliquots of reaction mixtures containing cDNA, appropriate pairs of primers and probes, as well as the dPCR 4x Mastermix of the QIAcuity Probe PCR kit (QIAGEN- 250102). The primers given in Table 1 and Table 4 (separate primers and probes for each target, as indicated) were used with a PCR program that was as follows: 2 min at 95°C; 40 cycles for 15 sec at 95°C and 30 sec at 61-63°C. The plate was placed in the system where partitioning PCR and imaging is performed automatically. Thereafter the copy / pL values were retrieved from the instrument. The editing percentage was calculated per replicate according to the formula: score = SUM(G) / (SUM(A+G) * 100. The editing percentage results in the iPSC-derived forebrain neuron cells with the indicated AONs using gymnotic uptake with a concentration of 5pM AON are shown in Fig. 4A for the D572G target and Fig. 4B for the D586G target. Editing up to 2% was obtained for the D572G target in the neuron cells, in which RM 120563 (SEQ ID NO: 1933) performed best. In respect of the D586G target (caspase-6 cleavage site), editing up to 1% was obtained in which RM 120575 (SEQ ID NO: 1945) and RM 120577 (SEQ ID NO: 1947) performed best. Table 4. Primers and probes forthe ddPCR after HTT editing. SEQ ID NO’s are given between brackets. The “+” symbol represents a Locked Nucleic Acid (LNA) at the 3’ side of the symbol. Primers and probes Sequence (5’-3’) Human HTT_eO3_Fw primer AGGATGGTGGCTGACGAATG (SEQ ID NO:1954) Human HTT_eO5_Rv primer Al I I LI GAGGCCGAACCAGG (SEQ ID NO:1955) Human HTT probe e04-05_TEX AAA+GAATGGTGCCCCTCG+GAG (SEQ ID NO:1956) Human ACTB_e06_Fw primer AGTCCTCTCCCAAGTCCACA (SEQ ID NO: 1957) Human ACTB_e06_Rv primer GGCACGAAGGCTCATCATTC (SEQ ID NO:1958) ACTB_eO6_G_FAM probe AGGTGA+T+G+GCATTGCTTTCGT (SEQ ID NO:1959) ACTB_eO6_A_HEX probe AG+GTGA+T+A+GCATTGCTTTCGTGT (SEQ ID NQ:1960) Human LAP3_e03_Fw primer CACCTCTGAAGGCAGGGAAG (SEQ ID NO:1961) Human LAP3_eO4_Rv primer TCCTGTTCGTCGATTCCAGC (SEQ ID NO: 1962) Human LAP3_e03-04_Cy5 probe TCTGCA+TCAGGA+CTTCCCCAG (SEQ ID NO: 1963) Example 3. In silico 2D-structure predictions for optimized AON designs. In addition to AONs that show experimentally verified editing activity, as shown in example 1 and 2, several other AONs were designed in silico. These were selected to largely retain characteristics of the best performing AONs (see above) such as the predicted affinity to the target mRNA site (predicted by 2D-structure prediction) and the symmetry of the AON with respect to the Benner’s base. However, they were designed to have a lower potential for intramolecular 2D-structure formation and homodimerization. It is envisioned that AONs with less intramolecular 2D-structure formation penetrate cells more efficiently and facilitate ADAR mediated editing more efficiently. The absence of intramolecular 2D-structure formation is beneficial for: (i) endosomal escape due to more degrees of freedom and reduced local charge density; (ii) lowering the energy barriers that must be overcome to unfold the AON enabling the hybridization with the (pre-)mRNA; and (iii) enhancing the probability of successfully making an initial contact with the target mRNA by complementary nucleotides not involved in intramolecular base pairing. Therefore, all AONs designed in the in silico screening are characterized by a low potential to form intramolecular 2D structure and / or homodimers for a cytosine, a 7-deaza adenosine or a hypoxanthine base 3’ to the Benner’s base at nucleotide position -1. U:G wobble base pairs (II in the AON, G in the mRNA) that were introduced at nucleotide positions -5, -6 or -7 have been shown to increase editing efficiency and or reduce pre-mRNA processing defects such as exon skip for multiple, unrelated targets. The AON designs are based on initial screening