Molecular marker for detection, quantification, and monitoring of the presence of Oreochromis niloticus in aquatic environments.

Description

1 / 19 Molecular marker for detection, quantification and monitoring of the presence of Oreochromis niloticus in aquatic environments. TECHNOLOGICAL SECTOR OF THE INVENTION

[001] In general, the present invention relates to a set of primers and probes for specific DNA replication using the TaqMan system, applicable in environmental DNA techniques for the qualitative and quantitative monitoring of the ichthyological species Oreochromis niloticus (Nile tilapia) in limnic environments. STATE OF THE ART

[002] Monitoring of limnic aquatic species, including fish, amphibians, mollusks, and other invertebrates, is essential in various freshwater environments, such as rivers, lakes, swamps, and reservoirs. This monitoring has varied objectives, such as the preparation of Environmental Impact Assessments (EIAs), the conservation of threatened species, the evaluation of environmental health indicators, the quantification of natural resource stocks, the identification and control of invasive alien species, as well as the carrying out of general scientific studies.

[003] Currently, many monitoring efforts still utilize traditional techniques, primarily based on capturing individuals using nets, longline fishing, electrofishing, traps, and other methods, to determine the species present in an environment and their abundances. Although widely used, these techniques often have limitations, as the captured species may not represent the entirety of the local biodiversity and do not provide conclusive information about the population size of each species in the environment. Petition 870240109079, dated 12 / 20 / 2024, page 11 / 51 2 / 19

[004] Another drawback of traditional monitoring techniques is the requirement for highly trained professionals to identify individuals, which often cannot be done in the field. As a result, captured specimens need to be killed for laboratory identification. This factor is especially impactful in studies involving threatened species, as it removes individuals from already declining populations from the environment. Furthermore, capture methods are generalist, resulting in the accidental capture of other species that are not the target of monitoring (bycatch), often leading to the death of these individuals.

[005] These, among other reasons, have encouraged the development of new, less invasive monitoring techniques that, at the same time, can provide more accurate answers without increasing the effective costs. In recent years, techniques associated with an approach called Environmental DNA (eDNA) have proven to be a new alternative for carrying out monitoring, seeking to meet the requirements mentioned above.

[006] Environmental DNA is based on the idea that all organisms release fragments of DNA into their environment through processes such as excretion, skin, feces, and the decomposition of their bodies. These DNA fragments can be collected from water, soil, or other surfaces, allowing the detection of the presence of different species without the need to capture them directly.

[007] For example, in an aquatic environment, such as a lake or river, fish, amphibians, and other organisms continuously release small amounts of DNA into the water. By collecting a water sample and analyzing this DNA, it is possible to identify which species are present in the environment, even if they are not visible or easily captured. This technique offers a Petition 870240109079, dated 12 / 20 / 2024, page 12 / 51 3 / 19 a less invasive and potentially more accurate way to monitor biodiversity and the presence of specific species, without disturbing natural ecosystems.

[008] One point to highlight is that environmental DNA analysis can be performed using different techniques, depending on the study objectives. These techniques can be directed towards the identification of multiple species or taxa, as well as the identification of a specific species. For the identification of multiple species, techniques such as metabarcoding, which uses universal DNA sequences and high-throughput analyses, can be employed. For the detection of a specific species, methodologies such as conventional PCR, qPCR, and digital droplet PCR can be used, allowing for the amplification and quantification of target DNA. Among these, qPCR with the TaqMan system stands out for its high sensitivity and specificity.

[009] qPCR with the TaqMan system uses fluorophore-labeled DNA probes, which are designed to bind specifically to the target DNA sequence. During PCR amplification, the probe is degraded by the exonuclease activity of Taq polymerase, separating the fluorophore from the quencher and generating a fluorescent signal. The equipment used for the reaction is equipped with sensitive fluorescence detectors, capable of monitoring this signal in real time, allowing for precise quantification of the amount of DNA present in the sample. The high sensitivity and specificity of the TaqMan system make it a powerful tool for detecting environmental DNA, providing fast and reliable results for monitoring specific species.

