ketoreductase

Abstract

The present invention relates to ketoreductases and uses thereof. The ketoreductases of the present invention are particularly suitable for use in the enzyme-catalyzed reduction of ketones to chiral secondary alcohols.

Description

[0001] Ketoreductases (KREDs, also known as "alcohol dehydrogenases" ADHs, or "carbonyl reductases") catalyze the reduction of aldehydes and ketones to the corresponding primary and secondary alcohols, respectively. These enzymes can also catalyze the reverse reaction, i.e., the oxidation of primary and secondary alcohols to the corresponding aldehydes and ketones, respectively.

[0002] The reduction of ketones to secondary alcohols is of great interest for industrial applications, as prochiral carbonyl compounds are stereoselectively reduced to chiral alcohols. In some industrial applications, the stereoselective conversion of secondary alcohols to ketones for the chiral resolution of racemic compounds is also desired, e.g., to allow the separation of enantiomers. In industrial applications, the enzymatic oxidation of primary alcohols to aldehydes and the enzymatic reduction of aldehydes to primary alcohols are generally considered to be of lower relevance, but can also be catalyzed by KREDs. The use of the same KRED in either the oxidation or the reduction reaction can be influenced by adjusting the chemical equilibrium of the enzymatic reaction.

[0003] The KRED-catalyzed reduction requires a reduced cofactor as electron donor. Some KREDs use reduced nicotinamide adenine dinucleotide (NADH) as cofactor, other KREDs use reduced nicotinamide adenine dinucleotide phosphate (NADPH), and some ketoreductases can use both NADH and NADPH. The KRED-catalyzed oxidation requires a corresponding oxidized cofactor as electron acceptor. For this reaction, KREDs use oxidized nicotinamide adenine dinucleotide (NAD + ) or oxidized nicotinamide adenine dinucleotide phosphate (NADP + ) or both NAD + and NADP + .

[0004] KREDs are ubiquitous enzymes found in all kingdoms of life. Known commercially available KREDs are from horse liver (HLADH), baker's yeast (YADH), and bacteria, such as Thermoanaerobium brockii (TBADH) and Lactobacillus kefir (LKADH).

[0005] Based on their sequence identity and biochemical properties, KREDs can be divided into different protein families. Members of the SDR-family (short-chain-dehydrogenases / reductases) exhibit short-chain enzymes, which do not contain any metal ions. In contrast, members of the MDR-family (medium-chain-dehydrogenases / reductases) exhibit medium-chain enzymes, which depend on Zn 2+ . Another group of KREDs exhibits long-chain enzymes, which depend on Fe 2+ . (For review: K. Drauz, H. O. May, Enzyme Catalysis in Organic Synthesis, Wiley VCH, Weinheim, 2012).

[0006] For industrial applications it is desirable to use KREDs with high specific activity and stereoselectivity. Another important criterion for the industrial use of KREDs is long process stability, which is usually linked to high stability at high temperatures and high solvent stability. If the substrate is already chiral, it is also desirable to use KREDs with high stereodirecting properties.

[0007] Improvements of enzymes can be achieved by enzyme engineering. This technology involves the development of variants of a starting enzyme with improved properties (for review: S. Lutz, U. T. Bornscheuer, Protein Engineering Handbook, Wiley VCH, Weinheim, 2009).

[0008] The in vitro use of KREDs in reduction processes requires a regeneration system for NAD(P)H. Common regeneration systems are glucose dehydrogenase (GDH) or formate dehydrogenase, which are used in combination with KREDs. The cofactor regeneration can also be performed by the KRED itself through the concomitant oxidation of a cosubstrate, usually a primary or secondary alcohol, such as isopropanol to acetone. The concomitant use of KREDs as reduction catalysts with a cofactor regeneration system requires the simultaneous acceptance of a ketone substrate and a cosubstrate for the cofactor regeneration. The choice of the specific cosubstrate can depend on the specific activity of the KRED for this cosubstrate and the stability of the KRED under the specific cofactor regeneration conditions.

[0009] Besides the reversible reduction of aldehydes, there are some reports about ketoreductases catalyzing the oxidation of aldehydes to the corresponding acids. However, this reaction is considered as a side reaction rather than the main reaction (for review: K. Drauz, H. O. May, Enzyme Catalysis in Organic Synthesis, Wiley VCH, Weinheim, 2012).

[0010] Examples for industrial applications of KREDs to produce valuable compounds are the reduction of 1-phenyl-2-propanone by Rhodococcus erythroplis KRED, the reduction of ethyl acetoacetate by Lactobacillus brevis KRED or the reduction of ethyl 6-benzyloxy-3,5-dioxo-hexanoate by a KRED from Acinetobacter calcoaceticus (for review: A. Liese, K. Seelbach, C. Wandrey, Industrial Biotransformations, Wiley VCH, Weinheim, 2006).

[0011] Even though a large number of KREDs for asymmetric reduction of a ketone are described in the literature, only a few KREDs are used in patent processes. Many processes contain a ketoreductase from Lactobacillus kefiranofaciens (LKADH) or variants thereof. US 8,426,178 discloses a process for the stereoselective reduction of N,N-dimethyl-3-keto-3-(2-thienyl)-1- ketopropylamine to (S)-N,N-dimethyl-3-hydroxy-3-(2-thienyl)-1-propanamine by a variant of LKADH. US 8,512,973 describes a process for the stereoselective reduction of 2',6'-substituted acetophenones to the corresponding substituted (S)-1-phenylethanol by a KRED variant from Lactobacillus kefiranofaciens, Lactobacillus brevis or Lactobacillus minor. A process for the stereoselective reduction of 3-ketothiolane to (R)-3-hydroxythiolane by a variant of LKADH is disclosed in US 7,977,078. US 8,617,853 describes a process for the stereoselective reduction of the substrate methyl 2-[3-[3-[2-(7-chloro-2-quinolinyl)ethenyl]phenyl]-3- oxopropyl]benzoate to (S,E)-methyl 2-(3-(3-(2-(7-chloroquinolin-2-yl)ethenyl)phenyl)-3- hydroxypropyl)benzoate by a variant of KRED from Lactobacillus kefiranofaciens, Lactobacillus brevis or Lactobacillus minor. US 8,273,554 discloses a process for the stereoselective reduction of 5-((4S)-2-oxo-4-phenyl(1,3-oxazolidin-3-yl))-1 -(4-fluorophenyl)pentane-1,5- dione to (4S)-3[(5S)-5-(4-fluorophenyl)-5-hydroxypentanoyl]-4-phenyl-1,3-oxazolidin-2- one by a variant of LKADH. A process for the asymmetric reduction of tert-butyl (S)-6-chloro-5- hydroxy-3-oxohexanoate to tert-butyl (3R,5S)-6-chloro-3,5-dihydroxyhexanoate by a ketoreductase from Candida magnolia is described in US 6,645,746. US 7,393,667 discloses the preparation of propan-2-ols, for example 1-[4-(4-halo-2-methyl-1 H-indol-5-yloxy)-5-methyl- pyrrolo[2,1 -f][1,2,4]triazin-6-yloxy]-propan-2-ols by stereoselective reduction of the corresponding oxo compounds using a ketoreductase from Pichia angusta. US 8,288,131 relates to a process for the stereoselective reduction of 2-methylpentanal to (R)-2-methylpentanol by a variant of LKADH.WO 2011 / 022548 discloses a process for the stereoselective conversion of l-(3- hydroxyphenyl)-2-(methylamino)ethanone to (R)-phenylephrine by LKADH variants. WO 2012 / 046254 discloses stereoselective enzyme reduction processes for the preparation of (S) or (R)-3-hydroxy-l-(3-(trifluoromethyl)-5,6-dihydro-[l,2,4]triazolo[4,3- a]pyrazin-7(8H)-yl)-4-(2,4,5-trifluorophenyl)butan-l-one using KREDs from Saccharomyces cerevisiae, Rhodotorula rubra, Pichia methanolica or E. coli. US 8,257,952 discloses LKADH variants capable of stereoselectively reducing methyl-2- benzamidomethyl-3-oxobutanoate to 2R,3R-methyl-2-benzamidomethyl-3-hydroxy- butanoate. US 7,629,157 describes variants of ketoreductases from Pseudozyma lanuginosa capable of stereoselectively converting ethyl 4-chloroacetoacetate to ethyl (S)-4- chloro-3-hydroxybutanoate.

[0012] EP 1 553 170 relates to polypeptides forming (R)-N-benzyl-3-pyrrolidinol, polynucleotides encoding the polypeptides and uses thereof. The polypeptides are said to have the following physical and chemical properties (1)-(4): (1) activity: acting on N-benzyl-3-pyrrolidinone with NADH or NADPH as coenzyme, thereby forming (R)-N-benzyl-3-pyrrolidinol; (2) pH optimum of activity: 5.5-6.0; (3) temperature optimum of activity: 50-55 °C; (4) molecular weight: about 55,000 as measured by gel filtration analysis, about 28,000 as measured by SDS polyacrylamide gel electrophoresis analysis.

[0013] Protein database online, accession number: WP_022887115, relates to a Glaciibacter superstes short-chain dehydrogenase.

[0014] However, the prior art ketoreductases are unsatisfactory in all respects and there is a need for ketoreductases having advantages over conventional ketoreductases, in particular advantages in terms of high process stability and good cofactor reactivity in the industrial production of chiral alcohol compounds, respectively. In this respect, high process stability in industrial applications can include chemical and physical stability and enzymatic activity under aqueous, non-aqueous and / or biphasic systems, and / or at high substrate concentrations and / or at high temperatures and / or in the presence of water-miscible solvents and / or a broad pH range of 4-11 and / or on solid supports (i.e. when immobilized) and / or under high shear forces (e.g. by stirring, suction, membrane filtration preparation). Other factors, such as substrate selectivity, K M , specific activity, stereoselectivity, stereospecificity, diastereoselectivity, regioselectivity, substrate inhibition, product inhibition, other factors such as inhibition by crude extract components, substrate contaminants or byproducts, and recombinant soluble expression capability in suitable hosts can play an important role. When the substrate is a chiral substrate, i.e. already contains one or more chiral centers and / or axes of chirality, it can be desirable that the stereoselectivity of the enzymatic reduction of the prochiral carbonyl group contained in said chiral substrate is essentially not influenced by said one or more chiral centers and / or axes.

[0015] It is an object of the present invention to provide improved ketoreductases.

[0016] The subject matter of the present patent application has solved this problem.

[0017] The present invention provides novel ketoreductases, in particular engineered ketoreductases exhibiting improved properties compared to wild-type enzymes, preferably wild-type ketoreductases of SEQ ID NO: 2.

[0018] A first aspect of the present invention relates to a ketoreductase comprising an amino acid sequence which is at least 72% homologous to the amino acid sequence of SEQ ID NO: 2.

[0019] The ketoreductases of the present invention comprise an amino acid sequence which is a certain homology to the amino acid sequence of SEQ ID NO: 2. This means that the ketoreductases of the present invention can comprise said amino acid sequence as a subsequence of its total amino acid sequence, or the ketoreductases of the present invention can essentially consist of said amino acid sequence. When the ketoreductases of the present invention comprise said amino acid sequence as a subsequence of its total amino acid sequence, said total amino acid sequence can be extended at the N- and / or C-terminus of said subsequence, i.e. can comprise further amino acid residues. Such extensions can be advantageous, for example, when the ketoreductases are immobilized on a solid support, for example for purification purposes.

[0020] In the sense of the present application, the homology is preferably calculated as identity using BLASTP (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402; Stephen F. Altschul, John C. Wootton, E. Michael Gertz, Richa Agarwala, Aleksandr Morgulis, Alejandro A. Schaffer, and Webb Miller (2005) "Using Active Sets for Multiple Alignment", Bioinformatics 21 : 3001-3012; and Yi-Kuo Yu (2005) "Protein database searches using compositionally adjusted substitution matrices." FEBS J. 272:5101-5109), preferably using the BLASTP version 2.2.29+ (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi), preferably using the following settings:

[0021] • Field "Input query sequences": Query sub-range: none

[0022] • Field "Select search set": Database: non-redundant protein sequences (nr); Optional parameters:

[0023] none

[0024] • Field "Program selection": Algorithm: blastp (protein-protein BLAST)

[0025] • Algorithm parameters: Field "General parameters": Max target sequences: 100; Short queries: adjust parameters for short input sequences; Expect threshold: 10; Word size: 3; Max matches in a query range: 0

[0026] • Algorithm parameters: Field "Scoring parameters": Matrix: BLOSUM62; Gap costs: Existence: 11; Extension: 1; Composition adjustment: Conditional compositional score matrix adjustment

[0027] • Algorithm parameters: Field "Filters and masks": Filters: none; Masks: none.​​

[0028] Preferably, the ketoreductase of the application is capable of stereoselectively reducing a ketone substrate to a secondary alcohol and / or capable of stereoselectively oxidizing a secondary alcohol to a ketone product.

[0029] Preferably, the ketoreductase of the application is capable of oxidizing a primary alcohol to an aldehyde and / or capable of reducing an aldehyde to a primary alcohol.

[0030] In some embodiments, the ketoreductase of the application is capable of oxidizing an aldehyde compound to a carboxylic acid.

[0031] Preferably, the ketoreductase comprises an amino acid sequence which is at least 72% homologous to the amino acid sequence of SEQ ID NO: 2, preferably at least 75%, or at least 80%, or at least 82%, or at least 84%, more preferably at least 86%, or at least 88%, still more preferably at least 90%, or at least 91%, still more preferably at least 92%, or at least 93%, even more preferably at least 94%, or at least 95%, most preferably 96%, or at least 97%, in particular at least 98%, or at least 99%.

[0032] It has surprisingly been found that the ketoreductase of the application exhibits:

[0033] - high activity,

[0034] - broad substrate tolerance,

[0035] - high stereoselectivity,

[0036] - high stereospecificity, and / or

[0037] - high stability in various solvents, optionally containing a co-substrate such as isopropanol.

[0038] For the purpose of illustration, stereoselectivity is the property of a chemical reaction in which a single reactant forms an unequal mixture of stereoisomers during the non-stereospecific creation of a new stereocenter or during the non-stereospecific conversion of an already existing stereocenter. Selectivity usually arises from differences in steric and electronic effects in the mechanistic pathways leading to different products. Preferably, the conversion of a substrate to a chiral product under the catalysis of the ketoreductase of the application provides the desired chiral product in an enantiomeric excess of at least 50% ee, more preferably at least 75% ee, still more preferably at least 90% ee, still more preferably at least 95% ee, even more preferably at least 97% ee, most preferably at least 98% ee, in particular at least 99% ee.

[0039] For the purpose of illustration, stereospecificity is the property of a reaction mechanism leading to different stereoisomeric reaction products from different stereoisomeric reactants, or it acts on only one (or a subset) of the stereoisomers. Preferably, the conversion of a chiral substrate to another chiral product under the catalysis of a ketoreductase enzyme of the present application provides the desired chiral product in at least 50% de, more preferably at least 75% de, still more preferably at least 90% de, still more preferably at least 95% de, even more preferably at least 97% de, most preferably at least 98% de, and in particular at least 99% de enantiomeric excess.

[0040] In a preferred embodiment, the ketoreductase enzyme of the present application is preferably capable of stereoselectively reducing a ketone substrate of general formula (I)

[0041]

[0042] or the ketoreductase enzyme of the present application is preferably capable of stereoselectively reducing an aldehyde substrate of general formula (I')

[0043]

[0044] wherein X and Y are each independently selected from a saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic or cycloaliphatic C 1-12 - hydrocarbon residue; an unsubstituted or mono- or poly-substituted C 6-10 - aromatic hydrocarbon residue, optionally bridged by a saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 - hydrocarbon residue; an unsubstituted or mono- or poly-substituted C 1-12 - hydrocarbon residue; and a sugar residue comprising a monosaccharide, disaccharide or oligosaccharide or a deoxy sugar residue comprising a monosaccharide, disaccharide or oligosaccharide;

[0045] wherein mono- or poly-substitution means substitution independently by one or more functional groups selected from -halogen, -OH, =0, -OC 1-12 - alkyl, -OC 6-10 - aryl, -O-heteroaryl, -OCOC 1-12 - alkyl, -OCOC 6-10 - aryl, -OCO-heteroaryl, -SH, -SC 1-12 - alkyl, -SC 6-10 - aryl, -S-heteroaryl, -S(=0) 1-2 OH, -NO, -NO2, -N3, -NH2, -NH(C 1-12 - alkyl), -N(C 1-12 - alkyl), -N(C6-10 -aryl), -N(C 6-10 -aryl), -N(C 1-2 -alkyl, -CO-C 6-10 -aryl and -CO-aryl.