results, as described in example 1 and 2, and in silico 2D-structure design. AONs targeting the D572 site (SEQ ID NO:1964 to 2007; see Fig. 5) are characterized by the option to introduce U:G wobble base pairs between the AON and the (pre-) mRNA at all three sites whilst the AONs targeting the D586 site (SEQ ID N0:2008 to 2054, see Fig. 5) allow for the introduction of U:G wobble base pairs at nucleotide positions -5 and -7 in the AON and a G:ll (G in the AON, II in the mRNA) wobble base pair at nucleotide position -6 in the AON. Additionally, wobble base pairs are introduced at nucleotide position -4 and +4 one AON designed for the D586 target site (SEQ ID NO:2026). In the AONs as shown in SEQ ID NO: 1964 to 2054, the orphan nucleotide is a cytidine analog, preferably a deoxynucleotide comprising a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase. The cytosine nucleobase at the -1 position as depicted in those sequences is interchangeable with is a nucleotide analog that can induce a syn-conformation of the guanosine, for example a modified purine nucleobase, more preferably wherein this modified purine nucleobase is selected from the group consisting of: 7-deaza-2’-deoxyadenosine (7- deaza dA); 7-deaza-2’-adenosine (7-deaza A); 7-deaza-2’-deoxy-2’-fluoroadenosine (7-deaza fA); 7-deaza-2’-deoxy-2’-ara-fluoroadenosine; 7-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-deoxyadenosine (3-deaza dA); 3-deaza-2’-adenosine (3-deaza A); 3-deaza-2’-deoxy-2’-fluoroadenosine (3-deaza fA); 3-deaza-2’-deoxy-2’-ara-fluoroadenosine; 3-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3,7-dideaza-2’-deoxyadenosine (3,7-dideaza dA); 3,7-dideaza-2’-adenosine (3,7-dideaza A); 3,7-dideaza-2’-deoxy-2’-fluoroadenosine (3,7-dideaza fA); 3,7-dideaza-2’-deoxy-2’-ara-fluoroadenosine; 3,7-dideaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-O-[2-(methoxy)ethyl] adenosine; 3-deaza-2’-O-[2-methylamino-2-oxoethyl] adenosine; 2’-deoxy-2’-fluoroguanosine; 2’-ara-fluoro guanosine (FANA G); 2’,2’-difluoro guanosine; 2’-deoxyinosine (dl); 2’-OH-inosine (rl); 2’-fluoroinosine (2’-F-l); 2‘-ara-fluoro inosine (FANA I); 2’,2’-difluoro inosine; 5-formylindole-2’-deoxyriboside; 5-formyl-2’-fluoro-2’-deoxyriboside; 5-formylindole-2’-ara-fluoro-2’-deoxyriboside; 5-formylindole-2’,2’-difluoro-2’-deoxyriboside; 5-formylindole-2’-O-methylriboside; 5-formylindole-2’-O-[2-(methoxy)ethyl]riboside;          5-formylindole-2’-O-[2-methylamino-2- oxoethyl]riboside; beta-(4-amidino-1H-imidazol-1-yl) riboside; beta-(4-amidino-1H-imidazol-1-yl) 2’-deoxyriboside; beta-(4-amidino-1H-imidazol-1-yl) 2’-ara-fluoro-2’-deoxyriboside; and beta-(4-amidino-1H-imidazol-1-yl) 2’,2’-difluoro-2’-deoxyriboside. The internucleotide linkages in these AONs are selected from phosphorothioate (PS), phosphonoacetate, phosphorodithioate, methylphosphonate (MP), sulfonylphosphoramidate, PNdmi, or PNms, where the 5’ and / or 3’ terminus of the AONs is a PNdmi or PNms linkage. In one aspect, the linkage at linkage position -2 in the AON is an MP or a PNms linkage. The mono- or di-substitution 2', 3' and / or 5' position of the ribose in these AONs are each independently selected from the group consisting of: -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; -0-, S-, or N-alkyl; -0-, S-, or N-alkenyl; -0-, S-, or N-alkynyl; -0-, S-, or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylamino oxyethoxy; and -dimethylaminoethoxyethoxy. The nucleotides in these AONs can also be deoxynucleotides, for example the orphan nucleotide that is preferably DNA. However, whenever a thymine nucleobase (T) is depicted in the figure and sequence listing, it is not excluded that these nucleotides are exclusively DNA but could also be an uracil nucleobase and therefore RNA with a 2’ modification on the sugar base.