[0010] Using a qPCR approach, several valuable pieces of information can be obtained from an environmental sample. Firstly, it is possible to determine the presence or absence of specific species, Petition 870240109079, dated 12 / 20 / 2024, page 13 / 51 4 / 19 assisting in the detection of rare or invasive species. Furthermore, qPCR allows for the quantification of a species' relative abundance, providing data on the biomass present in the environment. This technique can also be used to monitor temporal changes in species populations, detecting seasonal variations or impacts of human activities. In addition, qPCR can identify the spatial dispersal of species, revealing distribution patterns and identifying critical habitats.

[0011] The use of environmental DNA techniques to monitor invasive species has proven particularly effective. Invasive species can cause serious ecological impacts by competing with native species for resources, altering habitats, and introducing new diseases. A notable example is the Nile tilapia (Oreochromis niloticus), a fish introduced into bodies of water around the world due to its popularity in aquaculture. Although not fully proven, it is widely accepted that Nile tilapia may have a high invasive potential (Canonico et al. 2005, Britton and Orsi 2012), potentially destabilizing natural aquatic ecosystems by competing with native species for food and habitat, preying directly on them, and altering the structure of aquatic communities (Rahel 2002, Gozlan et al. 2010, Rocha et al. 2023).Furthermore, Nile tilapia has a high capacity for adaptation to different environmental conditions, which contributes to its wide global distribution (Attayde et al. 2011). This species has been found not only in freshwater environments but also in coastal marine waters, demonstrating its adaptability to diverse environmental conditions.

[0012] Some studies have already reported the use of environmental DNA for monitoring Nile tilapia. Keskin (2014) describes a study that used eDNA and conventional PCR with a multiple-tube approach to detect invasive species, including Nile tilapia, in fifteen locations in the Basin. Petition 870240109079, dated 12 / 20 / 2024, page 14 / 51 5 / 19 Superior Sakarya. Using generalist primers and metabarcoding approaches, other studies have also identified the presence of Nile tilapia in environments through environmental samples (Chen et al. 2021, Wibowo et al. 2023).

[0013] Patent document CN116287290A - FLUORESCENT Quantitative PCR Method for Identifying Tilapia Source Component in Fish Meal presents a method that uses fluorescent qPCR to identify components of Nile tilapia origin in fishmeal used in animal feed. High-quality fishmeal is typically made from marine fish caught at sea. Among adulterants, tilapia powder produced using tilapia offal as raw material is common. To achieve the above objective, the invention provides a primer combination for quantitatively identifying tilapia-derived components by fluorescence, comprising an upstream primer with a nucleotide sequence shown as SEQ ID NO. 1 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 2.The primer group is used to perform fluorescent qPCR amplification on the DNA of the fishmeal to be detected, and the content of tilapia-derived components in the fishmeal to be detected is judged according to a quantitative fluorescent detection curve. As can be observed, this publication is not aimed at monitoring limnic environments, as is the case with the present patent; furthermore, it does not use the TaqMan system, nor primers and probes specifically designed for the Cytochrome Oxidase Subunit I (COI) gene of Nile tilapia.

[0014] Patent document KR20170000866A - PROBE FOR IDENTIFYING SEA BREAM SPECIES AND TILAPIA SPECIES AND IDENTIFYING METHOD USING THE SAME presents a method that uses Petition 870240109079, dated 12 / 20 / 2024, p. 15 / 51 6 / 19 A probe for identifying species of gilthead seabream and tilapia that are morphologically indistinguishable from each other by molecular biology. It refers to a method for preparing a hybridoma, comprising mixing a PNA probe and a primer with a target nucleic acid from a sample to hybridize the PNA probe with a target nucleic acid, melting the hybridized product at varying temperatures to obtain a melting curve. A method is provided for detecting species-discriminating SNPs in a portion of COI (Cytochrome Oxidase I) of gilthead seabream and tilapia through the step of detecting the presence or absence of base mutations in the target nucleic acid. Again, the objective is not the monitoring of limnic environments.