[0046] Preferably, X and Y are each independently selected from unsubstituted or mono- or poly-substituted C 1-12 -alkyl; unsubstituted or mono- or poly-substituted C 6-10 -aryl, optionally bridged with an unsubstituted or mono- or poly-substituted C 1-12 -alkylene residue; unsubstituted or mono- or poly-substituted heteroaryl, optionally bridged with an unsubstituted or mono- or poly-substituted C 1-12 -alkylene residue; and a sugar residue comprising a monosaccharide, disaccharide or oligosaccharide or a deoxy sugar residue comprising a monosaccharide, disaccharide or oligosaccharide;

[0047] wherein mono- or poly-substitution means substitution independently with one or more functional groups selected from -halogen, -OH, =0, -OC 1-12 -alkyl, -OC 6-10 -aryl, -O-heteroaryl, -OCOC 1-12 -alkyl, -OCOC 6-10 -aryl, -OCO-heteroaryl, -SH, -SC 1-12 -alkyl, -SC 6-10 -aryl, -S-heteroaryl, -S(=0) 1-2 OH, -NO, -N02, -N3, -NH2, -NH(C 1-12 -alkyl), -N(C 1-12 -alkyl), -N(C 6-10 -aryl), -N(C 6-10 -aryl), -N(C 1-2 -alkyl, -CO-C 6-10 -aryl and -CO-aryl.

[0048] For the purpose of illustration, stereoselective reduction of a ketone substrate can preferably mean that a ketone reductase exhibits at least some activity on at least one ketone substrate to produce a secondary alcohol in the presence of a suitable co-factor under suitable conditions, preferably in water at pH 7.0 and 30°C.

[0049] For the purpose of illustration, saturated or unsaturated aliphatic C 1-12- hydrocarbon residues include, but are not limited to, alkyl residues, alkenyl residues or alkynyl residues, such as -CH3, -CH2CH3, -CH2CH2CH3, -CH(CH3)2, -CH2CH2CH2CH3, -CH(CH3)CH2CH3, -CH2CH(CH3)2, -C(CH3)3, -CH=CH2, -CH=CHCH=CH2, -C≡CH and -CH=CHC≡CH.

[0050] For the purpose of illustration, saturated or unsaturated alicyclic C 1-12 hydrocarbon residues include, but are not limited to, C 3-12 - cycloalkyl, wherein 1 or 2 carbon ring atoms can optionally be replaced by a heteroatom selected from N, O and S (C 1-12 - heterocycloalkyl).

[0051] For the purpose of illustration, saturated or unsaturated alicyclic C 6-10 - aromatic hydrocarbon residues (= C 6-10 - aryl) include, but are not limited to, phenyl and naphthyl.

[0052] For illustrative purposes, heteroaryl hydrocarbon residues (= heteroaryl) include, but are not limited to, monocyclic, bicyclic, and tricyclic ring systems. Examples of monocyclic heteroaryl groups include, but are not limited to, aziridine, aziridine, diaziridine, 1,3-dioxolane, dioxahexacyclone, dithiaalkyl, furanyl, imidazolyl, imidazolinyl, imidazolyl, isothiazolyl, isothiazolinyl, isothiazolinyl, isoxazolyl, isoxazolinyl, isoxazolinyl, morpholinyl, oxadiazolyl, oxadiazolinyl, oxadiazolinyl, oxazolyl, oxazolinyl, oxazolinyl, oxazolinyl, oxazolinyl, oxazolinyl, oxazolinyl, piperazine. Piperidinyl, pyranyl, pyrazinyl, pyrazolyl, pyrazolinyl, pyrazolylalkyl, pyridinyl, pyrimidinyl, pyridazinyl, pyrroloyl, pyrrololinyl, pyrroloalkyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetraazinyl, tetrazolyl, thiadiazolyl, thiadiazolinyl, thiadiazoalkyl, thiazolyl, thiazolinyl, thiazolyl, thiazolinyl, thiazolinyl, thiophenyl, thiomorpholinyl, 1,1-dioxothiomorpholinyl (thiomorpholinone), thiaranyl, triazinyl, triazolyl, and trithiaalkyl. Examples of bicyclic heteroaryl groups include, but are not limited to, benzimidazolyl, benzothiadiazolyl, benzothiazolyl, benzothiophene, benzotriazolyl, benzoxazolyl, benzofuranyl, benzopyranyl, benzothiaranyl, cyclolinyl, indazole, indolyl, 2,3-dihydroindolyl, inazinyl, naphridinyl, isobenzofuranyl, isobenzothiaphenyl, isoindolyl, isoquinolinyl, phthalazinyl, 4H-pyrido(1,2-a)pyrimidin-4-one, pyranopyridinyl, quinolinyl, quinazinyl, quinoxalinyl, quinazolinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, and thiaranopyridinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, acridinel, carbazolyl, carbaolinyl, dibenzo(b,d)furanyl, dibenzo(b,d)thiophenyl, naphtho(2,3-b)furan, naphtho(2,3-b)thiophenyl, phenazinyl, phenothiazinyl, phenotoxazinyl, thiaanthryl, thioxanyl, and xanthryl.

[0053] For illustrative purposes, alkyl groups (e.g., -C) 1-12 -alkyl), cycloalkyl (e.g., -C) 3-8 -cycloalkyl), aryl (e.g., -C) 6-10 -aryl) and heteroaryl, each having mono- or poly-substituted, preferably independently refers to the substitution of the nucleus hydrogen by one or more functional groups selected from the group consisting of: -halogen (preferably -F, -Cl, -Br, -I), -OH, =O, -OC 1-12 -alkyl, -OC 6-10 -aryl, -O-heteroaryl, -OCOC 1-12 -alkyl, -OCOC 6-10 -aryl, -OCO-heteroaryl, -SH, -SC 1-12 -alkyl, -SC 6-10 -aryl, -S-heteroaryl, -S(=O) 1-2OH, -NO2, -N3, -NH2, -NH(C 1-12 -alkyl), -N(C 1-12 -alkyl)2, -NH(C 6-10 -aryl), -N(C 6-10 -aryl)2, -NH(heteroaryl), -N(heteroaryl)2, -CN, -CHO, -CO2H, CO-C 1-2 -alkyl, -CO-C 6-10 -aryl and -CO-heteroaryl.

[0054] For the purpose of illustration, a sugar residue comprising a monosaccharide, a disaccharide or an oligosaccharide or a deoxy sugar residue comprising a monosaccharide, a disaccharide or an oligosaccharide means that the ketone substrate of general formula (I) or the aldehyde substrate of general formula (I') can be a polyhydroxycarbonyl compound, optionally linked to other polyhydroxycarbonyl compounds via an acetal and / or ketal linkage. For example, when X is a Ci alkyl monosubstituted with -OH and Y is a C2 alkyl polysubstituted with -OH, wherein each carbon atom has a single -OH substituent, the ketone substrate of general formula (I) is an aldotetrose comprising two enantiomers, namely D-erythrulose and L-erythrulose. Similarly, the ketone substrate of general formula (I) can be an aldotetrose or an aldopentose which in turn can be linked to other sugar residues thereby forming a disaccharide or an oligosaccharide. Correspondingly, when X is a C2 alkyl polysubstituted with -OH, wherein each carbon atom has a single -OH substituent, the aldehyde substrate of general formula (I') is an aldotriose comprising two enantiomers, namely D-glyceraldehyde and L-glyceraldehyde. Similarly, the aldehyde substrate of general formula (I') can be an aldotetrose, an aldopentose or an aldohexose which in turn can be linked to other sugar residues thereby forming a disaccharide or an oligosaccharide.

[0055] In a preferred embodiment, the ketoreductase of the present application is capable of selectively reducing a ketone substrate selected from the group consisting of:

[0056] (i) a 3-aryl-3-ketopropylamine-derivative according to general formula (II)

[0057]

[0058] wherein

[0059] R1and R2are each independently selected from the group consisting of -H; unsubstituted or monosubstituted or polysubstituted -C 1-12 -alkyl; unsubstituted or monosubstituted or polysubstituted -C 3-8 -cycloalkyl; unsubstituted or monosubstituted or polysubstituted -C 6-10 -aryl, optionally via a saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic C 1-12- a hydrocarbon residue bridge; or an unsubstituted or mono- or poly-substituted heteroaryl group, optionally via a saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 - a hydrocarbon residue bridge; or, alternatively, wherein

[0060] R1and R2together with the nitrogen atom to which they are attached form an unsubstituted or mono- or poly-substituted C 2-8 - a heterocycloalkyl ring or an unsubstituted or mono- or poly-substituted heteroaryl ring;

[0061] Preferably, R1and R2are -C 1-12 - an alkyl group, more preferably -CH3;

[0062] R3, R4, R5and R6are each independently selected from the group consisting of: -H; an unsubstituted or mono- or poly-substituted -C 1-12 - an alkyl group; or wherein R3and R4together are =0;

[0063] Preferably, R3and R4together are =0, R5and R6are -H; and

[0064] R7is an unsubstituted or mono- or poly-substituted -C 6-10 - an aryl group; or an unsubstituted or mono- or poly-substituted heteroaryl group;

[0065] Preferably, R7is an unsubstituted, mono- or poly-substituted heteroaryl group; more preferably an unsubstituted heteroaryl group; more preferably a thienyl group; in particular a 2-thienyl group;

[0066] A particularly excellent ketone substrate of this type is N,N-dimethyl-3-keto-3-(2- thienyl)-1-ketopropylamine

[0067]

[0068] A further particularly preferred ketone substrate of this type is N-monomethyl-3-keto-3-(2- thienyl)-1-ketopropylamine

[0069]

[0070] (ii) a 5-hydroxy-3-oxo-hexanoate-derivative according to general formula (III)

[0071]

[0072] wherein

[0073] R8is an unsubstituted or mono- or poly-substituted -C 1-12 - an alkyl group; or an unsubstituted or mono- or poly-substituted -C 6-10- alkyl; more preferably -C(CH3)3; 1-12 - a hydrocarbon residue bridge;

[0074] Preferably, R8is -C 1-12 - alkyl; more preferably -C(CH3)3;

[0075] R9is -H; -halogen (preferably chlorine, bromine, iodine); -CN; or -OR 11 wherein R 11 is hydrogen or a protecting group (such as benzyloxy);

[0076] Preferably, R9is halogen or -CN; more preferably -Cl or -CN;

[0077] R 10 is -H; unsubstituted or mono- or poly-substituted -C 1-12 - alkyl; or unsubstituted or mono- or poly-substituted -C 6-10 - alkyl; or unsubstituted or mono- or poly-substituted -C 1-12 - a hydrocarbon residue bridge;

[0078] Preferably, R 10 is -H;

[0079] A particularly preferred ketone substrate of this type is tert-butyl (5S)-6-chloro-5- hydroxy-3-oxo-hexanoate

[0080]

[0081] A further particularly preferred ketone substrate of this type is tert-butyl (5R)-6-cyano-5- hydroxy-3-oxo-hexanoate

[0082]

[0083] (iii) a phenylacetone-derivative according to general formula (IV)

[0084]

[0085] wherein

[0086] R 12 , R 13 , R 14 , R 15 and R 16 are each independently selected from the group consisting of -H; -halogen (preferably chlorine, bromine and iodine); unsubstituted or mono- or poly-substituted -C 1-12 - alkyl; unsubstituted or mono- or poly-substituted -C 6-10-aryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 -alkyl, or unsubstituted or mono- or poly-substituted -aryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 -hydrocarbon residue bridges; and -OR 18 , wherein R 18 is -H, unsubstituted or mono- or poly-substituted -C 1-12 -alkyl, or unsubstituted or mono- or poly-substituted -aryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 6-10 -aryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 -hydrocarbon residue bridges;

[0087] Preferably, R 12 , R 13 , R 14 , R 15 and R 16 are independently -H, -halogen or OR 18 ; more preferably -H, -CI or OCH3;

[0088] R 17 is -H; -halogen (preferably chlorine, bromine and iodine); unsubstituted or mono- or poly-substituted -C 1-12 -alkyl; unsubstituted or mono- or poly-substituted -aryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 6-10 -aryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 -hydrocarbon residue bridges; unsubstituted or mono- or poly-substituted -heteroaryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 -hydrocarbon residue bridges; -OR 19 , -NH2, -NHR 19 or -NR 19 R 20 , wherein R 19 and R 20 are each independently selected from unsubstituted or mono- or poly-substituted -C 1-12 -alkyl; unsubstituted or mono- or poly-substituted -aryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 6-10 -aryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 -hydrocarbon residue bridges; or unsubstituted or mono- or poly-substituted -heteroaryl, optionally bridged by saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 -hydrocarbon residue bridges;

[0089] Preferably, R 17 is -H;

[0090] wherein a particularly preferred ketone substrate of this type is 1 -(4-chlorophenyl)ethanone

[0091]

[0092] or wherein a particularly preferred ketone substrate of this type is 1 -(2-methoxyphenyl)ethanone

[0093]

[0094] (iv) a benzoyl-derivative according to general formula (V)

[0095]

[0096] wherein

[0097] R 21 and R 22 are each independently selected from the group consisting of unsubstituted or mono- or poly-substituted C 6-10 -aryl and unsubstituted or mono- or poly-substituted heteroaryl;

[0098] Preferably, R 21 is unsubstituted or mono- or poly-substituted C 6-10 -aryl, R 22 is unsubstituted or mono- or poly-substituted heteroaryl; more preferably R 21 is unsubstituted C 6-10 -aryl, R 22 is unsubstituted heteroaryl;

[0099] wherein a particularly preferred ketone substrate of this type is phenyl-(2-pyridyl)-methanone

[0100]

[0101] (v) an open-chain diketone-derivative according to general formula (VI)

[0102]

[0103] wherein

[0104] R 23 and R 24 are each independently selected from the group consisting of -H and -C 1-12 -alkyl; and

[0105] Preferably, R 23 is -CH2CH3, R 24 is -C 1-12 -alkyl; more preferably, R 23 is -CH2CH3, R 24 is -CH3;

[0106] wherein a particularly preferred ketone substrate of this type is ethyl-3-methoxy-8,14- norbornenedione (ethyl-3-methoxy-8,14-norbornane-l,3,5(10),9(ll)-tetraene-14,17-dione)

[0107]

[0108] (vi) 3-quinuclidinone (i.e. l-azabicyclo[2.2.2]octan-3-one);

[0109] (vii) ethyl-4-chloro-3-oxo-butyrate;

[0110] (viii) ethyl-3-oxo-3-phenyl-propionate; and

[0111] (ix) a ketose, preferably a butanose, pentanose or hexanose;

[0112] or the ketoreductase enzyme of the application is capable of reducing stereoselectively an aldehyde substrate selected from the group consisting of:

[0113] (x) 2-butanal (synonymous with isobutyraldehyde) (as this ketone substrate is a non-prochiral aldehyde, reduction does not occur stereoselectively); and

[0114] (xi) 1-heptanal (as this ketone substrate is a non-prochiral aldehyde, reduction does not occur stereoselectively);

[0115] wherein in each case mono- or poly-substitution means substitution independently with one or more functional groups selected from the group consisting of: -halogen, -OH, -OC 1-12 -alkyl, -OC 6-10 -aryl, -O-heteroaryl, -OCOC 1-12 -alkyl, -OCOC 6-10 -aryl, -OCO-heteroaryl, -SH, -SC 1-12 -alkyl, -SC 6-10 -aryl, -S-heteroaryl, -S(=O) 1-2 OH, -NO, -NO2, -N3, -NH2, -NH(C 1-12 -alkyl), -N(C 1-12 -alkyl)2, -NH(C 6-10 -aryl), -N(C 6-10 -aryl)2, -NH(heteroaryl), -N(heteroaryl)2, -CN, -CHO, -CO2H, CO-C 1-2 -alkyl, -CO-C 6-10 -aryl and -CO-heteroaryl.

[0116] In some embodiments of the application, the ketoreductase of the application is capable of reducing an aldehyde substrate or is capable of reducing a ketone substrate according to the general formula (I)-(VI), or a 3-quinuclidinone as defined above, or ethyl-4-chloro-3-oxo- butyrate, ethyl-3-oxo-3-phenyl-propionate, 2-butanal or 1-heptanal, preferably stereoselectively, to the respective primary or secondary alcohol. In some embodiments of the application, the ketoreductase of the application is capable of oxidizing a substrate such as 2-butanal or 1-heptanal to the corresponding carboxylic acid.

[0117] In some embodiments, the ketoreductase of the application is capable of stereoselectively reducing a 3-aryl-3-ketopropylamine-derivative according to the general formula (II), preferably N,N-dimethyl-3-keto-3-(2-thienyl)-1-ketopropylamine, to the preferred (1 S)-3-(dimethylamino)-1 -(2-thienyl)-propan-1 -ol. Examples of such ketoreductases comprise an amino acid sequence according to SEQ ID NO: 47, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 62, 72, 85, 86, 87, 88, or 89, preferably SEQ ID NO: 55, 58, or 87, most preferably SEQ ID NO: 58.

[0118] In some embodiments, the ketoreductase of the application is capable of stereoselectively reducing a 3-aryl-3-ketopropylamine-derivative according to the general formula (II), preferably N- monomethyl-3-keto-3-(2-thienyl)-1-ketopropylamine, to the preferred (1 S)-3-(methylamino)-1 -(2- thienyl)-propan-1 -ol. Examples of such ketoreductases comprise an amino acid sequence according to SEQ ID NO: 19, 28, 40, 46, 47, 49, 50, 55, 56, 57, 58, 59, 62, 64, 67, 72, 81, 82, 83, 85, 86, 87, 88, 89, 92, or 93, preferably SEQ ID NO: 58, 87, or 92, most preferably SEQ ID NO: 87.