Claims

1. An antisense oligonucleotide (AON) that is capable of forming a double-stranded complex with a region of a target RNA nucleic acid molecule in a human cell, wherein the double-stranded complex binds to an ADAR enzyme that is naturally present in the cell, wherein the region comprises a target adenosine, wherein the nucleotide in the AON that is opposite the target adenosine is the orphan nucleotide, wherein the ADAR enzyme can deaminate the target adenosine into an inosine, wherein the target RNA nucleic acid molecule is a transcript molecule of the human HTT gene that encodes the HTT protein, and wherein the target adenosine is in a codon coding for an aspartic acid within a proteolytic cleavage site of the HTT protein.

2. An AON according to claim 1, wherein the target adenosine is in the GAU codon coding for aspartic acid at position 572 that is part of a caspase-1 proteolytic cleavage site in the HTT protein, or wherein the target adenosine is in the GAC codon coding for aspartic acid at position 586 that is part of a caspase-6 proteolytic cleavage site in the HTT protein.

3. An AON according to claim 1 or 2, wherein the human cell is a brain cell, preferably a cell within the striatum.

4. An AON according to any one of claims 1 to 3, wherein the HTT gene comprises a CAG trinucleotide repeat (TNR) with 36-39 repeats, preferably 40 or more repeats.

5. An AON according to any one of claims 1 to 4, wherein the orphan nucleotide is a deoxycytidine or a deoxyuridine.

6. An AON according to any one of claims 1 to 4, wherein the orphan nucleotide is a cytidine analog, preferably a deoxynucleotide comprising a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase.

7. An AON according to any one of claims 1 to 4, wherein the orphan nucleotide is a deoxynucleotide comprising a uracil nucleobase attached such that it forms an iso-uridine.

8. An AON according to any one of claims 1 to 7, wherein the nucleotide numbering in the AON is such that the orphan nucleotide is number 0 and nucleotides are further positively (+) incremented towards the 5’-end and negatively (-) incremented towards the 3’-end, and the first nucleotide 3’ from the orphan nucleotide (-1) in the AON is positioned opposite a guanosine that is 5’ of the target adenosine in the target sequence, wherein thenucleotide at position -1 is a nucleotide analog that can induce a syn-conformation of the guanosine, preferably a modified purine nucleobase, more preferably wherein this modified purine nucleobase is selected from the group consisting of: 7-deaza-2’-deoxyadenosine (7-deaza dA); 7-deaza-2’-adenosine (7-deaza A); 7-deaza-2’-deoxy-2’-fluoroadenosine (7-deaza fA); 7-deaza-2’-deoxy-2’-ara-fluoroadenosine; 7-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-deoxyadenosine (3-deaza dA); 3-deaza-2’-adenosine (3-deaza A); 3-deaza-2’-deoxy-2’-fluoroadenosine (3-deaza fA); 3-deaza-2’-deoxy-2’-ara-fluoroadenosine; 3-deaza-2’-deoxy-2’,2’-difluoroadenosine; 3,7-dideaza-2’-deoxyadenosine (3,7-dideaza dA); 3,7-dideaza-2’-adenosine (3,7-dideaza A); 3,7-dideaza-2’-deoxy-2’-fluoroadenosine (3,7-dideaza fA); 3,7-dideaza-2’-deoxy-2’-ara-fluoroadenosine; 3,7-dideaza-2’-deoxy-2’,2’-difluoroadenosine; 3-deaza-2’-O-[2-(methoxy)ethyl] adenosine; 3-deaza-2’-O-[2-methylamino-2-oxoethyl] adenosine; 2’-deoxy-2’-fluoroguanosine; 2’-ara-fluoro guanosine (FANA G); 2’,2’-difluoro guanosine; 2’-deoxyinosine (dl); 2’-OH-inosine (rl); 2’-fluoroinosine (2’-F-l); 2‘-ara-fluoro inosine (FANA I); 2’,2’-difluoro inosine; 5-formylindole-2’-deoxyriboside; 5-formyl-2’-fluoro-2’-deoxyriboside; 5-formylindole-2’-ara-fluoro-2’-deoxyriboside; 5-formylindole-2’,2’-difluoro-2’-deoxyriboside; 5-formylindole-2’-O-methylriboside; 5-formylindole-2’-O-[2-(methoxy)ethyl]riboside; 5-formylindole-2’-O-[2-methylamino-2-oxoethyl]riboside; beta-(4-amidino-1 / - / -imidazol-1-yl) riboside; beta-(4-amidino-1 / - / -imidazol-1-yl) 2’-deoxyriboside; beta-(4-amidino-1 / - / -imidazol-1-yl) 2’-ara-fluoro-2’-deoxyriboside; and beta-(4-amidino-1 / - / -imidazol-1 -yl) 2’,2’-difluoro-2’-deoxyriboside.

9. An AON according to any one of claims 1 to 8, wherein the AON comprises one or more modifications in the linkage moiety, which is each independently selected from a phosphorothioate (PS), phosphonoacetate, phosphorodithioate, methylphosphonate (MP), sulfonylphosphoramidate, a PNdmi, ora PNms linkage.