[0015] Patent document CN111485028A - FLUORESCENT This document, titled "QUANTITATIVE PCR METHOD FOR DETECTING TILAPIA STREPTOCOCCUS AGALACTIAE AND CORRESPONDING KIT," presents a method for identifying Streptococcus agalactiae using a quantitative fluorescent PCR kit for detecting S. agalactiae. This kit includes primers for detecting the 16S rRNA, SIP, and CFB genes of the specific 16S rRNA gene of S. agalactiae, and a TaqMan probe. The objective is not to monitor the presence of Nile tilapia; therefore, the primers and probes were not developed for this purpose, unlike the current patent.

[0016] As can be seen above, regarding the use of qPCR with TaqMan systems, we see that these have been developed and validated for other invasive fish species, such as African catfish (Clarias gariepinus) (Prabhakaran et al. 2023) and armored catfish (Pterygoplichthys spp.) (Desai et al. 2024). However, the product developed here is the first designed for Nile tilapia based on the TaqMan system. Petition 870240109079, dated 12 / 20 / 2024, page 16 / 51 7 / 19

[0017] Given the high invasive capacity and wide distribution of Nile tilapia, monitoring its presence and dispersal is crucial for the management of aquatic ecosystems and the protection of local biodiversity. qPCR with the TaqMan system is particularly effective for this purpose, using primers and probes specifically designed for the Cytochrome Oxidase Subunit I (COI) gene of Nile tilapia. This methodology allows for the detection and quantification of the presence of Nile tilapia in water samples with high precision, monitoring its dispersal and abundance in different water bodies. Furthermore, qPCR with the TaqMan system can be used to assess the environmental impact of Nile tilapia farming by monitoring the transport of debris and the presence of Nile tilapia DNA in areas adjacent to farming systems. SUMMARY OF THE INVENTION

[0018] This patent application relates to a set of molecular tools developed for the detection, quantification and monitoring of the presence of Oreochromis niloticus (Nile tilapia) in aquatic environments. This set includes primers and specific probes based on the TaqMan system, targeting the Cytochrome Oxidase Subunit I (COI) gene sequence of Nile tilapia mitochondrial DNA.

[0019] The use of the kit for qPCR amplification of aliquots from environmental samples will allow for several practical applications: • Determining the presence / absence of the species: the methodology allows for the precise detection of Nile tilapia in bodies of water, identifying whether the species is present or absent in the analyzed sample; • Quantification of relative biomass: the method allows for the quantification of the relative biomass of Nile tilapia in the environment, which is useful for assessing both the ecological impact Petition 870240109079, dated 12 / 20 / 2024, page 17 / 51 8 / 19 of the species regarding its availability as a fishing resource. This information is essential for the sustainable management of aquatic resources and for decision-making in conservation and management policies; • Assessment of waterways susceptible to invasion: the technique can be used to monitor waterways where there is a possibility of invasion by Nile tilapia, helping to identify risk areas and implement preventive control measures; • Monitoring of fish farm effluents: the system is effective in monitoring the environmental impact of effluent discharges from Nile tilapia fish farms, and can also assess any animal escapes; • Use in scientific research: the tool can be widely used in research involving Nile tilapia, from ecological studies to genetic research, providing accurate and high-quality data.