[0119] In some embodiments, the ketoreductase enzymes of the application are capable of stereoselectively reducing a 5-hydroxy-3-oxo-hexanoate derivative according to general formula (III), preferably tert-butyl (5S)-6-chloro-5-hydroxy-3-oxohexanoate, to the preferred tert-butyl (3R,5S)-6-chloro-3,5-dihydroxy-hexanoate. Examples of such ketoreductase enzymes comprise an amino acid sequence according to SEQ ID NO: 34, 36, 40, 49, 53, 54, 55, 60, 61, 62, 64, 65, 66, 67, 68, 70, 72, 73, 74, 75, 76, 77, 78, 81, 82, 83, 92, or 93, preferably SEQ ID NO: 62, 91, or 92, more preferably SEQ ID NO: 91.

[0120] In some embodiments, the ketoreductase enzymes of the application are capable of stereoselectively reducing a 5-hydroxy-3-oxo-hexanoate derivative according to general formula (III), preferably tert-butyl (5S)-6-chloro-5-hydroxy-3-oxohexanoate, to the preferred tert-butyl (3R,5S)-6-chloro-3,5-dihydroxy-hexanoate. Examples of such ketoreductase enzymes comprise an amino acid sequence according to SEQ ID NO: 34, 36, 40, 49, 53, 54, 55, 60, 61, 62, 64, 65, 66, 67, 68, 70, 72, 73, 74, 75, 76, 77, 78, 81, 82, 83, 92, or 93, preferably SEQ ID NO: 62, 91, or 92, more preferably SEQ ID NO: 91.

[0121] In some embodiments, the ketoreductase enzymes of the application are capable of stereoselectively reducing a phenylacetone derivative according to general formula (IV), preferably 1-(4-chlorophenyl)ethanone, to 1-(4-chlorophenyl)ethanol. Examples of such ketoreductase enzymes comprise an amino acid sequence according to SEQ ID NO: 7, 9, 12, 15, 17, 18, 23, 24, 28, 31, 36, 38, 39, 47, 48, 49, 50, 51, 52, 53, 54, 55, 58, 62, 72, 81, 82, 83, 87, or 92, preferably SEQ ID NO: 7, 15, or 28, more preferably SEQ ID NO: 28.

[0122] In some embodiments, the ketoreductase of the application is capable of stereoselectively reducing a propanone-derivative according to general formula (III), preferably 1-phenyl- propan-1-one, to 1-phenyl-propan-1-ol. Examples of such ketoreductases comprise an amino acid sequence according to SEQ ID NO: 15, 17, 22, 24, 26, 36, 38, 40, 58, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 75, 76, 77, 78, 81, 82, 83, 86, 92, or 93, preferably SEQ ID NO: 17, 72, or 92, more preferably SEQ ID NO: 72.

[0123] In some embodiments, the ketoreductase of the application is capable of stereoselectively reducing a propanone-derivative according to general formula (III), preferably 1-phenyl- propan-1-one, to 1-phenyl-propan-1-ol. Examples of such ketoreductases comprise an amino acid sequence according to SEQ ID NO: 15, 17, 22, 24, 26, 36, 38, 40, 58, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 75, 76, 77, 78, 81, 82, 83, 86, 92, or 93, preferably SEQ ID NO: 17, 72, or 92, more preferably SEQ ID NO: 72.

[0124] In some embodiments, the ketoreductase of the application is capable of stereoselectively reducing a propanone-derivative according to general formula (III), preferably 1-phenyl- propan-1-one, to 1-phenyl-propan-1-ol. Examples of such ketoreductases comprise an amino acid sequence according to SEQ ID NO: 15, 17, 22, 24, 26, 36, 38, 40, 58, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 75, 76, 77, 78, 81, 82, 83, 86, 92, or 93, preferably SEQ ID NO: 17, 72, or 92, more preferably SEQ ID NO: 72.

[0125] In some embodiments, the ketoreductase of the application is capable of stereoselectively reducing the ketone substrate ethyl 3-oxo-3-phenyl-propionate to ethyl 3-hydroxy-3- phenyl-propionate. Examples of such ketoreductases include an amino acid sequence according to SEQ ID NO: 17, 34, 36, 40, 46, 47, 52, 60, 61, 62, 64, 65, 66, 67, 68, 70, 71, 72, 73, 74, 75, 76, 77, 78, 81, 82, 83, 84, 92, or 93, preferably SEQ ID NO: 46, 76, or 78, more preferably SEQ ID NO: 76.

[0126] In some embodiments, the ketoreductase of the application is capable of stereoselectively reducing the ketone substrate ethyl-4-chloro-3-oxo-butyrate to ethyl (3S)-4-chloro-3- hydroxy-butyrate. Examples of such ketoreductases include an amino acid sequence according to SEQ ID NO: 2, 63, or 90.

[0127] In some embodiments, the ketoreductase of the application is capable of stereoselectively reducing the ketone substrate 3-quinuclidinone (synonymous with l-azabicyclo[2.2.2]octan-3- one hydrochloride) to 3-quinuclidinol (synonymous with l-azabicyclo[2.2.2]octan-3-ol). Examples of such ketoreductases include an amino acid sequence according to SEQ ID NO: 17, 21, 26, 38, 40, 62, 72, 73, 81, 83, 86, 92, or 93, preferably SEQ ID NO: 17, 21, or 73, more preferably SEQ ID NO: 17.

[0128] In some embodiments, the ketoreductase of the application is capable of oxidizing a secondary alcohol to the corresponding ketone, e.g., 2-butanol to 2-butanal.

[0129] In some embodiments, the ketoreductase of the application is capable of oxidizing a primary alcohol to an aldehyde compound, e.g., 1-heptanol to 1-heptanal.

[0130] In some embodiments, the ketoreductase of the application is capable of oxidizing an aldehyde compound to a carboxylic acid.

[0131] Preferably, the ketoreductase of the application is capable of oxidizing a co-substrate for cofactor regeneration with a high specific activity, preferably with a specific activity of 0.1-100 U / mg, more preferably with a specific activity of 1-50 U / mg, most preferably with a specific activity of 10-12 U / mg of the lyophilisate of the ketoreductase. In the sense of the present application, the co-substrate which is converted, preferably oxidized, by the ketoreductase of the application and which accompanies the conversion, preferably reduction, of the ketone substrate is a primary or secondary alcohol.

[0132] The co-substrate can be selected according to the specific activity for cofactor regeneration, preferably selected from the group consisting of isopropanol, 2-butanol, 2-pentanol, 2-hexanol and 2-heptanol. Preferably, the ketoreductase of the present application converts isopropanol to propanone with a high specific activity. The ketoreductase lyophilisate can be obtained, for example, by cell disruption as described in Example 2 (see below) followed by freeze-drying of the crude extract.

[0133] To determine the oxidative activity of a given co-substrate, the ketoreductase of the present application is incubated in a buffer containing 20% co-substrate, for example isopropanol, and a cofactor, for example 0.25 mM NAD(P), preferably at 30°C. The oxidative activity is determined by measuring the decrease in absorbance at 340 nm resulting from the reduction of NAD(P). The ketoreductase having the amino acid sequence of SEQ ID NO: 2 exhibits a specific activity of 10.6 U / mg ketoreductase lyophilisate for the oxidation of isopropanol under the specified conditions.

[0134] Preferably, the ketoreductase of the present application exhibits a high specific activity in a co-substrate, preferably in isopropanol, 2-butanol, 2-pentanol, 2-hexanol and / or 2-heptanol. Preferably, after pre-incubation of the ketoreductase in 50% aqueous co-substrate, preferably isopropanol, for 48 hours at 30°C, the ketoreductase exhibits at least 1%, more preferably at least 10% or at least 20%, still more preferably at least 30% or at least 40%, still more preferably at least 50% or at least 60%, even more preferably at least 70% or at least 80%, most preferably at least 85% or at least 90%, in particular at least 95% or at least 99%, residual activity relative to its activity prior to pre-incubation with the co-substrate. In this respect, residual activity in the sense of the present application describes the remaining ketoreductase activity of the enzyme after pre-incubation with a co-substrate compared to the activity after pre-incubation without the co-substrate. To determine the stability in a co-substrate, including for example isopropanol, the ketoreductase of the present application is pre-incubated in a buffer, preferably at 30°C in 50% co-substrate, for example isopropanol, at pH 9 for 48 hours, and the enzymatic activity of the ketoreductase is compared to the enzyme pre-incubated without the co-substrate. The residual activity of the ketoreductase of the present application is 100% when both enzymatic activities are identical; i.e. there is no loss of activity compared to the activity without pre-incubation with the co-substrate. The ketoreductase having the amino acid sequence of SEQ ID NO: 2 exhibits a residual activity of 100% under the described conditions.

[0135] The efficient conversion of co-substrates by the ketoreductase and the stability of the ketoreductase in the co-substrate are of particular relevance for the establishment of efficient industrial processes for the reduction of ketone or aldehyde substrates to secondary or primary alcohols. The stability of the ketoreductase of the present application in co-substrates and its ability to convert the co-substrates of the present application are also relevant for the reverse conversion of primary and secondary alcohols to aldehyde and ketone substrates.

[0136] In some embodiments, the ketoreductase of the application exhibits increased specific activity, temperature stability, and / or stereoselectivity when engineered with SEQ ID NO: 2.

[0137] The increased specific activity of the application relates to the specific activity of the engineered ketoreductase being higher than the specific activity of the non-engineered ketoreductase of SEQ ID NO: 2. Preferably, the specific activity is at least 10%, or at least 50%, or at least 100%, or at least 1.5-fold, or at least 2-fold, or at least 3-fold, or at least 5-fold, or at least 10-fold, or at least 20-fold, or at least 50-fold, or at least 100-fold, or at least 200-fold, or at least 300-fold, or at least 500-fold, or at least 700-fold, or at least 1000-fold, or at least 10,000-fold, or at least 100,000-fold higher than the specific activity of the non-engineered ketoreductase. The increased specific activity can also mean that the engineered ketoreductase does exhibit a particular activity for a desired substrate, whereas the non-engineered ketoreductase does not have significant activity for said substrate.

[0138] The increased temperature stability of the application relates to the engineered ketoreductase having a higher residual specific activity after incubation at 30 °C for 48 hours compared to the non-engineered ketoreductase of SEQ ID NO: 2. Alternatively, the increased temperature stability of the application can relate to the engineered ketoreductase having the same residual specific activity compared to the non-engineered ketoreductase after incubation at a higher temperature for the same time or at the same temperature for a longer time.

[0139] The stereoselectivity of the application relates to the enantiomeric excess of the product provided by the engineered ketoreductase being higher than the enantiomeric excess of the product provided by the non-engineered ketoreductase of SEQ ID NO: 2. Preferably, the enantiomeric excess provided by the engineered ketoreductase is increased by at least 0.1% ee, at least 0.5% ee, at least 1% ee, at least 2% ee, at least 3% ee, at least 5% ee, at least 7% ee, at least 10% ee, at least 20% ee, at least 30% ee, at least 40% ee, at least 50% ee, at least 60% ee, at least 70% ee, at least 80% ee, at least 90% ee, at least 95% ee, at least 97% ee, at least 98% ee, or at least 99% ee compared to the non-engineered ketoreductase. The increased stereoselectivity can also mean that the engineered ketoreductase does exhibit a particular stereoselectivity for a desired chiral product, whereas the non-engineered ketoreductase does not have significant stereoselectivity for said chiral product.

[0140] The increased specific activity of the engineered ketoreductase compared to the non-engineered ketoreductase of SEQ ID NO: 2 is preferably determined under standard reaction conditions, typically at 30°C in an aqueous buffer solution containing the substrate, the co-factor, optional supplements and the ketoreductase. The buffer is preferably selected from 10-200 mM Tris / HCI, pH 7-9, 10-200 mM sodium phosphate / NaOH, pH 6-8, or 10-200 mM triethanolamine / HCI, pH 7-9, containing 2 mM MgCI2. The co-factor NADH is preferably added to a final concentration ranging from 0.05-10 mM. The substrate is preferably added to a final concentration ranging from 5 mM to 1 M, the substrate preferably being selected from ethyl-4-chloro-3-oxo-butyrate, 1-(4-chloro-phenyl)ethanone, 1-(2-methoxyphenyl)ethanol, tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate, N,N-dimethyl-3-keto-3-(2-thienyl)-1- ketopropylamine, ethyl secodione (ethyl-3-methoxy-8,14-seco-steran-1,3,5(10),9(11)- tetraen-14,17-dione), tert-butyl (5S)-6-chloro-5-hydroxy-3-oxohexanoate, and N- monomethyl-3-keto-3-(2-thienyl)-1-ketopropylamine, phenyl-(2-pyridyl)-methanone, ethyl 3-oxo-3-phenyl-propionate, 3-quinuclidinone, 2-butanal and 1-heptanal. Optional further supplements are preferably selected from 1-5% Triton X-100 (v / v) and 0.5-10% DMSO (v / v). The ketoreductase is preferably added as a crude extract supernatant. The crude extract is obtained by disrupting the expression host containing the ketoreductase, followed by centrifugation to separate the cell debris and the ketoreductase containing crude extract supernatant. The specific activity is determined by measuring product formation, consumption of reduced co-factor NADH and / or substrate consumption. In case the specific activity is determined by measuring product formation or substrate consumption, a co-factor regeneration system (isopropanol or GDH / glucose) can be applied in the standard reaction; in case the specific activity is determined by measuring consumption of reduced co-factor NADH, no co-factor regeneration system is applied. In case a co-factor regeneration system is applied, the reduced co-factor NADH can be regenerated by the co-factor regeneration system from oxidized co-factor NAD TM X-100 (v / v) and 0.5-10% DMSO (v / v). The ketoreductase is preferably added as a crude extract supernatant. The crude extract is obtained by disrupting the expression host containing the ketoreductase, followed by centrifugation to separate the cell debris and the ketoreductase containing crude extract supernatant. The specific activity is determined by measuring product formation, consumption of reduced co-factor NADH and / or substrate consumption. In case the specific activity is determined by measuring product formation or substrate consumption, a co-factor regeneration system (isopropanol or GDH / glucose) can be applied in the standard reaction; in case the specific activity is determined by measuring consumption of reduced co-factor NADH, no co-factor regeneration system is applied. In case a co-factor regeneration system is applied, the reduced co-factor NADH can be regenerated by the co-factor regeneration system from oxidized co-factor NAD + Alternative.

[0141] The increased stereoselectivity of the engineered ketoreductase compared to the non-engineered ketoreductase of SEQ ID NO: 2 is preferably determined under standard reaction conditions as described above for determining the increased specific activity. Chiral analysis is applied to analyze the product formed in the reaction.

[0142] The increased temperature stability of the engineered ketoreductase compared to the non-engineered ketoreductase of SEQ ID NO: 2 is preferably determined by incubating the crude extract containing the ketoreductase for 15 minutes at a given temperature in a PCR cycler, preferably at a temperature at which the non-engineered ketoreductase of SEQ ID NO: 2 shows 10% of the residual activity. The crude extract is then incubated on ice for 30 minutes. The insoluble proteins are separated by centrifugation and the remaining ketoreductase activity of the supernatant is analyzed in a standard ketoreductase assay. In this standard assay, a substrate suitable for ketoreductases, such as isopropanol, is oxidized by the ketoreductase to, for example, acetone, accompanied by the reduction of NAD + to NADH (since no other ketoreductase substrate is present in this standard assay, isopropanol is used as a substrate for the ketoreductase and is not used for cofactor regeneration). The increase of NADH is monitored by measuring the absorption at 340 nm in a standard photometer. The assay is performed under standard reaction conditions, typically at 30°C, in an aqueous buffer solution containing the substrate (e.g. isopropanol), the cofactor and the ketoreductase. The ketoreductase is preferably added as a crude extract supernatant. The crude extract is obtained by destroying the expression host containing the ketoreductase, followed by centrifugation to separate the cell debris and the ketoreductase containing crude extract supernatant. The buffer is preferably selected from 10-200 mM Tris / HCI, pH 7-9, containing 2 mM MgCI2, 10-200 mM sodium phosphate / NaOH, pH 6-8, or 10-200 mM triethanolamine / HCI, pH 7-9. The cofactor NAD + is preferably added to a final concentration ranging from 0.05-10 mM. The ketoreductase is preferably added as a crude extract supernatant. The crude extract is obtained by destroying the expression host containing the ketoreductase, followed by centrifugation to separate the cell debris and the ketoreductase containing crude extract supernatant.

[0143] In a preferred embodiment, the engineered ketoreductase of the present application differs from the wild type ketoreductase of SEQ ID NO: 2 by 1-70 amino acids, typically 1-50 amino acids, more typically 1-30 amino acids, even more typically 1-20 amino acids, most typically 1-11 amino acids.

[0144] In this respect, engineering means that one or more amino acids of a given position are substituted by any other proteinogenic amino acid selected from the group consisting of Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp Tyr and Val. In a preferred embodiment, the substitution does not change the sequence length, i.e. a single amino acid residue is replaced by another single amino acid residue. However, it is also possible that one or more amino acid residues are not replaced but deleted and / or one or more amino acid residues are inserted.