10. An AON according to any one of claims 1 to 9, wherein the AON comprises one or more nucleotides comprising a mono- or di-substitution at the 2', 3' and / or 5' position of the ribose, each independently selected from the group consisting of: -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; -0-, S-, or N-alkyl; -0-, S-, or N-alkenyl; -0-, S-, or N-alkynyl; -0-, S-, or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylamino oxyethoxy; and -dimethylaminoethoxyethoxy.

11. An AON according claim 2, wherein the target adenosine is in the GAU codon coding for aspartic acid at position 572 that is part of a caspase-1 proteolytic cleavage site in the HTT protein, wherein the AON is selected from the group consisting of SEQ ID NO:1 to 960, 1930 to 1935, and 1964 to 2007, preferably from the group consisting of SEQ ID NO:1932, 1933, and 1934.

12. An AON according claim 2, wherein the target adenosine is in the GAC codon coding for aspartic acid at position 586 that is part of a caspase-6 proteolytic cleavage site in the HTT protein, wherein the AON is selected from the group consisting of SEQ ID NO:961 to 1920, 1936 to 1953, and 2008 to 2054, preferably from the group consisting of SEQ ID NO: 1942, 1945, and 1947.

13. An AON according to claim 11 or 12, wherein the orphan nucleotide is replaced by a deoxynucleotide carrying: a cytosine, a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase, or an uracil nucleobase.

14. An AON according to any one of claims 11 to 13, wherein the nucleotide at the -1 position in the AON is replaced by a nucleotide analog that can induce a syn-conformation of the opposite guanosine.

15. A nanoparticle delivery vehicle formulation comprising an AON according to any one of claims 1 to 14.

16. A nanoparticle delivery vehicle formulation according to claim 15, wherein the nanoparticle delivery vehicle is a Lipid Nanoparticle (LNP).

17. A pharmaceutical composition comprising an AON according to any one of claims 1 to 14, or a nanoparticle delivery vehicle formulation according to claim 15 or 16, and a pharmaceutically acceptable carrier.

18. An AON according to any one of claims 1 to 14, for use in the treatment of Huntington’s Disease (HD).

19. Use of an AON according to any one of claims 1 to 14 in the manufacture of a medicament for the treatment of HD.

20. An in vitro, ex vivo, or in vivo method of editing a human HTT transcript molecule in a cell, the method comprising contacting the HTT transcript molecule, or a part thereof, with an AON according to any one of claims 1 to 14, thereby allowing the formation of a doublestranded complex of the AON with the HTT transcript molecule, thereby enabling the recruitment of an ADAR1 or ADAR2 deamination enzyme that binds to the doublestranded complex, and therethrough allowing the specific editing of a target adenosine in the HTT transcript molecule, by the deamination enzyme, into an inosine, wherein the target adenosine is in the GAU codon coding for aspartic acid at position 572 of the caspase-1 proteolytic cleavage site, and / or in the GAC codon coding for aspartic acid at position 586 of the caspase-6 proteolytic cleavage site, in the human HTT protein.

21. A method of treating, preventing, slowing down, or ameliorating HD in a patient in need thereof, the method comprising contacting a HTTtranscript molecule in a cell of the subject with an AON according to any one of claims 1 to 14, thereby treating the patient.

22. A method of treating, preventing, slowing down, or ameliorating HD in a patient in need thereof, the method comprising administering to said patient an AON according to any one of claims 1 to 14, wherein said administration is by intrathecal (IT) or intracerebroventricular (ICV) injection, allowing the AON to hybridize to a HTT transcript molecule in a brain cell of the subject, preferably a brain cell in the striatum, thereby allowing the production of a HTT protein with a diminished ability to be cleaved by caspase 1 and / or caspase 6, thereby treating the patient.

23. A method for the deamination of a target adenosine in a human HTT transcript molecule in a cell, wherein the target adenosine is in the GAU codon coding for aspartic acid at position 572 of the caspase-1 proteolytic cleavage site, and / or in the GAC codon coding for aspartic acid at position 586 of the caspase-6 proteolytic cleavage site, in the human HTT protein, the method comprising the steps of:(i) providing the cell with an AON according to any one of claims 1 to 14;(ii) allowing uptake of the AON by the cell;(iii) allowing annealing of the AON to the HTT transcript molecule;(iv) allowing an ADAR enzyme that is naturally present in the cell to deaminate the target adenosine in the HTT transcript molecule to an inosine; and optionally(v) identifying the presence of the inosine in the target RNA molecule.