[0020] The use of the TaqMan system-based kit offers several advantages compared to other monitoring methods and other eDNA analysis techniques. Firstly, the high specificity and sensitivity of the TaqMan system ensure accurate and reliable detection of Nile tilapia, minimizing the occurrence of false positives and negatives, something that can be a challenge with traditional monitoring methods and other eDNA approaches. Furthermore, the real-time quantification capability of qPCR allows for a more detailed and quantitative analysis of the species' presence and abundance in the environment, unlike qualitative methods that Petition 870240109079, dated 12 / 20 / 2024, page 18 / 51 9 / 19 only indicates presence or absence. The speed and efficiency of the TaqMan system are also superior, providing rapid results that are essential for timely decision-making in natural resource management and conservation. Finally, the technique is less invasive, reducing the impact on natural ecosystems and allowing for less disruptive data collection compared to traditional capture methods. BRIEF DESCRIPTION OF THE ATTACHED DRAWINGS

[0021] In order for the present invention to be fully understood and put into practice by any technician in a compatible technological sector, it is described in a clear, concise and sufficient manner, based on the attached drawings, which illustrate and support it, listed below: Figure 1 represents the Melting Curve calculated for the validation of the primers (F and R) and probe designed for the identification of Oreochromis niloticus by real-time PCR. DETAILED DESCRIPTION OF THE INVENTION

[0022] The MOLECULAR MARKER FOR DETECTION, QUANTIFICATION AND MONITORING OF THE PRESENCE OF Oreochromis niloticus IN AQUATIC ENVIRONMENTS presented in this patent of invention, consists of a set of molecular tools developed for the detection, quantification and monitoring of the presence of Oreochromis niloticus (Nile tilapia) in aquatic environments. This set includes specific primers and probes based on the TaqMan system, targeting the Cytochrome Oxidase Subunit I (COI) gene sequence of the Nile tilapia mitochondrial DNA.

[0023] The first step in developing a set of primers and probes for detecting a specific species is to assess the availability of sequences of a given gene for that species and its congeners. Petition 870240109079, dated 12 / 20 / 2024, p. 19 / 51 10 / 19 For the creation of specific primers and probes, it is important that sequences of the gene of interest are available for several species of that genus, or even for species of other genera but from the same family. This alignment allows the design of primers and probes that will amplify only the sequences of the species of interest. To develop the present set, the mitochondrial gene Cytochrome Oxidase Subunit I (COI) was chosen due to the greater availability of sequences for different species in GenBank (https: / / www.ncbi.nlm.nih.gov / genbank / ). COI gene sequences from 27 species, from 5 genera, of fish belonging to the Cichildae family were used, Table 1 below. Specifically from the genus Oreochromis, the sequence from 9 species of Tilapia was used. Family Genus Species - GenBank Sequence Code COI 12S 16S Cichlidae Cichla Cichla kelberi JN988797.1 - DQ779580.1 Cichlidae Crenicichla Crenicichla sp. - - - Cichlidae Crenicichla Crenicichla vitatta KU288979.1 - - Cichlidae Crenicichla Crenicichla acutirostris GU817292.1 - GU817248.1 Cichlidae Crenicichla Crenicichla alta AY263860.1 - AY263837.1 Cichlidae Crenicichla Crenicichla percna MH931612.1 - - Cichlidae Crenicichla Crenicichla jegui MH931615.1 - - Cichlidae Crenicichla Crenicichla caetana MH931627.1 - JF520126.1 Cichlidae Crenicichla Crenicichla regani MH931655.1 KR233977.1 AF049003.1 Cichlidae Crenicichla Crenicichla wallacii MH931656.1 - - Cichlidae Crenicichla Crenicichla lacustrine GU702157.1 - JF520153.1 Cichlidae Crenicichla Crenicichla britskii GU701937.1 - - Cichlidae Crenicichla Crenicichla lepidota HM405098.1 AF285917.1 JF520163.1 Cichlidae Crenicichla Crenicichla menezesi KF938552.1 - - Cichlidae Crenicichla Crenicichla haroldoi JN988829.1 - - Petition 870240109079, dated 12 / 20 / 2024, p. 20 / 51 11 / 19 Family Genus Species Sequence code in GenBank IOC 12S 16S Cichlidae Crenicichla Crenicichla niederleinii - - - Cichlidae Geophagus Geophagus brasiliensis MG825020.1 Cichlidae Geophagus Geophagus proximus GU701786.1 Cichlidae Geophagus Geophagus sveni MH780911.1 Cichlidae Satanoperca Satanoperca pappaterra JN989214.1 Cichlidae Oreochromis Oreochromis niloticus KU565863.1 MN255618.1 MK788803.1 Cichlidae Oreochromis Oreochromis mossambicus KU565826.1 KU821711.1 DQ426661.1 Cichlidae Oreochromis Oreochromis urolepis KM438540.1 - MK788839.1 Cichlidae Oreochromis Oreochromis aureus KU565852.1 EU709731.1 DQ426663.1 Cichlidae Oreochromis Oreochromis schwebischi MK074536.1 - MK788821.1 Cichlidae Oreochromis Oreochromis karongae KM438532.1 - MK788777.1 Cichlidae Oreochromis Oreochromis leucostictus KT193495.1 Cichlidae Oreochromis Oreochromis tanganicae KU194060.1 Cichlidae Oreochromis Oreochromis lepidurus KP027397.1 Table 1 - List of species, including family and genus identification, whose mitochondrial gene sequences (COI, 12S and 16S) were searched in GenBank for alignment.