[0145] In principle, a substitution at any position of the enzyme can be a conservative substitution, where such amino acid is replaced by an amino acid of comparable character (e.g. a hydrophobic amino acid is replaced by another hydrophobic amino acid). Furthermore, a substitution at any position of the enzyme can be a non-conservative substitution, where such amino acid is replaced by an amino acid of other character (e.g. a hydrophobic amino acid is replaced by a hydrophilic amino acid).

[0146] Techniques for enzyme engineering are reviewed in S. Lutz, U. T. Bornscheuer, Protein Engineering Handbook, Wiley VCH, Weinheim, 2009.

[0147] Any substitution according to the present application does not include amino acid substitutions at positions of the ketoreductase according to the present application which are essential for the catalytic activity of the ketoreductase, preferably at positions N120, S148, Y161 and K165 of SEQ ID NO: 2. Furthermore, it is known in the art that sequence positions involved in predictable protein structural elements, e.g. alpha helices or beta sheets or ion interactions, are sensitive to mutagenesis and can not require substitution or only require concomitant substitution at a position.

[0148] The present application also relates to an engineered ketoreductase differing from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by 1-70 residue changes, preferably 1-50 residue changes, more preferably 1-30 residue changes, even more preferably 1-20 residue changes, most preferably 1-11 residue changes, preferably comprising one or more of the following residue changes at the following positions of SEQ ID NO: 2: Y21, V23, S33, L39, R40, A43, P68, V89, G95, P97, T98, D103, G109, V119, L121, V124, Y125, 1149, L150, S154, E155, T157, A158, T163, H190, Y193, L198, L199, A201, A206, Y207, V229, and V247.

[0149] Preferably, the engineered ketoreductase of the present application differs from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by 1-70 residue changes, more preferably 1-50, still more preferably 1-30, even more preferably 1-20, and most preferably 1-11 residue changes, preferably comprising one or more of the following residue changes:

[0150]

[0151]

[0152] Preferably, the engineered ketoreductase of the present application is capable of reducing any aldehyde substrate or capable of stereoselectively reducing any ketone substrate, preferably a ketone substrate according to general formula (I); or a 3-aryl-3-ketopropylamine-derivative according to general formula (II); or a 5-hydroxy-3-oxo-hexanoate-derivative according to general formula (III); or a phenylethanone-derivative according to general formula (IV); or a benzoyl-derivative according to general formula (V); or a ring-opened diketone-derivative according to general formula (VI); or 3-quinuclidinone; or ethyl-3-oxo-3-phenyl-propionate; or ethyl-4-chloro-3-oxo-butanoate; or a ketose; or an aldehyde substrate according to general formula (I'); or 2-butanal; or 1-heptanal; preferably exhibiting an improved specific activity, temperature stability and / or stereoselectivity compared to the wild-type ketoreductase of SEQ ID NO: 2.

[0153] Preferably, the engineered ketoreductase of the application is capable of reducing any aldehyde substrate or any ketone substrate, preferably a ketone substrate according to general formula (I); or a 3-aryl-3-ketopropylamine-derivative according to general formula (II); or a 5-hydroxy-3-oxo-hexanoate-derivative according to general formula (III); or an acetophenone-derivative according to general formula (IV); or a benzoyl-derivative according to general formula (V); or an open ring diketone-derivative according to general formula (VI); or 3-quinuclidinone; or ethyl-3-oxo-3-phenyl-propionate; ethyl-4-chloro-3-oxo-butanoate; or a ketose; or an aldehyde substrate according to general formula (I'); or 2-butanal; or 1-heptanal; and differs from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by 1-70 amino acids, preferably 1-50 amino acids, more preferably 1-30 amino acids, even more preferably 1-20 amino acids, most preferably 1-11 residues alterations, preferably including alterations at one or more of the following positions: Y21, V23, S33, L39, R40, A43, P68, V89, G95, P97, T98, D103, G109, V119, L121, V124, Y125, 1149, L150, S154, E155, T157, A158, T163, H190, Y193, L198, L199, A201, A206, Y207, V229, and V247.

[0154] Preferably, the engineered ketoreductase of the application is capable of reducing any aldehyde substrate or capable of stereoselectively reducing any ketone substrate, preferably a ketone substrate according to general formula (I); or a 3-aryl-3-ketopropylamine-derivative according to general formula (II); or a 5-hydroxy-3-oxo-hexanoate-derivative according to general formula (III); or a phenylacetone-derivative according to general formula (IV); or a benzoyl-derivative according to general formula (V); or an open ring diketone-derivative according to general formula (VI); or 3-quinuclidinone; or ethyl-3-oxo-3-phenyl-propionate; ethyl-4-chloro-3-oxo-butanoate; or a ketose; or an aldehyde substrate according to general formula (I'); or 2-butanal; or 1-heptanal; and differs from the amino acid sequence of a wild-type ketoreductase by 1-70 residue changes, preferably 1-50, more preferably 1-30, even more preferably 1-20 and most preferably 1-11 residue changes, preferably comprising one or more of the following residue changes: Y21Q; V23T; S33A; L39V; R40C; A43E or G; P68S; V89F; G95A; E, M, Q, S or V; P97A, E, K, N, V or Y; T98A or G; D103E; G109Y; V119Y; L121Q; V124I; Y125F; I149A, G, L, M, Q, T or V; L150A, F, H or S; S154G; E155A, D, F, G, K, L or S; T157Y; A158G, L, P, Q, S, V or W; T163A or S; H190C; Y193A, F, G, P, T or V; L198M; L199A, F, I or T; A201G; A206G; Y207R or L; V229I and V247I.

[0155] Preferably, the engineered ketoreductase of the application is capable of stereoselectively reducing one of the following substrates: N,N-dimethyl-3-keto-3-(2-thienyl)-1- ketopropylamine, N-monomethyl-3-keto-3-(2-thienyl)-1-ketopropylamine, tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate, tert-butyl (5S)-6-chloro-5-hydroxy-3-oxo- hexanoate, 1-(4-chlorophenyl)ethanone, 1-(2-methoxyphenyl)ethanone, phenyl-(2-pyridyl)- methanone, ethyl open diketone, ethyl 3-oxo-3-phenyl-propionate, 3-quinuclidinone, ethyl-4- chloro-3-oxo-butyrate; or a ketose; or an aldehyde substrate according to general formula (I’); or 2-butanal; or 1-heptanal; and differs from the amino acid sequence of a wild-type ketoreductase by 1-70 amino acids, preferably 1-50 amino acids, more preferably 1-30 amino acids, even more preferably 1-20 amino acids, and most preferably 1-11 residues, preferably including an alteration at one or more of the following positions: Y21, V23, S33, L39, R40, A43, P68, V89, G95, P97, T98, D103, G109, V119, L121, V124, Y125, I149, L150, S154, E155, T157, A158, T163, H190, Y193, L198, L199, A201, A206, Y207, V229, and V247.

[0156] Preferably, the engineered ketoreductase of the application is capable of stereoselectively reducing one of the following substrates: N,N-dimethyl-3-keto-3-(2-thienyl)-1- ketopropylamine, N-monomethyl-3-keto-3-(2-thienyl)-1-ketopropylamine, tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate, tert-butyl (5S)-6-chloro-5-hydroxy-3-oxo- hexanoate, 1-(4-chlorophenyl)ethanone, 1-(2-methoxyphenyl)ethanone, phenyl-(2-pyridyl)- methanone, ethyl open diketone, ethyl 3-oxo-3-phenyl-propionate, 3-quinuclidinone, ethyl-4- chloro-3-oxo-butyrate; or a ketose; or an aldehyde substrate according to general formula (I’); or 2-butanal; or 1-heptanal; and differs from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by 1-70, preferably 1-50, more preferably 1-30, even more preferably 1-20, and most preferably 1-11 residue alterations, preferably including one or more of the following residue alterations: Y21Q; V23T; S33A; L39V; R40C; A43E or G; P68S; V89F; G95A, E, M, Q, S or V; P97A, E, K, N, V or Y; T98A or G; D103E; G109Y; V119Y; L121Q; V124I; Y125F; I149A, G, L, M, Q, T or V; L150A, F, H or S; S154G; E155A, D, F, G, K, L or S; T157Y; A158G, L, P, Q, S, V or W; T163A or S; H190C; Y193A, F, G, P, T or V; L198M; L199A, F, I or T; A201G; A206G; Y207R or L; V229I and V247I.

[0157] Preferably, the engineered ketoreductase of the application, which differs from the wild-type ketoreductase of SEQ ID NO: 2, comprises or consists essentially of an amino acid sequence having one of the following sets of amino acid substitution(s):

[0158]

[0159]

[0160]

[0161]

[0162] Preferably, the engineered ketoreductase of the application is capable of reducing any aldehyde substrate or capable of stereoselectively reducing any ketone substrate, preferably a ketone substrate according to general formula (I); or a 3-aryl-3-ketopropylamine-derivative according to general formula (II); or a 5-hydroxy-3-oxo-hexanoate-derivative according to general formula (III); or an acetophenone-derivative according to general formula (IV); or a benzoyl-derivative according to general formula (V); or an open ring diketone-derivative according to general formula (VI); or 3-quinuclidinone; or ethyl-3-oxo-3-phenyl-propionate; or ethyl-4-chloro-3-oxo-butanoate; or a ketose; or an aldehyde substrate according to general formula (I'); or 2-butanal; or 1-heptanal; and comprises or essentially consists of one of the following amino acid sequences: SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, or 93.

[0163] Preferably, the engineered ketoreductase of the application is capable of reducing any aldehyde substrate or capable of stereoselectively reducing any ketone substrate, preferably a ketone substrate according to general formula (I); or a 3-aryl-3-ketopropylamine-derivative according to general formula (II); or a 5-hydroxy-3-oxo-hexanoate-derivative according to general formula (III); or a acetophenone-derivative according to general formula (IV); or a benzoyl-derivative according to general formula (V); or a open ring diketone-derivative according to general formula (VI); or 3-quinuclidinone; or ethyl-3-oxo-3-phenyl-propionate; or ethyl-4-chloro-3-oxo-butanoate; or a ketose; or an aldehyde substrate according to general formula (I'); or 2-butanal; or 1-heptanal; and has an increased specific activity, temperature stability and / or stereoselectivity compared to the wild type ketoreductase of SEQ ID NO: 2 and comprises or essentially consists of one of the following amino acid sequences: SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, or 93.

[0164] Preferably, the engineered ketoreductase of the application is capable of stereoselectively reducing N,N-dimethyl-3-keto-3-(2-thienyl)-1-ketopropylamine to preferably (1S)-3-(dimethylamino)-1-(2-thienyl)-propan-1-ol and comprises or essentially consists of one of the following amino acid sequences: SEQ ID NO: 47, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 62, 72, 85, 86, 87, 88, or 89, more preferably SEQ ID NO: 55, 58, or 87, most preferably SEQ ID NO: 58.

[0165] Preferably, the engineered ketoreductase of the present application is capable of stereoselectively reducing N-monomethyl-3-keto-3-(2-thienyl)-1-ketopropylamine to the preferred (1S)-3-(methylamino)-1-(2-thienyl)-propan-1-ol and comprises or consists essentially of one of the following amino acid sequences: SEQ ID NO: 19, 28, 40, 46, 47, 49, 50, 55, 56, 57, 58, 59, 62, 64, 67, 72, 81, 82, 83, 85, 86, 87, 88, 89, 92, or 93, more preferably SEQ ID NO: 58, 87, or 92, most preferably SEQ ID NO: 87.

[0166] Preferably, the engineered ketoreductase of the present application is capable of stereoselectively reducing tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate to the preferred tert-butyl (3R,5R)-6-cyano-3,5-dihydroxy-hexanoate and comprises or consists essentially of one of the following amino acid sequences: SEQ ID NO: 34, 36, 40, 49, 55, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 81, 82, 83, 84, 91, 92, or 93, more preferably SEQ ID NO: 62, 91, or 92, most preferably SEQ ID NO: 91.

[0167] Preferably, the engineered ketoreductase of the present application is capable of stereoselectively reducing tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate to the preferred tert-butyl (3R,5R)-6-cyano-3,5-dihydroxy-hexanoate and comprises or consists essentially of one of the following amino acid sequences: SEQ ID NO: 34, 36, 40, 49, 55, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 81, 82, 83, 84, 91, 92, or 93, more preferably SEQ ID NO: 62, 91, or 92, most preferably SEQ ID NO: 91.

[0168] Preferably, the engineered ketoreductase of the present application is capable of stereoselectively reducing 1-(4-chlorophenyl)ethanone to 1-(4-chlorophenyl)ethanol and comprises or consists essentially of one of the following amino acid sequences: SEQ ID NO: 7, 9, 12, 15, 17, 18, 23, 24, 28, 31, 36, 38, 39, 47, 48, 49, 50, 51, 52, 53, 54, 55, 58, 62, 72, 81, 82, 83, 87, or 92, more preferably SEQ ID NO: 7, 15, or 28, most preferably SEQ ID NO: 28.

[0169] Preferably, the engineered ketoreductase of the application is capable of stereoselectively reducing 1-(2-methoxyphenyl)ethanone to 1-(2-methoxyphenyl)ethanol and comprises or consists essentially of one of the following amino acid sequences: SEQ ID NO: 15, 17, 22, 24, 26, 36, 38, 40, 58, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 75, 76, 77, 78, 81, 82, 83, 86, 92, or 93, more preferably SEQ ID NO: 17, 72, or 92, most preferably SEQ ID NO: 72.

[0170] Preferably, the engineered ketoreductase of the application is capable of stereoselectively reducing phenyl-(2-pyridyl)-methanone to phenyl-(2-pyridyl)-methanol and comprises or consists essentially of one of the following amino acid sequences: SEQ ID NO: 21, 24, 28, 36, 38, 39, 40, 44, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 81, 82, 83, 85, 86, 87, 88, 89, 92, or 93, more preferably SEQ ID NO: 72, 82, or 92, most preferably SEQ ID NO: 72.

[0171] Preferably, the engineered ketoreductase of the application is capable of stereoselectively reducing ethyl ring-opened diketone (ethyl-3-methoxy-8,14-ring-opened- stigmasta-1,3,5(10),9(11)-tetraene-14,17-dione) to the preferred ethyl ring- opened alcohol (ethyl-3-methoxy-8,14-ring-opened-stigmasta-1,3,5(10),9(11)- tetraene-14-one-17-beta-ol) and comprises or consists essentially of one of the following amino acid sequences: SEQ ID NO: 61, 62, 65, 66, 69, 70, 71, 75, 78, 82, 83, 86, 92, or 93, more preferably SEQ ID NO: 69, 70, or 71, most preferably SEQ ID NO: 70.

[0172] Preferably, the engineered ketoreductase of the application is capable of stereoselectively reducing ethyl 3-oxo-3-phenyl-propionate to ethyl 3-hydroxy-3-phenyl-propionate and comprises or essentially consists of one of the following amino acid sequences: SEQ ID NO: 17, 34, 36, 40, 46, 47, 52, 60, 61, 62, 64, 65, 66, 67, 68, 70, 71, 72, 73, 74, 75, 76, 77, 78, 81, 82, 83, 84, 92, or 93, more preferably SEQ ID NO: 46, 76, or 78, most preferably SEQ ID NO: 76.

[0173] Preferably, the engineered ketoreductase of the application is capable of stereoselectively reducing the ketone substrate ethyl-4-chloro-3-oxo-butyrate to preferably ethyl (3S)-4-chloro-3-hydroxy-butyrate and comprises or essentially consists of one of the following amino acid sequences: SEQ ID NO: 63 or 90.

[0174] Preferably, the engineered ketoreductase of the application is capable of stereoselectively reducing 3-quinuclidinone (synonymous with l-azabicyclo[2.2.2]octan-3-one hydrochloride) to 3-quinuclidinol (synonymous with l-azabicyclo[2.2.2]octan-3-ol) and comprises or essentially consists of one of the following amino acid sequences: SEQ ID NO: 17, 21, 26, 38, 40, 62, 72, 73, 81, 83, 86, 92, or 93, more preferably SEQ ID NO: 17, 21, or 73, most preferably SEQ ID NO: 17.

[0175] Preferably, the engineered ketoreductase of the application exhibits high co-substrate activity and / or co-substrate stability, in particular high stability and / or activity for isopropanol, 2-butanol, 2-pentanol, 2-hexanol, or 2-heptanol, in addition to having increased specific activity, temperature stability, and / or stereoselectivity compared to the wild-type ketoreductase of SEQ ID NO: 2.

[0176] Preferably, the ketoreductase of the application exhibits an increased specific activity over that of a non-engineered ketoreductase. Preferably, the specific activity is at least 10%, at least 50%, at least 100%, at least 1.5-fold, at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, at least 300-fold, at least 500-fold, at least 700-fold, at least 1000-fold, at least 10,000-fold, or at least 100,000-fold higher than the specific activity of a non-engineered ketoreductase. An increased specific activity can also mean that the engineered ketoreductase does exhibit a particular activity for a desired substrate, whereas the non-engineered ketoreductase does not have significant activity for that substrate.