[0024] Based on the sequence alignment, it was possible to design a set of primers (forward and reverse primers) and a probe that align exclusively with the COI gene of Nile tilapia. Each primer has 22 base pairs and aims to amplify an amplicon of 166 base pairs. The primer and probe sequences are shown in Table 2. Petition 870240109079, dated 12 / 20 / 2024, p. 21 / 51 12 / 19 Primer Sequence Melting Temp. COI UF ACATGAAACCCCCTGCCATCTC 62.61 °C COI UR CCTCCGGCAGGGTCAAAGAAG 62.99 °C Probe TGCCCGTTCTTGCCGCCGGCATCACAA 68.63 °C Table 2 - Sequence of the primers (mitochondrial Cytochrome Oxidase Subunit I gene - COI) and probe designed for detection of the Oreochromis niloticus species by qPCR and their respective melting temperatures.

[0025] The primer and TaqMan probe application method described in the text is based on the real-time PCR (qPCR) technique, widely used for the specific detection and quantification of DNA. The process begins with the preparation of the reaction, which includes DNA extracted from the sample, forward and reverse primers (F and R) designed to amplify a specific 166 base pair region of the COI gene, and the TaqMan probe. This probe is designed to align exclusively with the target sequence and contains a fluorophore at its 5' end (reporter) and a quencher at the 3' end, which inhibits fluorescence emission while the probe remains intact. In addition, the components of the mastermix are added to the reaction, including the Taq polymerase enzyme, free nucleotides (dNTPs), buffer, and magnesium ions. The amplification protocol takes place in a thermocycler capable of measuring fluorescence in real time and follows a series of cyclic steps.Initially, the DNA is heated to separate the strands (denaturation). Then, the temperature is reduced to allow the primers to anneal to complementary regions on the target DNA. Subsequently, at the same temperature, the extension step occurs, where Taq polymerase synthesizes a new DNA strand from the primers. During extension, the polymerase degrades the TaqMan probe that is bound to the target DNA. This degradation separates the fluorophore from the quencher, allowing the fluorophore to emit a fluorescent signal detected by the thermocycler. As PCR cycles are repeated, the increase in the fluorescent signal reflects amplification. Petition 870240109079, dated 12 / 20 / 2024, p. 22 / 51 13 / 19 progressive alignment of the target sequence. The fluorescence intensity is proportional to the initial amount of DNA present in the reaction, allowing for both precise detection and quantification. The specificity of the method is guaranteed by the design of the primers and probe, which align exclusively with the COI gene of Nile tilapia, avoiding the amplification of DNA from other species or non-specific sequences. This specificity is reinforced by the use of sequences from various species during the initial alignment to ensure that the primers and probe are unique to the species of interest. Finally, the fluorescence data are analyzed after the reaction is complete. This allows for the determination of the presence of the target DNA and, when necessary, quantification of its concentration based on a standard curve.The choice of the mitochondrial COI gene for this study proves particularly advantageous due to the high availability of sequences in GenBank, making the assay robust, reliable, and applicable for studies involving species-specific detection.

[0026] Double-stranded DNA is a spiral-shaped molecule that forms alternating large and small pits along its length. During melting curve analysis, the SYBR® Green dye (a fluorescent molecule) used in the reaction binds to the smaller pit of the DNA molecule, emitting light while bound to the DNA molecule. When exposed to high temperatures, double-stranded DNA dissociates into two single strands, losing the pits and causing the dye to detach and cease emitting light. The temperature required to dissociate the molecule varies depending on its composition; that is, each product of the amplification process with a different composition will require a specific temperature for its strands to dissociate. By successively increasing the reaction temperature in the denaturation step in each PCR cycle, the DNA begins to dissociate and the fluorescence decreases. In this way, it is possible to determine the exact temperature. Petition 870240109079, dated 12 / 20 / 2024, page 23 / 51 14 / 19 in which 50% of the molecules are dissociated into a single strand, which is called the melting point, practically unique for each amplicon.

[0027] The marker validation analysis consisted of performing an rtPCR assay. The reaction medium was supplemented with: 1 X of the Mastermix (commercial PCR kit SYBR Green - Qiagen), 1 µM of each primer (F and R), 1 pL of target species DNA extract, and ultrapure water to a final volume of 25 pL. The temperature cycling used was a HotStart activation at 95 °C for 5 minutes, followed by 45 cycles of strip opening at 95 °C for 5 seconds, and combined annealing and extension at 60 °C for 10 seconds. Next, a melting analysis was performed at 40 to 90 °C and the dissociation curve was calculated using Rotor-Gene Q software. Extracts from the target species Oreochromis niloticus, other fish species (Astyanax altiparanae and Pseudoplatystoma corruscans), as well as a negative control using only ultrapure water, were used for comparison purposes.

[0028] After the reaction, the dissociation curve was calculated, in which the decrease in fluorescence as a function of temperature is transformed into the melting curve, identifying the peak temperature of the melting point. The existence of only one peak means that only one temperature produced the dissociation of 50% of the molecules. This indicates that only one amplicon was generated during the PCR and that both the primers and the probe are highly specific.

[0029] After designing the primers (F and R) and the rtPCR labeling probe, a validation step is essential to confirm that the chosen primer sequence is indeed specific, ensuring that the amplified DNA fragment (amplicon) corresponds only to the target region of the target species' DNA. To evaluate the Petition 870240109079, dated 12 / 20 / 2024, page 24 / 51 15 / 19 specificity of the primers (F and R) and the probe used in the assay was performed using a melting curve analysis (HRM - High Resolution Melting).

[0030] After performing the analysis, it was possible to observe, as expected, that the sample containing Nile tilapia DNA extract showed a peak in the melting curve, in contrast to the samples containing DNA from other fish species and the negative control. This result indicates a high efficiency and specificity of the designed primers and probe. Therefore, this set of rtPCR primers can be used for the detection and quantification of the presence of O. niloticus DNA in environmental DNA samples, as shown in Figure 1.