[0177] Preferably, the engineered ketone reductase of the present invention exhibits higher temperature stability than the wild-type ketone reductase of SEQ ID NO:2. More preferably, the ketone reductase of the present invention exhibits improved temperature stability by 1°C-40°C, more preferably 1°C-30°C, more preferably 1°C-20°C, even more preferably 3°C-15°C, and most preferably 15°C, compared to the wild-type ketone reductase of SEQ ID NO:2.

[0178] Preferably, the engineered ketone reductase of the present invention provides an enhanced enantiomer excess, which preferably increases by at least 0.1% ee, at least 0.5% ee, at least 1% ee, at least 2% ee, at least 3% ee, at least 5% ee, at least 7% ee, at least 10% ee, at least 20% ee, at least 30% ee, at least 40% ee, at least 50% ee, at least 60% ee, at least 70% ee, at least 80% ee, at least 90% ee, at least 95% ee, at least 97% ee, at least 98% ee, or at least 99% ee compared to a non-engineered ketone reductase. Enhanced stereoselectivity may also mean that the engineered ketone reductase exhibits a specific stereoselectivity to the desired chiral product, while the non-engineered ketone reductase does not have significant stereoselectivity to said chiral product.

[0179] Preferably, under standard reaction conditions, typically at 30°C, the increased specific activity of the engineered ketone reductase compared to the non-engineered ketone reductase of SEQ ID NO:2 was determined in a buffer solution containing substrate, cofactor, selective supplement, and ketone reductase, compared to standard reaction conditions. The buffer solution is preferably selected from 10-200 mM Tris / HCl containing 2 mM MgCl2 at pH 7-9, 10-200 mM sodium phosphate / NaOH at pH 6-8, or 10-200 mM triethanolamine / HCl at pH 7-9. Preferably, the cofactor NADH is added to a final concentration ranging from 0.05-10 mM. Preferably, the substrate is added to a final concentration ranging from 5 mM to 1 M, and the substrate is preferably selected from ethyl-4-chloro-3-oxo-butyrate, 1-(4-chloro-phenyl)ethyl ketone, 1-(2-methoxyphenyl)ethanol, tert-butyl(5R)-6-cyano-5-hydroxy-3-oxo-hexanoate, N,N-dimethyl-3-one-3-(2-thienyl)-1-onepropylamine, ethyl open-ring dione (ethyl-3-methyl-4-ethyl-2-ethyl-3 ... Oxy-8,14-open-ring-sterane-1,3,5(10),9(11)-tetraen-14,17-dione), tert-butyl(5S)-6-chloro-5-hydroxy-3-oxohexanoate, and N-monomethyl-3-one-3-(2-thienyl)-1-onepropane, phenyl-(2-pyridyl)-methyl ketone, ethyl 3-oxo-3-phenyl-propionate, 3-quininecycloone, 2-butanal and 1-heptanal. Optional additional supplements are preferably selected from 1-5% Triton.TM X-100 (v / v) and 0.5-10% DMSO (v / v). Ketoreductase is preferably added as the supernatant of the crude extract. The crude extract is obtained by disrupting the expression host containing ketone reductase, followed by centrifugation to separate cell debris and ketone reductase containing the supernatant of the crude extract. Specific activity is preferably determined by measuring product formation, consumption of reduced cofactor NADH, and / or substrate consumption. In the case of determining specific activity by measuring product formation or substrate consumption, a cofactor regeneration system (isopropanol or GDH / glucose) can be used in the standard reaction. In the case of determining specific activity by measuring the consumption of reduced cofactor NADH, the cofactor regeneration system is not used. In the case of using a cofactor regeneration system, reduced cofactor NADH can be replaced by oxidized cofactor NAD reduced by the cofactor regeneration system. + Replacement.

[0180] Preferably, the increased stereoselectivity of the engineered ketone reductase compared to the non-engineered ketone reductase of SEQ ID NO:2 is determined under the standard reaction conditions described above for determining the increased specific activity. Chiral analysis is applied to analyze the products formed in the reaction.

[0181] The improved temperature stability of the engineered ketone reductase compared to the non-engineered ketone reductase of SEQ ID NO:2 was preferably determined by incubating the ketone reductase containing the crude extract in a PCR cycler for 15 minutes at a given temperature (preferably at the temperature at which the non-engineered ketone reductase of SEQ ID NO:2 exhibits 10% residual activity). The crude extract was then incubated on ice for 30 minutes. The residual ketone reductase activity of the supernatant was analyzed in a standard ketone reductase assay by centrifugation to separate insoluble proteins. In this standard assay, a substrate suitable for ketone reductase, such as isopropanol, is oxidized by the ketone reductase to, for example, acetone, accompanied by NAD+. + The NADH is reduced to NADH (since no other ketone reductase substrates are available in this standard assay, isopropanol is used as the substrate for ketone reductase and is not applied to cofactor regeneration). The increase in NADH is monitored by measuring the absorbance at 340 nm in a standard photometer. The assay is performed under standard reaction conditions, typically at 30°C, in a buffer solution containing the substrate (e.g., isopropanol), cofactor, and ketone reductase. Ketoreductase is preferably added as the supernatant of the crude extract. The crude extract is obtained by disrupting the expression host containing ketone reductase, followed by centrifugation to separate cell debris and the ketone reductase containing the crude extract supernatant. The buffer solution is preferably selected from 10-200 mM Tris / HCl with pH 7-9 and 2 mM MgCl2, 10-200 mM sodium phosphate / NaOH with pH 6-8, or 10-200 mM triethanolamine / HCl with pH 7-9. Cofactor NAD is preferably added. +to a final concentration ranging from 0.05 to 10 mM. Preferably, the ketoreductase is added as a crude extract supernatant. The crude extract is obtained by disrupting the expression host containing the ketoreductase, followed by centrifugation to separate the cell debris and the ketoreductase containing crude extract supernatant.

[0182] In a preferred embodiment, the engineered ketoreductase exhibiting improved thermal stability differs from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by a residue change at at least one of the following positions: V89, Y125, or V229.

[0183] In another preferred embodiment, the engineered ketoreductase exhibiting improved thermal stability differs from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by an amino acid substitution at one, two, or three positions selected from positions V89, Y125, or V229, and at least one other amino acid substitution at a different position.

[0184] In a more preferred embodiment, the engineered ketoreductase exhibiting improved thermal stability differs from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by one of the following residue changes: V89F, Y125F, or V229I.

[0185] In another preferred embodiment, the engineered ketoreductase exhibiting improved thermal stability differs from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by an amino acid substitution at one, two, or three positions selected from positions V89F, Y125F, or V229I, and at least one other amino acid substitution at a different position.

[0186] In a most preferred embodiment, the engineered ketoreductase exhibiting improved thermal stability differs from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by the residue change V89F.

[0187] In another most preferred embodiment, the engineered ketoreductase exhibiting improved thermal stability differs from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 by the residue change V89F and at least one other amino acid substitution at a different position.

[0188] In another preferred embodiment, the engineered ketoreductase of the application differing from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 at one, two, or three positions selected from positions V89, Y125, or V229, more preferably at one, two, or three positions selected from positions V89F, Y125F, and V229I, exhibits an improved thermostability of 1 °C to 40°C, preferably 1 °C to 30°C, more preferably 1 °C to 20°C, even more preferably 3°C to 15°C, and most preferably 15°C compared to the wild-type ketoreductase of SEQ ID NO: 2.

[0189] In another embodiment, the engineered ketoreductase of the application differing from the amino acid sequence of the wild-type ketoreductase of SEQ ID NO: 2 at one, two, or three positions selected from positions V89, Y125, or V229 and at least one other amino acid substitution at a different position, most preferably at one, two, or three positions selected from positions V89F, Y125F, and V229I and at least one other amino acid substitution at a different position, exhibits an improved thermostability of 1 °C to 40°C, preferably 1 °C to 30°C, more preferably 1 °C to 20°C, even more preferably 3°C to 15°C, and most preferably 15°C compared to the wild-type ketoreductase of SEQ ID NO: 2.

[0190] Preferably, the ketoreductase of the application comprises or consists of an amino acid sequence having at least 85% homology, preferably at least 86% or at least 87%, more preferably at least 88% or at least 89%, still more preferably at least 90% or at least 91 %, still more preferably at least 92% or at least 93%, even more preferably at least 94% or at least 95%, most preferably at least 96% or at least 97%, in particular at least 98% or at least 99% homology to SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, or 93.

[0191] In preferred embodiments, the ketoreductase of the application is a variant of the polypeptide of SEQ ID NO: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, or 93 comprising a substitution, deletion, and / or insertion of 1-36 amino acids, e.g., 1-6 amino acids, 7-12 amino acids, 13-18 amino acids, 19-24 amino acids, 25-30 amino acids, or 31-36 amino acids.

[0192] In preferred embodiments, the ketoreductase of the application is a fragment of at least 220 amino acid residues, more preferably at least 225 amino acid residues, still more preferably at least 230 amino acid residues, still more preferably at least 235 amino acid residues, even more preferably at least 240 amino acid residues, most preferably at least 245 amino acid residues, most preferably at least 250 amino acid residues, most preferably at least 251 amino acid residues, most preferably at least 252 amino acid residues, particularly at least 253 amino acid residues of the polypeptide of SEQ ID NO: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, or 93. In this regard, a "fragment" refers to a contiguous subsequence of the respective SEQ ID NO, but shortened at the N-terminus and / or C-terminus.

[0193] In preferred embodiments, the ketoreductase of the application is a fusion protein of the amino acid sequence of SEQ ID NO: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, or 93 fused to the N-terminus and / or the C-terminus to any other amino acid, oligopeptide or polypeptide.

[0194] In preferred embodiments, the ketoreductase of the application comprises the amino acid sequence of SEQ ID NO: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, or 93, and additionally comprises at least 10 amino acid residues, more preferably at least 20 amino acid residues, even more preferably at least 30 amino acid residues, and most preferably at least 40 amino acid residues independently selected from Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val.

[0195] In some embodiments, the ketoreductase of the application is capable of oxidizing an aldehyde substrate to a carboxylic acid, wherein the aldehyde substrate is preferably selected from the group consisting of aliphatic, aromatic and heteroaromatic aldehyde substrates.

[0196] Another aspect of the application relates to a method for the stereoselective reduction of a ketone substrate to a secondary alcohol, comprising the step of reacting the ketone substrate with a suitable co-factor in the presence of a ketoreductase according to the application. Preferably, the suitable co-factor is NADH or NADPH. All preferred embodiments as defined above in relation to the ketoreductases according to the application also apply to the method according to the application and are therefore not repeated hereinafter.

[0197] Another aspect of the application relates to a method for the reduction of an aldehyde to a primary alcohol, comprising the step of reacting the aldehyde with a suitable co-factor in the presence of a ketoreductase according to the application. Preferably, the suitable co-factor is NADH or NADPH. All preferred embodiments as defined above in relation to the ketoreductases according to the application also apply to the method according to the application and are therefore not repeated hereinafter.

[0198] Preferably, the method comprises the conversion of a co-substrate for co-factor regeneration by the respective ketoreductase with high specific activity, preferably such co-substrate is selected from the group consisting of isopropanol, 2-butanol, 2-pentanol, 2-hexanol and 2-heptanol, most preferably isopropanol is converted to acetone with high specific activity. In a preferred embodiment of the method according to the application, the oxidized form of the co-factor NAD(P)H is regenerated by using an NADPH:NADH oxidase (NOX), e.g. from Lactobacillus sanfranciscensis (Lountos et al., Acta Cryst. (2004), D60, 2044-2047), and a suitable co-substrate, e.g. isopropanol. + .

[0199] Another aspect of the application relates to a method for the stereoselective oxidation of a secondary alcohol to a ketone product, comprising the step of reacting the secondary alcohol with a suitable co-factor in the presence of a ketoreductase according to the application. Preferably, the suitable co-factor is NAD + or NADP + . All preferred embodiments as defined above in relation to the ketoreductases according to the application also apply to the method according to the application and are therefore not repeated hereinafter.

[0200] Another aspect of the application relates to a method for the oxidation of a primary alcohol to an aldehyde, comprising the step of reacting the primary alcohol with a suitable co-factor in the presence of a ketoreductase according to the application. Preferably, the suitable co-factor is NAD + or NADP + . All preferred embodiments as defined above in relation to the ketoreductases according to the application also apply to the method according to the application and are therefore not repeated hereinafter.

[0201] Preferably, the method comprises the assisted conversion of a co-substrate for cofactor regeneration by the respective ketoreductase with high specific activity, preferably such co-substrate is selected from the group consisting of isopropanol, 2-butanol, 2-pentanol, 2-hexanol and 2-heptanol, most preferably isopropanol is converted to acetone with high specific activity. In a preferred embodiment of the inventive method, the reduced form of the cofactor NAD(P)H is regenerated by using an NADPH:NADH oxidase (NOX), e.g. from Luteococcus juenii (Lountos et al., Acta Cryst. (2004), D60, 2044-2047), and a suitable co-substrate, e.g. acetone.

[0202] Preferably, in the inventive method for the stereoselective reduction of a ketone substrate to a secondary alcohol and for the reduction of an aldehyde substrate to a primary alcohol, the respective aldehyde substrate and ketone substrate can be any aldehyde substrate or any ketone substrate, preferably a ketone substrate according to general formula (I) or an aldehyde substrate according to general formula (I'); or a 3-aryl-3-ketopropylamine-derivative according to general formula (II); or a 5-hydroxy-3-oxo-hexanoate-derivative according to general formula (III); or a phenylacetone-derivative according to general formula (IV); or a benzoyl-derivative according to general formula (V); or an open-chain diketone-derivative according to general formula (VI); or 3-quinuclidinone; or ethyl 3-oxo-3-phenyl-propionate; or ethyl-4-chloro-3-oxo-butanoate; or a ketose; or 2-butanal; or 1-heptanal.

[0203] All preferred embodiments as defined above in connection with the ketone substrates and aldehyde substrates of the present invention also apply to the inventive method and are therefore not repeated hereinafter.

[0204] Another aspect of the present invention relates to a method for the oxidation of an aldehyde substrate to a carboxylic acid, comprising the step of reacting the aldehyde substrate with a suitable cofactor in the presence of a ketoreductase of the present invention. Preferably, the suitable cofactor is NAD + or NADP + . All preferred embodiments as defined above in connection with the ketoreductases of the present invention also apply to the inventive method and are therefore not repeated hereinafter.

[0205] Preferably, the aldehyde substrate has the general formula (VII)

[0206]

[0207] wherein Z is selected from a saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic or cycloaliphatic C 1-12 -hydrocarbon residue; an unsubstituted or mono- or poly-substituted aromatic C 6-10 -hydrocarbon residue, optionally interrupted by a saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12- a hydrocarbon residue is bridged to the CO-moiety; and a heteroaromatic residue, which is unsubstituted or mono- or poly-substituted, optionally by a saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C 1-12 - a hydrocarbon residue is bridged to the CO-moiety; and a heteroaromatic residue, which is unsubstituted or mono- or poly-substituted, optionally by a saturated or unsaturated, unsubstituted or mono- or poly-substituted aliphatic C

[0208] wherein mono- or poly-substitution means being independently substituted by one or more functional groups selected from the group consisting of -halogen, -OH, =0, -OC 1-12 -alkyl, -OC 6-10 -aryl, -O-heteroaryl, -OCOC 1-12 -alkyl, -OCOC 6-10 -aryl, -OCO-heteroaryl, -SH, -SC 1-12 -alkyl, -SC 6-10 -aryl, -S-heteroaryl, -S(=0) 1-2 OH, -NO, -NO2, -N3, -NH2, -NH(C 1-12 -alkyl), -N(C 1-12 -alkyl)2, -NH(C 6-10 -aryl), -N(C 6-10 -aryl)2, -NH(heteroaryl), -N(heteroaryl)2, -CN, -CHO, -CO2H, CO-C 1-2 -alkyl, -CO-C 6-10 -aryl and -CO-heteroaryl.

[0209] Preferably, the method comprises the assisted conversion of a co-substrate for cofactor regeneration by the respective ketoreductase with high specific activity, preferably such co-substrate is selected from the group consisting of isopropanol, 2-butanol, 2-pentanol, 2-hexanol and 2-heptanol, most preferably isopropanol is converted to acetone with high specific activity. In a preferred embodiment of the inventive method, the reduced form of the cofactor NAD(P)H is regenerated by using an NADPH:NADH oxidase (NOX), e.g. from Luteococcus juenii (Lountos et al., Acta Cryst. (2004), D60, 2044-2047), and a suitable co-substrate, e.g. acetone.