[0031] Although the TaqMan system-based molecular toolkit for Nile tilapia detection, quantification, and monitoring offers several advantages, some disadvantages and limitations should be considered: • Cost and infrastructure requirements: qPCR with the TaqMan system can be more expensive compared to other PCR techniques due to the cost of fluorescent probes and the equipment needed to perform real-time detection. Furthermore, implementing the technique requires laboratories equipped with qPCR thermocyclers, which may not be available in all regions or in institutions with limited resources; • Technical complexity: the use of the TaqMan system and qPCR requires trained and qualified personnel to ensure the accuracy and reliability of the results. Data interpretation also requires specialized knowledge; Petition 870240109079, dated 12 / 20 / 2024, p. 25 / 51 16 / 19 • Sensitivity to inhibitors and degradation of environmental DNA: environmental samples may contain substances that inhibit the qPCR reaction, such as organic matter or heavy metals, leading to false negatives. In addition, environmental DNA (eDNA) can degrade rapidly in the environment, making species detection difficult if samples are not collected and processed properly. Environmental factors such as temperature, pH, and the presence of nucleases influence eDNA stability, making rigorous quality control essential to ensure sample purity; • Limitations in knowledge and development of eDNA techniques: the use of environmental DNA is a relatively new approach, and there is still a need for continuous development of the associated techniques and methodologies. Further research is needed to improve the accuracy, efficiency, and applicability of these techniques in different environments and conditions. Current knowledge about eDNA is still evolving, and methodological limitations may influence the results; • Limitations in absolute quantification: although qPCR allows for the relative quantification of a species' abundance, the absolute quantification of biomass or population can still be challenging due to variability in eDNA release by organisms and environmental conditions; Petition 870240109079, dated 12 / 20 / 2024, page 26 / 51 17 / 19 • False positives and negatives: as with any detection technique, there is a possibility of false positives and negatives. False positives can occur due to cross-contamination, while false negatives can result from low DNA concentration or the presence of inhibitors in the sample.

[0032] It is important to emphasize that the descriptions and Application Forms provided do not limit the forms of execution, modifications, and variations that can be made following the formulations, methodologies, and products of the invention now proposed, but rather illustrate and make understandable the conceptual innovations revealed in this solution. Therefore, the descriptions should be interpreted in an illustrative and non-restrictive manner, and may present variations in the equipment used in the process steps, proportions, dimensions, and other variables, whether of the whole or of its elements individually, provided that their particular characteristics are maintained, and that they are essential to the inventive concept now revealed and do not fall outside the scope of protection outlined in the proposed solution. REFERENCES

[0033] Attayde, J., J. Brasil and R. Menescal (2011). Impacts of introducing Nile tilapia on the fisheries of a tropical reservoir in North-eastern Brazil. Fisheries Management and Ecology 18(6): 437-443.

[0034] Britton, J. R. and M. L. Orsi (2012). Non-native fish in aquaculture and sport fishing in Brazil: economic benefits versus risks to fish diversity in the upper River Paraná Basin. Reviews in Fish Biology and Fisheries 22: 555-565. Petição 870240109079, de 20 / 12 / 2024, pág. 27 / 51 18 / 19

[0035] Canonico, G. C., A. Arthington, J. K. McCrary and M. L. Thieme (2005). The effects of introduced tilapias on native biodiversity. Aquatic Conservation: Marine and Freshwater Ecosystems 15(5): 463-483.

[0036] Chen, J., Z. Chen, S. Liu, W. Guo, D. Li, T. Minamoto and T. Gao (2021). Revealing an Invasion Risk of Fish Species in Qingdao Underwater World by Environmental DNA Metabarcoding. Journal of Ocean University of China 20(1): 124-136.

[0037] Desai, C., Kartikey, S. Mallick, J. K. Sundaray and R. Ghosal (2024). Development and validation of a TaqMan-based qPCR assay for reliable detection of invasive sailfin catfishes ( Pterygoplichthys spp.) through measurements of environmental DNA. Marine and Freshwater Research 75(7).

[0038] Gozlan, R. E., J. Britton, I. Cowx and G. Copp (2010). Current knowledge on non-native freshwater fish introductions. Journal of fish biology 76(4): 751-786.