[0210] Thus, the present invention also relates to a method for:

[0211] - the preparation of a secondary alcohol, involving the reduction of a ketone substrate, preferably stereoselectively, to said secondary alcohol;

[0212] - the preparation of a primary alcohol, involving the reduction of an aldehyde substrate to said primary alcohol;

[0213] - the preparation of a ketone product, involving the oxidation of a secondary alcohol substrate to said ketone product;

[0214] - the preparation of aldehydes, involving the oxidation of primary alcohol substrates to said aldehydes; and / or

[0215] - the preparation of carboxylic acids, involving the oxidation of aldehyde substrates to said carboxylic acids;

[0216] wherein the method comprises the step of reacting a substrate with a suitable co-factor in the presence of a ketoreductase enzyme of the application. For reduction reactions catalysed by ketoreductases (reduction of ketone substrates to the corresponding secondary alcohols, reduction of aldehydes to the corresponding primary alcohols) a reduced form of the suitable co-factor is required as an electron donor. For oxidation reactions catalysed by ketoreductases (oxidation of secondary alcohols to the corresponding ketones, oxidation of primary alcohols to the corresponding aldehydes, oxidation of aldehydes to the corresponding carboxylic acids) an oxidised form of the suitable co-factor is required as an electron acceptor.

[0217] When the substrate is chiral, the reaction can proceed with stereo- specificity, and thus be useful, for example, in kinetic resolution of racemic mixtures.

[0218] When setting up a process, for example the reduction of a ketone, on a preparative scale, the method of the application can be carried out taking into account one or more parameters selected from the following parameters: the reduction on a preparative scale can be carried out, for example, using isopropanol or glucose / GDH for co-factor regeneration. The method of the application can be carried out in an aqueous environment, in a non-aqueous environment or in a two-phase system. The method of the application can be carried out at a pH of 4-11, and / or at a temperature of 5°C-90°C and / or at a substrate concentration of 1-800 g / L. The method of the application can be carried out with free enzyme or with immobilised enzyme. The method of the application can be carried out in a batch process or with continuous removal of product. The method of the application can be carried out with high substrate feed, and / or by binding (for example by adsorption) of the product to a solid phase in the reaction vessel, and / or by addition of a water-soluble solvent and / or under high shear.

[0219] Another aspect of the present application relates to a method for increasing the thermostability of a ketoreductase having an amino acid sequence that is matchable to SEQ ID NO: 2, the method comprising engineering the ketoreductase, preferably the ketoreductase of SEQ ID NO: 2, at at least one of the amino acid positions selected from the positions corresponding to positions V89, Y125 and / or V229 of SEQ ID NO: 2. In this respect, "matchable" means that a meaningful comparison and matching of the two sequences can be made, such that the amino acid residues corresponding to positions V89, Y125 and / or V229 of SEQ ID NO: 2 can be identified. Typically, an amino acid sequence that belongs to the SDR family (protein family database in PF00106 (Pfam protein family database: M. Punta, P.C. Coggill, R.Y. Eberhardt, J. Mistry, J. Tate, C. Boursnell, N. Pang, K. Forslund, G. Ceric, J. Clements, A. Heger, L. Holm, E.L.L. Sonnhammer, S.R. Eddy, A. Bateman, R.D. Finn Nucleic Acids Research (2012) Database Issue 40:D290-D301), version Pfam 27.0) and / or comprises a ketoreductase activity (reduction of aldehydes and ketones to the corresponding primary and secondary alcohols and / or oxidation of primary and secondary alcohols to the corresponding aldehydes and ketones, respectively) and / or has at least 30% homology to SEQ ID NO: 2 can be considered "matchable". Preferably, the method comprises engineering the ketoreductase at one, two or three of the amino acid positions selected from the positions corresponding to positions V89, Y125 and / or V229 of SEQ ID NO: 2, and further engineering such amino acid sequence by replacing the respective amino acid residue with an arbitrary other protein-derived amino acid residue.

[0220] Preferably, the method is for increasing the thermostability of an arbitrary ketoreductase of SEQ ID NO: 2 or an arbitrary ketoreductase having at least 72% homology to the ketoreductase of SEQ ID NO: 2 by engineering the ketoreductase at at least one of the positions selected from positions V89, Y125 and / or V229. Preferably, the method comprises engineering the ketoreductase at one, two or three of the amino acid positions selected from the positions corresponding to positions V89, Y125 and / or V229, and further engineering such amino acid sequence.

[0221] Another aspect of the present application relates to a method of preparing a product, preferably a chiral product, comprising:

[0222] • a method for stereoselectively reducing a ketone substrate to a secondary alcohol according to the present application;

[0223] • a method for reducing an aldehyde to a primary alcohol according to the present application;

[0224] • a method for stereoselectively oxidizing a secondary alcohol to a ketone product according to the present application;

[0225] • a method for oxidizing a primary alcohol to an aldehyde according to the present application; and / or

[0226] • a method for oxidizing an aldehyde substrate to a carboxylic acid according to the present application.

[0227] All preferred embodiments as defined above in connection with the various methods of the present application, including the ketoreductase of the present application, the ketone substrate of the present application, the secondary alcohol substrate of the present application, the aldehyde substrate of the present application, the primary alcohol substrate of the present application, also apply to the methods of the present application and are therefore not repeated hereinafter.

[0228] Another aspect of the present application relates to the use of the ketoreductase of the present application for stereoselectively reducing a ketone substrate to a secondary alcohol.

[0229] Another aspect of the present application relates to the use of the ketoreductase of the present application for reducing an aldehyde to a primary alcohol.

[0230] Another aspect of the present application relates to the use of the ketoreductase of the present application for stereoselectively oxidizing a secondary alcohol to a ketone product.

[0231] Another aspect of the present application relates to the use of the ketoreductase of the present application for oxidizing a primary alcohol to an aldehyde product.

[0232] Another aspect of the present application relates to the use of the ketoreductase of the present application for oxidizing an aldehyde to a carboxylic acid.

[0233] Preferably, in the respective use of the present application for stereoselectively reducing a ketone substrate to a secondary alcohol and for reducing an aldehyde substrate to a primary alcohol, the aldehyde substrate and the ketone substrate can be any aldehyde substrate or any ketone substrate, preferably a ketone substrate according to general formula (I); or a 3-aryl-3-ketopropylamine-derivative according to general formula (II); or a 5-hydroxy-3-oxo-hexanoate-derivative according to general formula (III); or an acetophenone-derivative according to general formula (IV); or a benzoyl-derivative according to general formula (V); or an open-chain diketone-derivative according to general formula (VI); or a 3-quinuclidinone; or ethyl-3-oxo-3-phenyl-propionate; or ethyl-4-chloro-3-oxo-butanoate; or a ketose; or an aldehyde substrate according to general formula (I'); or 2-butanal; or 1-heptanal.

[0234] All preferred embodiments as defined above in connection with the ketone substrate and the aldehyde substrate of the present application also apply to the methods of the present application and are therefore not repeated hereinafter.

[0235] The following examples further illustrate the application but should not be construed as limiting its scope.

[0236] Example 1:

[0237] Detection of a new ketoreductase gene corresponding to SEQ ID NO: 1

[0238] A gene for a new ketoreductase was detected while screening for new ketoreductases in a genomic library from a microbial community present in a dead top of a Tilia cordada tree. DNA of microorganisms selectively grown in 96-well format was isolated, mechanically disrupted to the desired size range and cloned into the dual promoter expression vector system pF2F4 (WO 2010 / 075956 Al). The resulting plasmids were transformed into E. coli BL21 (DE3) placI (+) cells. Screening of the library was performed by cluster screening (WO 2005 / 040376 A2) with a cluster size of 5,000-350,000 clones per plate.

[0239] For expression of the genomic library, cells were grown in ZYM 505 medium (F. William Studier, Protein Expression and Purification 41 (2005) 207-234) supplemented with kanamycin (50 mg / 1) and chloramphenicol (34 mg / 1). Expression of the genes of the genomic library was induced by IPTG (0.1 mM) or arabinose (0.1 (v / v)) in the logarithmic phase. Cultivation was performed at 30°C for 16 hours.

[0240] Cells were harvested by centrifugation (3220 x g, 20 min, 4°C) and cells were disrupted with cell lysis buffer (50 mM Tris-HCl pH 7.0; 2 mM MgCl2, 1 x CelLytic B (Sigma); DNA nuclease 0.02 U, lysozyme 0.5 mg / ml). Crude extracts were isolated from cell debris by centrifugation (3220 x g 30 min, 4°C).

[0241] The ability of the crude extracts of the genomic library to reduce the substrate mixture (ethyl-4-chloro-3-oxo-butyrate and 1-(4-chloro-phenyl)ethanone) was investigated by measuring the decrease in absorbance at 340 nm caused by oxidation of NAD(P)H.

[0242] Example 2:

[0243] Expression of a new ketoreductase gene corresponding to SEQ ID NO: 1

[0244] The newly discovered ketoreductase gene corresponding to SEQ ID NO: 1 was cloned into the expression vector pLE1A23 (derivative of pRSF-1b, Novagen). In addition, the gene was optimized for E. coli expression with codons, while reducing the GC content (see SEQ ID NO: 2). The gene was cloned into the expression vector pLE1A27 (derivative of pRSF-1b, Novagen). The resulting plasmid was used to transform E. coli BL21 (DE3) cells.

[0245] For expression of the new ketoreductase gene corresponding to SEQ ID NO: 1, the cells were cultivated at 37°C in ZYM505 medium (F. William Studier, Protein Expression and Purification 41 (2005) 207-234) supplemented with kanamycin (50 mg / 1). The expression of the gene was induced by IPTG (0.1 mM) in the logarithmic phase and carried out at 30°C for 16-18 hours.

[0246] The cells were harvested by centrifugation (3220 x g, 20 min, 4°C) and the cells were disrupted with cell lysis buffer (50 mM Tris-HCl pH 7.0; 2 mM MgCl2, 1 x CelLytic B (Sigma); DNA nuclease 0.02 U, lysozyme 0.5 mg / ml). The crude extract was separated from the cell debris by centrifugation (3220 x g 30 min, 4°C).

[0247] The ketoreductase expression level of the crude extract was investigated by SDS-PAGE denaturation and its ability to reduce ethyl-4-chloro-3-oxo-butanoate by measuring the absorbance decrease at 340 nm caused by the oxidation of NAD(P)H.

[0248] Example 3:

[0249] Reduction of ethyl-4-chloro-3-oxo-butanoate to (3S)-4-chloro-3-hydroxy- butanoate by the new ketoreductase of SEQ ID NO: 2 on a preparative scale

[0250] In a 250 ml round bottom flask, equipped with a magnetic stirrer, 24.08 g D(+)-glucose monohydrate was dissolved in 0.1 M sodium phosphate buffer pH 6.5 to a final volume of 45 ml. The pH of the solution was adjusted to pH 6.5-6.6 with NaOH. 10.7 mg of the new ketoreductase of SEQ ID NO: 2, 22.9 mg of glucose dehydrogenase (GDH-03, commercially available at c-LEcta GmbH) and 39.8 mg of NAD + The flask was connected to a pH Stat titration device and adjusted to 35°C under stirring. The reaction was started by stepwise controlled addition of 18.18 g ethyl-4-chloro-3-oxo-butanoate in 9.375 ml n-butyl acetate. During the whole reaction time the mixture was stirred and adjusted to 35°C. The pH was automatically controlled by the pH-stat device by addition of NaOH (set point: pH = 6.5). The progress of the reaction was controlled by tracking the amount of 5 M NaOH automatically titrated by the pH Stat. After 22 hours the reaction was complete with a total conversion of > 99.9% analyzed by GC analysis. The reduced product showed an enantiomeric excess of > 99 for ethyl (3S)-4-chloro-3-hydroxy-butanoate.

[0251] Example 4:

[0252] Evaluation of the thermal stability of ketoreductase variants

[0253] The thermal stability of several ketoreductase variants that have been generated was analyzed. Melting curves were recorded by incubating the crude extract containing the ketoreductase at different temperatures for 15 minutes in a PCR cycler. The crude extract was then incubated on ice for 30 minutes. Insoluble proteins were separated by centrifugation and the remaining ketoreductase activity of the supernatant was analyzed in a standard ketoreductase assay. In this standard assay, isopropanol is oxidized by the ketoreductase to acetone, accompanied by the reduction of NAD + to NADH. The increase of the ketoreductase was monitored by measuring the absorbance at 340 nm in a standard photometer.

[0254] It was found that the ketoreductase corresponding to SEQ ID NO: 4 exhibited a melting temperature (Tm) that was 15°C higher than the Tm of the wild type ketoreductase of SEQ ID NO: 2.

[0255] Example 5:

[0256] Reduction of tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate by engineered ketoreductases from the ketoreductase of SEQ ID NO: 2

[0257] The ability of the large number of engineered ketoreductases that had been generated to reduce the substrate tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate to tert-butyl (5R)-6-cyano-3,5-dihydroxy-hexanoate was analyzed. Screening assays were performed in 96-well plates with 0.1 M sodium phosphate buffer, pH 6.5, 0.1 M final concentration of pure tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate, 1 mM co-factor NAD + in a final volume of 150 μΐ per well. Reactions were initiated by adding 10 μΐ of crude extract diluted 1-300 fold in 0.05 M Tris-HCl buffer, pH 7.0, 2 mM MgCl2to each well. The activity of the ketoreductase variants was determined by measuring the decrease in absorbance at 340 nm in an enzyme plate reader at 30°C. The ketoreductase variant corresponding to SEQ ID NO: 91 was found to reduce the substrate tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate at a rate that was 55-fold higher than the ketoreductase of SEQ ID NO: 2.

[0258] Example 6:

[0259] Preparation of a large scale reduction of tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo- hexanoate by engineered ketoreductases from the ketoreductase of SEQ ID NO: 2

[0260] In a glass beaker, 4.3 g of crude tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate (purity ~ 70%) (equivalent to 3 g of pure tert-butyl (5R)-6-cyano-5-hydroxy-3-oxo-hexanoate) was weighed. 3.7 g of D(+)-glucose monohydrate in water (final volume 6.8 ml), 1.5 ml of 1 M sodium phosphate buffer, pH 6.5, and 10 mg of NAD +A solution of 0.5 M N,N-dimethyl-3-keto-3-(2-thienyl)-1 -ketopropylamine and 1 mM co-factor NADPH in 0.1 M triethanolamine-HCI buffer, pH 9.0, and 50 isopropanol (v / v) was prepared. The pH of the solution was adjusted to 6.5-6.6 with NaOH. The reaction mixture was attached to a pH Stat titration device and adjusted to 30°C with stirring. The reaction was started by the addition of a solution of engineered ketoreductase corresponding to SEQ ID NO: 91 (21 mg) and glucose dehydrogenase (GDH-03, 10 mg) in water. The mixture was stirred and adjusted to 30°C throughout the reaction time. The pH was automatically controlled by the pH-stat device by the addition of NaOH (set point: pH = 6.5). The progress of the reaction was controlled by tracking the amount of 5 M NaOH automatically titrated by the pH Stat. After 12 hours the reaction was complete with a total conversion of >95% analyzed by the HPLC assay (detection at 212 nm and 200 nm, quantification by calibration curves of substrates and products). The measurement by chiral HPLC showed that the reduced product had a diastereomeric excess of >99 for the cis product (tert-butyl (3R,5R)-6-cyano-3,5-dihydroxy-hexanoate) over the corresponding trans product (anti product) (tert-butyl (3S,5R)-6-cyano-3,5-dihydroxy-hexanoate).

[0261] Example 7:

[0262] Reduction of N,N-dimethyl-3-keto-3-(2-thienyl)-1 -ketopropylamine by engineered ketoreductase from ADH97

[0263] A number of engineered ketoreductases that had been produced were analyzed for their ability to reduce the substrate N,N-dimethyl-3-keto-3-(2-thienyl)-1 -ketopropylamine to N,N-dimethyl-3-hydroxy-3-(2-thienyl)-1 -propylamine. The screening assay was performed in 96-well plate format with a final volume of 300 μΐ of 0.1 M triethanolamine-HCI buffer, pH 9.0, 50 isopropanol (v / v), and a final concentration of 0.5 M N,N-dimethyl-3-keto-3-(2-thienyl)-1 -ketopropylamine and 1 mM co-factor NADPH in each well. The reaction was started by adding 10 μΐ of crude extract diluted 1 -10 fold in 0.1 M triethanolamine-HCI buffer to each well. The reactions were incubated at 30°C for 20 hours. The activity of the ketoreductase variants was determined by HPLC analysis of the substrates and products (detection at 230 nm / 245 nm, determination of conversion by calibration curves of substrates and products). It was found that the ketoreductase variant corresponding to SEQ ID NO: 58 was able to reduce the substrate N,N-dimethyl-3-keto-3-(2-thienyl)-1 -ketopropylamine. After 20 hours of reaction a conversion of 23% was obtained. The ketoreductase of SEQ ID NO: 2 did not show conversion under the given conditions. + A number of engineered ketoreductases that had been produced were analyzed for their ability to reduce the substrate N,N-dimethyl-3-keto-3-(2-thienyl)-1 -ketopropylamine to N,N-dimethyl-3-hydroxy-3-(2-thienyl)-1 -propylamine. The screening assay was performed in 96-well plate format with a final volume of 300 μΐ of 0.1 M triethanolamine-HCI buffer, pH 9.0, 50 isopropanol (v / v), and a final concentration of 0.5 M N,N-dimethyl-3-keto-3-(2-thienyl)-1 -ketopropylamine and 1 mM co-factor NADPH in each well. The reaction was started by adding 10 μΐ of crude extract diluted 1 -10 fold in 0.1 M triethanolamine-HCI buffer to each well. The reactions were incubated at 30°C for 20 hours. The activity of the ketoreductase variants was determined by HPLC analysis of the substrates and products (detection at 230 nm / 245 nm, determination of conversion by calibration curves of substrates and products). It was found that the ketoreductase variant corresponding to SEQ ID NO: 58 was able to reduce the substrate N,N-dimethyl-3-keto-3-(2-thienyl)-1 -ketopropylamine. After 20 hours of reaction a conversion of 23% was obtained. The ketoreductase of SEQ ID NO: 2 did not show conversion under the given conditions.

[0264] Example 8:

[0265] Preparation of the scale reduction N,N-dimethyl-3-keto-3-(2-thienyl)-1- ketopropylamine by the engineered ketoreductase from SEQ ID NO: 2

[0266] Into a 500 ml round bottom flask equipped with a magnetic stirrer was added 25% NaOH (110 ml), isopropanol (41.5 ml) and N,N-dimethyl-keto-3-(2- thienyl)-1-ketopropylamine hydrochloride (60 g). The resulting slurry was stirred at room temperature until complete dissolution and phase separation occurred. In a glass beaker, water (40 ml) was added to 27.3 ml of the upper layer. The pH of the solution was adjusted to 9.0 by the addition of concentrated sulfuric acid. To the mixture was added 37.5 ml of isopropanol followed by 66.5 mg of NAD + The flask neck was connected to a rotary evaporator and the solution was adjusted to 40°C by rotating the flask in a preheated (40°C) oil bath. A solution of engineered ketoreductase corresponding to SEQ ID NO: 58 (1.35 g) dissolved in 22.5 ml of water was added to start the reaction. During the entire reaction time, the mixture was rotated and adjusted to 40°C in the oil bath and vacuum (110 mbar, 82.5 mm Hg) was applied to mainly remove acetone and isopropanol. Periodically every half hour a preheated (40°C) mixture of isopropanol and water (80:20) was added to the reaction mixture. Every hour a sample was taken to control the reaction progress and analyzed by HPLC (detection at 230 nm / 245 nm, conversion was determined by calibration curves of the substrates and products). After 8 hours the reaction was complete with a total conversion of > 98%. The reduction product showed an enantiomeric excess of > 99.5 in favor of the enantiomer (1S)-3-(dimethylamino)-1-(2-thienyl)-propan-1-ol.

[0267] Example 9:

[0268] Reduction of ethyl open-dione (ethyl-3-methoxy-8,14-open-sterane-1,3,5(10),9(11)- tetraen-14,17-dione) by the engineered ketoreductase from SEQ ID NO: 2

[0269] The ability of the large number of engineered ketoreductases generated to reduce the substrate ethyl ring-opened diketone (ethyl-3-methoxy-8,14-ring-opened- stigmasta-1,3,5(10),9(11 )-tetraen-14,17-dione) was analyzed. The screening assay was performed in 96-well plate scale with a final volume of 500 μΙ in each well of 0.1 M triethanolamine / HCI buffer, pH 7.0, 2 mM MgCI2, 50% isopropanol (v / v), 1 % Triton™ X-100 (v / v), 3% DMSO (v / v), 10 g / l final concentration of ethyl ring-opened diketone (ethyl-3-methoxy-8,14-ring-opened-stigmasta-1,3,5(10),9(11 )-tetraen-14,17-dione) and 1 mM of the co-factor NADPH + The reaction was started by adding 10 μΙ of the diluted 1 -10 fold crude extract to each well. The reaction was incubated for 4 hours at 30°C while stirring. The activity of the ketoreductase variants was determined by HPLC analysis (detection at 265 nm; conversion was determined by calibration curves of the substrate and the product). It was found that the ketoreductase variant corresponding to SEQ ID NO: 70 was able to reduce the substrate ethyl ring-opened diketone (ethyl-3-methoxy-8,14-ring-opened-stigmasta-1,3,5(10),9(11 )-tetraen-14,17-dione) with a conversion of 94% and a stereoisomeric excess of the 17-beta-ring-opened alcohol (ethyl-3-methoxy-8,14-ring-opened-stigmasta-1,3,5(10),9(11 )-tetraen-14-one-17-beta-ol) > 99.5% under the given conditions. The ketoreductase of SEQ ID NO: 2 did not show conversion under the given conditions.

[0270] The engineered ketoreductase corresponding to SEQ ID NO: 70 can also be used for the production scale reduction of ethyl ring-opened diketone (ethyl-3-methoxy-8,14- ring-opened-stigmasta-1,3,5(10),9(11 )-tetraen-14,17-dione) under similar conditions as described in this example, wherein a substrate feed is applied.

[0271] Example 10:

[0272] reduction of tert-butyl (5S)-6-chloro-5-hydroxy-3-oxobutanoate by engineered ketoreductases from SEQ ID NO: 2

[0273] The ability of the large number of engineered ketoreductases generated to reduce the substrate (5S)-6-chloro-5-hydroxy-3-oxohexanoate to tert-butyl (5S)-6-chloro-3,5- dihydroxy-hexanoate was analyzed. The screening assay was performed in 96-well plate format with a final volume of 150 μΐ in each well of 0.1 M sodium phosphate buffer, pH 6.5, and a final concentration of 25 mM of purified (5S)-6-chloro-5-hydroxy-3- oxohexanoate and 1 mM of the co-factor NAD + The reaction was initiated by adding 10 μΐ of crude extract diluted several times in 0.05 M Tris-HCl buffer, pH 7.0, 2 mM MgCl2to each well. The activity of the ketoreductase variants was determined by measuring the decrease in absorbance at 340 nm in an enzyme reader at 30 °C. The ketoreductase variants corresponding to SEQ ID NOs: 62 and 91 were found to reduce the substrate (5S)-6-chloro-5-hydroxy-3-oxohexanoate at a rate that was 3-fold higher than the ketoreductase of SEQ ID NO: 2.

[0274] The engineered ketoreductases corresponding to SEQ ID NOs: 62 and 91 can also be used to reduce (5S)-6-chloro-5-hydroxy-3-oxohexanoate to tert-butyl (3R,5S)-6-chloro-3,5- dihydroxy-hexanoate on a preparative scale under conditions comparable to those described in Example 6.

[0275] Example 11:

[0276] Reduction of N-mono-methyl-3-keto-3-(2-thienyl)-1-ketopropylamine by engineered ketoreductases from SEQ ID NO: 2

[0277] The ability of the large number of engineered ketoreductases generated to reduce the substrate N-mono-methyl-3-keto-3-(2-thienyl)-1-ketopropylamine to N-mono-methyl-3-hydroxy-3- (2-thienyl)-1-propylamine was analyzed. The screening assay was performed in 96-well plate format with a final volume of 150 μΐ in each well of 0.1 M triethanolamine / HCl buffer, pH 7.0, 10 isopropanol (v / v), a final concentration of 0.1 M of N-mono-methyl-3-keto-3-(2- thienyl)-1-ketopropylamine and 1 mM of the co-factor NAD +The final volume was 200 μΐ. The reaction was started by adding 10 μΐ of the crude extract to each well. The reactions were incubated for 4 hours and 24 hours at 30°C. The activity of the ketoreductase variants was determined by HPLC analysis (detection at 230 nm / 245 nm; conversion was determined by calibration curves of the substrate and the product). It was found that the ketoreductase variants corresponding to SEQ ID NO: 58 and SEQ ID NO: 87 were able to reduce the substrate N-mono-methyl-3-keto-3-(2-thienyl)-1-ketopropylamine best. Conversion rates of 40-43% and 87-89% were obtained after 4 hours and 24 hours, respectively. The ketoreductase of SEQ ID NO: 2 did not show conversion under the given conditions.

[0278] The ketoreductase variants corresponding to SEQ ID NO: 58 and 87 can also be used to reduce N-mono-methyl-3-keto-3-(2-thienyl)-1-ketopropylamine on a preparative scale to (1 S)-3-(methylamino)-1 -(2-thienyl)-propan-1 -ol under conditions comparable to those described in Example 6 or Example 8. SEQUENCE LISTING <110> C-LEOCTA GMBH <120> KETOREDUCTASE <130> KHP16213046.3 <150> EP 14165444.2 <151> 2014-04-22 <160> 93 <170> PatentIn version 3.5 <210> 1 <211> 765 <212> DNA <213> Unknown <220> <223> Isolated from a library <400> 1 atggctacacaattcgacggt aagaccgctc tc atcaccgg aggggcttcc ggcatcggc 60 tatgccgtcgc cctcgagctc gccgcggagg gtgccagcgt cgtcgtgca ggacctgcgc 120 ctcgaagcag cacagcaggt ggcagatgag atcaccgccg ccggcggcac ggcgatcgcc 180 gtagccggcg acgtcggcaa gccggaagac gtcaaagccg ccgtcgacgc cgccgtggcc 240 gcctatggcg ccctgcacct tgccgtcaac aacgccggca tcggcggccc caccgggctc 300 atcggcgact acgacgactc cgatggcttc gccgcctacc gcaagctcat cgatgtgaac 360 cttaactccg tctactacgg cctgcgctat gagatccctg ccatcatcag cgcgggcggc 420 ggttccattg tgaacacctc gtccatcctc gggctggtat ccgagccgac cgccgccccg 480 tacacgacgg ccaagcacgg tgttgccggt ctgaccaagg ccgctgccgc gggctacgcg 540 tcccagggtg tccgcatcaa ctccgtccac cccggataca tcgacacccc cctgctcgcc 600 gcgatgccca aagaggccta cgacgccctc gtgtccaagc acccgatcgg ccgcctgggt 660 accgcggaag aagtcgccca cctcgtgact ttcctcctca gtgataaggc cagcttcatc 720 accggctcgc aacacgtcgt tgacggcgga tacgtcgcgg tctag 765 <210> 2 <211> 254 <212> PRT <213> Unknown <220> <223> Isolated from a library <400> 2 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 3 <211> 765 <212> DNA <213> Artificial Sequence <220> <223> Codi n-Optimized Artificial Synthetic Sequence <400> 3 atggcaaccc agtttgatgg taaaaccgca ctgattaccg gtggtgcaag cggtattggt 60 tatgcagttg cactggaact ggcagcagaa ggtgccagcg ttgttgttca ggatctgcgt 120 ctggaagcag cacagcaggt tgcagatgaa attaccgcag ccggtggcac cgcaattgca 180 gttgccggtg atgttggtaa accggaagat gttaaagcag cagttgatgc agccgttgca 240 gcatatggtg cactgcatct ggcagttaat aatgcaggta ttggtggtcc gaccggtctg 300 attggtgatt atgatgatag tgatggtttt gcagcctatc gcaaactgat tgatgttaat 360 ctgaacagcg tgtattatgg cctgcgttat gaaattccgg caattattag tgccggtggt 420 ggtagcattg ttaataccag cagcattctg ggtctggtta gcgaaccgac cgcagcaccg 480 tataccaccg caaaacatgg tgttgcaggt ctgaccaaag cagccgcagc gggttatgca 540 agccagggtg ttcgtattaa tagcgttcat ccgggttata ttgatacacc gctgctggca 600 gcaatgccga aagaagcata cgacgcactg gttagcaaac atccgattgg tcgtctgggc 660 accgcagaag aagttgcaca tctggttacc tttctgctga gcgataaagc aagctttatt 720 accggtagcc agcatgttgt tgatggtggt tatgttgcag tttaa 765 <210> 4 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 4 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Phe Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 5 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 5 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Phe Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 6 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 6 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Ile Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 7 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 7 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gin Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Ser Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 8 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 8 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Ser Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Ala Gly Leu Val Ser Ser Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Val Ile Asp Thr Pro Leu Ala Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 9 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 9 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Glu Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile His Gly Leu Val Ser Glu Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 10 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 10 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gln Gly 85 90 95 Ala Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 11 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 11 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Met Gly 85 90 95 Val Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Ser Pro Thr Val Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Pro Ile Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 12 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 12 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Ser Gly 85 90 95 Tyr Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Phe Gly Leu Val Ser Ser Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Ile Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 13 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 13 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gln Gly 85 90 95 Lys Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Ser Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Ala Ile Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 14 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 14 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Met Gly 85 90 95 Lys Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Leu Pro Thr Ser Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Ala Ile Asp Thr Pro Leu Ala Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 15 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 15 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Met Gly 85 90 95 Tyr Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Ala Gly Leu Val Ser Ala Pro Thr Gly Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Ala Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 16 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 16 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Cys Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Met Gly 85 90 95 Ala Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Leu Gly Leu Val Ser Glu Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Ile Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 17 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 17 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Met Gly 85 90 95 Asn Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Ala Gly Leu Val Ser Glu Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Ala Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 18 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 18 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Ser Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Phe Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Phe Ile Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 19 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 19 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Met Gly 85 90 95 Val Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Ala Gly Leu Val Ser Leu Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gin Gly Val Arg lie Asn Ser Val His Pro Gly 180 185 190 Phe lie Asp Thr Pro Leu Ala Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro lie Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe lie 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 20 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 20 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gin Gly 85 90 95 Ala Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Phe Gly Leu Val Ser Ser Pro Thr Val Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Val Ile Asp Thr Pro Leu Ile Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 21 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 21 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Ser Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Met Gly 85 90 95 Tyr Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Leu Gly Leu Val Ser Phe Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Ala Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 22 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 22 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Met Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Leu Gly Leu Val Ser Lys Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Thr Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 23 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 23 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Met Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Leu Gly Leu Val Ser Ser Pro Thr Val Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gin Gly Val Arg lie Asn Ser Val His Pro Gly 180 185 190 Phe lie Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro lie Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe lie 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 24 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 24 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Ala Gly 85 90 95 Asn Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Ala Gly Leu Val Ser Leu Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Pro Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 25 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 25 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gln Gly 85 90 95 Val Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Ser Gly Leu Val Ser Gly Pro Thr Pro Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Val Ile Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 26 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 26 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Met Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Ala Gly Leu Val Ser Phe Pro Thr Ser Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Ala Ile Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 27 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 27 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Ser Gly 85 90 95 Glu Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Ala Gly Leu Val Ser Leu Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gin Gly Val Arg lie Asn Ser Val His Pro Gly 180 185 190 Val lie Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro lie Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe lie 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 28 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 28 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Ser Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Leu Gly Leu Val Ser Glu Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Val Ile Asp Thr Pro Leu Ala Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 29 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 29 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Pro Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 30 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 30 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Ser Gly 85 90 95 Ala Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Ala Gly Leu Val Ser Leu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Phe Ile Asp Thr Pro Leu Ala Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 31 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 31 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Ser Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Leu Gly Leu Val Ser Glu Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Thr Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 32 <211> 254 <212> PRT <213> artificial sequence <220> <223> Separation from the library <400> 32 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Phe Gly Leu Val Ser Lys Pro Thr Ser Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Pro Ile Asp Thr Pro Leu Phe Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 33 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 33 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Glu Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Ala Gly Leu Val Ser Ser Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Val Ile Asp Thr Pro Leu Thr Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 34 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 34 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Met Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Ala Gly Leu Val Ser Glu Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Val Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 35 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 35 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Ala Gly 85 90 95 Ala Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Phe Gly Leu Val Ser Ala Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gin Gly Val Arg lie Asn Ser Val His Pro Gly 180 185 190 Pro lie Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro lie Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe lie 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 36 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 36 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Ala Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Ala Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 37 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 37 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Ala Gly 85 90 95 Val Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Leu Gly Leu Val Ser Glu Pro Thr Ser Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Ala Ile Asp Thr Pro Leu Ile Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 38 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 38 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Val Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Ala Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 39 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 39 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Phe Gly Leu Val Ser Ser Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gin Gly Val Arg lie Asn Ser Val His Pro Gly 180 185 190 Gly lie Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro lie Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe lie 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 40 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 40 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Leu Gly Leu Val Ser Asp Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 41 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 41 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Leu Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 42 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 42 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Met Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 43 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 43 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Gly Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 44 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 44 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Thr Phe Gly Leu Val Ser Ser Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 45 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 45 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Gln Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 46 <211> 254 <212> PRT <213> artificial sequence <220> <223> Separation from the library <400> 46 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ala Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 47 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 47 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 48 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 48 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Glu Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Phe Gly Leu Val Ser Ser Pro Thr Gin Ala Pro 145 150 155 160 ​​​​​​​​​​​​​​​​​​​Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 49 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 49 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 50 <211> 254 <212> PRT <213> artificial sequence <220> <223> Separation from the library <400> 50 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Gly Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 51 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 51 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Arg Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 52 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 52 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Phe Gly Leu Val Ser Ser Pro Tyr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 53 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 53 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Val Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Ser Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 54 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 54 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ile Phe Gly Leu Val Gly Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 55 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 55 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Val Arg Leu Glu Gly Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Gly Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Gly Met Pro Lys Glu Ala Leu Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 56 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 56 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Val Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Gly Ser Pro Tyr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Gly Met Pro Lys Glu Ala Arg Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 57 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 57 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Val Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Gly Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Gly Met Pro Lys Glu Ala Leu Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 58 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 58 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Val Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Gly Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Gly Met Pro Lys Glu Ala Arg Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 59 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 59 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Val Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Gly Ser Pro Thr Trp Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Gly Met Pro Lys Glu Ala Arg Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 60 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 60 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 61 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 61 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 62 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 62 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Gly Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 63 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 63 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Ala Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Tyr Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 64 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 64 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 65 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 65 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Ala Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 66 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 66 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Ser Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 67 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 67 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Ala Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 68 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 68 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gin Ala Pro 145 150 155 160 ​​​​​​​​​​​​​​​​​​​Tyr Thr Ser Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 69 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 69 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val Cys Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 70 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 70 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Gly Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 71 <211> 254 <212> PRT <213> artificial sequence <220> <223> Separation from the library <400> 71 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Gly Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 72 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 72 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 73 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 73 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Ser Gly Leu Val Ser Leu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 74 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 74 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Ser Gly Leu Val Ser Asp Pro Thr Ser Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 75 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 75 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Leu Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gin Gly Val Arg lie Asn Ser Val His Pro Gly 180 185 190 Gly lie Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro lie Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe lie 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 76 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 76 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Ser Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 77 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 77 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Ala Pro Thr Ser Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 78 <211> 254 <212> PRT <213> artificial sequence <220> <223> Separation from the library <400> 78 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Asp Pro Thr Ser Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 79 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 79 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Thr Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Gly Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Tyr Asn Leu Asn Ser lie Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 80 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 80 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Gly Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Tyr Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Gin Asn Ser lie Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Gly Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 81 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 81 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Gly Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Tyr Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Ile Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Gly Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Ile Asp Gly Gly Tyr Val Ala Val 245 250 <210> 82 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 82 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Thr Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ala Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Gly Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Tyr Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Ile Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Gly Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val He Asp Gly Gly Tyr Val Ala Val 245 250 <210> 83 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 83 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu He Thr Gly Gly Ala 1 5 10 15 Ser Gly He Gly Tyr Ala Thr Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ala Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu He Thr Ala Ala Gly Gly Thr Ala He Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly He Gly Gly 85 90 95 Pro Gly Gly Leu He Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu He Asp Val Asn Leu Asn Ser He Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Gly Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Ile Asp Gly Gly Tyr Val Ala Val 245 250 <210> 84 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 84 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Met Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser lie Ala Gly Leu Val Ser Glu Pro Thr Leu Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Thr Ile Asp Thr Pro Leu Ile Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 85 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 85 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Gly Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Gly Met Pro Lys Glu Ala Arg Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 86 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 86 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Val Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Gly Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Gly Met Pro Lys Glu Ala Arg Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 87 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 87 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Val Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Gly Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Gly Met Pro Lys Glu Ala Arg Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 88 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 88 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Val Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Thr Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Gly Ser Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Gly Met Pro Lys Glu Ala Arg Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 89 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 89 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Val Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Phe Gly Leu Val Gly Ser Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Ala Arg Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 90 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 90 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Ala Gly 85 90 95 Pro Thr Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Thr Leu Gly Leu Val Ser Glu Pro Thr Ala Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Leu Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 91 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 91 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Glu Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Ala Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Gly Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser Val Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 92 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 92 Met Ala Thr Gin Phe Asp Gly Lys Thr Ala Leu lie Thr Gly Gly Ala 1 5 10 15 Ser Gly lie Gly Tyr Ala Thr Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gin Asp Leu Arg Leu Glu Ala Ala Gin Gin Val Ala 35 40 45 Asp Glu lie Thr Ala Ala Gly Gly Thr Ala lie Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly lie Gly Gly 85 90 95 Pro Gly Gly Leu lie Gly Asp Tyr Asp Asp Ser Asp Tyr Phe Ala Ala 100 105 110 Tyr Arg Lys Leu lie Asp Val Asn Leu Asn Ser lie Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu lie Pro Ala lie lie Ser Ala Gly Gly Gly Ser lie Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gin Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Ala Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro Ile Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe Ile 225 230 235 240 Thr Gly Ser Gln His Val Val Asp Gly Gly Tyr Val Ala Val 245 250 <210> 93 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Isolated from a library <400> 93 Met Ala Thr Gln Phe Asp Gly Lys Thr Ala Leu Ile Thr Gly Gly Ala 1 5 10 15 Ser Gly Ile Gly Gln Ala Val Ala Leu Glu Leu Ala Ala Glu Gly Ala 20 25 30 Ser Val Val Val Gln Asp Leu Arg Leu Glu Ala Ala Gln Gln Val Ala 35 40 45 Asp Glu Ile Thr Ala Ala Gly Gly Thr Ala Ile Ala Val Ala Gly Asp 50 55 60 Val Gly Lys Pro Glu Asp Val Lys Ala Ala Val Asp Ala Ala Val Ala 65 70 75 80 Ala Tyr Gly Ala Leu His Leu Ala Val Asn Asn Ala Gly Ile Gly Gly 85 90 95 Pro Gly Gly Leu Ile Gly Asp Tyr Asp Asp Ser Asp Tyr Phe Ala Ala 100 105 110 Tyr Arg Lys Leu Ile Asp Val Asn Leu Asn Ser Ile Tyr Tyr Gly Leu 115 120 125 Arg Tyr Glu Ile Pro Ala Ile Ile Ser Ala Gly Gly Gly Ser Ile Val 130 135 140 Asn Thr Ser Ser Val Leu Gly Leu Val Ser Glu Pro Thr Gln Ala Pro 145 150 155 160 Tyr Thr Thr Ala Lys His Gly Val Ala Gly Leu Thr Lys Ala Ala Ala 165 170 175 Ala Gly Tyr Ala Ser Gln Gly Val Arg Ile Asn Ser Val His Pro Gly 180 185 190 Gly Ile Asp Thr Pro Met Leu Ala Ala Met Pro Lys Glu Gly Tyr Asp 195 200 205 Ala Leu Val Ser Lys His Pro lie Gly Arg Leu Gly Thr Ala Glu Glu 210 215 220 Val Ala His Leu Val Thr Phe Leu Leu Ser Asp Lys Ala Ser Phe lie 225 230 235 240 Thr Gly Ser Gin His Val Val Asp Gly Gly Tyr Val Ala Val 245 250