[0039] Keskin, E. (2014). Detection of invasive freshwater fish species using environmental DNA survey. Biochemical Systematics and Ecology 56: 6874.

[0040] Prabhakaran, G. K., M. Sunkara, R. Raghavan and G. Umapathy (2023). Development of a species-specific qPCR assay for the detection of invasive African sharptooth catfish (Clarias gariepinus) using environmental DNA. Biological Invasions 25(4): 975-982.

[0041] Rahel, F. J. (2002). Homogenization of Freshwater Faunas. Annual Review of Ecology, Evolution, and Systematics 33(Volume 33, 2002): 291-315.

[0042] Rocha, B. S., E. García-Berthou and M. V. Cianciaruso (2023). Non-native fishes in Brazilian freshwaters: identifying biases and gaps in ecological research. Biological Invasions 25(5): 1643-1658. Petição 870240109079, de 20 / 12 / 2024, pág. 28 / 51 19 / 19

[0043] Wibowo, A., K. Kurniawan, D. Atminarso, T. H. Prihadi, L. J. Baumgartner, M. L. Rourke, S. Nagai, N. Hubert and A. Vasemagi (2023). Assessing freshwater fish biodiversity of Kumbe River, Papua (Indonesia) through environmental DNA metabarcoding. Pacific Conservation Biology 29(4): 340-350. Petição 870240109079, de 20 / 12 / 2024, pág. 29 / 51

Claims

1 / 2 CLAIMS 1. MOLECULAR MARKER FOR DETECTION, QUANTIFICATION AND MONITORING OF THE PRESENCE OF Oreochromis niloticus IN AQUATIC ENVIRONMENTS characterized by comprising a set of primers, forward (COI UF) and reverse (COI UR) primers and a probe that align exclusively with the COI gene of Nile tilapia (Oreochromis niloticus), and by each primer having 22 base pairs and amplifying an amplicon of 166 base pairs, and by the forward primer (COI UF) having the sequence ACATGAAACCCCCTGCCATCTC and a melting temperature of 62.61°C, and the reverse primer (COI UR) having the sequence CCTCCGGCAGGGTCAAAGAAG and a melting temperature of 62.99°C and the probe having the sequence TGCCCGTTCTTGCCGCCGGCATCACAA and Melting temperature 68.63°C.

2. MOLECULAR MARKER FOR DETECTION, QUANTIFICATION AND MONITORING OF THE PRESENCE OF Oreochromis niloticus IN AQUATIC ENVIRONMENTS, according to claim 1, characterized by being applied according to the method below: • Prepare the reaction, which includes 1 pL of DNA extracted from the sample, 1 uM of each of the forward and reverse primers (F and R) designed to amplify a specific 166 base pair region of the COI gene, the TaqMan probe, designed to align exclusively with the target sequence and containing a fluorophore at its 5' end (reporter) and a quencher at the 3' end, which inhibits fluorescence emission while the probe remains intact; and ultrapure water to a final volume of 25 pL; Petition 870240109079, dated 12 / 20 / 2024, p.30 / 51 2 / 2 • Include in the reaction the components of the mastermix (commercial PCR kit), including the Taq polymerase enzyme, free nucleotides (dNTPs), buffer, and magnesium ions; • In a thermocycler, start with a HotStart activation at 95 °C for 5 minutes, heat the DNA for 45 cycles at 95 °C for 5 seconds to separate the strands (denaturation); reduce the temperature to 60 °C for 10 seconds to allow the primers to anneale to complementary regions in the target DNA; maintain the temperature at 60 °C for the extension step, where the Taq polymerase synthesizes a new DNA strand from the primers and degrades the TaqMan probe that is bound to the target DNA, separating the fluorophore from the quencher, allowing the fluorophore to emit a fluorescent signal detected by the thermocycler; • Fluorescence data are analyzed after the reaction is complete. Petition 870240109079, dated 12 / 20 / 2024, pp. 31 / 51.

Images