Claims

1. Ketoreductase, the amino acid sequence of which is SEQ ID NO: 2, SEQ ID NO: 91, SEQ ID NO: 58, SEQ ID NO: 70, SEQ ID NO: 62 or SEQ ID NO:

87.

2. The ketone reductase according to claim 1, which is stereoselectively capable of reducing ketone substrates of general formula (I) to secondary alcohols. (I)； Alternatively, it can reduce aldehyde substrates of general formula (I') to primary alcohols. (I')； Where X and Y are each independently selected from saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic or alicyclic C. 1-12 - Hydrocarbon residue; unsubstituted, monosubstituted, or polysubstituted C 6-10 -Aromatic hydrocarbon residues, optionally via saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic C 1-12 - Hydrocarbon residues partially bridged to CO-; unsubstituted, monosubstituted, or polysubstituted heteroaromatic residues, optionally via saturated or unsaturated, unsubstituted, monosubstituted, or polysubstituted aliphatic C-. 1-12 - Hydrocarbon residues are partially bridged with CO-; and sugar residues containing monosaccharides, disaccharides or oligosaccharides or deoxy sugar residues containing monosaccharides, disaccharides or oligosaccharides; Mono- or poly-substituted means independently substituted by one or more functional groups selected from the following: -halogen, -OH, =O, -OC. 1-12 -alkyl, -OC 6-10 -aryl, -O-heteroaryl, -OCOC 1-12 -alkyl, -OCOC 6-10 -aryl, -OCO-heteroaryl, -SH, -SC 1-12 -alkyl, -SC 6-10 -aryl, -S-heteroaryl, -S(=O) 1-2 OH, -NO, -NO2, -N3, -NH2, -NH(C 1-12 -alkyl), -N(C 1-12 -alkyl)2, -NH(C 6-10 -aryl), -N(C 6-10 -aryl)2, -NH (heteroaryl), -N (heteroaryl)2, -CN, -CHO, -CO2H, CO-C 1-2 -alkyl, -CO-C 6-10 -aryl and -CO-heteroaryl.

3. The ketone reductase according to claim 2, wherein the ketone substrate is selected from the group consisting of: (i) 3-aryl-3-ketopropylamine derivatives according to general formula (II) (II), in R1 and R2 are each independently selected from the following group: -H; unsubstituted, monosubstituted, or polysubstituted -C. 1-12 -alkyl; unsubstituted, monosubstituted, or polysubstituted -C 3-8 -Cycloalkyl; unsubstituted, monosubstituted, or polysubstituted -C 6-10 -aryl, optionally via a saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; or unsubstituted, monosubstituted, or polysubstituted heteroaryl groups, optionally via saturated or unsaturated, unsubstituted, monosubstituted, or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; or, alternatively, wherein R1 and R2, together with the nitrogen atom they are attached to, form unsubstituted, monosubstituted, or polysubstituted C atoms. 2-8 - Heterocyclic alkyl rings or unsubstituted, monosubstituted, or polysubstituted heteroaryl rings; R3, R4, R5, and R6 are each independently selected from: -H; unsubstituted, monosubstituted, or polysubstituted -C. 1-12 -alkyl; or wherein R3 and R4 together are =O; R7 is an unsubstituted, monosubstituted, or polysubstituted -C. 6-10 -aryl; or unsubstituted, monosubstituted, or polysubstituted heteroaryl; (ii) 5-hydroxy-3-oxo-hexanoate derivatives according to general formula (III) (III), in R8 is an unsubstituted, monosubstituted, or polysubstituted -C. 1-12 -alkyl; or unsubstituted, monosubstituted, or polysubstituted -C 6-10 -aryl, optionally via a saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; R9 represents -H; -halogen; -CN; or -OR. 11 , where R 11 It is hydrogen or a protecting group; R 10 -H; unsubstituted, monosubstituted, or polysubstituted -C 1-12 -alkyl; or unsubstituted, monosubstituted, or polysubstituted -C 6-10 -aryl, optionally via a saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; (iii) Acetophenone derivatives according to general formula (IV) (IV), in R 12 R 13 R 14 R 15 and R 16 Each is independently selected from the following group: -H; -halogen; unsubstituted, monosubstituted, or polysubstituted -C. 1-12 -alkyl; unsubstituted, monosubstituted, or polysubstituted -C 6-10 -aryl, optionally via a saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; unsubstituted, monosubstituted, or polysubstituted - heteroaryl group, optionally via a saturated or unsaturated, unsubstituted, monosubstituted, or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; and -OR 18 , where R 18 -H, unsubstituted, monosubstituted, or polysubstituted -C 1-12 -alkyl, or unsubstituted, monosubstituted, or polysubstituted -C 6-10 -aryl, optionally via a saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; R 17 -H; -halogen; unsubstituted, monosubstituted, or polysubstituted -C 1-12 -alkyl; unsubstituted, monosubstituted, or polysubstituted -C 6-10 -aryl, optionally via a saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; unsubstituted, monosubstituted, or polysubstituted - heteroaryl group, optionally via a saturated or unsaturated, unsubstituted, monosubstituted, or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; - OR 19 -NH2, -NHR 19 or -NR 19 R 20 , where R 19 and R 20 Each is independently selected from unsubstituted, monosubstituted, or polysubstituted -C 1-12 -alkyl; unsubstituted, monosubstituted, or polysubstituted -C 6-10 -aryl, optionally via a saturated or unsaturated, unsubstituted or monosubstituted or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; or unsubstituted, monosubstituted, or polysubstituted - heteroaryl groups, optionally via saturated or unsaturated, unsubstituted, monosubstituted, or polysubstituted aliphatic C 1-12 - Hydrocarbon residue bridging; (iv) Benzoyl derivatives according to general formula (V) (V)， in R 21 and R 22 Each is independently selected from unsubstituted, monosubstituted, or polysubstituted C. 6-10 -Aryl and unsubstituted, monosubstituted or polysubstituted heteroaryl; (v) Ring-opening diketone derivatives according to general formula (VI) (WE), in R 23 and R 24 Each is independently selected from -H and -C 1-12 -alkyl; and (vi) 3-quininecycloketone; (vii) Ethyl-4-chloro-3-oxo-butyrate; and (viii) Ethyl-3-oxo-3-phenyl-propionate; (ix) Ketooses; Or the aldehyde substrate mentioned above is selected from the group consisting of: (x) 2-Butyraldehyde; and (xi) 1-Heptanal; In various cases, monosubstituted or polysubstituted means independently substituted by one or more functional groups selected from the following: -halogen, =O, -OH, -OC. 1-12 -alkyl, -OC 6-10 -aryl, -O-heteroaryl, -OCOC 1-12 -alkyl, -OCOC 6-10 -aryl, -OCO-heteroaryl, -SH, -SC 1-12 -alkyl, -SC 6-10 -aryl, -S-heteroaryl, -S(=O) 1-2 OH, -NO, -NO2, -N3, -NH2, -NH(C 1-12 -alkyl), -N(C) 1-12 -alkyl)2,-NH(C 6-10 -aryl), -N(C 6-10 -aryl)2, -NH (heteroaryl), -N (heteroaryl)2, -CN, -CHO, -CO2H, CO-C 1-2 -alkyl, -CO-C 6-10 -aryl and -CO-heteroaryl.

4. The ketone reductase according to claim 1, wherein... (i) Converting isopropanol to acetone at a rate of 0.01–100 U / mg lyophilized ketone reductase; and / or (ii) After incubation at 30°C in 50% aqueous isopropanol for 48 hours, it exhibits at least 1% residual activity relative to its activity before incubation.

5. The ketone reductase according to claim 1, wherein... (i) Converting isopropanol to acetone at a rate of 0.01–100 U / mg lyophilized ketone reductase; and / or (ii) After incubation at 30°C in 50% aqueous isopropanol for 48 hours, it exhibits at least 1% residual activity relative to its activity before incubation.

6. The ketone reductase according to claim 1, which is not identical to the peptide of SEQ ID NO:2, and exhibits improved specific activity, temperature stability and / or stereoselectivity compared to the peptide of SEQ ID NO:

2.

7. The ketone reductase according to claim 6, (i) wherein the specific activity of the ketone reductase is higher than that of the wild-type ketone reductase of SEQ ID NO:2; and / or (ii) wherein the temperature stability of the ketone reductase is higher than that of the wild-type ketone reductase of SEQ ID NO:2; and / or (iii) wherein the stereoselectivity of the ketone reductase is higher than that of the wild-type ketone reductase of SEQ ID NO:

2.

8. Used in the following methods: - Reduce ketone substrates to secondary alcohols; - Reduces aldehyde substrates to primary alcohols; - Oxidation of secondary alcohol substrates to ketone products; - Oxidation of primary alcohol substrates to aldehydes; and / or - Oxidizes aldehyde substrates to carboxylic acids; The method includes the step of reacting the substrate with a suitable cofactor in the presence of the ketone reductase as described in any one of claims 1-7, wherein the substrate is defined as in claim 2 or 3.

9. The method according to claim 8, wherein (i) The substrate is ethyl-4-chloro-3-oxo-butyrate, which is stereoselectively reduced to ethyl(3S)-4-chloro-3-hydroxy-butyrate by a ketoreductase with the amino acid sequence SEQ ID NO:2; (ii) The substrate is tert-butyl(5R)-6-cyano-5-hydroxy-3-oxo-hexanoate, which is stereoselectively reduced to tert-butyl(3R,5R)-6-cyano-3,5-dihydroxy-hexanoate by a ketone reductase with the amino acid sequence SEQ ID NO:

91. (iii) The substrate is N,N-dimethyl-3-one-3-(2-thienyl)-1-onepropane, which is stereoselectively reduced to (1S)-3-(dimethylamino)-1-(2-thienyl)-prop-1-ol by a ketone reductase with the amino acid sequence SEQ ID NO:58; (iv) The substrate is (5S)-6-chloro-5-hydroxy-3-oxohexanoate, which is stereoselectively reduced to (3R,5S)-6-chloro-3,5-dihydroxy-hexanoate by a ketone reductase with the amino acid sequence SEQ ID NO:62 or SEQ ID NO:

91. (v) The substrate is an ethyl open-ring dione (ethyl-3-methoxy-8,14-open-ring-sterane-1,3,5(10),9(11)-tetraen-14,17-dione), which is stereoselectively reduced to 17-β-open-ring alcohol (ethyl-3-methoxy-8,14-open-ring-sterane-1,3,5(10),9(11)-tetraen-14-one-17-β-ol) by a ketoreductase with the amino acid sequence SEQ ID NO:70; or (vi) The substrate is N-monomethyl-3-one-3-(2-thienyl)-1-onepropane, which is stereoselectively reduced to (1S)-3-(methylamino)-1-(2-thienyl)-prop-1-ol by a ketone reductase with the amino acid sequence SEQ ID NO:58 or SEQ ID NO:

87.

10. The ketone reductase according to any one of claims 1-7 is used for the following purposes: - Reduce ketone substrates to secondary alcohols; - Reduces aldehyde substrates to primary alcohols; - Oxidation of secondary alcohol substrates to ketone products; - Oxidation of primary alcohol substrates to aldehydes; and / or - Oxidize aldehyde substrates to carboxylic acids. The substrate is as defined in claim 2 or 3.

11. A method for increasing the thermostability of ketone reductase, said method comprising substituting the ketone reductase having the amino acid sequence SEQ ID NO:2 with the following substitution: V89F.

Images